Artificial micrornas targeting snca

Artificial miRNA molecules targeting SNCA mRNA, delivered via rAAV vectors, effectively reduce SNCA expression to slow disease progression in synucleinopathies like Parkinson's Disease, addressing the limitations of current symptomatic treatments.

WO2025160429A1PCT designated stage Publication Date: 2025-07-31GENZYME CORP
View PDF 25 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/012995
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-25
Filing Date
2025-01-24
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

Current treatments for synucleinopathies, such as Parkinson's Disease, are largely symptomatic and do not effectively reduce alpha-synuclein (SNCA) pathology, leading to progressive neurodegeneration.

Method used

Development of artificial microRNA (miRNA) molecules targeting SNCA mRNA to reduce its expression, using specific guide and passenger strands with high identity to sequences like SEQ ID NO: 1-28, potentially linked by a RNA linker, delivered via recombinant adeno-associated virus (rAAV) vectors for gene therapy.

Benefits of technology

The miRNA molecules significantly reduce SNCA expression, preventing aggregation and slowing disease progression in neurodegenerative synucleinopathies, offering a therapeutic approach to improve quality of life and slow disease progression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000029_0001
    Figure IMGF000029_0001
  • Figure 00000066_0000
    Figure 00000066_0000
  • Figure 00000067_0000
    Figure 00000067_0000
Patent Text Reader

Abstract

Provided herein are artificial microRNA (miRNA) molecules for treating synucleinopathies. In some embodiments, the miRNA molecules target expression of SNCA protein. Further provided herein are expression constructs, vectors (e.g., rAAV), cells, viral particles, and pharmaceutical compositions containing the artificial miRNA molecules. Yet further provided herein are methods and kits related to the use of the miRNA molecules, for example, to treat synucleinopathies including Parkinson's Disease, Multiple System Atrophy, or Dementia with Lewy Bodies.
Need to check novelty before this filing date? Find Prior Art

Description

ARTIFICIAL microRNAs TARGETING SNCACROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority benefit of U.S. Provisional Application No. 63 / 625,856, filed January 26, 2024, and U.S. Provisional Application No. 63 / 638,871, filed April 25, 2024, the contents of both which are incorporated by reference in its entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (159792018940seqlist.xml; Size: 39,522 bytes; and Date of Creation: January 23, 2025) is herein incorporated by reference in its entirety.FIELD OF THE DISCLOSURE

[0003] The present disclosure relates to artificial miRNA molecules. In some aspects, the disclosure relates to artificial miRNA molecules that reduce expression of alpha-synuclein.BACKGROUND

[0004] The accumulation of alpha-synuclein (e.g., synuclein alpha or SNCA) drives neurotoxicity and regional brain atrophy in a group of neurodegenerative diseases known as synucleinopathies like Parkinson’s Disease. Current treatments for synucleinopathies are largely symptomatic and supportive, and none have been shown to significantly reduce SNCA pathology.BRIEF SUMMARY

[0005] The disclosure provides artificial microRNA (miRNA) molecules targeting human SNCA mRNA. SNCA-targeted artificial miRNA gene therapy stands to markedly improve quality of life and slow disease progression. The constructs described herein have wide commercial applicability in neurodegenerative synucleinopathies.

[0006] In one aspect, the disclosure artificial miRNA comprising a first strand and a second strand, wherein(a) the first strand and second strand form a duplex;(b) the first strand comprises a guide region comprising a nucleotide sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’-UUCGUAGUCUUGAUACCCUUC-3’), SEQ ID NO: 2 (5’-GUUCGUAGUCUUGAUACCCUU-3’), SEQ ID NO: 3 (5’- UACCGAAAUGCUGAGUGGGGG-3’), SEQ ID NO: 4 (5’- AUCGUAGAUUGAAGCCACAAA-3’), SEQ ID NO 5: (5’- UAUCGUAGAUUGAAGCCACAA-3’), SEQ ID NO: 6 (5’- AACAUCGUAGAUUGAAGCCAC-3’), SEQ ID NO: 7 (5’- AUACGUCAUUAUUCUUAGACA-3’), SEQ ID NO: 8 (5’- AAUACGUCAUUAUUCUUAGAC-3’), SEQ ID NO: 9 (5’- AUUUCGAGACAAAAAUAACAA-3’), SEQ ID NO: 10 (5’- GUCGAAUAUUAUUUAUUGUCA-3’), SEQ ID NO: 11 (5’- GGUCGAAUAUUAUUUAUUGUC-3’), SEQ ID NO: 12 (5’- AACCGCCACUUUCUAACCUUC-3’), SEQ ID NO: 13 (5’- UAACCGCCACUUUCUAACCUU-3’), SEQ ID NO: 14 (5’- UGACCGUGGAGUCAUAUGAGG-3’), SEQ ID NO: 15 (5’- GAAGGGUAAAGACUACGAA-3’), SEQ ID NO: 16 (5’-AAGGGUAUAGACUACGAAU- 3’), SEQ ID NO: 17 (5’-CCCCCACUGCAUUUCGGUG-3’), SEQ ID NO: 18 (5’- UUUGUGGCCAAUCUACGAU-3’), SEQ ID NO: 19 (5’-UUGUGGCUAAUCUACGAUG-3’), SEQ ID NO: 20 (5’-GUGGCUUCUCUACGAUGUU-3’), SEQ ID NO: 21 (5’- UGUCUAAGUAAUGACGUAU-3’), SEQ ID NO: 22 (5’-GUCUAAGAAAUGACGUAUU- 3’), SEQ ID NO: 23 (5’-UUGUUAUUUGUCUCGAAAU-3’), SEQ ID NO: 24 (5’- UGACAAUAUAAUAUUCGAU-3’), SEQ ID NO: 25 (5’-GACAAUAAAAUAUUCGAUU- 3’), SEQ ID NO: 26 (5’-GAAGGUUAAAGUGGCGGUU-3’), SEQ ID NO: 27 (5’- AAGGUUAGAGUGGCGGUUA-3’), or SEQ ID NO: 28 (5’-CCUCAUAUCUCCACGGUUG- 3’); and(c) the second strand (passenger strand) comprises a non-guide region that comprises a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of the guide region.

[0007] In some embodiments, the first strand comprises a guide sequence having the sequence SEQ ID NO: 1 (5’-UUCGUAGUCUUGAUACCCUUC-3’), SEQ ID NO: 2 (5’- GUUCGUAGUCUUGAUACCCUU-3’), SEQ ID NO: 3 (5’- UACCGAAAUGCUGAGUGGGGG-3’), SEQ ID NO: 4 (5’- AUCGUAGAUUGAAGCCACAAA-3’), SEQ ID NO: 5 (5’- UAUCGUAGAUUGAAGCCACAA-3’), SEQ ID NO: 6 (5’- AACAUCGUAGAUUGAAGCCAC-3’), SEQ ID NO: 7 (5’- AUACGUCAUUAUUCUUAGACA-3’), SEQ ID NO: 8 (5’- AAUACGUCAUUAUUCUUAGAC-3’), SEQ ID NO: 9 (5’- AUUUCGAGACAAAAAUAACAA-3’), SEQ ID NO: 10 (5’- GUCGAAUAUUAUUUAUUGUCA-3’), SEQ ID NO: 11 (5’- GGUCGAAUAUUAUUUAUUGUC-3’), SEQ ID NO: 12 (5’- AACCGCCACUUUCUAACCUUC-3’), SEQ ID NO: 13 (5’- UAACCGCCACUUUCUAACCUU-3’), SEQ ID NO: 14 (5’- UGACCGUGGAGUCAUAUGAGG-3’), SEQ ID NO: 15 (5’- GAAGGGUAAAGACUACGAA-3’), SEQ ID NO: 16 (5’-AAGGGUAUAGACUACGAAU- 3’), SEQ ID NO: 17 (5’-CCCCCACUGCAUUUCGGUG-3’), SEQ ID NO: 18 (5’- UUUGUGGCCAAUCUACGAU-3’), SEQ ID NO: 19 (5’-UUGUGGCUAAUCUACGAUG-3’), SEQ ID NO: 20 (5’-GUGGCUUCUCUACGAUGUU-3’), SEQ ID NO: 21 (5’- UGUCUAAGUAAUGACGUAU-3’), SEQ ID NO: 22 (5’-GUCUAAGAAAUGACGUAUU- 3’), SEQ ID NO: 23 (5’-UUGUUAUUUGUCUCGAAAU-3’), SEQ ID NO: 24 (5’- UGACAAUAUAAUAUUCGAU-3’), SEQ ID NO: 25 (5’-GACAAUAAAAUAUUCGAUU- 3’), SEQ ID NO: 26 (5’-GAAGGUUAAAGUGGCGGUU-3’), SEQ ID NO: 27 (5’- AAGGUUAGAGUGGCGGUUA-3’), or SEQ ID NO: 28 (5’-CCUCAUAUCUCCACGGUUG- 3’).

[0008] In one embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’-UUCGUAGUCUUGAUACCCUUC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:15 (5’-GAAGGGUAAAGACUACGAA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1 (5’— 3’) and the non-guide region comprises the sequence of SEQ ID NO: 15 (5’-GAAGGGUAAAGACUACGAA-3’).

[0009] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 2 (5’- GUUCGUAGUCUUGAUACCCUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:16 (5’-AAGGGUAUAGACUACGAAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 2 (5’-GUUCGUAGUCUUGAUACCCUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 16 (5’- AAGGGUAUAGACUACGAAU-3’).

[0010] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 3 (5’- UACCGAAAUGCUGAGUGGGGG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:17 (5’-CCCCCACUGCAUUUCGGUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3 (5’-UACCGAAAUGCUGAGUGGGGG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 17 (5’- CCCCCACUGCAUUUCGGUG-3 ’ ).

[0011] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 4 (5’- AUCGUAGAUUGAAGCCACAAA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:18 (5’-UUUGUGGCCAAUCUACGAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4 (5’-AUCGUAGAUUGAAGCCACAAA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 18 (5’- UUUGUGGCCAAUCUACGAU-3 ’ ).

[0012] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 5 (5’- UAUCGUAGAUUGAAGCCACAA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:19 (5’-UUGUGGCUAAUCUACGAUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5 (5’-UAUCGUAGAUUGAAGCCACAA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 19 (5’- UUGUGGCUAAUCUACGAUG-3’).

[0013] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 6 (5’- AACAUCGUAGAUUGAAGCCAC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:20 (5’-GUGGCUUCUCUACGAUGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6 (5’-AACAUCGUAGAUUGAAGCCAC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 20 (5’- GUGGCUUCUCUACGAUGUU-3’).

[0014] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 7 (5’- AUACGUCAUUAUUCUUAGACA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:21 (5’-UGUCUAAGUAAUGACGUAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 7 (5’-AUACGUCAUUAUUCUUAGACA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 21 (5’- UGUCUAAGUAAUGACGUAU-3’).

[0015] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 8 (5’- AAUACGUCAUUAUUCUUAGAC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:22 (5’-GUCUAAGAAAUGACGUAUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 8 (5’-AAUACGUCAUUAUUCUUAGAC-3’) and thenon-guide region comprises the sequence of SEQ ID NO: 22 (5’- GUCUAAGAAAUGACGUAUU-3’).

[0016] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 9 (5’- AUUUCGAGACAAAAAUAACAA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:23 (5’-UUGUUAUUUGUCUCGAAAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 9 (5’-AUUUCGAGACAAAAAUAACAA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 23 (5’- UUGUUAUUUGUCUCGAAAU-3’).

[0017] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 10 (5’- GUCGAAUAUUAUUUAUUGUCA-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:24 (5’-UGACAAUAUAAUAUUCGAU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 10 (5’-GUCGAAUAUUAUUUAUUGUCA-3’) and the non-guide region comprises the sequence of SEQ ID NO: 24 (5’- UGACAAUAUAAUAUUCGAU-3 ’ ).

[0018] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 11 (5’- GGUCGAAUAUUAUUUAUUGUC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:25 (5’-GACAAUAAAAUAUUCGAUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 11 (5’-GGUCGAAUAUUAUUUAUUGUC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 25 (5’- GACAAUAAAAUAUUCGAUU-3 ’ ).

[0019] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 12 (5’- AACCGCCACUUUCUAACCUUC-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:26 (5’-GAAGGUUAAAGUGGCGGUU-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 12 (5’-AACCGCCACUUUCUAACCUUC-3’) and the non-guide region comprises the sequence of SEQ ID NO: 26 (5’-GAAGGUU AAAGUGGCGGUU-3 ’ ) .

[0020] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 13 (5’- UAACCGCCACUUUCUAACCUU-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:27 (5’-AAGGUUAGAGUGGCGGUUA-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 13 (5’-UAACCGCCACUUUCUAACCUU-3’) and the non-guide region comprises the sequence of SEQ ID NO: 27 (5’- AAGGUUAGAGUGGCGGUU A-3 ’ ) .

[0021] In another embodiment, the guide sequence comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 14 (5’- UGACCGUGGAGUCAUAUGAGG-3’) and the non-guide region comprises the sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO:28 (5’-CCUCAUAUCUCCACGGUUG-3’). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 14 (5’-UGACCGUGGAGUCAUAUGAGG-3’) and the non-guide region comprises the sequence of SEQ ID NO: 28 (5’- CCUCAUAUCUCCACGGUUG-3 ’ ).

[0022] In any of the embodiments herein, the guide strand and the non-guide strand can be linked by means of a RNA linker capable of forming a loop structure. In some embodiments, the RNA linker comprises from 4 to 50 nucleotides. In some embodiments, the loop structure comprises 4 to 20 nucleotides.

[0023] In some embodiments of the above aspect and embodiments, the artificial miRNA molecules target the 3’-untranstlated region (3’-UTR) of SNCA mRNA. In some embodiments, the artificial miRNA molecules show low off-target potential.

[0024] In some embodiments of the above aspect and embodiments, the disclosure provides an expression construct comprising nucleic acid encoding the artificial miRNA moleculesdescribed herein. In some embodiments, the nucleic acid encoding the artificial miRNA molecules are embedded in a miRNA scaffold. In some embodiments, the nucleic acid encoding the artificial miRNA is operably linked to a promoter. In some embodiments, the promoter is selected from a cytomegalovirus (CMV) immediate early promoter, an RSV LTR, a MoMLV LTR, a phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter, a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, a chimeric liver-specific promoter (LSP), an E2F promoter, a telomerase (hTERT) promoter; a cytomegalovirus enhancer / chicken beta-actin / Rabbit P-globin promoter (CAG) promoter, an elongation factor 1 - alpha promoter (EFl-alpha) promoter, a human P-glucuronidase promoter, a chicken P-actin (CBA) promoter, a retroviral Rous sarcoma virus (RSV) LTR promoter, a dihydrofolate reductase promoter, and a 13-actin promoter. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is a CBA intron or an hEFl alpha intron. In some embodiments, the intron is a chimeric intron. In some embodiments, the expression vector is a self-complementary vector and the intron is a delta chimeric intron. In some embodiments, the expression construct further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or a HSV TK polyadenylation signal.

[0025] In some embodiments, the disclosure provides a vector comprising any of the expression constructs described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression construct is flanked by two AAV ITRs. In some embodiments, the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, the AAV ITRs are AAV2 ITRs. In some embodiments, the vector further comprises a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the artificial miRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises first nucleic acid sequence encoding the artificial miRNA and a second nucleic acid sequence encoding a complement of the artificial miRNA, wherein thefirst nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of the terminal resolution sequence.

[0026] In some embodiments, the disclosure provides a cell comprising any of the rAAV vectors as described herein.

[0027] In some embodiments, the disclosure provides a recombinant AAV particle comprising any of the rAAV vectors as described herein. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, a goat AAV, AAV1 / AAV2 chimeric, bovine AAV, or mouse AAV capsid rAAV2 / HBoV 1 serotype capsid. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle are derived from different AAV serotypes. In some embodiments, the ITR is derived from AAV2 and the capsid of the rAAV particle is derived from AAV 1.

[0028] In some embodiments, the capsid proteins of the rAAV particles are modified AAV9 capsids. In some such embodiments, the modified AAV9 capsid proteins of the AAV viral particles comprise targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle following administration to the patient. The rAAV particles comprising modified AAV9 capsid proteins, as disclosed herein, comprise three structural capsid proteins, VP1, VP2 and VP3. The three capsid proteins are alternative splice variants. In some embodiments, the targeting peptide is inserted into the VP1, VP2 and VP3 capsid proteins within the rAAV particle.

[0029] In particular embodiments, the targeting peptide of the modified AAV9 capsids are inserted after residue 588 of the AAV9 structural protein (numbering based on VP1 numbering of AAV9). In some embodiments, the targeting peptide has SEQ ID NO: 60. In someembodiments, the targeting peptide is flanked by linker sequences on the N-terminal and the C- terminal end of the targeting peptide. In some embodiments, the linker sequence on the N- terminal side has the sequence AAA. In some embodiments, the linker sequence on the C- terminal side is AS. In some embodiments, the full sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 61. In some embodiments, the full modified AAV9 capsid structural protein has SEQ ID NO: 62. In some embodiments, the full modified AAV9 capsid structural protein that it at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 62, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 60. The capsid having SEQ ID NO: 62 will also be referred to herein as SAN006 or AAV.SAN006.

[0030] In some embodiments, the disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0031] In some embodiments, the disclosure provides a kit comprising any of the artificial miRNA molecules described herein. In some embodiments, the disclosure provides a kit comprising any of the AAV particles described herein. In some embodiments, the disclosure provides a kit comprising any of the compositions described herein. In some embodiments, the kit further comprises instructions for use.

[0032] In some aspects, the disclosure provides methods for treating a synucleinopathy in a patient in need thereof, comprising administering to the patient a composition comprising an artificial miRNA comprising a guide strand that binds to a SNCA mRNA and a non-guide (passenger) strand, wherein the guide strand and the non-guide have sequences as disclosed herein. In some embodiments, the synucleinopathy may comprise Parkinson’s Disease, Multiple System Atrophy, Dementia with Lewy Bodies.

[0033] In some aspects, the disclosure provides methods for of reducing SNCA expression in a patient suffering from a synucleinopathy, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a SNCA mRNA and a non-guide (passenger) strand, wherein the guide strand and the non-guide have sequences asdisclosed herein. In some embodiments, administering the artificial miRNA molecules disclosed herein prevents SNCA aggregation. In some embodiments, administering the artificial miRNA molecules disclosed herein results in reduction of existing SNCA aggregates.BRIEF DESCRIPTION OF THE DRAWINGS

[0034] FIG. 1 shows reduction of exogenous human SNCA protein following treatment with artificial miRNAs, in accordance with some embodiments.

[0035] FIG. 2 shows dose-dependent reduction of endogenous human SNCA following treatment with artificial miRNAs, in accordance with some embodiments.

[0036] FIGS. 3A-B show guide to passenger ratio and strand processing in human cells, in accordance with some embodiments.

[0037] FIGS. 4A-D show chaining of artificial miRNAs in tandem improves SNCA reduction in human cells, in accordance with some embodiments.

[0038] FIG. 5A shows reduction of human SNCA mRNA in vivo, in accordance with some embodiments. FIG. 5B shows the 3X 130bp chain variant showed increased expression levels of the amiRNAs relative to the single miRNA hairpin for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 8 (x-axis). The increased expression levels of the chain variant relative to the single miRNA hairpin range from 2-fold to 10-fold.DETAILED DESCRIPTION

[0039] The accumulation of pathological synuclein protein drives neurotoxicity and regional brain atrophy in a group of neurodegenerative diseases known as synucleinopathies (e.g., Parkinson’s Disease, Multiple System Atrophy, Dementia with Lewy Bodies).Neurodegeneration manifests with progressive and fatal cognitive, autonomic and motor impairments, and there are no approved treatments known to modify disease course. The synuclein protein is a well-credentialed therapeutic target; copy number variations and missense mutations in the Alpha-synuclein (SNCA) gene cause Parkinson’s Disease. SNCA reduction inpreclinical models not only prevents further aggregation but may enable clearance of existing protein aggregates. In some embodiments, provided herein are methods for SNCA-targeted artificial miRNA gene therapy may improve quality of life and slow disease progression and may be readily adopted by clinicians and patients. The constructs described herein may have wide commercial applicability in both rare and common neurodegenerative synucleinopathies, in accordance with some embodiments.

[0040] In some embodiments, provided herein are artificial miRNA designs may bind to previously unclaimed sequences within the SNCA gene. In some embodiments, artificial miRNA may be designed a priori to have a lower propensity for seed-mediated off targeting, and / or have rationally designed sequence changes to optimize guide strand loading to increase potency and / or lower off-targeting via the passenger strand.

[0041] In some embodiments, the therapeutic constructs described herein may be related to fields comprising RNA inhibition, molecular biology, and / or central nervous system (CNS) gene therapy. In some embodiments, the therapeutic constructs described herein may be designed to reduce expression of the SNCA protein and may provide a method to treat neurodegenerative synucleinopathies comprising Parkinson’s Disease, Multiple System Atrophy, Dementia with Lewy Bodies.

[0042] In some embodiments, provided herein are therapeutic constructs comprising the fields of RNA inhibition, molecular biology, and / or central nervous system (CNS) gene therapy. In some embodiments, these constructs are designed to possibly reduce expression of alpha- synuclein and may provide a method to treat neurodegenerative diseases characterized by the accumulation of alpha-synuclein aggregates, including, but not limited to, Parkinson’s Disease (PD) and Multiple System Atrophy (MSA)

[0043] In some aspects, provided herein are selective and potent artificial miRNAs targeting SNCA mRNA for alpha-synuclein reduction to treat neurodegenerative synucleinopathies.

[0044] In some embodiments, provided herein are artificial miRNA sequences, with a guide strand and passenger strand sequence specified for each. In some embodiments, the guide strand may target the antisense sequence of human and NHP SNCA mRNA, and / or the semi- complementary passenger strand may be designed with specific mismatches to bias loading of the guide strand into the RISC complex for lowering of target mRNA.

[0045] In some embodiments, the artificial miRNA comprises a guide strand that has a nucleotide sequence having at least about 90% identity or at least about 95% identity to the sequence of SEQ ID NO: 1 (5’-UUCGUAGUCUUGAUACCCUUC-3’), SEQ ID NO: 2 (5’- GUUCGUAGUCUUGAUACCCUU-3’), SEQ ID NO: 3 (5’- UACCGAAAUGCUGAGUGGGGG-3’), SEQ ID NO: 4 (5’- AUCGUAGAUUGAAGCCACAAA-3’), SEQ ID NO 5 (5’- UAUCGUAGAUUGAAGCCACAA-3’), SEQ ID NO: 6 (5’- AACAUCGUAGAUUGAAGCCAC-3’), SEQ ID NO: 7 (5’- AUACGUCAUUAUUCUUAGACA-3’), SEQ ID NO: 8 (5’- AAUACGUCAUUAUUCUUAGAC-3’), SEQ ID NO: 9 (5’- AUUUCGAGACAAAAAUAACAA-3’), SEQ ID NO: 10 (5’- GUCGAAUAUUAUUUAUUGUCA-3’), SEQ ID NO: 11 (5’- GGUCGAAUAUUAUUUAUUGUC-3’), SEQ ID NO: 12 (5’- AACCGCCACUUUCUAACCUUC-3’), SEQ ID NO: 13 (5’- UAACCGCCACUUUCUAACCUU-3’), SEQ ID NO: 14 (5’- UGACCGUGGAGUCAUAUGAGG-3’), SEQ ID NO: 15 (5’- GAAGGGUAAAGACUACGAA-3’), SEQ ID NO: 16 (5’-AAGGGUAUAGACUACGAAU- 3’), SEQ ID NO: 17 (5’-CCCCCACUGCAUUUCGGUG-3’), SEQ ID NO: 18 (5’- UUUGUGGCCAAUCUACGAU-3’), SEQ ID NO: 19 (5’-UUGUGGCUAAUCUACGAUG-3’), SEQ ID NO: 20 (5’-GUGGCUUCUCUACGAUGUU-3’), SEQ ID NO: 21 (5’- UGUCUAAGUAAUGACGUAU-3’), SEQ ID NO: 22 (5’-GUCUAAGAAAUGACGUAUU- 3’), SEQ ID NO: 23 (5’-UUGUUAUUUGUCUCGAAAU-3’), SEQ ID NO: 24 (5’- UGACAAUAUAAUAUUCGAU-3’), SEQ ID NO: 25 (5’-GACAAUAAAAUAUUCGAUU- 3’), SEQ ID NO: 26 (5’-GAAGGUUAAAGUGGCGGUU-3’), SEQ ID NO: 27 (5’- AAGGUUAGAGUGGCGGUUA-3’), or SEQ ID NO: 28 (5’-CCUCAUAUCUCCACGGUUG- 3’).

[0046] In some embodiments, the artificial miRNA comprises a second strand (passenger strand) comprising a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region. In one embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1 and the non-guide region comprises the sequence of SEQ ID NO: 15. In another embodiment, the guide sequence comprises thesequence of SEQ ID NO: 2 and the non-guide region comprises the sequence of SEQ ID NO: 16. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3 and the non-guide region comprises the sequence of SEQ ID NO: 17. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4 and the non-guide region comprises the sequence of SEQ ID NO: 18. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5 and the non-guide region comprises the sequence of SEQ ID NO: 19. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6 and the non-guide region comprises the sequence of SEQ ID NO: 20. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 7 and the non-guide region comprises the sequence of SEQ ID NO: 21. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 8 and the non-guide region comprises the sequence of SEQ ID NO: 22. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 9 and the non-guide region comprises the sequence of SEQ ID NO: 23. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 10 and the non-guide region comprises the sequence of SEQ ID NO: 24. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 11 and the non-guide region comprises the sequence of SEQ ID NO: 25. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 12 and the non-guide region comprises the sequence of SEQ ID NO: 26. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 13 and the non-guide region comprises the sequence of SEQ ID NO: 27. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 14 and the non-guide region comprises the sequence of SEQ ID NO: 28.

[0047] In some aspects, the disclosure provides expression constructs, vectors (e.g., recombinant AAV vectors), cells, viral particles (e.g., AAV particles), and pharmaceutical compositions comprising an artificial miRNA of the present disclosure. In further aspects, the disclosure provides methods for a treating a synucleinopathy in a mammal comprising administering to the mammal a pharmaceutical composition comprising an artificial miRNA of the present disclosure. In some embodiments, the synucleinopathy may comprise Parkinson’s Disease, Multiple System Atrophy, Dementia with Lewy Bodies.I. General Techniques

[0048] The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized methodologies described in Molecular Cloning: A Laboratory Manual (Sambrook et al., 4thed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2012); Current Protocols in Molecular Biology (F.M. Ausubel, et al. eds., 2003); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (M.J. MacPherson, B.D. Hames and G.R. Taylor eds., 1995); Antibodies, A Laboratory Manual (Harlow and Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (R.I. Freshney, 6thed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., Academic Press, 1998); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (D.M. Weir and C.C. Blackwell, eds., 1996);Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); Current Protocols in Immunology (J.E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Ausubel et al., eds., J. Wiley and Sons, 2002); Immunobiology (C.A. Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (V.T. DeVita et al., eds.,J.B. Lippincott Company, 2011).II. Definitions

[0049] A “vector,” as used herein, refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.

[0050] The term “polynucleotide” or “nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphoramidate- phosphodiester oligomer. In addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.

[0051] The terms “polypeptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full- length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present disclosure, a “polypeptide” refers to a protein which includes modifications, such as deletions, additions, and substitutions (generally conservative in nature), to the native sequence, as long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.

[0052] A “recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one and in some embodiments two, inverted terminal repeat sequences (ITRs).

[0053] A “recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin) that are flanked by at least one, and in embodiments two, AAV inverted terminal repeat sequences (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a “pro-vector” which can be “rescued” by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. An rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, particularly an AAV particle. A rAAV vector can be packaged into an AAV virus capsid to generate a “recombinant adeno-associated viral particle (rAAV particle)”.

[0054] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated. For example, a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.

[0055] The term “transgene” refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and / or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.

[0056] “Chicken P-actin (CBA) promoter” refers to a polynucleotide sequence derived from a chicken P-actin gene (e.g., Gallus gallus beta actin, represented by GenBank Entrez Gene ID 396526). As used herein, “chicken P-actin promoter” may refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of thechicken P- actin gene, and the splice acceptor of the rabbit beta-globin gene, such as the sequences described in Miyazaki, J. et al. (1989) Gene 79(2):269-77. As used herein, the term “CAG promoter” may be used interchangeably. As used herein, the term “CMV early enhancer / chicken beta actin (CAG) promoter” may be used interchangeably.

[0057] The terms “genome particles (gp),” “genome equivalents,” or “genome copies” as used in reference to a viral titer, refer to the number of virions containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genome particles in a particular vector preparation can be measured by procedures such as described in the Examples herein, or for example, in Clark et al. (1999) Hum. Gene Ther., 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0058] The term “vector genome (vg)” as used herein may refer to one or more polynucleotides comprising a set of the polynucleotide sequences of a vector, e.g., a viral vector. A vector genome may be encapsidated in a viral particle. Depending on the particular viral vector, a vector genome may comprise single-stranded DNA, double-stranded DNA, or singlestranded RNA, or double-stranded RNA. A vector genome may include endogenous sequences associated with a particular viral vector and / or any heterologous sequences inserted into a particular viral vector through recombinant techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking a promoter, a stuffer, a sequence of interest (e.g., a miRNA), and a polyadenylation sequence. A complete vector genome may include a complete set of the polynucleotide sequences of a vector. In some embodiments, the nucleic acid titer of a viral vector may be measured in terms of vg / mL. Methods suitable for measuring this titer are known in the art e.g., quantitative PCR).

[0059] As used herein, the term “inhibit” may refer to the act of blocking, reducing, eliminating, or otherwise antagonizing the presence, or an activity of, a particular target. Inhibition may refer to partial inhibition or complete inhibition. For example, inhibiting the expression of a gene may refer to any act leading to a blockade, reduction, elimination, or any other antagonism of expression of the gene, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, and so forth. In some embodiments, inhibiting the expression of SNCA protein may refer a blockade, reduction, elimination, or any other antagonism of expression of SNCA protein, includingreduction of Synuclein alpha mRNA abundance (e.g., silencing SNCA mRNA transcription), degradation of SNCA mRNA, inhibition of SNCA mRNA translation, and so forth. As another example, inhibiting the accumulation of a protein in a cell may refer to any act leading to a blockade, reduction, elimination, or other antagonism of expression of the protein, including reduction of mRNA abundance (e.g., silencing mRNA transcription), degradation of mRNA, inhibition of mRNA translation, degradation of the protein, and so forth. In some embodiments, inhibiting the accumulation of SNCA protein in a cell refers to a blockade, reduction, elimination, or other antagonism of expression of the SNCA protein in a cell, including reduction of SNCA mRNA abundance (e.g., silencing SNCA mRNA transcription), degradation of SNCA mRNA, inhibition of SNCA mRNA translation, degradation of the SNCA protein, and so forth

[0060] The terms “infection unit (iu),” “infectious particle,” or “replication unit,” as used in reference to a viral titer, refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as replication center assay, as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.

[0061] The term “transducing unit (tu)” as used in reference to a viral titer, refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in functional assays such as described in Examples herein, or for example, in Xiao et al. (1997) Exp. Neurobiol., 144: 113-124; or in Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).

[0062] An “inverted terminal repeat” or “ITR” sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation.

[0063] An “AAV inverted terminal repeat (ITR)” sequence, a term well-understood in the art, is an approximately 145 -nucleotide sequence that is present at both termini of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter regions of self-complementarity (designated A, A', B, B', C, C and D regions), allowing intrastrand base-pairing to occur within this portion of the ITR.

[0064] A “terminal resolution sequence” or “trs” is a sequence in the D region of the AAV ITR that is cleaved by AAV rep proteins during viral DNA replication. A mutant terminal resolution sequence is refractory to cleavage by AAV rep proteins.

[0065] “AAV helper functions” refer to functions that allow AAV to be replicated and packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper virus or helper virus genes which aid in AAV replication and packaging. Other AAV helper functions are known in the art such as genotoxic agents.

[0066] A “helper virus” for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A helper virus provides "helper functions" which allow for the replication of AAV. A number of such helper viruses have been identified, including adenoviruses, herpesviruses and, poxviruses such as vaccinia and baculovirus. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most commonly used. Numerous adenoviruses of human, nonhuman mammalian and avian origin are known and are available from depositories such as the ATCC. Viruses of the herpes family, which are also available from depositories such as ATCC, include, for example, herpes simplex viruses (HSV), Epstein-Barr viruses (EBV), cytomegaloviruses (CMV) and pseudorabies viruses (PRV). Examples of adenovirus helper functions for the replication of AAV include El A functions, E1B functions, E2A functions, VA functions and E4orf6 functions. Baculoviruses available from depositories include Autographa californica nuclear polyhedrosis virus.

[0067] A preparation of rAAV is said to be “substantially free” of helper virus if the ratio of infectious AAV particles to infectious helper virus particles is at least about 102: 1 ; at least about 104:l, at least about 106:l; or at least about 108:l or more. In some embodiments, preparations are also free of equivalent amounts of helper virus proteins (z.e., proteins as would be present as a result of such a level of helper virus if the helper virus particle impurities noted above were present in disrupted form). Viral and / or cellular protein contamination can generally be observed as the presence of Coomassie staining bands on SDS gels (e.g., the appearance of bands other than those corresponding to the AAV capsid proteins VP1, VP2 and VP3).

[0068] “Percent (%) sequence identity” with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid or nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software programs, for example, those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, section 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y, where X is the number of amino acid residues scored as identical matches by the sequence alignment program in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows: 100 times the fraction W / Z, where W is the number of nucleotides scored as identical matches by the sequence alignment program in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.

[0069] An “isolated” molecule (e.g., nucleic acid or protein) or cell means it has been identified and separated and / or recovered from a component of its natural environment.

[0070] An “effective amount” is an amount sufficient to effect beneficial or desired results, including clinical results (e.g., amelioration of symptoms, achievement of clinical endpoints, and the like). An effective amount can be administered in one or more administrations. In terms of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay development of a disease.

[0071] An “individual” or “subject” is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and nonhuman primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0072] As used herein, “treatment” is an approach for obtaining beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (e.g., not worsening) state of disease, preventing spread (e.g., metastasis) of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0073] As used herein, the term “prophylactic treatment” refers to treatment, wherein an individual is known or suspected to have or be at risk for having a disorder but has displayed no symptoms or minimal symptoms of the disorder. An individual undergoing prophylactic treatment may be treated prior to onset of symptoms.

[0074] “miRNA scaffold” may refer to a polynucleotide containing (i) a double-stranded sequence targeting a gene of interest for knockdown by miRNA and (ii) additional sequences that form a stem-loop structure resembling that of endogenous miRNAs. A sequence targeting a gene of interest for miRNA (e.g., a short, ~20-nt sequence) may be ligated to sequences that create a miRNA-like stem-loop and a sequence that base pairs with the sequence of interest to form a duplex when the polynucleotide is assembled into the miRNA-like secondary structure. As described herein, this duplex may hybridize imperfectly, e.g., it may contain one or moreunpaired or mispaired bases. Upon cleavage of this polynucleotide by Dicer, this duplex containing the sequence targeting a gene of interest may be unwound and incorporated into the RISC complex. A miRNA scaffold may refer to the miRNA itself or to a DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos- Quintana, M. et al. (2002) Curr. Biol. 12:735-9). Commercially available kits for cloning a sequence into a miRNA scaffold are known in the art (e.g., the Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0075] As used herein, a “bulge” refers to a region of nucleic acid that is non-complementary to nucleic acid opposite it in a duplex nucleic acid. For example, a bulge may refer to a nucleic acid sequence that is noncomplementary to nucleic acid opposite in a duplex nucleic acid where the bulge is flanked by regions of nucleic acid that are complementary to nucleic acid opposite in a duplex nucleic acid. In some examples, the bulge may be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 bases in length. In some examples, the bulge may be the result of mispairing (e.g. , the opposite strand contains a base that is noncomplementary) or the bulge may be the result of nonpairing (e.g., the opposite strand comprises nucleic acid complementary to nucleic acid flanking the bulge but the opposite strand does not contain nucleic acid opposite the bulge).

[0076] As used herein, the term “sense” nucleic acid is a nucleic acid comprising a sequence that encodes all or a part of a transgene. In some examples, mRNA for a transgene is a sense nucleic acid.

[0077] As used herein, “antisense” nucleic acid is a sequence of nucleic acid that is complementary to a “sense” nucleic acid. For example, an antisense nucleic acid may be complementary to an mRNA encoding a transgene.

[0078] As used herein, the “guide region” of a miRNA is the strand of the miRNA that binds the target mRNA, typically on the basis of complementarity. The region of complementarity may encompass all or a portion of the guide region. Typically, the region of complementarity includes at least the seed region. In many cases, the antisense region of a miRNA is the guide region.

[0079] As used herein, the “passenger region,” or “non-guide region,” used interchangeably herein, of a miRNA is the region of the miRNA that is complementary to the guide region. In many cases, the sense region of a miRNA is the passenger region.

[0080] As used herein, the “seed region” of a miRNA is a region of about 1-8 nucleotides in length of a miRNA. In some examples, the seed region and the 3'-UTR of its target mRNA may be a key determinant in miRNA recognition.

[0081] As used herein, “off-target gene silencing” refers to the pairing of a seed region of a miRNA with sequences in 3'-UTRs of unintended mRNAs and directs translational repression and destabilization of those transcripts (e.g., reduces expression of the unintended mRNAs).

[0082] Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0083] As used herein, the singular form of the articles “a,” “an,” and “the” includes plural references unless indicated otherwise.

[0084] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and / or “consisting essentially of’ aspects and embodiments.III. Artificial miRNA Molecules

[0085] In some aspects, the disclosure provides artificial miRNA molecules comprising sequences disclosed herein. A miRNA is known in the art as an RNA molecule that induces RNA interference in a cell comprising a short (e.g., 19-25 base pairs) sequence of doublestranded RNA linked by a loop and containing one or more additional sequences of doublestranded RNA comprising one or more bulges (e.g., mispaired or unpaired base pairs). In some embodiments, “miRNA” may refer to a pri-miRNA or a pre-miRNA. During miRNA processing, a pri-miRNA transcript is produced. The pri-miRNA is processed by Drosha- DGCR8 to produce a pre-miRNA by excising one or more sequences to leave a pre-miRNA with a 5 ’flanking region, a guide strand, a loop region, a non-guide strand, and a 3 ’flanking region; or a 5 ’flanking region, a non-guide strand, a loop region, a guide strand, and a 3 ’flanking region. The pre-miRNA is then exported to the cytoplasm and processed by Dicer to yield a miRNAwith a guide strand and a non-guide (or passenger) strand. The guide strand is then used by the RISC complex to catalyze gene silencing, e.g., by recognizing a target RNA sequence complementary to the guide strand. The recognition of a target sequence by a miRNA is primarily determined by pairing between the target and the miRNA seed sequence, e.g., nucleotides 1-8 (5’ to 3’) of the guide strand (see, e.g., Boudreau, R.L. et al. (2013) Nucleic Acids Res. 41:e9).

[0086] In the pri / pre-miRNA structure, the guide strand: non-guide strand interface in a duplex is formed in part through complementary base pairing e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend through the entire duplex. In some embodiments, a bulge in the interface may exist at one or more nucleotide positions. As used herein, the term "bulge" may refer to a region of nucleic acid that is non- complementary to the nucleic acid opposite it in a duplex. In some embodiments, the bulge is formed when the regions of complementary nucleic acids bind to each other, whereas the regions of central non-complementary region do not bind. In some embodiments, the bulge is formed when the two strands of nucleic acid positioned between the two complementary regions are of different lengths. As described below, a bulge may comprise 1 or more nucleotides. In some embodiments, the miRNA comprises an internal bulge generated by deleting 2 based from the passenger strand of the miRNA -bases 9-10, counting from the start of the passenger strand.

[0087] In a particular aspect, the artificial miRNA molecules described in this disclosure are inhibitory against SNCA mRNA. In some embodiments, the SNCA mRNA is human SNCA mRNA. In some embodiments, the artificial mRNA targets the coding sequence of the SNCA mRNA. In some embodiments, the artificial miRNA targets the 3’-UTR region of mRNA encoding SNCA. In some embodiments, the artificial miRNA inhibits the expression of SNCA in a subject. In some embodiments, the artificial miRNA inhibits the accumulation of SNCA protein in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0088] The safety of miRNA-based therapies can be hampered by the ability of the miRNAs to bind to unintended mRNAs and reduce their expression, an effect known as off-target gene silencing. Off-targeting primarily occurs when the seed region (nucleotides 2-8 of the smallmiRNA) pairs with sequences in 3’-UTRs of unintended mRNAs and directs translational repression and destabilization of those transcripts. Reduced off-targeting miRNA may be designed by substituting bases within the guide and nonguide sequences; e.g., by creating CpG motifs. Potential substitutions that may result in a significantly lower off-target score can be evaluated using the SiSPOTR algorithm, a specificity-focused design algorithm which identifies candidate sequences with minimal off-targeting potentials and potent silencing capacities (Boudreau et al, Nucleic Acids Res. 2013 Jan; 41(1) e9. A reduced SiSPOTR score predicts sequences that have a lower number of potential human off targets compared parent miRNA molecules. In some embodiments of the disclosure, the miRNA is improved to reduce off-target gene silencing. In some embodiments, the miRNA comprises one or more CpG motifs. In some embodiments, the miRNA comprises one or more CpG motifs in a seed region.

[0089] In some embodiments, the first strand and the second strand are linked by means of a RNA (e.g., a RNA linker) capable of forming a loop structure. As is commonly known in the art, an RNA loop structure (e.g., a stem-loop or hairpin) is formed when an RNA molecule comprises two sequences of RNA that base pair together separated by a sequence of RNA that does not base pair together. For example, a loop structure may form in the RNA molecule A-B- C if sequences A and C are complementary or partially complementary such that they base pair together, but the bases in sequence B do not base pair together. In some embodiments, the loop sequence is 5’-GTTTTGGCCACTGACTGAC-3’ (SEQ ID NO: 45) in DNA form or 5’- GUUUUGGCCACUGACUGAC-3’ (SEQ ID NO: 46) in RNA form.

[0090] In some embodiments, the RNA capable of forming a loop structure comprises from 4 to 50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is from 4 to 50 nucleotides or any integer there between. In some embodiments, from 0-50% of the loop can be complementary to another portion of the loop. As used herein, the term “loop structure” is a sequence that joins two complementary strands of nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure are contiguous to the complementary strands of nucleic acid and may be complementary to 1 -3 nucleotides of the distal portion of the loop structure. For example, the three nucleotides at the 5’ end of the loop structure may be complementary to the three nucleotides at the 3’ end of the loop structure.

[0091] In some embodiments, nucleic acid encoding a miRNA of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used. In some embodiments, the miRNA scaffold is derived from a miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and the Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA).

[0092] In some embodiments, the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences. In some embodiments, the first strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to any guide sequences but maintains the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence. In some embodiments, the second strand comprises a nucleic acid sequence having more than about any of 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the corresponding passenger sequence but maintains the CpG motif.

[0093] Table 1 presents sequence IDs and sequence information (e.g., the sequence) of guide and passenger RNA sequences designed for human and NHP SNCA homology, low predicted off targeting in accordance with some embodiments. Seventeen sequences were selected based on: 1 ) their low potential for off-targeting calculated using an algorithm to reduce the promiscuity of candidate seed sequences (Boudreau et al, 2013); 2) avoidance of known pathogenic SNCA mutations and high frequency single nucleotide polymorphisms (SNP); and / or 3) homology between human and nonhuman primate SNCA to facilitate translatability.

[0094] In some embodiments, the miRNA (e.g., artificial miRNA) is selected from Table 1.TABLE 1IV. miRNA Expression Constructs and Vectors

[0095] The disclosure provides expression constructs, vectors and viral particles for expression of the miRNA molecules described herein.

[0096] In some embodiments, nucleic acid encoding an artificial miRNA of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, use of a heterologous miRNA scaffold is used to modulate miRNA expression; for example, to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art may be used. In some embodiments, the miRNA scaffold is derived from a miR-155 scaffold (see, e.g., Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and the Invitrogen™ BLOCK- iT™ Pol II miR RNA interference expression vector kit from Life Technologies, Thermo Fisher Scientific; Waltham, MA). In some embodiments, nucleic acid encoding a miRNA of the present disclosure comprises a miRNA scaffold. In some embodiments, miRNA scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgcaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 47), wherein the miRNA is inserted between the bolded gc residues.

[0097] In some embodiments, the miRNA in the scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgtacgatetaatategctegttttggccactgactgacgagcgatatgategtacgacaggaca caaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 48) where the underlined regular text represents the 5 ’-flank, italics text represents the guide sequence, bolded text represents the loop, underlined italics represents the non-guide sequence and regular text represents the 3’ flank.

[0098] In some embodiments, the miRNA targets RNA encoding a polypeptide associated with a synucleinopathy. In some embodiments, the polypeptide is SNCA.

[0099] In some embodiments, the transgene (e.g., a miRNA of the present disclosure) is operably linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase- 1 (PGK) promoter, a simian virus 40 (SV40) promoter and a CK6 promoter, a transthyretin promoter (TTR), a TK promoter, a tetracycline responsive promoter (TRE), an HBV promoter, an hAAT promoter, a LSP promoter, chimeric liver- specific promoters (LSPs), the E2F promoter, the telomerase (hTERT) promoter; the cytomegalovirus enhancer / chicken beta-actin / Rabbit P-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2): 193-9) and the elongation factor 1-alpha promoter (EFl-alpha) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo et al., Gene Ther., 1996, 3(9):802-10). In some embodiments, the promoter comprises a human P-glucuronidase promoter or a cytomegalovirusenhancer linked to a chicken P-actin (CBA) promoter. The promoter can be a constitutive, inducible or repressible promoter. In some embodiments, the disclosure provides a recombinant vector comprising nucleic acid encoding a heterologous transgene of the present disclosure operably linked to a CBA promoter. Exemplary promoters and descriptions may be found, e.g., in U.S. PG Pub. 20140335054. In some embodiments, the promoter is a CBA promoter, a minimum CBA promoter, a CMV promoter or a GUSB promoter. In some embodiments, the promoter is a hEF la promoter.

[0100] Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen].

[0101] Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al, Science, 268: 1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)) and the rapamycin- inducible system (Magari et al, J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

[0102] In another embodiment, the native promoter, or fragment thereof, for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissuespecific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

[0103] In some embodiments, the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissuespecific transcription factors that induce transcription in a tissue specific manner. Such tissuespecific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to the following tissue specific promoters: neuronal such as neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)). In some embodiments, the tissue-specific promoter is a promoter of a gene selected from: neuronal nuclei (NeuN), glial fibrillary acidic protein (GFAP), adenomatous polyposis coli (APC), and ionized calcium-binding adapter molecule 1 (Iba-1). Other appropriate tissue specific promoters will be apparent to the skilled artisan. In some embodiments, the promoter is a chicken Beta-actin promoter.

[0104] In some embodiments, the promoter expresses the heterologous nucleic acid in a cell of the CNS. As such, in some embodiments, a therapeutic polypeptide or a therapeutic nucleic acid of the disclosure may be used to treat a synucleinopathy. In some embodiments, the promoter expresses the heterologous nucleic acid in a brain cell. A brain cell may refer to any brain cell known in the art, including without limitation a neuron (such as a sensory neuron, motor neuron, interneuron, dopaminergic neuron, medium spiny neuron, cholinergic neuron, GABAergic neuron, pyramidal neuron, etc.), a glial cell (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glia, etc.), a brain parenchyma cell, microglial cell, ependemal cell, and / or a Purkinje cell. In some embodiments, the promoter expresses the heterologous nucleic acid in a neuron and / or glial cell. In some embodiments, theneuron is a medium spiny neuron of the caudate nucleus, a medium spiny neuron of the putamen, a neuron of the cortex layer IV and / or a neuron of the cortex layer V.

[0105] Various promoters that express transcripts (e.g., a heterologous transgene) in CNS cells, brain cells, neurons, and glial cells are known in the art and described herein. Such promoters can comprise control sequences normally associated with the selected gene or heterologous control sequences. Often, useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes. Examples include, without limitation, the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. In addition, sequences derived from nonviral genes, such as the murine metallothionein gene, may also be used. Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, CA). CNS-specific promoters and inducible promoters may be used. Examples of CNS-specific promoters include without limitation those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillary acid protein (GFAP), and neuron specific enolase (NSE). Examples of inducible promoters include DNA responsive elements for ecdysone, tetracycline, metallothionein, and hypoxia, inter alia.

[0106] The present disclosure contemplates the use of a recombinant viral genome for introduction of one or more nucleic acid sequences encoding for an artificial miRNA as described herein or packaging into an AAV viral particle. The recombinant viral genome may include any element to establish the expression of a miRNA, for example, a promoter, a heterologous nucleic acid, an ITR, a ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal, and / or origin of replication. In some embodiments, the rAAV vector comprises one or more of an enhancer, a splice donor / splice acceptor pair, a matrix attachment site, or a polyadenylation signal.

[0107] In some embodiments, the administration of an effective amount of rAAV particles comprising a vector encoding an artificial miRNA transduces cells (e.g., CNS cells, brain cells, neurons, and / or glial cells) at or near the site of administration e.g., the striatum and / or cortex) or more distal to the site of administration. In some embodiments, more than about any of 5%,10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 100% of neurons are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of the neurons are transduced. Methods to identify neurons transduced by recombinant viral particles expressing miRNA are known in the art; for example, immunohistochemistry, RNA detection (e.g., qPCR, Northern blotting, RNA-seq, in situ hybridization, and the like) or the use of a co-expressed marker such as enhanced green fluorescent protein can be used to detect expression.

[0108] In some aspects, the disclosure provides viral particles comprising a recombinant selfcomplementing genome (e.g., a self-complementary rAAV vector). AAV viral particles with self-complementing vector genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154;7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. A rAAV comprising a selfcomplementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises first nucleic acid sequence encoding the heterologous nucleic acid and a second nucleic acid sequence encoding a complement of the nucleic acid, where the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length.

[0109] In some embodiments, the first heterologous nucleic acid sequence encoding a miRNA and a second heterologous nucleic acid sequence encoding the complement of the miRNA are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5’- CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3’ (SEQ ID NO: 49). The mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence. As a result, on replicating an AAV viral genome, the rep proteins will not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologouspolynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR.V. Viral particles and methods of producing viral particles

[0110] The disclosure provides, inter alia, recombinant viral particles comprising a nucleic acid encoding an artificial miRNA of the present disclosure, as well as methods of use thereof to treat a disease or disorder in a mammal; e.g., a synucleinopathy.Viral particles

[0111] The disclosure provides viral particles comprising the miRNA molecules as disclosed herein. In some embodiments, the disclosure provides viral particles for delivering the miRNA molecules of the disclosure as disclosed herein. For example, the disclosure provides methods of using recombinant viral particles to deliver miRNA to treat a disease or disorder in a mammal; e.g., rAAV particles comprising miRNA to treat a synucleinopathy. In some embodiments, the recombinant viral particle is a recombinant AAV particle. In some embodiments, the viral particle is a recombinant AAV particle comprising a nucleic acid comprising a sequence an artificial miRNA of the present disclosure flanked by one or two ITRs. The nucleic acid is encapsidated in the AAV particle. The AAV particle also comprises capsid proteins. In some embodiments, the nucleic acid comprises the coding sequence(s) of interest (e.g., nucleic acid a miRNA of the present disclosure) operatively linked components in the direction of transcription, control sequences including transcription initiation and termination sequences, thereby forming an expression construct. The expression construct is flanked on the 5' and 3' end by at least one functional AAV ITR sequences. By “functional AAV ITR sequences” it is meant that the ITR sequences function as intended for the rescue, replication and packaging of the AAV virion. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16: 10-16, all of which are incorporated herein in their entirety by reference. For practicing some aspects of the disclosure, the recombinant vectors comprise at least all of the sequences of AAV essential for encapsidation and the physical structures for infection by the rAAV. AAV ITRs for use in the vectors of the disclosure need not have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum.Gene Ther., 1994, 5:793-801), and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 serotypes of AAV are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol., 2003, 77(12):6799-810. Use of any AAV serotype is considered within the scope of the present disclosure. In some embodiments, a rAAV vector is a vector derived from an AAV serotype, including without limitation, AAV ITRs are AAV 1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like. In some embodiments, the nucleic acid in the AAV comprises an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype or the like. In some embodiments, the nucleic acid in the AAV further encodes a miRNA as described herein. In some embodiments the rAAV particle comprise an AAV1, an AAV2HBKO capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl capsid.

[0112] For example, the nucleic acid in the AAV can comprise at least one ITR of any AAV serotype contemplated herein and can further encode a miRNA comprising a first strand and a second strand, wherein a) the first strand and the second form a duplex; b) the first strand comprises a guide region, and c) the second strand comprises a non-guide region, wherein the non-guide region comprises a two nucleotide deletion at bases 9 and 10 to create bulge in the guide strand. In some embodiments, a vector may include a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid may encode a green fluorescent protein. In some embodiments, the stuffer nucleic acid may be located between the promoter and the nucleic acid encoding the miRNA. In some embodiments, the stuffer nucleic acid is an A1AT stuffer nucleic acid.

[0113] Different AAV serotypes are used to optimize transduction of particular target cells or to target specific cell types within a particular target tissue (e.g., a diseased tissue). A rAAV particle can comprise viral proteins and viral nucleic acids of the same serotype or a mixed serotype. For example, in some embodiments a rAAV particle can comprise AAV 1 capsidproteins and at least one AAV2 ITR or it can comprise AAV2 capsid proteins and at least one AAV 1 ITR. Any combination of AAV serotypes for production of a rAAV particle is provided herein as if each combination had been expressly stated herein. In some embodiments, the disclosure provides rAAV particles comprising an AAV 1 capsid and a rAAV vector of the present disclosure (e.g., an expression construct comprising nucleic acid encoding a miRNA of the present disclosure), flanked by at least one AAV2 ITR. In some embodiments, the disclosure provides rAAV particles comprising an AAV2 capsid. In some embodiments the rAAV particle comprise an AAV1, an AAV2HBK0 capsid (e.g., as described in WO2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an OligOOl .

[0114] In some aspects, the disclosure provides viral particles comprising a recombinant selfcomplementing genome. AAV viral particles with self-complementing genomes and methods of use of self-complementing AAV genomes are described in US Patent Nos. 6,596,535;7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which are incorporated herein by reference in its entirety. A rAAV comprising a self-complementing genome will quickly form a double stranded DNA molecule by virtue of its partially complementing sequences (e.g., complementing coding and non-coding strands of a transgene). In some embodiments, the disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., a miRNA of the present disclosure) and a second heterologous polynucleotide sequence (e.g., antisense strand of a miRNA of the present disclosure) wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a sequence that facilitates intrastrand base pairing; e.g., a hairpin DNA structure. Hairpin structures are known in the art, for example in miRNA or siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and a second heterologous polynucleotide sequence are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5’-ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct- 3’ (SEQ ID NO: 50). The mutated ITR comprises a deletion of the D region comprising the terminal resolution sequence.As a result, on replicating an AAV viral genome, the rep proteins will not cleave the viral genome at the mutated ITR and as such, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in a viral capsid: an AAV ITR, the first heterologous polynucleotide sequence including regulatory sequences, the mutated AAV ITR, the second heterologous polynucleotide in reverse orientation to the first heterologous polynucleotide and a third AAV ITR. In some embodiments, the disclosure provides AAV viral particles comprising a recombinant viral genome comprising a functional AAV2 ITR, a first polynucleotide sequence encoding a miRNA of the present disclosure, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal resolution sequence, a second polynucleotide sequence comprising the complementary sequence to the sequence encoding a miRNA of the present disclosure, of the first polynucleotide sequence and a functional AAV2 ITR.Production of viral particles

[0115] rAAV particles can be produced using methods known in the art. See, e.g., U.S. Pat. Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing the disclosure, host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast. Host cells can also be packaging cells in which the AAV rep and cap genes are stably maintained in the host cell or producer cells in which the AAV vector genome is stably maintained.Exemplary packaging and producer cells are derived from 293, A549 or HeLa cells. AAV vectors are purified and formulated using standard techniques known in the art.

[0116] Methods known in the art for production of rAAV vectors include but are not limited to transfection, stable cell line production, and infectious hybrid virus production systems which include adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789) and baculovirus-AAV hybrids. rAAV production cultures for the production of rAAV virus particles all require; 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9, in the case of baculo virus production systems; 2) suitable helper virus function, provided by wild-type or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper functions; 3) AAV rep and cap genes and gene products; 4) a nucleic acid (such as a therapeutic nucleic acid) flanked by at least one AAV ITR sequences ; and 5) suitable media and media components to support rAAV production. Insome embodiments, the AAV rep and cap gene products may be from any AAV serotype. In general, but not obligatory, the AAV rep gene product is of the same serotype as the ITRs of the rAAV vector genome as long as the rep gene products may function to replicated and package the rAAV genome. Suitable media known in the art may be used for the production of rAAV vectors. These media include, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and Sf-900 II SFM media as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to custom media formulations for use in production of recombinant AAV vectors. In some embodiments, the AAV helper functions are provided by adenovirus or HSV. In some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0117] In some embodiments, rAAV particles may be produced by a triple transfection method, such as the exemplary triple transfection method provided infra. Briefly, a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid, may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified. As such, in some embodiments, the rAAV particle was produced by triple transfection of a nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions into a host cell, wherein the transfection of the nucleic acids to the host cells generates a host cell capable of producing rAAV particles.

[0118] In some embodiments, rAAV particles may be produced by a producer cell line method, such as the exemplary producer cell line method provided infra (see also (referenced in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., a HeLa cell line) may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a promoter-heterologous nucleic acid sequence. Cell lines may be screened to select a lead clone for rAAV production, which may then be expanded to a production bioreactor and infected with an adenovirus (e.g., a wild-type adenovirus) as helper to initiate rAAV production. Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and / or removed, and the rAAV particles may be purified. As such, in some embodiments, the rAAV particle wasproduced by a producer cell line comprising one or more of nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions.

[0119] In some aspects, a method is provided for producing any rAAV particle as disclosed herein comprising (a) culturing a host cell under a condition that rAAV particles are produced, wherein the host cell comprises (i) one or more AAV package genes, wherein each said AAV packaging gene encodes an AAV replication and / or encapsidation protein; (ii) an rAAV provector comprising a nucleic acid encoding miRNA of the present disclosure as described herein flanked by at least one AAV ITR, and (iii) an AAV helper function; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, said at least one AAV ITR is selected from the group consisting of AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV capsid serotype ITRs or the like. In some embodiments, said encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShHIO, as described in U.S. PG Pub. 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., a wild-type AAV9 capsid, or a modified AAV9 capsid as described in U.S. PG Pub. 2013 / 0323226), AAV10, AAVrhlO, AAV11, AAV12, a tyrosine capsid mutant, a heparin binding capsid mutant, an AAV2R471 A capsid, an AAVAAV2 / 2-7m8 capsid, an AAV DJ capsid (e.g., an AAV-DJ / 8 capsid, an AAV-DJ / 9 capsid, or any other of the capsids described in U.S. PG Pub. 2012 / 0066783), AAV2 N587A capsid, AAV2 E548A capsid, AAV2 N708A capsid, AAV V708K capsid, goat AAV capsid, AAV1 / AAV2 chimeric capsid, bovine AAV capsid, mouse AAV capsid, rAAV2 / HBoVl capsid, or an AAV capsid described in U.S. Pat. No. 8,283,151 or International Publication No. WG / 2003 / 042397. In some embodiments, the AAV capsid is an AAV2HBKO capsid as described in WO2015168666. In some embodiments, the AAV capsid is an AAV9 capsid. In some embodiments, the AAV capsid is a PHP.B, PHP.eB or an OligOOl capsid. In some embodiments, a mutant capsid protein maintains the ability to form an AAV capsid. In some embodiments, the encapsidation protein is an AAV5 tyrosine mutant capsid protein. In further embodiments, the rAAV particle comprises capsid proteins of an AAV serotype from Clades A-F. In some embodiments, the rAAV particles comprise an AAV1 capsid and a recombinant genome comprising AAV2 ITRsand nucleic acid encoding a miRNA of the present disclosure. In a further embodiment, the rAAV particles are purified. The term “purified” as used herein includes a preparation of rAAV particles devoid of at least some of the other components that may also be present where the rAAV particles naturally occur or are initially prepared from. Thus, for example, isolated rAAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant. Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase-resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in-process contaminants, including helper virus, media components, and the like.

[0120] Numerous methods are known in the art for production of adenoviral vector particles. For example, for a gutted adenoviral vector, the adenoviral vector genome and a helper adenovirus genome may be transfected into a packaging cell line (e.g., a 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes may be transfected into a packaging cell line that expresses a recombinase (e.g., the Cre / loxP system may be used), such that the adenoviral vector of interest is packaged more efficiently than the helper adenovirus (see, e.g., Alba, R. et al. (2005) Gene Ther. 12 Suppl ESI 8-27). Adenoviral vectors may be harvested and purified using standard methods, such as those described herein.

[0121] Numerous methods are known in the art for production of lenti viral vector particles. For example, for a third-generation lentiviral vector, a vector containing the lentiviral genome of interest with gag and pol genes may be co-transfected into a packaging cell line (e.g., a 293 cell line) along with a vector containing a rev gene. The lentiviral genome of interest also contains a chimeric ETR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. 72:8463-71). Eentiviral vectors may be harvested and purified using methods (e.g., Segura MM, et al., (2013) Expert Opin Biol Ther. 13(7):987- 1011) described herein.

[0122] Numerous methods are known in the art for production of HSV particles. HSV vectors may be harvested and purified using standard methods, such as those described herein. For example, for a replication-defective HSV vector, an HSV genome of interest that lacks all ofthe immediate early (IE) genes may be transfected into a complementing cell line that provides genes required for virus production, such as ICP4, ICP27, and ICPO (see, e.g., Samaniego, L.A. et al. (1998) J. Virol. 72:3307-20). HSV vectors may be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology 1144:63-79).

[0123] Also provided herein are pharmaceutical compositions comprising a recombinant viral particle comprising a transgene encoding a miRNA of the present disclosure and a pharmaceutically acceptable carrier. The pharmaceutical compositions may be suitable for any mode of administration described herein. A pharmaceutical composition of a recombinant viral particle comprising a nucleic acid encoding a miRNA of the present disclosure can be introduced to the brain. For example, a recombinant viral particle comprising a nucleic acid encoding a miRNA of the present disclosure can be administered intrastriatally. Any of the recombinant viral particles of the present disclosure may be used, including rAAV, adenoviral, lentiviral, and HSV particles.

[0124] In some embodiments, the pharmaceutical compositions comprising a recombinant viral particle comprising a transgene encoding a miRNA of the present disclosure described herein and a pharmaceutically acceptable carrier is suitable for administration to human. Such carriers are well known in the art (see, e.g., Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580). In some embodiments, the pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant lentiviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant adenoviral particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, the pharmaceutical compositions comprising a recombinant HSV particle described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).

[0125] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. The pharmaceutical composition may further comprise additional ingredients, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like. The pharmaceutical compositions described herein can be packaged in single unit dosages or in multidosage forms. The compositions are generally formulated as sterile and substantially isotonic solution.

[0126] In some embodiments, SEQ ID NO: 1-14 (e.g., artificial miRNA sequences) may be configured to target human and / or non-human primate (cynomolgus macaque) SNCA mRNA, avoiding known SNCA mutations, and / or low seed-mediated off-target potential. In some embodiments, SEQ ID NO: 1-14 may express in two different human cells lines for SNCA mRNA and / or protein reduction. In some embodiments, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 8 may be expressed via adeno-associated viral vector in the human SNCA expressing BAChSyn mouse model. In some embodiments, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8 may reduce SNCA mRNA. In some embodiments, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8 may be confirmed to reduce SNCA mRNA by RTdPCR.

[0127] In some aspects, provided here are artificial miRNAs comprising a first stand and a second strand, wherein (a) the first strand and second strand form a duplex; (b) the first strand comprises a guide region comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14; and (c) the second strand may comprise a non-guide region that comprises a nucleotide sequence that may be partially complementary to the nucleotide sequence of the guide region. In some embodiments, the guide region comprises the sequence of SEQ ID NO: 4. In some embodiments, the guide region comprises the sequence of SEQ ID NO: 5. In some embodiments, the guide region comprises the sequence of SEQ ID NO: 7. In some embodiments, the guide region comprises the sequence of SEQ ID NO: 8.

[0128] In some embodiments, the guide region may comprise (a) the sequence of SEQ ID NO: 1 and the non-guide region comprises the sequence of SEQ ID NO: 15; (b) the sequence of SEQ ID NO: 2 and the non-guide region comprises the sequence of SEQ ID NO: 16; (c) the sequence of SEQ ID NO: 3 and the non-guide region comprises the sequence of SEQ ID NO: 17; (d) the sequence of SEQ ID NO: 4 and the non-guide region comprises the sequence of SEQ ID NO: 18; (e) the sequence of SEQ ID NO: 5 and the non-guide region comprises the sequence of SEQ ID NO: 19; (f) the sequence of SEQ ID NO: 6 and the non-guide region comprises the sequence of SEQ ID NO: 20; (g) the sequence of SEQ ID NO: 7 and the non-guide region comprises the sequence of SEQ ID NO: 21; (h) the sequence of SEQ ID NO: 8 and the non-guide region comprises the sequence of SEQ ID NO: 22; (i) the sequence of SEQ ID NO: 9 and the non-guide region comprises the sequence of SEQ ID NO: 23; j) the sequence of SEQ ID NO: 10 and the non-guide region comprises the sequence of SEQ ID NO: 24; (k) the sequence of SEQ ID NO: 11 and the non-guide region comprises the sequence of SEQ ID NO: 25; (1) the sequence of SEQ ID NO: 12 and the non-guide region comprises the sequence of SEQ ID NO: 26; (m) the sequence of SEQ ID NO: 13 and the non-guide region comprises the sequence of SEQ ID NO: 27; or (n) the sequence of SEQ ID NO: 14 and the non-guide region comprises the sequence of SEQ ID NO: 28.

[0129] In some embodiments, the guide region may comprise the sequence of SEQ ID NO: 4 and the non-guide region may comprise the sequence of SEQ ID NO: 18. In some embodiments, the guide region may comprise the sequence of SEQ ID NO: 5 and the non-guide region may comprise the sequence of SEQ ID NO: 19. In some embodiments, the guide region may comprise the sequence of SEQ ID NO: 7 and the non-guide region may comprise the sequence of SEQ ID NO: 21. In some embodiments, the guide region may comprise the sequence of SEQ ID NO: 8 and the non-guide region may comprise the sequence of SEQ ID NO: 22. In some embodiments, the artificial miRNA may target SNCA mRNA.

[0130] In some embodiments, the artificial miRNA may be configured for binding of the guide region to the coding sequence of the SNCA mRNA thereby reducing expression of the protein SNCA.

[0131] In some embodiments, an expression construct may comprise a nucleic acid encoding the artificial miRNA as provided herein. In some embodiments, the nucleic acid encoding themiRNA is operably linked to a promoter. In some embodiments, the nucleic acid encoding the artificial miRNA may be cloned into a miRNA scaffold, wherein transcription of the expression construct may form a stem-loop structure.

[0132] In some embodiments, a vector may comprise the expression construct as provided herein. In some embodiments, the vector may be a rAAV vector.

[0133] In some embodiments, a viral particle may comprise the vector as provided herein, wherein the viral particle may comprise an AAV particle encapsidating the rAAV vector. In some embodiments, the viral particle may comprise a modified AAV9 capsid protein. In some embodiments, the modified AAV9 capsid protein may comprise SAN006. In some embodiments, the viral particle may comprise a modified AAV2 capsid protein. In some embodiments, the viral particle may comprise AAV2-HBKO.VI. Methods of Treatment

[0134] Certain aspects of the present disclosure relate to methods of treating a synucleinopathy by reducing levels of SNCA mRNA expression in an individual in need thereof. In some embodiments, the invention provides methods of treating a synucleinopathy by administering an effective amount of an expression cassette (e.g., an expression cassette delivered in a rAAV particle) for expressing an artificial miRNA of the present disclosure. Examples of synucleinopathies include, but are not limited to Parkinson’s disease.

[0135] The expression cassette (e.g., expression cassette delivered in a rAAV particle) for expressing the artificial miRNA may be administered through various routes. In some embodiments, the administration includes direct spinal cord injection and / or intracerebral administration. In some embodiments, the administration is at a site selected from the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges surrounding the brain, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) of the subarachnoid space surrounding the brain, deep cerebellar nuclei of the cerebellum, ventricular system of the cerebrum, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and the parenchyma of the brain. In some embodiments, the administration comprises intracerebro ventricular injection into at least one cerebral lateral ventricle. In some embodiments, the administration comprises intrathecalinjection in the cervical, thoracic, and / or lumbar region. In some embodiments, the administration comprises intrastriatal injection. In some embodiments, the administration comprises intrathalamic injection.

[0136] In some embodiments, routes of administration to the central nervous system may comprise an intraparenchymal route. In some embodiments, the intraparenchymal route may comprise thalamic, striatal, or hippocampal. In some embodiments, routes of administration to the central nervous system may comprise an intra-cerebral spinal fluid (CSF) route. In some embodiments, the intra-CSF route may comprise intracerebroventricular, intra-cisternal magna, or intrathecal. In some embodiments, routes of administration to the central nervous system may comprise a peripheral route. In some embodiments, the peripheral route may comprise an intravenous route. In some embodiments, routes of administration to the central nervous system may comprise an experimental route. In some embodiments, the experimental route may comprise an intranasal route.

[0137] In some embodiments, a route of administration (ROA) may comprise an intracerebral spinal fluid (intra-CSF) ROA. In some embodiments, the intra-CSF ROA may comprise intracerebroventricular (ICV), intra-cisternal magna (ICM), or intrathecal (IT) ROA.

[0138] An effective amount of rAAV (in some embodiments in the form of particles) is administered, depending on the objectives of treatment. For example, where a low percentage of transduction can achieve the desired therapeutic effect, then the objective of treatment is generally to meet or exceed this level of transduction. In some instances, this level of transduction can be achieved by transduction of only about 1 to 5% of the target cells of the desired tissue type, in some embodiments at least about 20% of the cells of the desired tissue type, in some embodiments at least about 50%, in some embodiments at least about 80%, in some embodiments at least about 95%, in some embodiments at least about 99% of the cells of the desired tissue type. The rAAV composition may be administered by one or more administrations, either during the same procedure or spaced apart by days, weeks, months, or years. One or more of any of the routes of administration described herein may be used. In some embodiments, multiple vectors may be used to treat the human.

[0139] In some embodiments of the above aspects, the rAAV is administered via direct injection into the spinal cord, via intrathecal injection, or via intracisternal injection. In some embodiments, the rAAV is administered to more than one location of the spinal cord or cisterna magna. In some embodiments, the rAAV is administered to more than one location of the spinal cord. In some embodiments, the rAAV is administered to one or more of a lumbar subarachnoid space, thoracic subarachnoid space and a cervical subarachnoid space of the spinal cord. In some embodiments, the rAAV is administered to the cisterna magna.

[0140] In some embodiments, the invention provides a method for treating a human with a synucleinopathy by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA of the present disclosure. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0141] In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA polypeptide of the present disclosure to a synucleinopathy in an individual in need thereof. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x IO12, 6 x IO12, 7 x IO12, 8 x IO12, 9 x IO12, 10 x IO12, 11 x IO12, 15 x IO12, 20 x IO12, 25 x 1012, 30 x IO12, or 50 x IO12genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO12to 6 x IO12, 6 x IO12to 7 x IO12, 7 x IO12to 8 x IO12, 8 x IO12to 9 x IO12, 9 x IO12to 10 x IO12, 10 x IO12to 11 x IO12, 11 x IO12to 15 x 1012, 15 x IO12to 20 x IO12, 20 x IO12to 25 x IO12, 25 x IO12to 30 x IO12, 30 x IO12to 50 x IO12, or 50 x IO12to 100 x IO12genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO12to 10 x IO12, 10 x IO12to 25 x IO12, or 25 x IO12to 50 x I012genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about any of 5 x IO9, 6 x 109, 7 x 109, 8 x 109, 9 x 109, 10 x IO9, 11 x IO9, 15 x IO9, 20 x 109, 25 x 109, 30 x 109, or 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO9to 6 x IO9, 6 x 109to 7 x 109, 7 x 109to 8 x 109, 8 x 109to 9 x 109, 9 x 109to 10 x IO9, 10 x IO9to 11 x IO9, 11 x 109to 15 x IO9, 15 x IO9to 20 x IO9, 20 x 109to 25 x 109, 25 x 109to 30 x 109, 30 x 109to 50 x 109or 50 x 109to 100 x IO9transducing units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about any of 5 x IO9to 10 x IO9, 10 x IO9to 15 x 109, 15 x 109to 25 x 109, or 25 x 109to 50 x 109transducing units / mL. In some embodiments, the viral titer of the viral particles e.g., rAAV particles) is at least any of about 5 x IO10, 6 x IO10, 7 x IO10, 8 x IO10, 9 x IO10, 10 x IO10, 11 x IO10, 15 x IO10, 20 x IO10, 25 x IO10, 30 x IO10, 40 x IO10, or 50 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x 1010to 6 x 1010, 6 x 1010to 7 x 1010, 7 x 1010to 8 x 1010, 8 x IO10to 9 x 1010, 9 x IO10to 10 x IO10, 10 x IO10to 11 x IO10, 11 x IO10to 15 x IO10, 15 x IO10to 20 x IO10, 20 x IO10to 25 x IO10, 25 x IO10to 30 x IO10, 30 x IO10to 40 x IO10, 40 x IO10to 50 x IO10, or 50 x IO10to 100 x IO10infectious units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least any of about 5 x 1010to 10 x 1010, 10 x 1010to 15 x 1010, 15 x IO10to 25 x IO10, or 25 x IO10to 50 x 1010infectious units / mL. In some embodiments, the viral particles are rAAV particles.

[0142] In some embodiments, the dose of viral particles administered to the individual is at least about any of 1 x 108to about 6 x 1013genome copies / kg of body weight. In some embodiments, the dose of viral particles administered to the individual is about any of 1 x 108to about 6 x 1013genome copies / kg of body weight. . In some embodiments, the dose of viral particles administered to the individual is about any of 1 x 1010, 2 x 1010, 3 x 1010, 4 x 1010, 5 x1010, 6 x 1010, 7 x 1010, 8 x 1010, 9 x 1010, 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 13x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x1012, 8 x 1012, 9 x 1012, or 1 x 1013genome copies / kg of body weight.

[0143] In some embodiments, the total amount of viral particles administered to the individual is at least about any of 1 x 109to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x 109to about 1 x 1014genome copies. In some embodiments, the total amount of viral particles administered to the individual is about any of 1 x 1011, 2 x 1011, 3 x 1011, 4 x 1011, 5 x 1011, 6 x1011, 7 x 1011, 8 x 1011, 9 x 1011, 1 x 1012, 2 x 1012, 3 x 1012, 4 x 1012, 5 x 1012, 6 x 1012, 7 x1012, 8 x 1012, 9 x 1012, 1 x 1013, 2 x 1013, 13x 1013, 4 x 1013, 5 x 1013, 6 x 1013, 7 x 1013, 8 x1013, 9 x 1013, or 1 x 1014genome copies.

[0144] In some aspects, provided herein are methods of treating or preventing a synucleinopathy in a patient in need thereof. In some aspects, provided herein are methods of treating or preventing a synucleinopathy in a patient in need thereof, comprising administering tothe patient a composition comprising a miRNA comprising a guide strand that binds to a SNCA mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO: 13, or SEQ ID NO: 14.

[0145] In some embodiments, the synucleinopathy may comprise Parkinson’s Disease, Multiple System Atrophy, or Dementia with Lewy Bodies. In some embodiments, the synucleinopathy may be Parkinson’s Disease. In some embodiments, the synucleinopathy may be Multiple System Atrophy. In some embodiments, the synucleinopathy is Dementia with Lewy Bodies.

[0146] In some embodiments, provided here are methods of reducing SNCA expression in a patient suffering from a synucleinopathy, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that may bind to a SNCA mRNA and / or a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:13, or SEQ ID NO: 14.

[0147] In some embodiments, provided here are methods for reduction of exogenous human SNCA protein following treatment with artificial miRNAs. Plasmids expressing the indicated artificial miRNA IDs were cotransfected with the target cDNA with flanking UTRs into HEK293T cells in triplicate as depicted in FIG. 1. After three days, cells were lysed and total alpha synuclein levels were measured via a commercial enzyme-linked immunosorbent assay (ELISA, Abeam) according to the manufacturer’s instructions. Values were normalized to cells treated with a control artificial miRNA. 15 sequences significantly reduced human alpha- synuclein protein. Values represent the mean + / - SEM. ***p<0.01.

[0148] In some embodiments, provided here are methods for dose-dependent reduction of endogenous human SNCA following treatment with artificial miRNAs. To evaluate candidates based on their ability to reduce endogenous human SNCA, HeLa cells were transfected with the indicated artificial miRNAs. Plasmids were transfected into cells with Lipofectamine 3000 at three different dose levels, with the DNAdipid ratio held constant by supplementing withtransfection carrier DNA as needed (Promega). SNCA mRNA levels were quantified 2 days after transfection using digital PCR and normalized to housekeeper TBP mRNA and to the control artificial miRNA sequence transfected at each respective dose level. Each artificial miRNA exhibited a dose dependent reduction in human SNCA target as depicted in FIG. 2. Values represent the mean + / - SEM with individual data points shown. *,« *** p<0.05, p<0.01, p<0.001.

[0149] In some embodiments, provided here are methods for reducing levels of SNCA mRNA and or reducing SNCA proteins (e.g., SNCA peptides. Results for guide to passenger ratio and strand processing in human cells are depicted in FIGS. 3A-B. In some embodiments, the ratio of guide strand to passenger strand may serve as an indicator of whether artificial miRNAs will engage the expected target (via homology between the guide and the target mRNA). For the results depicted in FIG. 3A-B, total RNA (including small RNA) was isolated from HeLa cells treated with the indicated sequences in triplicate and small RNA sequencing was used to measure the number of small RNAs matching the predicted guide or passenger strand sequence. Each sequence tested exhibited excellent guide:passenger expression with values approaching 100% (99.11, 99.72, 99.76, 99.33 for 264, 265, 422 and 423 respectively). Values on the graph represent the mean + / - SEM of three biologic replicates with individual data points shown.

[0150] In some embodiments, provided herein are methods comprising chaining of artificial miRNAs in tandem. In such embodiments, chaining artificial miRNA in tandem may improve SNCA reduction in human cells. Results for experiments comprising chaining artificial miRNA in tandem are depicted in FIGS. 4A-D. Plasmids expressing artificial miRNAs in the indicated formats (CBA-single, Hl -single, 2X 7bp, 2X 130bp, 3X 7bp and 3X 130bp) were transfected into HeLa cells. For FIGS. 4A-D, human SNCA (e.g., hSNCA) normalized to the respective control (e.g., housekeeper TBP) is shown on the y-axis and each plasmid format is shown on the x-axis. FIG. 4A shows results for SEQ ID NO: 4, FIG. 4B shows results for SEQ ID NO: 5, FIG. 4C shows results for SEQ ID NO: 7 and FIG. 4D shows results for SEQ ID NO: 8. SNCA mRNA levels were quantified 2 days after transfection

[0151] using RTdPCR and normalized to housekeeper TBP mRNA and to cell treated with control plasmids in each respective format. Groups were compared to each other via 1-wayANOVA with repeated measures are depicted in FIGS. 4A-D. Values represent mean+ / - SEM of 4 biologic replicates. **, ***, *** p<0.01, p<0.001, p<0.0001 respectively.

[0152] In some embodiments, provided here are methods for reduction of human SNCA mRNA in vivo. Results showing reduction of human SNCA mRNA in vivo are depicted in FIG. 5A. AAV.SAN006 vectors encoding the indicated artificial miRNA formats were injected bilaterally into the striatum of two-month-old BAChSyn mice. Each artificial miRNA was tested as the CBA-driven single artificial miRNA and compared to a vector where that same artificial miRNA was expressed as three tandem repeats separated by the longer 130bp linker (“-3X” suffix). Total RNA was isolated from striatal tissue 6 weeks post-dosing. RT-dPCR was used to quantify human SNCA mRNA levels normalized to the geometric mean of Hprt and Rpp30 housekeeper mRNAs. Values are graphed as fold change vs animals injected with formulation buffer. Bars represent the mean+ / - standard error of the mean (SEM).VII. Articles of Manufacture and Kits

[0153] Also provided are kits or articles of manufacture for use in the methods described herein. In aspects, the kits comprise the compositions described herein (e.g., a recombinant viral particle of the present disclosure, such as a rAAV particle comprising nucleic acid encoding a miRNA of the present disclosure) in suitable packaging. Suitable packaging for compositions (such as intrastriatal compositions) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed.

[0154] The present disclosure also provides kits comprising compositions described herein and may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing any methods described herein. For example, in some embodiments, the kit comprises a composition of recombinant viral particles comprising a transgene encoding a miRNA of the present disclosure for delivery of at least 1 x IO9genome copies into the brain of a mammal (e.g., through intrastriatal administration) to a primate as described herein, a pharmaceutically acceptable carrier suitable for injection into the brain of aprimate, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing injections into the brain of a primate e.g., intrastriatal administration). In some embodiments, the kit comprising instructions for treating a neurodegenerative synucleinopathy with the recombinant viral particles described herein. In some embodiments, the kit comprising instructions for using the recombinant viral particles described herein according to any one of the methods described hereinEXAMPLES

[0155] The disclosure will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.General MethodsPlasmid and adeno associated virus (AAV) generation

[0156] Artificial micro-RNAs (artificial miRNAs) were expressed from the murine miR155 scaffold under the control of the human cytomegalovirus enhancer / chicken beta-actin (CBA) promoter. Guide sequences were designed to match regions homologous only to human and NHP SNCA. The Control artificial miRNA encodes a non-targeting artificial miRNA sequence designed for minimal seed-mediated off-target gene repression. To generate recombinant AAV vectors encoding artificial miRNAs, the expression cassettes were cloned into a plasmid containing AAV2 inverted terminal repeats (ITRs). To generate AAV.SAN006 vectors, HEK293 cells were transfected using PEI (polyethyleneimine) with a 1: 1: 1 ratio of three plasmids (containing the ITR, AAV rep / cap and Ad helper). The Ad helper plasmid (pHelper) was obtained from Stratagene / Agilent Technologies (Santa Clara, CA). AAV purification was performed using cesium chloride ultracentrifugation, and virus was titered using qPCR against the polyA sequence.Cell culture and transfections

[0157] HEK293T (ATCC) cells and HeLa (ATCC) cells were grown to 70-80% confluency in complete DMEM at 37C and 5% CO2. Endotoxin-free plasmid DNA was diluted into Opti- MEM, complexed with Lipofectamine 3000 (Invitrogen) and added to cells according to manufacturer’s instructions. Cells were washed with PBS and lysed 2-3 days after transfection for RNA or protein measurements (as indicated).Total RNA isolation and mRNA quantification by RT-digital PCR (RTdPCR)

[0158] Following addition of chloroform and phase separation, total RNA including small RNAs <200bp was isolated from the aqueous phase using the RNeasy 96 QIAcube HT kit (QIAgen #74171) according to manufacturer’s instructions. RNA concentration and purity were assessed by measuring absorbance at A260 / A280 and A260 / A230 on a NanoDrop eight spectrophotometer (ThermoScientific). RNA samples were diluted to equal concentration and tested by RT-dPCR for multiplexed quantification of human SNCA mRNA (TaqManHsOl 103383 ) and human TBP mRNA (IDT Hs.PT.58v.39859774) using the QIAcuity 8 system (QIAgen) and QIAcuity One-Step Viral RT-PCR Kit (QIAgen 1123145). SNCA mRNA values were normalized to TBP housekeeper and analyzed relative to control levels.Small RNA seq

[0159] Small RNA (<200 bp) libraries were prepared and sequenced using the Illumina Truseq small RNA Library Prep Kit and sequencer. Raw data were filtered and aligned to the human reference genome (Human.B38 genome used by Qiagen Omicsoft studio) with miRbase.R22 gene annotation; reads were also aligned to custom genomes for each artificial miRNA hairpin cassette including guide, stem loop, and passenger, plus flanking sequence. A custom python script was used to export the mature miRNA sequences and counts.Alpha- synuclein ELISA

[0160] HEK293T cells were washed with PBS, lysed in assay buffer and levels of total alpha-synuclein were measured by ELISA using the human alpha-synuclein SimpleStep Kit (Abeam, ab260052) using the manufacturer’s instructions. Values were normalized to Control artificial miRNA transfected cells.Animal use and care

[0161] All procedures were performed according to a protocol approved by the Institutional Animal Care and Use Committee (IACUC) at Jackson Labs, as per guidelines specified by the Guide for the Care and Use of Laboratory Animals, NIH. Adult C57BL / 6N-Tg(SNCA)129Mjff / J (“BAChSyn”) mice were maintained on a 12 hour light / dark cycle with food and water available ad libitum. Each animal was identified with a unique ear tag and microchip.Stereotaxic injections with AAV.SAN006-artificial miRNA vectors

[0162] Mice were anaesthetized by isoflurane exposure and secured on a stereotactic frame (Stoelting) with constant isoflurane perfusion. The scalp was shaved and an incision was made down the midline to locate bregma. A small burr hole was drilled above the desired location within the brain. A Hamilton syringe was mounted onto a micro-controlled stereotactic frame (Stoelting), and the needle was slowly lowered to the appropriate depth. For striatal injections, 3E10 viral particles were injected into each hemisphere at coordinates AP +0.5, DV -3.1, and ML + / -2.0. In each surgery, virus was injected at a rate of 0.5pL per minute. The needle was left in for two more minutes to prevent flow of vector back through the needle tract, and then slowly raised out of the brain. Mice were kept warm following surgery and observed continuously until recovery. Four weeks post-injection, mice were euthanized by anesthetic overdose with >150mg / kg sodium pentobarbital. Following overdose, mice were kept warm until cardiac perfusion with ice-cold PBS.Statistical Analysis

[0163] Statistics were performed using Prism software (Version 9, Graphpad) using one-way ANOVA with multiple comparisons when applicable.Example 1: Artificial miRNA sequences reduce alpha-synuclein expression in human cells.

[0164] Seventeen candidate artificial miRNA (artificial miRNA) sequences were selected based on: 1) their low potential for off-targeting calculated using an algorithm to select sequences that have seed with a lower predicted frequency of off-targets (Boudreau et al, 2013) 2) avoidance of known pathogenic SNCA mutations and high frequency single nucleotide polymorphisms (SNP), and 3) homology between human and nonhuman primate SNCA to facilitate translatability. Sequences as displayed in Table 1 were each embedded within themurine miR155 scaffold for expression as an artificial miRNA and cloned into an expression plasmid driven by a constitutive polymerase II promoter.

[0165] Sequences were first screened in HEK293T cells via a cotransfection based assay. An expression plasmid was designed containing the human SNCA cDNA with sufficient SNCA 3’UTR sequence (NM_000345.3) to encompass the binding sites for all artificial miRNAs in the screen. Since the target is co-transfected with the artificial miRNA, this experimental design enables for detection of activity even from low potency artificial miRNAs.

[0166] Plasmids expressing the indicated artificial miRNA IDs were cotransfected with the target cDNA with flanking UTRs into HEK293T cells in triplicate. The HEK293T cells were lysed 3 days later. Total alpha-synuclein protein was quantified by a commercial enzyme-linked immunosorbent assay (ELISA, Abeam) according to the manufacturer’s instructions. Values were normalized to cells treated with a control artificial miRNA. Values represent the mean + / - SEM. ***p<0.01. Fifteen sequences significantly reduced human alpha-synuclein as compared to cell transfected with a control artificial miRNA sequence as seen in FIG. 1.

[0167] A subset of candidate sequences was subsequently evaluated for their ability to reduce levels of endogenous alpha-synuclein in a dose dependent manner. HeLa cells were transfected with varying levels of plasmid encoding each artificial miRNA. Specifically, plasmids were transfected into cells with Lipofectamine 3000 at three different dose levels, with the DNAdipid ratio held constant by supplementing with transfection carrier DNA as needed (Promega). Cells were lysed 2 days after transfection and total RNA was quantified to evaluate SNCA mRNA reduction by reverse transcription digital polymerase chain reaction (RT-dPCR). The SNCA mRNA levels were normalized to housekeeper TBP mRNA and to the control artificial miRNA sequence transfected at each respective dose level. Each sequence exhibited dose dependent reduction of endogenous human SNCA mRNA as seen in FIG. 2. Values represent the mean + / - SEM with individual data points shown. *,« *** p<0.05, p<0.01, p<0.001.Example 2: Artificial miRNA sequences show excellent strand biasing and accurate 5’ processing in human cells

[0168] Each artificial miRNA is expressed as a pre-miRNA hairpin loop that is processed by the endogenous RNAi machinery to generate a mature 21 nucleotide duplex, the antisense guidestrand of which is preferentially loaded into the RNA-induced silencing complex (RISC) to mediate target mRNA degradation while the passenger strand is excluded and degraded in the cytosol. Proper 5 ’ cleavage of the artificial miRNA guide sequence defines the seed sequence and is critical for on-target transcriptional silencing. Small RNA sequencing was used to evaluate guide vs passenger strand processing in vivo according to metrics known to contribute to on- and off-target activity of the artificial miRNA. HeLa cells were transfected with varying levels (50ng, lOOng, 150ng) of plasmid encoding each artificial miRNA. Cells were lysed 2 days after transfection and total RNA was isolated. Small RNA libraries were prepared and sequenced to quantify guide and passenger strand expression levels and fidelity of strand cleavage. Four artificial miRNA sequences including SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 8 were selected for more in depth characterization. The ratio of guide strand to passenger strand can serve as an indicator of whether artificial miRNAs will engage the expected target (via homology between the guide and the target mRNA). Therefore, the guide strands containing the antisense seed sequence targeting SNCA were highly enriched over their respective passenger strands, constituting an average of over 99% of the total artificial miRNA sequence expressed as shown in FIG. 3A. Total RNA (including small RNA) was isolated from HeLa cells treated with the indicated sequences in triplicate. Small RNA sequencing was used to measure the number of small RNAs matching the predicted guide or passenger strand sequence. 5’ processing of the guide strand was over 99% accurate for each artificial miRNA. Specifically, each sequence tested exhibited excellent guide:passenger expression with values approaching 100% (99.11, 99.72, 99.76, 99.33 for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 8, respectively) as depicted in FIG. 3B. Values on the graph represent the mean + / - SEM of three biologic replicates with individual data points. These results suggest that strand biasing for these artificial miRNAs is highly accurate and 5’ cleavage of the artificial miRNA sequences preserves the SNCA-targeting seed sequence as designed.Example 3: Chaining of artificial miRNAs in tandem improves target SNCA mRNA reduction.

[0169] While each artificial miRNA was able to significantly reduce SNCA target when expressed as a single hairpin, it is possible to express artificial miRNAs as a tandem series all driven by one promoter, to boost expression and target reduction (Fowler, 2016). A series of modified artificial miRNA expression plasmids were designed with the CBA promoter drivingexpression of one to three copies (IX, 2X, 3X) of the artificial miRNA. The effect of linker length between hairpins was evaluated by choosing either a short 7 base pair (bp) linker nucleotide sequence, or a longer sequence (termed “130” with a 134bp linker (first) and 124bp linker (second), resulting in four variants of each single “parent” artificial miRNA (2X 7bp, 2X 130bp, 3X 7bp, and 3X 130bp). How these chained artificial miRNA plasmids compare to a single artificial miRNA expressed from the strong H 1 polymerase Ill-based promoter was also evaluated. The plasmids expressing artificial miRNAs in the indicated formats (CBA-single, Hi- single, 2X 7bp, 2X 130bp, 3X 7bp and 3X 130bp) were transfected into HeLa cells. Total RNA was isolated 2 days later to quantify SNCA target mRNA knockdown using RT-dPCR.Knockdown was assessed relative to respective control artificial miRNA plasmid expressed from the same format. SNCA RNA levels were normalized to housekeeper TBP mRNA and cells were treated with control plasmids in each respective format. Regardless of the parental artificial miRNA sequence, the 3X 130bp chaining format produced SNCA knockdown significantly greater than a single artificial miRNA expressed from either the CBA promoter or the Hl promoter as depicted in FIGS. 4A-D. Groups were compared to each other via 1 way ANOVA with repeated measures. Values represent mean+ / - SEM of 4 biologic replicates. **, ***, *** p<0.01, p<0.001, p<0.0001 respectively.Example 4: Reduction of human SNCA mRNA in vivo

[0170] Candidate artificial miRNAs were evaluated for their ability to reduce human SNCA in vivo. AAV vectors (capsid SAN006) were generated to express either the single artificial miRNA hairpin or the 3X 130bp chained variant. For in vivo studies, transgenic mice that express the entire human SNCA gene including UTRs, enabling evaluation of guides which target the 3’UTR of SNCA mRNA were used. AAV.SAN006 vectors were administered directly into the striatum (e.g., injected bilaterally into the striatum) of two-month old BAChSyn mice at 3E10 VG per hemisphere. Each artificial miRNA was tested as the CBA-driven single artificial miRNA and compared to a vector where that same artificial miRNA was expressed as three tandem repeats separated by the longer 130bp linker (“-3X” suffix). Total striatal RNA and genomic DNA was isolated to evaluate target reduction and compared to control animals injected with formulation buffer. Total RNA was isolated from striatal tissue 6 weeks post-dosing. RT- dPCR was used to quantify human SNCA mRNA levels normalized to the geometric mean of Hprt and Rpp30 housekeeper mRNAs. Each sequence, except for SEQ ID NO: 5, exhibitedevidence of potent SNCA mRNA reduction in the single and / or 3X formats as depicted in FIG. 5A. Values are graphed as fold change vs animals injected with formulation buffer. Bars represent mean+ / -SEM. FIG. 5B shows the 3X 130bp chain variant showed increased expression levels of the amiRNAs relative to the single miRNA hairpin for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 8 (x-axis). The increased expression levels of the chain variant relative to the single miRNA hairpin range from 2-fold to 10-fold.ADDITIONAL SEQUENCE LISTINGTargeting Peptide Amino Acid SequenceKGGGFHG ( SEQ ID NO : 60 )Targeting Peptide Flanked by Linkers - Amino Acid SequenceAAAKGGGFHGAS ( SEQ ID NO : 61 )SAN0006 Capsid Amino Acid Sequence (Full Structural Protein)Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15Glu Gly He Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gin Pro20 25 30Lys Ala Asn Gin Gin His Gin Asp Asn Ala Arg Gly Leu Vai Leu Pro35 40 45Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro50 55 60Vai Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80Gin Gin Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala85 90 95Asp Ala Glu Phe Gin Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly100 105 110Asn Leu Gly Arg Ala Vai Phe Gin Ala Lys Lys Arg Leu Leu Glu Pro115 120 125Leu Gly Leu Vai Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg130 135 140Pro Vai Glu Gin Ser Pro Gin Glu Pro Asp Ser Ser Ala Gly He Gly 145 150 155 160Lys Ser Gly Ala Gin Pro Ala Lys Lys Arg Leu Asn Phe Gly Gin Thr165 170 175Gly Asp Thr Glu Ser Vai Pro Asp Pro Gin Pro He Gly Glu Pro Pro180 185 190Ala Ala Pro Ser Gly Vai Gly Ser Leu Thr Met Ala Ser Gly Gly Gly195 200 205Ala Pro Vai Ala Asp Asn Asn Glu Gly Ala Asp Gly Vai Gly Ser Ser210 215 220Ser Gly Asn Trp His Cys Asp Ser Gin Trp Leu Gly Asp Arg Vai He225 230 235 240Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu245 250 255Tyr Lys Gin lie Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn260 265 270Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg275 280 285Phe His Cys His Phe Ser Pro Arg Asp Trp Gin Arg Leu He Asn Asn290 295 300Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn He305 310 315 320Gin Vai Lys Glu Vai Thr Asp Asn Asn Gly Vai Lys Thr He Ala Asn325 330 335Asn Leu Thr Ser Thr Vai Gin Vai Phe Thr Asp Ser Asp Tyr Gin Leu340 345 350Pro Tyr Vai Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro355 360 365Ala Asp Vai Phe Met He Pro Gin Tyr Gly Tyr Leu Thr Leu Asn Asp370 375 380Gly Ser Gin Ala Vai Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe385 390 395 400Pro Ser Gin Met Leu Arg Thr Gly Asn Asn Phe Gin Phe Ser Tyr Glu405 410 415Phe Glu Asn Vai Pro Phe His Ser Ser Tyr Ala His Ser Gin Ser Leu420 425 430Asp Arg Leu Met Asn Pro Leu lie Asp Gin Tyr Leu Tyr Tyr Leu Ser435 440 445Lys Thr He Asn Gly Ser Gly Gin Asn Gin Gin Thr Leu Lys Phe Ser450 455 460Vai Ala Gly Pro Ser Asn Met Ala Vai Gin Gly Arg Asn Tyr He Pro465 470 475 480Gly Pro Ser Tyr Arg Gin Gin Arg Vai Ser Thr Thr Vai Thr Gin Asn485 490 495Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn500 505 510Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys515 520 525Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu He Phe Gly530 535 540Lys Gin Gly Thr Gly Arg Asp Asn Vai Asp Ala Asp Lys Vai Met He 545 550 555 560Thr Asn Glu Glu Glu He Lys Thr Thr Asn Pro Vai Ala Thr Glu Ser565 570 575Tyr Gly Gin Vai Ala Thr Asn His Gin Ser Ala Gin Ala Ala Ala Lys580 585 590Gly Gly Gly Phe His Gly Ala Ser Ala Gin Ala Gin Thr Gly Trp Vai595 600 605Gin Asn Gin Gly He Leu Pro Gly Met Vai Trp Gin Asp Arg Asp Vai610 615 620Tyr Leu Gin Gly Pro He Trp Ala Lys He Pro His Thr Asp Gly Asn 625 630 635 640Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met Lys His Pro Pro645 650 655Pro Gin He Leu He Lys Asn Thr Pro Vai Pro Ala Asp Pro Pro Thr660 665 670Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe He Thr Gin Tyr Ser Thr675 680 685Gly Gin Vai Ser Vai Glu He Glu Trp Glu Leu Gin Lys Glu Asn Ser 690 695 700Lys Arg Trp Asn Pro Glu He Gin Tyr Thr Ser Asn Tyr Tyr Lys Ser 705 710 715 720Asn Asn Vai Glu Phe Ala Vai Asn Thr Glu Gly Vai Tyr Ser Glu Pro725 730 735Arg Pro He Gly Thr Arg Tyr Leu Thr Arg Asn Leu ( SEQ ID NO : 62 )740 745

Claims

CLAIMSWhat is claimed is:

1. An artificial miRNA comprising a first stand and a second strand, wherein(a) the first strand and second strand form a duplex;(b) the first strand comprises a guide region comprising a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14; and(c) the second strand comprises a non-guide region that comprises a nucleotide sequence that is partially complementary to the nucleotide sequence of the guide region.

2. The artificial miRNA of claim 1 , wherein the guide region comprises the sequence of SEQ ID NO: 4.

3. The artificial miRNA of claim 1, wherein the guide region comprises the sequence of SEQ ID NO: 5.

4. The artificial miRNA of claim 1 , wherein the guide region comprises the sequence of SEQ ID NO: 7.

5. The artificial miRNA of claim 1, wherein the guide region comprises the sequence of SEQ ID NO: 8.

6. The artificial miRNA of claim 1 , wherein the guide region comprises(a) the sequence of SEQ ID NO: 1 and the non-guide region comprises the sequence of SEQ ID NO: 15;(b) the sequence of SEQ ID NO: 2 and the non-guide region comprises the sequence of SEQ ID NO: 16;(c) the sequence of SEQ ID NO: 3 and the non-guide region comprises the sequence of SEQ ID NO: 17;(d) the sequence of SEQ ID NO: 4 and the non-guide region comprises the sequence of SEQ ID NO: 18;(e) the sequence of SEQ ID NO: 5 and the non-guide region comprises the sequence of SEQ ID NO: 19;(f) the sequence of SEQ ID NO: 6 and the non-guide region comprises the sequence of SEQ ID NO: 20;(g) the sequence of SEQ ID NO: 7 and the non-guide region comprises the sequence of SEQ ID NO: 21;(h) the sequence of SEQ ID NO: 8 and the non-guide region comprises the sequence of SEQ ID NO: 22;(i) the sequence of SEQ ID NO: 9 and the non-guide region comprises the sequence of SEQ ID NO: 23; j) the sequence of SEQ ID NO: 10 and the non-guide region comprises the sequence of SEQ ID NO: 24;(k) the sequence of SEQ ID NO: 11 and the non-guide region comprises the sequence of SEQ ID NO: 25;(l) the sequence of SEQ ID NO: 12 and the non-guide region comprises the sequence of SEQ ID NO: 26;(m) the sequence of SEQ ID NO: 13 and the non-guide region comprises the sequence of SEQ ID NO: 27; or(n) the sequence of SEQ ID NO: 14 and the non-guide region comprises the sequence of SEQ ID NO: 28.

7. The artificial miRNA of claim 6, wherein the guide region comprises the sequence of SEQ ID NO: 4 and the non-guide region comprises the sequence of SEQ ID NO: 18.

8. The artificial miRNA of claim 6, wherein the guide region comprises the sequence of SEQ ID NO: 5 and the non-guide region comprises the sequence of SEQ ID NO: 19.

9. The artificial miRNA of claim 6, wherein the guide region comprises the sequence of SEQ ID NO: 7 and the non-guide region comprises the sequence of SEQ ID NO: 21.

10. The artificial miRNA of claim 6, wherein the guide region comprises the sequence of SEQ ID NO: 8 and the non-guide region comprises the sequence of SEQ ID NO: 22.

11. The artificial miRNA of any one of claims 1-10, wherein the artificial miRNA targets SNCA mRNA.

12. The artificial miRNA of claim 11, wherein binding of the guide region to the coding sequence of the SNCA mRNA reduces expression of the protein SNCA.

13. An expression construct comprising a nucleic acid encoding the artificial miRNA of any one of claims 1-12.

14. The expression construct of claim 13, wherein the nucleic acid encoding the miRNA is operably linked to a promoter.

15. The expression construct of claim 13 or claim 14, wherein the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein transcription of the expression construct forms a stem-loop structure.

16. A vector comprising the expression construct of any one of claims 13-15.

17. The vector of claim 16, wherein the vector is a rAAV vector.

18. A viral particle comprising the vector of claim 16, wherein the viral particle is an AAV particle encapsidating the rAAV vector19. The viral particle of claim 18, wherein the viral particle comprises a modified AAV9 capsid protein.

20. A method of treating or preventing a synucleinopathy in a patient in need thereof, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a SNCA mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.

21. The method of claim 20, wherein the synucleinopathy is Parkinson’s Disease.

22. The method of claim 20, wherein the synucleinopathy is Multiple System Atrophy.

23. The method of claim 20, wherein the synucleinopathy is Dementia with Lewy Bodies.

24. A method of reducing SNCA expression in a patient suffering from a synucleinopathy, comprising administering to the patient a composition comprising a miRNA comprising a guide strand that binds to a SNCA mRNA and a passenger strand, wherein the guide strand comprises a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.

Citation Information

Patent Citations

  • AAV capsid library and AAV capsid proteins

    US20120066783A1

  • Adeno-associated virus virions with variant capsid and methods of use thereof

    US20120164106A1

  • Compositions and Methods for Altering Tissue Specificity and Improving AAV9-Mediated Gene Transfer

    US20130323226A1

  • CNS targeting AAV vectors and methods of use thereof

    US20140335054A1

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6566118B1