Compositions and methods of treatment with vectors having reduced or modified immunogenic profiles

Abstract

Adeno-associated viruses (AAVs) have been identified as ideal delivery vehicle for gene therapies and vaccines; however, AAV technology is limited by their immunogenic profile in humans. Disclosed herein are compositions and methods for reducing the immunogenicity of an AAV and other related nucleic acid delivery systems.

Description

[0001] COMPOSITIONS AND METHODS OF TREATMENT WITH VECTORS HAVING REDUCED OR MODIFIED IMMUNOGENIC PROFILES

[0002] STATEMENT AS TO FEDERALLY FUNDED RESEARCH

[0003] This invention was made with government support under Grant No. OD011170, awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.

[0004] SEQUENCE LISITNG

[0005] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 21 , 2025, is named “01948-293WO2_Sequence_Listing_1_21_25.xml” and is 174,272 bytes in size.

[0006] BACKGROUND

[0007] Various nucleic acid molecules, such as adeno-associated virus (AAV) vectors, are used as delivery vectors for gene therapies and vaccines. The usefulness of these vectors can be limited over time due to the development of patient anti-vector immunity responses. Both pre-existing neutralizing antibodies (NAbs) and post-administration NAbs can severely limit the expression of a vector’s transgene. Such vector immunogenicity can often prevent a patient from participating in clinical trials, limit their involvement in treatment regimens using vector-based therapies, or may necessitate the use of immunosuppression in the patient, which can result in adverse effects and may limit the possibility of follow up treatments. Attempts to reduce antibody neutralization of a viral vector by modifying the proteins presented on the surface of the viral vector can have negative effects on the vector’s tropism. Thus, there remains a need in the field to develop alternative delivery vectors having unchanged tropism and low anti-vector neutralization.

[0008] SUMMARY OF THE INVENTION

[0009] In one aspect, the disclosure features an isolated nucleic acid molecule that includes a nucleotide sequence encoding a polypeptide. In some embodiments, the encoded polypeptide includes an amino acid sequence of any one of SEQ ID NOs: 96-100. In some embodiments, the encoded polypeptide includes an amino acid sequence of any one of SEQ ID NOs: 96-100 and contains 1 or 2 amino acid substitutions (e.g., conservative substitutions) relative to any one of SEQ ID NOs: 96-100. In some embodiments, the encoded polypeptide further includes an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 80-95 (e.g., at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 80, SEQ ID NO: 81 , or SEQ ID NO: 88; 100% sequence identity to SEQ ID NO: 82 or SEQ ID NO: 87; at least 96%, 97%, 98%, 99%, 100% sequence identity to SEQ ID NO: 83; at least 99% or 100% sequence identity to SEQ ID NO: 84; at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 88; 100% sequence identity to SEQ ID NO: 89; at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 91 ; at least 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 92; and / or at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 93).

[0010] In some embodiments, the nucleotide sequence encoding the polypeptide includes: (a) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 17, or a complementary sequence thereto; (b) 100% sequence identity to SEQ ID NO: 18 or SEQ ID NO: 19, or a complementary sequence thereto; or (c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 20 or SEQ ID NO: 21 , or a complementary sequence thereto.

[0011] In some embodiments, the nucleotide sequence encoding the polypeptide includes: (a) 100% sequence identity to SEQ ID NO: 10, or a complementary sequence thereto; (b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 11 or SEQ ID NO: 12, or a complementary sequence thereto; (c) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 13, or a complementary sequence thereto; or (d) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 14, or a complementary sequence thereto.

[0012] In some embodiments, the nucleotide sequence encoding the polypeptide includes: (a) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary sequence thereto; (b) at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 3, or a complementary sequence thereto; (c) at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 4, or a complementary sequence thereto; (d) 100% sequence identity to SEQ ID NO: 8, or a complementary sequence thereto; or (e) at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 9, or a complementary sequence thereto.

[0013] In some embodiments, the nucleotide sequence encoding the polypeptide includes a region having at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a region of at least 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, 750, 1000, 1500, or 2000 contiguous nucleotides or more set forth in any one of SEQ ID NOs: 1 -5, 8, and 9, or a complementary sequence thereto.

[0014] In a further aspect, the disclosure features a recombinant vector including the isolated nucleic acid molecule of the preceding aspect. In some embodiments, the recombinant vector is a recombinant adenovirus (Ad) vector, a recombinant adeno-associated virus (rAAV) vector, a recombinant retrovirus vector, or a recombinant lentivirus vector.

[0015] In some embodiments, the vector includes a nucleotide sequence encoding a polypeptide that includes an amino acid sequence having: (a) 100% sequence identity to SEQ ID NO: 89; (b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 91 ; (c) at least 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 92; or (d) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 93.

[0016] In some embodiments, the vector includes a nucleotide sequence encoding a polypeptide that includes an amino acid sequence having: (a) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 80, SEQ ID NO: 81 , or SEQ ID NO: 88; (b) 100% sequence identity to SEQ ID NO: 82 or SEQ ID NO: 87; (c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 83; (d) at least 99% or 100% sequence identity to SEQ ID NO: 84; or (e) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 88.

[0017] In a further aspect, the disclosure features a recombinant virus (e.g., an rAAV, a recombinant adenovirus, a recombinant retrovirus, or a recombinant lentivirus). In some embodiment, the recombinant virus is an rAAV (e.g., RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, or RhAAV6674). In some embodiment, the recombinant virus (e.g., rAAV) includes (i) an AAV capsid, and (ii) the isolated nucleic acid molecule or the recombinant vector of any one of the preceding aspects.

[0018] In some embodiments, the AAV capsid of the rAAV includes a polypeptide including an amino acid sequence having: (a) 100% sequence identity to SEQ ID NO: 89; (b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 91 ; (c) at least 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 92; or (d) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 93.

[0019] In some embodiments, the AAV capsid of the rAAV includes a polypeptide including an amino acid sequence having: (a) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 80, SEQ ID NO: 81 , or SEQ ID NO: 88; (b) 100% sequence identity to SEQ ID NO: 82 or SEQ ID NO: 87; (c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 83; or (d) at least 99% or 100% sequence identity to SEQ ID NO: 84.

[0020] In a further aspect, the disclosure features a composition (e.g., a pharmaceutical composition) that includes: (a) the isolated nucleic acid molecule or complement thereof of any one of the preceding aspects; (b) the recombinant vector of any one of the preceding aspects; or (c) the rAAV of any one of the preceding aspects; and a transgene encoding a protein of interest (e.g., a therapeutic gene product or an immunogenic gene product, e.g., an antigen). In some embodiments, the composition further includes a pharmaceutically acceptable excipient or diluent.

[0021] In a further aspect, the disclosure features a method of treating a subject with a disease, the method including administering to the subject the nucleic acid molecule, the vector, the rAAV, or the composition (e.g., pharmaceutical composition) of any one of the preceding aspects. In some embodiments, the nucleic acid molecule, vector, or rAAV further includes a transgene encoding a protein of interest (e.g., a protein known to treat the disease in the subject; the disease may be, e.g., a cardiovascular disease (and the protein may be, e.g., vascular endothelial growth factor (VEGF) or heme oxygenase I (HO-1 )), an infectious disease, an autoimmune disease, a neurological disease, or the disease may be a cancer (and the protein may be, e.g., a known cancer antigen)).

[0022] In some embodiments, the subject is first administered an AAV vector (e.g., as a gene therapy or a vaccine). In some embodiments, the AAV vector is a serotype selected from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13 (or a chimeric thereof). In some embodiments, the nucleic acid molecule, the vector, the rAAV, or the composition (e.g., pharmaceutical composition) is administered intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilicaly, intraocularly, orally, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions.

[0023] In some embodiments, the subject is administered at least one dose of the nucleic acid molecule, the vector, the rAAV, and / or the composition (e.g., pharmaceutical composition). In some embodiments, the subject is administered at least two doses of the nucleic acid molecule, the vector, the rAAV, and / or the composition (e.g., pharmaceutical composition). In some embodiments, the subject is administered at least three or more (e.g., four, five, six, seven, eight, nine, ten, or more) doses of the nucleic acid molecule, the vector, the rAAV, and / or the composition (e.g., pharmaceutical composition). In some embodiments, the subject is administered the nucleic acid molecule, the vector, the rAAV, or the composition (e.g., pharmaceutical composition) as a prime boost.

[0024] In some embodiments, the disease is a cardiovascular disease. In some embodiments, the cardiovascular disease is selected from coronary artery disease, heart failure, atherosclerosis, stroke, arrhythmia, Brugada syndrome, hypertension, aortic aneurysm, vascular malformations, carotid disease, hypertrophic cardiomyopathy, idiopathic or familial dilated cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, peripheral artery disease, atrial tachycardia, supraventricular tachycardia, postphlebitic syndrome, thromboangiitis obliterans or Buerger disease, Raynaud syndrome, thoracic outlet syndrome, vasculitis, endocarditis, catecholaminergic polymorphic ventricular tachycardia, cyanotic heart disease, acyanotic heart disease, atrial septal defect, atrioventricular septal defect, coarctation of the aorta, double-outlet right ventricle, and pulmonary atresia.

[0025] In some embodiments, the disease is a neurological disease. In some embodiments, the disease is an infectious disease. In some embodiments, the disease is an autoimmune disease.

[0026] In a further aspect, the disclosure features a method of reducing or modifying immunogenicity or neutralization of a gene therapy vector, the method including administering to the subject the nucleic acid molecule, the vector, the rAAV, or the composition (e.g., pharmaceutical composition) of any one of the preceding aspects. In some embodiments, the gene therapy vector is an AAV vector (e.g., an AAV vector that was previously administered as a gene therapy). In some embodiments, the AAV vector is a serotype selected from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13 (or a chimeric thereof).

[0027] In a further aspect, the disclosure features a method of producing a recombinant AAV (rAAV), the method including transfecting a cell with (a) the isolated nucleic acid molecule or complement thereof of any one of the preceding aspects or (b) the recombinant vector of any one of the preceding aspects; culturing the cell in a suitable medium to allow replication of the nucleic acid molecule or the vector in said cell; and harvesting the rAAV from the cell and / or from the medium. In some embodiments, the cell is a bacterial cell, a plant cell, or a mammalian cell. In some embodiments, the mammalian cell is a human embryonic kidney cell.

[0028] In a further aspect, the disclosure features a kit that includes a package insert that instructs a user to perform the method of producing the rAAV, the method of treatment, or the method of reducing immunogenicity. In some embodiments, the kit includes a syringe or device for administering the nucleic acid molecule, the vector, the rAAV, or the composition (e.g., pharmaceutical composition). In some embodiments, the kit includes one or more binding molecules to detect the expression or activity of a protein of interest.

[0029] BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0031] The accompanying drawings are included to illustrate embodiments of the disclosure and further an understanding of its implementations.

[0032] FIG. 1 A is a phylogenetic tree of novel rhesus AAVs (RhAAV4284, RhAAV4302A.1 , RhAAV4302A.2, RhAAV6674, and RhAAV4302B) and contemporary AAV serotypes.

[0033] FIG. 1B is a chart displaying the capsid percent similarity between contemporary serotypes and novel AAV capsids.

[0034] FIG. 1C is a negative stain electron micrograph of the RhAAV4284 capsid packaging a luciferase transgene.

[0035] FIG. 1D is a micrograph of an in vitro transduction of cells with RhAAV4282 expressing enhanced green fluorescent protein (eGFP).

[0036] FIG. 2A is a graph of flow cytometry data depicting relative eGFP expression in HEK293T cells that were treated with different concentrations heparinase III one-hour prior to transduction with RhAAV4282-eGFP. Flow cytometry measurements were taken 72-hours following transduction.

[0037] FIG. 2B is a graph of flow cytometry data comparing eGFP expression following RhAAV4282- eGFP transduction in wildtype HEK293T cells and cytidine monophosphate N-acetylneuraminic acid synthetase (CMAS)-knock out HEK293T cells. Flow cytometry measurements were taken 72-hours following transduction.

[0038] FIG. 2C is a graph of flow cytometry data comparing eGFP expression following RhAAV4282- eGFP transduction in wildtype HeLa cells and KIAA0319L-knock out HeLa cells. Flow cytometry measurements were taken 72-hours following transduction.

[0039] FIG. 2D is a graph of differential scanning fluorimetry data comparing the stability of capsids from RhAAV4282, AAV7, and AAV9 serotypes. The derivative signal was used to determine the melting temperature of the capsid from each serotype. Horizontal lines denote the standard error of the mean for each temperature.

[0040] FIG. 3A is a graph of interferon-gamma (IFN-y) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 genome copies (GC) of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). IFN- Y concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the inter-quartile range.

[0041] FIG. 3B is a graph of interleukin-10 (IL-10) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV- luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). IL-10 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the inter-quartile range.

[0042] FIG. 3C is a graph of interferon-gamma-induced protein-10 (IP-10) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). IP-10 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the inter-quartile range.

[0043] FIG. 3D is a graph of monocyte chemoattractant protein-1 (MCP-1 ) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). MCP- 1 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the inter-quartile range.

[0044] FIG. 3E is a graph of macrophage inflammatory protein-1 -alpha (MIP-1 a) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). MIP-1 a concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the interquartile range.

[0045] FIG. 3F is a graph of macrophage inflammatory protein-2 (MIP-2) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). MIP-2 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point. Error bars represent the inter-quartile range.

[0046] FIG. 4A is a graph of viral genome detected in the indicated mouse tissues four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). DNA levels were measured via quantitative polymerase chain reaction (qPCR) and median values were analyzed via ANOVA where asterisks (****) indicate p<0.0001.

[0047] FIG. 4B is a graph of viral transcript detected in the indicated mouse tissues four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). RNA levels were measured via reverse transcriptase polymerase chain reaction (RT-PCR) and median values were analyzed via ANOVA where asterisks (****) inc|icate p<0.0001 .

[0048] FIG. 4C is a graph of relative luciferase protein expression levels in the indicated mouse tissues four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). Relative luciferase protein levels were detected by luminescence and median values were analyzed via ANOVA where asterisks (****) indicate p<0.0001 .

[0049] FIG. 4D is a set of representative images depicting the luminescence of indicated mouse tissues extracted from mice four-weeks following an intravenous injection of 5E11 GC of AAV- luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). Fifteen minutes prior to tissue extraction, mice were administered an intraperitoneal injection of luciferin. The tissues were immersed in phosphate-buffered saline (PBS) with luciferin and then imaged. Relative luminescence is shown according to the heatmap.

[0050] FIG. 4E is a set of representative images depicting the luminescence of mice four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). Nine minutes prior to imaging, mice were administered an intraperitoneal injection of luciferin. Relative luminescence is shown according to the heatmap.

[0051] FIG. 5A is an atomic modelc showing a cryo-electron microscopy (cryo-EM) reconstruction of an empty RhAAV4282 capsid to 2.57A resolution.

[0052] FIG. 5B is a schematic showing a cryo-EM reconstruction of a full RhAAV4282 capsid to 2.58A resolution.

[0053] FIG. 5C is a schematic showing a structural alignment comparing an RhAAV4282 VP3 monomer and an AAV7 VP3 monomer (Protein Databank (PDB) ID: 7L5Q). Figure inset highlights the hypervariable region IV.

[0054] FIG. 5D is a schematic showing a cryo-EM reconstruction depicting the electron density (mesh) and residues Trp280-Phe288 of the RhAAV4282 VP1 capsid monomer.

[0055] FIG. 5E is a schematic showing a cryo-EM reconstruction depicting the electron density (mesh) and residues Thr449-Arg457 of the RhAAV4282 VP1 capsid monomer.

[0056] FIG. 6A is an image showing a structural alignment comparing residues His291 -Pro294 of an RhAAV4282 VP3 monomer and residues His292-Pro295 of an AAV7 VP3 monomer (PDB ID: 7L5Q).

[0057] FIG. 6B is an image showing a structural alignment comparing residues Val712-Val717 of an RhAAV4282 VP3 monomer and residues Val716-Val721 of an AAV7 VP3 monomer (PDB ID: 7L5Q).

[0058] FIG. 6C is an image showing a structural alignment comparing residues Gln450-Arg457 of an RhAAV4282 VP3 monomer and residues Gln451 -Arg461 of an AAV7 VP3 monomer (PDB ID: 7L5Q).

[0059] FIG. 6D is an amino acid sequence alignment of AAV7 and RhAAV4282 VPI, in which hypervariable regions l-IX are indicated and denoted by bold letters. Hypervariable region IV neutralizing epitope (HRNE) is denoted by black brackets. Residues labeled A, B, and C are shown in FIGS. 6A-6C, respectively. Exact residue matches are denoted by an asterisk (*). Residues with strongly similar physicochemical properties are denoted by a colon (:). Residues with weakly similar physicochemical properties are denoted by a period (.). Residues with unsimilar physicochemical properties or where there is a deletion, have no denotation.

[0060] FIG. 7A is a graph showing the neutralization titer (NT50) data of AAV7 neutralizing antibodies detected in the serum of mice four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, AAV7, AAV7(4282L), RhAAV4282, RhAAV4282(AAV7L), and AAV9). Median values of AAV7 neutralizing antibody titers were analyzed by ANOVA, where ** is p<0.01 and **** is p<0.0001 . The dotted line denotes the limit of quantification, which was defined as two standard deviations from the mean of the sham data.

[0061] FIG. 7B is a graph showing the neutralization titer (NT50) data of RhAAV4282 neutralizing antibodies detected in the serum of mice four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, AAV7, AAV7(4282L), RhAAV4282, RhAAV4282(AAV7L) chimera, and AAV9). Median values of RhAAV4282 neutralizing antibody titers were analyzed by ANOVA, where ** is p<0.01 and **** is p<0.0001 . The dotted line denotes the limit of quantification, which was defined as two standard deviations from the mean of the sham data.

[0062] FIG. 7C is a graph showing the neutralization titer (NT50) data of AAV9 neutralizing antibodies detected in the serum of mice four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, RhAAV4282, AAV7, and AAV9). Median values of AAV9 neutralizing antibody titers were analyzed by ANOVA, where **** is p<0.0001 . The dotted line denotes the limit of quantification, which was defined as two standard deviations from the mean of the sham data.

[0063] FIG. 8A is a graph of flow cytometry data depicting relative eGFP expression in HEK293T cells that were treated with different concentrations heparinase III one-hour prior to transduction with AAV2-eGFP. Flow cytometry measurements were taken 72-hours following transduction.

[0064] FIG. 8B is a graph of flow cytometry data depicting relative eGFP expression in HEK293T cells that were treated with different concentrations heparinase III one-hour prior to transduction with AAV9-eGFP. Flow cytometry measurements were taken 72-hours following transduction.

[0065] FIG. 8C is a graph of flow cytometry data depicting relative eGFP expression in HEK293T cells that were treated with different concentrations heparinase III one-hour prior to transduction with AAV1 -eGFP. Flow cytometry measurements were taken 72-hours following transduction.

[0066] FIG. 9A is a graph of flow cytometry data comparing eGFP expression following AAV1 -eGFP transduction in wildtype and CMAS-knock out HEK393T cells. Flow cytometry measurements were taken 24 hours following transduction.

[0067] FIG. 9B is a graph of flow cytometry data comparing eGFP expression following AAV2-eGFP transduction in wildtype and CMAS-knock out HEK293T cells. Flow cytometry measurements were taken 24 hours following transduction.

[0068] FIG. 9C is a graph of flow cytometry data comparing eGFP expression following AAV9-eGFP transduction in wildtype and CMAS-knock out HEK293T cells. Flow cytometry measurements were taken 24 hours following transduction.

[0069] FIG. 9D is a graph of flow cytometry data comparing eGFP expression following RhAAV4282- eGFP transduction in wildtype and CMAS-knock out HEK293T cells. Flow cytometry measurements were taken 24 hours following transduction.

[0070] FIG. 10A is a graph of flow cytometry data comparing eGFP expression following AAV1 - eGFP transduction in wildtype and KIAA0319L-knock out HeLa cells. Flow cytometry measurements were taken 24 hours following transduction.

[0071] FIG. 10B is a graph of flow cytometry data comparing eGFP expression following AAV2- eGFP transduction in wildtype and KIAA0319L-knock out HeLa cells. Flow cytometry measurements were taken 24 hours following transduction.

[0072] FIG. 10C is a graph of flow cytometry data comparing eGFP expression following RhAAV4282-eGFP transduction in wildtype and KIAA0319L-knock out HeLa cells. Flow cytometry measurements were taken 24 hours following transduction.

[0073] FIG. 11 A is a graph of interleukin-1 -beta (IL-1 p) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV- luciferase with the indicated AAV serotype (sham, AAV7, RhAAV4282, and AAV9). IL-1 p concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point.

[0074] FIG. 11B is a graph of keratinocyte chemoattractant / growth-regulated oncogene (KC / GRO) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, AAV7, RhAAV4282, and AAV9). KC / GRO concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point.

[0075] FIG. 11C is a graph of interleukin-5 (IL-5) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV- luciferase with the indicated AAV serotype (sham, AAV7, RhAAV4282, and AAV9). IL-5 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point.

[0076] FIG. 11D is a graph of tumor necrosis factor-alpha (TNFa) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (sham, AAV7, RhAAV4282, and AAV9). TNFa concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point.

[0077] FIG. 11E is a graph of interleukin-6 (IL-6) concentrations detected in mouse serum at indicated time points over a 72-hour period following intravenous injection of 5E11 GC of AAV- luciferase with the indicated AAV serotype (sham, AAV7, RhAAV4282, and AAV9). IL-6 concentrations were measured using a commercially available mouse cytokine array. Each data point represents the median signal at each time point.

[0078] FIG. 12 is a schematic showing a structural alignment comparing an RhAAV4282 VP3 monomer, an AAV7 VP3 monomer (PDB ID: 7L5Q), and AAV9 (PDB ID: 3UX1 ). Figure inset highlights the hypervariable region IV.

[0079] FIG. 13 is a graph of relative luciferase protein expression levels in the indicated mouse tissues four-weeks following an intravenous injection of 5E11 GC of AAV-luciferase with the indicated AAV serotype (AAV7, AAV7(4282L), RhAAV4282, and RhAAV4282(AAV7L)).

[0080] FIG. 14A is a pie chart quantifying RhAAV4282, AAV7, and AAV2 neutralizing antibody titers from human serum samples. Responses were binned into the given half-maximal neutralizing antibody (nAb) titers (NT50).

[0081] FIG. 14B is a graph quantifying NAb titers from all responders. Black bars represent medians. P values represent the result of one-way ANOVA test. * = P < 0.05

[0082] FIG. 15A is a graph of eGFP expression in AAVs encoding eGFP. Briefly, eGFP was incubated with 293T cells for 72 hours. GFP positive cells were detected by FLOW cytometry. Separate biological replicates are denoted as black dots. Black lines represent group medians.

[0083] FIG. 15B is a graph of eGFP expression in AAVs encoding eGFP. Briefly, eGFP was incubated with HeLa cells for 72 hours. GFP positive cells were detected by FLOW cytometry. Separate biological replicates are denoted as black dots. Black lines represent group medians.

[0084] FIG. 15C is a graph of eGFP expression in AAVs encoding eGFP. Briefly, eGFP was incubated with A549 cells for 72 hours. GFP positive cells were detected by FLOW cytometry. Separate biological replicates are denoted as black dots. Black lines represent group medians.

[0085] FIG. 15D is a graph of eGFP expression in AAVs encoding eGFP. Briefly, eGFP was incubated with HepG2 cells for 72 hours. GFP positive cells were detected by FLOW cytometry. Separate biological replicates are denoted as black dots. Black lines represent group medians.

[0086] FIG. 15E is a graph of eGFP expression in AAVs encoding eGFP. Briefly, eGFP was incubated with AC16 cells for 72 hours. GFP positive cells were detected by FLOW cytometry. Separate biological replicates are denoted as black dots. Black lines represent group medians.

[0087] FIG. 16A is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against AAV2. Serum was diluted 2-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of Nabs.

[0088] FIG. 16B is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against AAV2. Serum was diluted 4-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of Nabs.

[0089] FIG. 17A is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against AAV7. Serum was diluted 2-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of Nabs.

[0090] FIG. 17B is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against AAV7. Serum was diluted 4-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of NAbs.

[0091] FIG. 18A is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against RhAAV4282. Serum was diluted 2-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of NAbs.

[0092] FIG. 18B is a heatmap of raw luminescence data from subjects tested for neutralizing antibody titers against RhAAV4282. Serum was diluted 4-fold per dilution and luminescence was measured at each dilution. Low luminescence indicates a high concentration of NAbs and high luminescence indicates a low concentration of Nabs. FIG. 19 is a structural overlay of an RhAAV4282 empty capsid monomer and an RhAAV4282 full capsid monomer.

[0093] FIG. 20A is a set of representative images depicting the luminescence of mice following intravenous injection of a heterologous mouse boost containing 5E11 GC of AAVs expressing eGFP. Four weeks post boost whole mouse imaging demonstrated the success of AAVs expressing luciferase.

[0094] FIG. 20B is a quantification of the whole mouse signal from FIG. 20A, with regions of interest (ROI) covering each mouse body excluding the head. Individual mice denoted as separate dots. P values represent result of one-way Mann-Whitney test * = P<0.05.

[0095] DEFINTIONS

[0096] Unless otherwise defined herein, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition.

[0097] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of "or" means "and / or" unless stated otherwise. The use of the term "including," as well as other forms, such as "includes" and "included," is not limiting.

[0098] As used herein, the term "about," as applied to one or more values of interest, refers to a value that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of a stated reference value, unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0099] By “adenovirus” or “Ad” is meant a medium-sized (90-100 nm), nonenveloped icosahedral virus that includes a capsid and a double-stranded linear DNA genome. The virus can be a naturally occurring, but isolated, virus or a recombinant virus described herein (e.g., a replication-defective or replication competent virus containing a transgene that does not naturally occur in the viral genome).

[0100] As used herein, by “administering” is meant a method of giving a dosage of a pharmaceutical composition (e.g., a nucleic acid molecule (e.g., a vector, e.g., an AAV vector) or recombinant adeno- associated virus described herein) to a subject. The compositions utilized in the methods described herein can be administered, for example, intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions. The preferred method of administration can vary depending on various factors (e.g., the components of the composition being administered and the severity of the condition being treated).

[0101] Throughout this specification and claims, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. By “deletion” of a genomic region is meant the partial or complete removal, the disruption (e.g., by an insertion mutation), or the functional inactivation (e.g., by a missense mutation) of a specified genomic region (e.g., the E1 , E2, E3, and / or E4 region), or any specific open-reading frame within the specified region.

[0102] By “heterologous nucleic acid molecule” is meant any exogenous nucleic acid molecule that can be incorporated into, for example, a nucleic acid molecule (e.g., vector) described herein, for subsequent expression of a gene product of interest, or fragment thereof, encoded by the heterologous nucleic acid molecule. In a preferred embodiment, the heterologous nucleic acid molecule encodes an antigenic or therapeutic gene product, or fragment thereof, that is a bacterial, viral, parasitic, or fungal protein, or fragment thereof (e.g., a nucleic acid molecule encoding one or more HIV or SIV Gag, Pol, Env, Nef, Tat, Rev, Vif, Vpr, or Vpu gene products, or fragments thereof). The heterologous nucleic acid molecule is one that is not normally associated with the other nucleic acid molecules found in a wild-type virus.

[0103] By “isolated” is meant separated, recovered, or purified (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% pure) from a component of its natural environment.

[0104] By “pharmaceutical composition” is meant any composition that contains a therapeutically or biologically active agent, such as a recombinant vector (e.g., an rAAV vector) described herein, preferably including a heterologous nucleotide sequence (e.g., a transgene) encoding an immunogenic or therapeutic gene product of interest, or fragment thereof, that is suitable for administration to a subject and that treats a disease or reduces or ameliorates one or more symptoms of the disease. For the purposes of this invention, pharmaceutical compositions include vaccines, and pharmaceutical compositions suitable for delivering a therapeutic or biologically active agent can include, for example, tablets, gelcaps, capsules, pills, powders, granulates, suspensions, emulsions, solutions, gels, hydrogels, oral gels, pastes, eye drops, ointments, creams, plasters, drenches, delivery devices, suppositories, enemas, injectables, implants, sprays, or aerosols. Any of these formulations can be prepared by well-known and accepted methods of art. See, for example, Flemington: The Science and Practice of Pharmacy (21sted.), ed. A.R. Gennaro, Lippincott Williams & Wilkins, 2005, and Encyclopedia of Pharmaceutical Technology, ed. J. Swarbrick, Informa Healthcare, 2006, each of which is hereby incorporated by reference.

[0105] By “pharmaceutically acceptable diluent, excipient, carrier, or adjuvant” is meant a diluent, excipient, carrier, or adjuvant which is physiologically acceptable to the subject while retaining the therapeutic properties of the pharmaceutical composition with which it is administered. One exemplary pharmaceutically acceptable carrier is physiological saline. Other physiologically acceptable diluents, excipients, carriers, or adjuvants and their formulations are known to one skilled in the art (see, e.g., U.S. Pub. No. 2012 / 0076812).

[0106] By “part,” “portion,” or “fragment,” as used interchangeably herein, is meant a less than a whole of a reference sequence. A part, portion, or fragment may comprise, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the entire length of a polynucleotide or polypeptide sequence region. For polynucleotides, for example, a part, portion, or fragment may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 15000, 20000, 25000, 30000, 35000 or more contiguous nucleotides of a reference polynucleotide molecule. For polypeptides, for example, a part, portion, or fragment may include at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, or 350 or more contiguous amino acids of a reference polypeptide molecule.

[0107] By “promotes an immune response” is meant eliciting a humoral response (e.g., the production of antibodies) or a cellular response (e.g., the activation of T cells, macrophages, neutrophils, and natural killer cells) directed against, for example, one or more infective agents (e.g., a bacterium, virus, parasite, fungus, or combination thereof) or protein targets in a subject to which the pharmaceutical composition (e.g., a vaccine) has been administered. Immune responses include both cell-mediated immune responses (i.e. , responses mediated by antigen-specific and non-specific T- cells, such as CD8+ T-cells, Th1 cells, Th2 cells, and Th17 cells) as well as humoral immune responses (i.e., responses characterized by B-cell activation and the production of antigen-specific antibodies). The term "immune response" encompasses both the innate immune responses to an antigen (e.g., a tumor-associated antigen), as well as memory responses that are a result of acquired immunity. For example, an immune response may include upregulation (e.g., upregulation by a log fold change of about +1 , +2, +3, +4, +5, +6, +7, +8, +9, +10, +11 , +12, +13, +14, or +15) or downregulation (e.g., downregulation by a log fold change of about -1 , -2, -3, -4, -5, -6, -7, -8, -9, -10, -11 , -12, -13, -14, or -15) of pro-inflammatory signaling pathways, TCR signaling pathways, BCR signaling pathways, T-help cells markers, NK cells activation markers, growth factors, T cell proliferation and differentiation markers, program cell death markers, NFKB signaling markers, STAT signaling markers, TGF-beta signaling markers, or negative immune regulators. In some instances, an immune response may include upregulation (e.g., upregulation by a log fold change of about +1 , +2, +3, +4, +5, +6, +7, +8, +9, +10, +11 , +12, +13, +14, or +15) or downregulation (e.g., downregulation by a log fold change of about -1 , -2, -3, -4, -5, -6, -7, -8, -9, -10, -11 , -12, -13, - 14, or - 15) of factors, such as, e.g., one or more of TNF-a, IL1 -a, IL1 -p, IL-2, I l-2ra, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-13, IL-15, IP10 (CXCL10), IL-12 (P40), IL-12 (P70), IL-18, Eotaxin (CCL11 ), KC (CXCL1 ), MCP-1 (CCL2), MIP-1 a (CCL3), MIP-1 b (CCL4), MIP2 (CXCL2), MIG (CXCR3), LIX (CXCL5), RANTES (CCL5), IFN-y, G-CSF, CCL19, CXCL11 , GM-CSF, CD40, CD40LG, NFATC3, NFATC4, CD28, CCR4, CD34, CD38, CD3e, CD4, CD68, CD80, CD86, CD8a, LY96, VCAM1 , C3, CD19, ICOS, TBX21 , IL-15, VEGF, CSF1 , CSF2, CSF3, BCL2, BCL2L1 , AGTR2, BAX, FAS, FASL, GZMB, LCAM1 , PRF1 , SOCS1 , SOCS2, Tnfrsfl 8, NFKB1 , NFKB2, IKBKB, Statl , Stat2, Stat3, STAT4, STAT6, SMAD3, SMAD7, TGFB1 , CTLA4, ACE, EDN1 , FN1 , H2-Ea, H2-Eb1 , LIF, LRP2, NOS2, PTGS2, PTPRC, SELE, SELP, or SKI (see, e.g., the methodology of Example 1 ). For example, the recombinant adeno-associated viruses (e.g., RhAAV4284, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, RhAAV6674, or a chimeric variant thereof containing a transgene that does not naturally occur in the viral genome) described herein may induce an immune response.

[0108] By “recombinant,” with respect to a nucleic acid molecule, polypeptide (e.g., a capsid protein), vector, or virus, is meant a nucleic acid molecule, polypeptide (e.g., a capsid protein), vector, or virus that has been manipulated in vitro, such as a vector or virus that includes a heterologous nucleotide sequence (e.g., a sequence encoding an immunogenic or therapeutic transgene) or a vector or virus bearing an alteration, disruption, or deletion in the vector or virus, such as an alteration, disruption, or deletion in a viral E1 , E3, and / or E4 region, relative to a wild-type vector or virus.

[0109] By “sequence identity” or “sequence similarity” is meant that the identity or similarity between two or more amino acid sequences, or two or more nucleotide sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of “percentage (%) identity,” wherein the higher the percentage, the more identity shared between the sequences. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similarity shared between the sequences. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity / similarity when aligned using standard methods. Sequence identity may be measured using sequence analysis software on the default setting (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wl 53705). Such software may match similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications.

[0110] A “subject” is a vertebrate, such as a mammal (e.g., primates and humans). Mammals also include, but are not limited to, farm animals (such as cows), sport animals (e.g., horses), pets (such as cats and dogs), mice, and rats. A subject to be treated according to the methods described herein (e.g., a subject having a disease such as cancer and / or a disease caused by an infective agent, e.g., a bacterium, virus, fungus, or parasite) may be one who has been diagnosed by a medical practitioner as having such a condition. Diagnosis may be performed by any suitable means. A subject in whom the development of an infection is being prevented may or may not have received such a diagnosis. One skilled in the art will understand that a subject to be treated according to the present invention may have been subjected to standard tests or may have been identified, without examination, as one at high risk due to the presence of one or more risk factors (e.g., exposure to a biological agent, such as a virus).

[0111] As used herein, and as well understood in the art, “treatment” is an approach for obtaining beneficial or desired results, such as clinical results. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease, disorder, or condition; stabilization (i.e., not worsening) of a state of disease, disorder, or condition; prevention of spread of disease, disorder, or condition; delay or slowing the progress of the disease, disorder, or condition; amelioration or palliation of the disease, disorder, or condition; and remission (whether partial or total), whether detectable or undetectable. “Palliating” a disease, disorder, or condition means that the extent and / or undesirable clinical manifestations of the disease, disorder, or condition are lessened and / or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment.

[0112] The term “vaccine,” as used herein, is defined as material used to provoke an immune response and may confer immunity after administration of the vaccine to a subject.

[0113] By “vector” is meant a composition that includes one or more genes (non-structural or structural), or fragments thereof, from a viral species, such as an adeno-associated viral species (e.g., RhAAV4284, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, or RhAAV6674), that may be used to transmit one or more heterologous genes (e.g., transgene) from a viral or non-viral source to a host or subject. The nucleic acid material of the viral vector may be encapsulated, e.g., in a lipid membrane or by structural proteins (e.g., capsid proteins), that may include one or more viral polypeptides (e.g., a glycoprotein). The viral vector can be used to infect cells of a subject, which, in turn, promotes the translation of the heterologous gene(s) of the viral vector into a protein product.

[0114] The term “virus,” as used herein, is defined as an infectious agent that is unable to grow or reproduce outside a host cell and that infects mammals (e.g., humans) or birds.

[0115] DETAILED DESCRIPTION

[0116] Described herein are compositions of matter (e.g., the nucleic acid molecules, vectors, and recombinant adeno-associated viruses (rAAVs)) and methods useful for treating or reducing the likelihood of a disease or reducing immunogenicity of a vector delivery system, such as reducing the immunogenicity of vaccine or reducing the immunogenicity of gene therapy. The present disclosure is based, at least in part, on the discovery of five rhesus adeno-associated virus (RhAAV) capsid proteins having low vector immunogenicity in mice: RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, and RhAAV6674. The complete capsid sequence of these RhAAVs, as well as the compositions generated from each is described in detail below. Advantageously, the compositions of the present disclosure (e.g., the nucleic acid molecules, vectors, polypeptides, and viruses) can serve as a potent delivery system for expressing a transgene (e.g., an immunogenic transgene or therapeutic transgene) while providing low vector immunogenicity. Moreover, the generation of recombinant compositions (e.g., recombinant nucleic acid molecules, recombinant vectors, recombinant polypeptides, and recombinant viruses) having a capsid sequence, hypervariable region IV sequence, or neutralization domain sequence described herein can lower the immunogenicity of the composition while maintaining its tropism, relative to an unmodified composition (e.g., a parental vector).

[0117] I. COMPOSITIONS

[0118] Featured herein are various compositions, such as nucleic acid molecules (e.g. vectors), polypeptides (e.g., capsid proteins), recombinant viruses (e.g., recombinant adenoviruses, recombinant AAV (rAAV), recombinant retroviruses, or recombinant lentiviruses), composition (e.g., pharmaceutical compositions) thereof (e.g., immunogenic compositions), and kits. All of these compositions are useful for the methods described in Section II.

[0119] A. Nucleic Acid Molecules

[0120] Featured are nucleic acid molecules (e.g., isolated or purified nucleic acid molecules) related to the following five RhAAVs capsids discovered by Applicant: RhAAV4282 (SEQ ID NO: 1 ), RhAAV4302A.1 (SEQ ID NO: 2), RhAAV4302A.2 (SEQ ID NO: 3), RhAAV4302B (SEQ ID NO: 4), and RhAAV6674 (SEQ ID NO: 5). In particular, the nucleic acid molecules of the disclosure relate to hypervariable sequences within the capsids of these viruses (e.g., SEQ ID NOs: 10-14), and neutralization epitopes within the hypervariable sequences of the capsids (e.g., SEQ ID NOs: 17-21 ). Each of these nucleic acid sequences are provided in Table 1 and described further below.

[0121] Underlined nucleotides indicate hypervariable region IV; bold nucleotides represent the neutralization epitope that is within the hypervariable region IV.

[0122] Table 1. Nucleic Acid Molecules

[0123]

[0124] Nucleic acid molecules (e.g., isolated or purified nucleic acid molecules) of the disclosure may include all or a portion of a nucleotide sequence encoding a capsid protein described herein. In particular, the nucleotide sequence encoding the capsid protein can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 1 -9. The isolated nucleic acid molecules described herein may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 contiguous or non-contiguous nucleotides of SEQ ID NOs: 1 -9 and have at least 90% identity (e.g., at least 91%, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 1 -9. Optionally, the nucleic acid molecule further includes 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 17-23. Alternatively, a nucleic acid molecule of the disclosure includes a naturally occurring nucleic acid molecule encoding a viral capsid protein that has been modified to include the nucleic acid molecule set forth in any one of SEQ ID NOs: 1 -9 (e.g., a surface exposed hypervariable region of the capsid protein has been replaced with the protein sequence encoded by the nucleic acid molecule set forth in any one of SEQ ID NOs: 1 -9).

[0125] Nucleic acid molecules (e.g., isolated or purified nucleic acid molecules) of the disclosure may include all or a portion of a nucleotide sequence encoding a hypervariable region of a capsid protein described herein. In particular, the nucleotide sequence encoding the hypervariable region can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 10-16. The nucleic acid molecules described herein may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, or 90 contiguous or non-contiguous nucleotides of SEQ ID NOs: 10-16 and have at least 90% identity (e.g., at least 91%, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 10-16. Optionally, the nucleic acid molecule further includes 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 17-23.

[0126] Nucleic acid molecules (e.g., isolated or purified nucleic acid molecules) of the disclosure may include all or a portion of a nucleotide sequence encoding a neutralization epitope within a hypervariable region of a capsid protein described herein. In particular, the nucleotide sequence encoding the neutralization epitope can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 17-23. The nucleic acid molecules described herein may include at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15 contiguous or non-contiguous nucleotides of SEQ ID NOs: 17-23 and have at least 90% identity (e.g., at least 91%, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 17-23.

[0127] / . Recombinant Nucleic Acid Molecules

[0128] Any of the nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may be incorporated into one or more viral vectors known in the art (e.g., an adenoviral (Ad) vector, an adeno-associated virus (AAV) vector, a retroviral vector, or a lentiviral vector) resulting in a recombinant (i.e. , a chimeric) nucleic acid molecule. For example, a nucleic acid molecule of Table 1 (e.g. any one of SEQ ID NOs: 1 -23, or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may be incorporated into any AAV vector sequence from the following serotypes: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13. By way of example, SEQ ID NO: 8 is a recombinant AAV7 capsid sequence having the neutralization epitope of SEQ ID NO: 17 incorporated into it (see Example 1 for more details).

[0129] Advantageously, incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a nucleic acid molecule that is used to produce a viral vector (e.g., modification of a viral vector known in the art to include the nucleic acid molecule of any one of SEQ ID NOs: 1 -23 or a variant thereof) can change the immune profile of a known viral vector or a component thereof encoded by the nucleic acid molecule (e.g., relative to an unmodified nucleic acid molecule). For example incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a nucleic acid molecule (e.g., viral vector) known in the art can reduce the neutralization of the viral vector or a component thereof by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, relative to the nucleic acid molecule prior to incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto). By way of example, SEQ ID NO: 8 is a nucleic acid molecule having the neutralization epitope of SEQ ID NO: 17 incorporated into it and that exhibits reduced immunogenicity (see Example 1 for more details). Reducing the immunogenicity of a viral vector or component thereof (e.g., a capsid protein) that is encoded by a nucleic acid molecule containing the region set forth in any one of SEQ ID NOs: 1 -9 provides a significant advantage over the art because it allows for re-administration of a viral vector or component thereof (e.g., a capsid protein) produced from such a nucleic acid molecule or the nucleic acid molecule to a subject with an expectation that re-administration will not provoke an immune response. Similarly, in a subject that has been previously administered a viral vector (e.g., in connection with a gene therapy regimen) that does not contain a viral component, such as a capsid protein, encoded by a nucleic acid molecule containing the region set forth in any one of SEQ ID NOs: 1 -9, modification of the originally administered viral vector to include a viral component, such as a capsid protein, encoded by a nucleic acid molecule containing the region set forth in any one of SEQ ID NOs: 1 -9, can reduce or eliminate the production of an immune response against the viral component, thereby circumventing the need to administer additional therapies to the subject, such as immunosuppression therapies. Advantageously, incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a nucleic acid molecule (e.g., a nucleic acid molecule that encodes a component of a viral vector, such as a capsid protein) known in the art significantly maintains the tropism of the viral vector (e.g., incorporating the nucleic acid molecule of any one of SEQ ID NOs: 1 -23 (or a variant thereof) into the genome of a virus used as a viral vector (e.g., for gene therapy or other purposes) does not change or reduce the ability of the modified virus to bind to and infect cells targeted by the unmodified virus). For example incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a nucleic acid molecule (e.g., a nucleic acid molecule encoding a component of a viral vector) known in the art maintains about 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the original tropism of the unmodified virus (e.g., the targeting efficiency of the modified virus is effectively unchanged). Stated otherwise, incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a nucleic acid molecule (e.g., encoding a component of a viral vector) known in the art may reduce the tropism of the viral vector (i.e. , the targeting efficiency), if at all, by only about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or, at most, 50%, relative to the unmodified virus or viral component. By way of example, SEQ ID NO: 8 is a recombinant nucleic acid molecule in which the neutralization epitope of SEQ ID NO: 17 is used in place of the corresponding region of the parental capsid protein-encoding nucleic acid molecule. This modification maintained the tropism of the unmodified capsid protein (see Example 1 for more details). Maintaining the nucleic acid molecules tropism provides a significant advantage over the art because the nucleic acid molecule can be engineered to have reduced immunogenicity with minimal effects on its targeting ability.

[0130] Any of the nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may further include one or more heterologous nucleotide sequences obtained from one or more viral vectors known in the art (e.g., an AAV vector, a retroviral vector, or a lentiviral vector) resulting in a recombinant (i.e., a chimeric) nucleic acid molecule. For example, the heterologous nucleotide sequence(s) may be obtained from one or more AAV vectors known in the art (e.g., any AAV vector from the following serotypes: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13). Exemplary heterologous nucleotide sequences obtained from a viral vector include, but are not limited to: an inverted terminal repeat (ITR), a Rep protein (e.g., Rep78, Rep68, Rep52, Rep40), a Cap protein (e.g., VP1 , VP2, VP3, and / or assembly-activating protein (AAP)), a hypervariable region, a neutralization epitope, or some variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto. By way of example, SEQ ID NO: 9 is a recombinant RhAAV4282 capsid having a neutralization epitope of AAV7 (SEQ ID NO: 22) incorporated into it (see Example 1 for more details).

[0131] Any of the nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may further include a nucleotide sequence encoding a transgene (e.g., a therapeutic transgene or an immunogenic transgene), resulting in a recombinant (e.g., a chimeric) nucleic acid molecule.

[0132] Exemplary transgenes are provided below; however, one of skill in the art could choose any suitable transgene for use in a method described herein. For example, the nucleic acid molecule may include a therapeutic transgene for use in a method of treating, preventing, ameliorating, inhibiting the progression of, or reducing the severity of one or more symptoms of a disease (e.g., a cardiovascular disease, a cancer, an infectious disease, an autoimmune disease, or a neurological disease) in a subject (e.g., a human). The disease could be, for example, a cardiovascular disease and the therapeutic transgene encoded by the nucleic acid molecule could be, for example, vascular endothelial growth factor (VEGF) and / or Heme Oxygenase I (HO-1 ). In another example, the nucleic acid molecule may include an immunogenic transgene for use in a method of treating, preventing, ameliorating, inhibiting the progression of, or reducing the severity of one or more symptoms of a disease (e.g., a cardiovascular disease, a cancer, an infectious disease, an autoimmune disease, or a neurological disease) or a disease caused by an infective agent (e.g., AIDS, tuberculosis, etc.) in a subject (e.g., a human). In yet another example, the nucleic acid molecule may include a transgene encoding an antibody (e.g., a single-domain antibody, e.g., a NANOBODY®). For example, an antibody (e.g., a bnAb or a single-domain antibody, e.g., a NANOBODY®) could target an immune molecule (e.g., TNFa) for treatment of and inflammatory or autoimmune disease. Such methods are described in Section II below.

[0133] Any of the nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may further include a promoter sequence to drive expression of a transgene (e.g., a therapeutic transgene or an immunogenic transgene). Exemplary promoters that are useful for the expression of a transgene include, but are not limited to, a synapsin (Syn) promoter, a chicken p-actin promoter with cytomegalovirus enhancer elements (CB7), a tetracycline-controlled transactivator protein (tTA) promoter, an upstream activating sequence (UAS) promoter, a homeobox protein 9 (HB9) promoter, a CD68 molecule (CD68) promoter, a platelet-derived growth factor beta chain promoter, a reverse tetracycline-controlled transactivator protein (rTA) promoter, a U1 promoter, a U6 promoter, and a U7 promoter.

[0134] / ' / . Therapeutic Transgenes

[0135] The nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may include a therapeutic transgene encoding a gene product (e.g., a protein, an antibody (e.g., a bnAb or a single-domain antibody, e.g., a NANOBODY®)), or an inhibitory nucleic acid, such as an siRNA, miRNA, or shRNA), or fragment thereof (e.g., a transgene can be incorporated into a genome of a viral vector that also includes a nucleic acid molecule of the present disclosure). For example, a therapeutic transgene may encode VEGF, HO-1 , interferon (IFN) proteins, dystrophin (or a variant thereof, e.g., microdystrophin), Factor VIII (FVIII), Factor IX (FIX), erythropoietin (EPO), alpha-1 antitrypsin (SERPINA1 ), calcitonin, glucocerebrosidase (GBA), growth hormone (GH), growth hormone receptor (GHR), low density lipoprotein (LDL), interleukin-2 (IL2) receptor (IL2R, e.g., IL2RA, IL2RB, and IL2RG) and its antagonists, insulin (IRS1), globin, immunoglobulins, catalytic antibodies, the interleukins (IL), insulin-like growth factors (IGF, e.g., IGF1 , IGF1 R, IGFBP1 , IGF2, and IGF2R), superoxide dismutase (SOD, e.g., SOD1 , SOD2, and SOD3), immune responder modifiers, parathyroid hormone and interferon, nerve growth factors, tissue plasminogen activators, and / or colony stimulating factors (see, e.g., U.S. Pat. No. 6,054,288, incorporated by reference herein). For example, the IFN protein has an amino acid sequence substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of a human IFN-a (e.g., IFN-a -1 a, IFN-a -1 b, IFN-a-2a, IFN-a-2b, and consensus IFN-a (conIFN-a)), a human IFN-p (e.g., IFN-p-1 a and IFN-p-1 b), a human IFN-y), or an IFN-T or a polypeptide that demonstrates the same or similar biological activity to an interferon (e.g., at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of a human IFN-a, a human IFN-p, a human IFN-y, an IFN-T, or a conIFN-a (see, e.g., U.S. Pat. No. 4,695,623 and U.S. Pub. No. 2011 / 0000480, incorporated by reference herein, for examples of specific IFN sequences). Any transgene known in the art for treating a particular disease is envisioned for use with the methods described herein. For example, the aforementioned therapeutic transgenes, as well as additional therapeutic transgenes, for use in treating particular diseases are provided in Table 2.

[0136] In some embodiments, the methods described herein are directed to treating a metabolic disorder, a blood disorder, a cardiovascular disorder, a neurological disorder, an ocular or ophthalmological disorder, a reproductive disorder, an infectious disease, an autoimmune or immunological disorder, or a type of cancer. Exemplary transgenes for cloning into the nucleic acid molecules described here, as well as the disease to be treated by the transgene, are provided in Table 2.

[0137] Table 2: Exemplary Transgenes for treating Disease

[0138]

[0139]

[0140]

[0141] In some particular instances, the therapeutic gene products may be a cancer antigen (e.g., a neoantigen) or tumor-associated antigen (TAA). TAAs include protein antigens that are overexpressed on the surface of a cancer cell relative to a non-cancerous cell, as well as proteins that arise from mutations of wild-type proteins. A TAA may be tumor-specific, in which case the expression of the antigen is restricted to a particular type of cancer cell. Alternatively, a TAA may be common to several cancers and thus expressed on the surface of a variety of cancer cell types. TAAs that can be expressed by any adenovirus described herein include an ovarian cancer TAA, a breast cancer TAA, a testicular cancer TAA, a pancreatic cancer TAA, a liver cancer TAA, a colorectal cancer TAA, a thyroid cancer TAA, a lung cancer TAA, a prostate cancer TAA, a kidney cancer TAA, a melanoma TAA, a squamous cell carcinoma TAA, a chronic myeloid leukemia TAA, an acute lymphoblastic leukemia TAA, an acute myelogenous leukemia TAA, a chronic lymphocytic leukemia TAA, a promyelocytic leukemia TAA, a multiple myeloma TAA, a B cell lymphoma TAA, a bladder carcinoma TAA, a head and neck cancer TAA, an esophageal cancer TAA, a brain cancer TAA, a pharynx cancer TAA, a tumor of the tongue TAA, a synovial cell sarcoma TAA, a neuroblastoma TAA, or a uterine cancer TAA. Examples of TAAs are known in the art and are described, e.g., in Reuschenbach et al., Cancer Immunol. Immunother. 58:1535-1544 (2009); Parmiani et al., J. Nat. Cancer Inst. 94:805-818 (2002); Zarour et al., Cancer Medicine. (2003); Bright et al., Hum. Vaccin. Immunother. 10:3297-3305 (2014); Wurz et al., Ther. Adv. Med. Oncol. 8:4-31 (2016); Criscitiello, Breast Care 7:262-266 (2012); Chester et al., J. Immunother. Cancer3:7 (2015); Li et al., Mol. Med. Report 1 :589-594 (2008); Liu et al., J. Hematol. Oncol. 3:7 (2010); Bertino et al., Biomed. Res. Int. 731469 (2015); and Suri et al., World J. Gastrointest. Oncol. 7:492-502 (2015), the disclosures of each of which are incorporated herein by reference in their entirety.

[0142] In some instances, the therapeutic gene product may be a neoantigen, which may be used to treat a cancer or a viral infection. In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., E6 and / or E7) from human papillomavirus (HPV). The oncogenic antigen (e.g., E6 and / or E7) from HPV may be cloned into a nucleic acid molecule described herein (e.g., a nucleic acid molecule of Table 1 , or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) for the treatment of a cancer or a viral infection (e.g., an HPV infection). In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., EBNA1 , EBNA2, EBNA3A, EBNA3B, EBNA3C, and / or LP) from Epstein-Barr virus (EBV). The oncogenic antigen (e.g., EBNA1 , EBNA2, EBNA3A, EBNA3B, EBNA3C, and / or LP) from EBV may be cloned into a nucleic acid molecule described herein (e.g., a nucleic acid molecule of Table 1 , or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) for the treatment of a cancer or a viral infection (e.g., an EBV infection). In some instances, the therapeutic gene product may be an oncolytic agent, such as an oncolytic viral treatment (e.g., IMLYGIC®), which may be used to treat a cancer or a viral infection (e.g., an HPV or EBV infection).

[0143] Hi. Immunogenic Transgenes

[0144] The nucleic acid molecule or vector of a recombinant virus (e.g., recombinant adenovirus, recombinant AAV, recombinant retrovirus, or recombinant lentivirus) may include an immunogenic transgene encoding a gene product, or fragment thereof. For example, an immunogenic transgene may encode a bacterial, viral, parasitic, or fungal protein, or fragment thereof. When expressed in a host, or host cells, as an antigen, the immunogenic transgene is capable of eliciting an immune response (e.g., a B cell or T cell response).

[0145] An immunogenic transgene may encode a bacterial protein (e.g., an antigen), or fragment thereof, derived from Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium leprae, Pseudomonas aeruginosa, Salmonella typhimurium, Escherichia coli, Klebsiella pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus, Francisella tularensis, Brucella, Burkholderia mallei, Yersinia pestis, Corynebacterium diphtheria, Neisseria meningitidis, Bordetella pertussis, Clostridium tetani, or Bacillus anthracis. Non-limiting examples of bacterial gene products, or fragments thereof, include 10.4, 85A, 85B, 86C, CFP-10, Rv3871 , and ESAT-6 gene products, or fragments thereof, of Mycobacterium; O, H, and K antigens, or fragments thereof, of E. coli; and protective antigen (PA), or fragments thereof, of Bacillus anthracis.

[0146] An immunogenic transgene may encode a viral protein (e.g., an antigen), or fragment thereof, derived from a virus of a viral family selected from the group consisting of Retroviridae, Flaviviridae, Arenaviridae, Bunyaviridae, Filoviridae, Togaviridae, Poxviridae, Herpesviridae, Orthomyxoviridae, Coronaviridae, Rhabdoviridae, Paramyxoviridae, Picornaviridae, Hepadnaviridae, Papillomaviridae, Parvoviridae, Astroviridae, Polyomaviridae, Calciviridae, and Reoviridae. The virus may be human immunodeficiency virus (HIV), human papillomavirus (HPV), hepatitis A virus (Hep A), hepatitis B virus (HBV), hepatitis C virus (HCV), Variola major, Variola minor, monkeypox virus, measles virus, rubella virus, mumps virus, varicella zoster virus (VZV), poliovirus, rabies virus, Japanese encephalitis virus, herpes simplex virus (HSV), cytomegalovirus (CMV), rotavirus, influenza, Ebola virus, yellow fever virus, Zika virus, or Marburg virus. Non-limiting examples of viral gene products, or fragments thereof, include Gag, Pol, Nef, Tat, Rev, Vif, Vpr, or Vpu, or fragments thereof, of HIV and other retroviruses (see, e.g., U.S. Pub. No. 2012 / 0076812, incorporated by reference herein); 9D antigen, or fragments thereof, of HSV; Env, or fragments thereof, of all envelope protein-containing viruses. For example, the viral protein, or fragment thereof, may be an Env protein or a structured protein. In a particular example, the viral protein may be an HIV or Zika virus Env protein. The viral protein may also be a Gag, Pol, Env, Nef, Tat, Rev, Vif, Vpr, or Vpu protein, e.g., of a virus (e.g., HIV).

[0147] An immunogenic transgene may encode a parasitic protein (e.g., an antigen), or fragment thereof, may be from Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Trypanosoma spp., or Legionella spp. Non-limiting examples of parasitic gene products, or fragments thereof, include circumsporozoite (CS) protein, gamete surface proteins Pfs230 and Pfs48 / 45, and Liver Specific Antigens 1 or 3 (LSA-1 or LSA-3), or fragments thereof, of Plasmodium falciparum.

[0148] An immunogenic transgene may encode a fungal protein (e.g., an antigen), or fragment thereof, may be from Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum var. capsulatum, Paracoccidioides brasiliensis, Sporothrix schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomucor pusillus, or Rhizopus arrhizus. Non-limiting examples of fungal gene products, or fragments thereof, include any cell wall mannoprotein (e.g., Afmpl of Aspergillus fumigatus) or suface-expressed glycoprotein (e.g., SOWgp of Coccidioides immitis).

[0149] B. Vectors

[0150] The present disclosure also features vectors that include any one or more of the nucleic acid molecules described above (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto). Vectors of the disclosure may include all or a portion of a nucleotide sequence that is encoding a capsid protein described herein. In particular, the vector’s nucleotide sequence that is encoding the capsid protein can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 1 -9. The vector may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 contiguous or non-contiguous nucleotides of SEQ ID NOs: 1 - 9 and have at least 90% identity (e.g., at least 91 %, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 1 -9.

[0151] Vectors of the disclosure may include all or a portion of a nucleotide sequence encoding a hypervariable region of a capsid protein described herein. In particular, the vector’s nucleotide sequence encoding the hypervariable region can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 10-16. The vector may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, or 90 contiguous or non-contiguous nucleotides of SEQ ID NOs: 10-16 and have at least 90% identity (e.g., at least 91%, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 10-16. Optionally, the nucleic acid molecule includes 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1 -9

[0152] Vectors of the disclosure may also include all or a portion of a nucleotide sequence encoding a neutralization epitope within a hypervariable region of a capsid protein described herein. In particular, the nucleotide sequence of the vector that encodes the neutralization epitope can be at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 17-23. The vector may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, or 90 contiguous or non-contiguous nucleotides of any one or more of SEQ ID NOs: 17-23 and have at least 90% identity (e.g., at least 91%, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 17-23. Optionally, the nucleic acid molecule further includes 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1 -9.

[0153] / . Recombinant Vectors

[0154] Any of the nucleic acid molecules described above (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may be incorporated into one or more viral vectors known in the art (e.g., an AAV vector, a retroviral vector, or a lentiviral vector) resulting in a recombinant (e.g., a chimeric) vector. For example, a nucleic acid molecule of Table 1 (e.g. any one of SEQ ID NOs: 1 -23, or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) may be incorporated into the genome (e.g., the nucleic acid molecule can replace the endogenous nucleic acid molecule) of any AAV vector from the following serotypes: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13. By way of example, SEQ ID NO: 8 is a recombinant AAV7 capsid containing the neutralization epitope of SEQ ID NO: 17 in place of the naturally occurring hypervariable region IV neutralization epitope of the AAV7 capsid (SEQ ID NO: 22) (see Example 1 for more details).

[0155] Advantageously, incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral component (e.g., a capsid protein) of a viral vector known in the art can change the immune profile a vector-based gene therapy (e.g., a vector expressing a transgene) such that a nearly identical vector-based gene therapy (e.g., a viral vector, e.g., an AAV vector) can be administered. The resulting recombinant vector can be provided as the therapeutic treatment because the recombinant vector will have a different immune profile in the subject (e.g., the subject will generate fewer nAbs against the recombinant vector or the recombinant vector will evade existing immune responses (e.g., nAbs)). Thus, described herein are vectors useful for reducing the immunogenicity of a gene therapy vector, modifying the immunogenicity of a gene therapy vector, reducing the neutralization (e.g., by a subject’s immune system) of a gene therapy vector, and / or modifying the neutralization of a gene therapy vector (e.g., reducing or modifying the immunogenicity or neutralization of the gene therapy vector relative to the naturally occurring or unmodified version of the gene therapy vector). Additionally, incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral component (e.g., a capsid protein) of a viral vector known in the art will also have minimal effect on the vector’s tropism (e.g., ability to target a tissue or cell in a tissue). For example incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral vector known in the art can reduce the neutralization of the viral vector in a subject by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, relative to the vector prior to incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto). By way of example, SEQ ID NO: 8 is a recombinant AAV7 capsid having the neutralization epitope of SEQ ID NO: 17 incorporated into it. The AAV7 containing the modified capsid protein exhibits reduced neutralization (see Example 1 for more details) relative to the unmodified AAV7. Reducing the immunogenicity and / or neutralization of a viral vector provides a significant advantage over the state of the art because it allows for re-administration of a nearly identical vector to a subject that, for example, has recently acquired anti-vector immunity against the unmodified vector, thereby circumventing the need to identify or implement additional therapies in the subject (e.g., immunosuppressive therapies or the selection of a different gene therapy vector).

[0156] Advantageously, incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral vector known in the art (e.g., by replacing the endogenous or naturally occurring capsid protein sequence with all or a portion of any one of SEQ ID NOs: 1 -23 or a variant thereof) significantly maintains the tropism of the known (e.g., unmodified) viral vector. For example incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral vector known in the art maintains about 50%, 55%, 60%, 65% 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of its original tropism (e.g., thereby maintaining the targeting efficiency of the modified viral vector relative to the unmodified viral vector). Stated otherwise, incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a viral vector known in the art may reduce the tropism of the known vector (i.e., the vectors targeting efficiency) by only about 0%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or, at most, 50%, relative to the vector prior to incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto). By way of example, SEQ ID NO: 8 is a recombinant AAV7 that has been modified to contain a nucleic acid molecule of SEQ ID NO: 17 encoding a neutralization epitope of the capsid protein. The tropism of the modified AAV7 is significantly maintained (see Example 1 for more details). Maintaining the tropism of a vector provides a significant advantage over the art because the vector can be engineered to have reduced immunogenicity with minimal effects on its targeting ability.

[0157] Vectors of the disclosure may further include one or more heterologous nucleotide sequences obtained from one or more viral vectors known in the art (e.g., an AAV vector, a retroviral vector, or a lentiviral vector) resulting in a recombinant (i.e., a chimeric) vector. For example, the heterologous nucleotide sequence(s) may be obtained from one or more AAV vectors known in the art (e.g., any AAV vector from the following serotypes: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13). Exemplary heterologous nucleic acid molecules obtained from a viral vector include those that encode an inverted terminal repeat (ITR), a Rep protein (e.g., Rep78, Rep68, Rep52, Rep40) and / or a Cap protein (e.g., VP1 , VP2, VP3, and / or AAP), a hypervariable region, a neutralization epitope, or some variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto. By way of example, SEQ ID NO: 9 is a recombinant RhAAV4282 capsid having the neutralization epitope of AAV7 (SEQ ID NO: 22) incorporated into it (see Example 1 for more details).

[0158] Vectors of the disclosure may further include a nucleotide sequence encoding a transgene (e.g., a therapeutic transgene or an immunogenic transgene), resulting in a recombinant (i.e., a chimeric) vector. Exemplary transgenes are provided below; however, one of skill in the art could choose any suitable transgene for use in a method described herein. For example, the vector may include a therapeutic transgene for use in a method of treating, preventing, ameliorating, inhibiting the progression of, or reducing the severity of one or more symptoms of a disease (e.g., a cardiovascular disease, a cancer, an infectious disease, an autoimmune disease, or a neurological disease) in a subject (e.g., a human). The disease could be, for example, a cardiovascular disease and the therapeutic transgene encoded by the nucleic acid molecule could be, for example, VEGF and / or HO- 1 . In another example, the vector may include an immunogenic transgene for use in a method of treating, preventing, ameliorating, inhibiting the progression of, or reducing the severity of one or more symptoms of a disease (e.g., cancer) or a disease caused by an infective agent (e.g., AIDS, tuberculosis, etc.) in a subject (e.g., a human). Such methods are described in Section II below.

[0159] Vectors of the disclosure may further include a promoter sequence to drive expression of a transgene (e.g., a therapeutic transgene or an immunogenic transgene). Exemplary promoters that are useful for the expression of a transgene include, but are not limited to, a Syn promoter, a CB7 promoter, a tTA promoter, a UAS promoter, an HB9 promoter, a CD68 promoter, a platelet-derived growth factor beta chain promoter, an rTA promoter, a U1 promoter, a U6 promoter, and a U7 promoter.

[0160] Vectors of the disclosure can be used in conjunction with one or more other vectors (e.g., 1 , 2, 3, or more vectors) described herein as a vector system, which can be used to generate recombinant replication-defective AAVs (rdsAAVs) or replication-competent AAVs (rcsAAVs). The vectors described herein may contain the E1 region for the purposes of producing rcsRhAAVs. The vectors described herein may contain a transgene (e.g., a therapeutic transgene or immunogenic transgene), which can replace or disrupt all or a portion of the E1 region in a vector. The E1 region can be deleted (either partially or completely), disrupted, or rendered inactive by one or more mutations.

[0161] Recombinant vectors may contain additional sequence elements used for the expression of proteins and / or the integration of these polynucleotide sequences into the genome of a mammalian cell. Certain vectors that can be used for the expression of transgenes (e.g., therapeutic transgenes or immunogenic transgenes) described herein include plasmids that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription. Other useful vectors for expression of transgenes contain polynucleotide sequences that enhance the rate of translation of these genes or improve the stability or nuclear export of the mRNA that results from gene transcription. These sequence elements include, e.g., 5’ and 3’ untranslated regions, an internal ribosomal entry site (IRES), and polyadenylation signal site in order to direct efficient transcription of the gene carried on the vector. The vectors described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0162] / . Therapeutic Transgenes

[0163] Vectors of the disclosure may include a therapeutic transgene encoding a gene product (e.g., a protein, an antibody (e.g., a bnAb or a single-domain antibody, e.g., a NANOBODY®)), or an inhibitory nucleic acid, such as an siRNA, miRNA, or shRNA), or fragment thereof. For example, a therapeutic transgene may encode VEGF, HO-1 , IFN proteins, dystrophin (or a variant thereof, e.g., microdystrophin), Factor VIII, Factor IX, erythropoietin, alpha-1 antitrypsin, calcitonin, glucocerebrosidase, growth hormone, LDL, receptor IL-2 receptor and its antagonists, insulin, globin, immunoglobulins, catalytic antibodies, the interleukins, insulin-like growth factors, superoxide dismutase, immune responder modifiers, parathyroid hormone and interferon, nerve growth factors, tissue plasminogen activators, and / or colony stimulating factors (see, e.g., U.S. Pat. No. 6,054,288, incorporated by reference herein). For example, the IFN protein has an amino acid sequence substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of a human IFN-a (e.g., IFN-a -1 a, IFN-a -1 b, IFN-a-2a, IFN-a-2b, and conIFN-a), a human IFN-p (e.g., IFN-p-1 a and IFN-p-1 b), a human IFN-y), or an IFN-T or a polypeptide that demonstrates the same or similar biological activity to an interferon (e.g., at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of a human IFN-a, a human IFN- p, a human IFN-y, an IFN-T, or a conIFN-a (see, e.g., U.S. Pat. No. 4,695,623 and U.S. Pub. No. 2011 / 0000480, incorporated by reference herein, for examples of specific IFN sequences).

[0164] Any transgene known in the art for treating a particular disease is envisioned for use with the methods described herein. For example, the aforementioned therapeutic transgenes, as well as additional therapeutic transgenes, for use in treating particular diseases are provided in Table 2.

[0165] In some embodiments, the methods described herein are directed to treating a metabolic disorder, a blood disorder, a cardiovascular disorder, a neurological disorder, an ocular or ophthalmological disorder, a reproductive disorder, an infectious disease, an autoimmune or immunological disorder, or a type of cancer. Exemplary transgenes for cloning into the nucleic acid molecules described here, as well as the disease to be treated by the transgene, are provided in Table 2.

[0166] In some particular instances, the therapeutic gene products may be a cancer antigen (e.g., a neoantigen) or TAA. TAAs include protein antigens that are overexpressed on the surface of a cancer cell relative to a non-cancerous cell, as well as proteins that arise from mutations of wild-type proteins. A TAA may be tumor-specific, in which case the expression of the antigen is restricted to a particular type of cancer cell. Alternatively, a TAA may be common to several cancers and thus expressed on the surface of a variety of cancer cell types. TAAs that can be expressed by any virus described herein include an ovarian cancer TAA, a breast cancer TAA, a testicular cancer TAA, a pancreatic cancer TAA, a liver cancer TAA, a colorectal cancer TAA, a thyroid cancer TAA, a lung cancer TAA, a prostate cancer TAA, a kidney cancer TAA, a melanoma TAA, a squamous cell carcinoma TAA, a chronic myeloid leukemia TAA, an acute lymphoblastic leukemia TAA, an acute myelogenous leukemia TAA, a chronic lymphocytic leukemia TAA, a promyelocytic leukemia TAA, a multiple myeloma TAA, a B cell lymphoma TAA, a bladder carcinoma TAA, a head and neck cancer TAA, an esophageal cancer TAA, a brain cancer TAA, a pharynx cancer TAA, a tumor of the tongue TAA, a synovial cell sarcoma TAA, a neuroblastoma TAA, or a uterine cancer TAA. Examples of TAAs are known in the art and are described, e.g., in Reuschenbach et al., Cancer Immunol. Immunother. 58:1535-1544 (2009); Parmiani et al., J. Nat. Cancer Inst. 94:805-818 (2002); Zarour et al., Cancer Medicine. (2003); Bright et al., Hum. Vaccin. Immunother. 10:3297-3305 (2014); Wurz et al., Ther. Adv. Med. Oncol. 8:4-31 (2016); Criscitiello, Breast Care 7:262-266 (2012); Chester et al., J. Immunother. Cancer3:7 (2015); Li et al., Mol. Med. Report s :589-594 (2008); Liu et al., J. Hematol. Oncol. 3:7 (2010); Bertino et al., Biomed. Res. Int. 731469 (2015); and Suri et al., World J. Gastrointest. Oncol. 7:492-502 (2015), the disclosures of each of which are incorporated herein by reference in their entirety.

[0167] In some instances, the therapeutic gene product may be a neoantigen. In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., E6 and / or E7) from human papillomavirus (HPV). In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., EBNA1 , EBNA2, EBNA3A, EBNA3B, EBNA3C, and / or LP) from Epstein-Barr virus (EBV). In some instances, the therapeutic gene product may be an oncolytic agent, such as an oncolytic viral treatment (e.g., IMLYGIC®). / ' / . Immunogenic Transgenes

[0168] Vectors of the disclosure may include an immunogenic transgene encoding a gene product, or fragment thereof. For example, an immunogenic transgene may encode a bacterial, viral, parasitic, or fungal protein, or fragment thereof. When expressed in a host, or host cells, as an antigen, the immunogenic transgene is capable of eliciting an immune response (e.g., a B cell or T cell response).

[0169] An immunogenic transgene may encode a bacterial protein (e.g., an antigen), or fragment thereof, derived from Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium leprae, Pseudomonas aeruginosa, Salmonella typhimurium, Escherichia coli, Klebsiella pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus, Francisella tularensis, Brucella, Burkholderia mallei, Yersinia pestis, Corynebacterium diphtheria, Neisseria meningitidis, Bordetella pertussis, Clostridium tetani, or Bacillus anthracis. Non-limiting examples of bacterial gene products, or fragments thereof, include 10.4, 85A, 85B, 86C, CFP-10, Rv3871 , and ESAT-6 gene products, or fragments thereof, of Mycobacterium; O, H, and K antigens, or fragments thereof, of E. coli and protective antigen (PA), or fragments thereof, of Bacillus anthracis.

[0170] An immunogenic transgene may encode a viral protein (e.g., an antigen), or fragment thereof, derived from a virus of a viral family selected from the group consisting of Retroviridae, Flaviviridae, Arenaviridae, Bunyaviridae, Filoviridae, Togaviridae, Poxviridae, Herpesviridae, Orthomyxoviridae, Coronaviridae, Rhabdoviridae, Paramyxoviridae, Picornaviridae, Hepadnaviridae, Papillomaviridae, Parvoviridae, Astroviridae, Polyomaviridae, Calciviridae, and Reoviridae. The virus may be human immunodeficiency virus (HIV), human papillomavirus (HPV), hepatitis A virus (Hep A), hepatitis B virus (HBV), hepatitis C virus (HCV), Variola major, Variola minor, monkeypox virus, measles virus, rubella virus, mumps virus, varicella zoster virus (VZV), poliovirus, rabies virus, Japanese encephalitis virus, herpes simplex virus (HSV), cytomegalovirus (CMV), rotavirus, influenza, Ebola virus, yellow fever virus, Zika virus, or Marburg virus. Non-limiting examples of viral gene products, or fragments thereof, include Gag, Pol, Nef, Tat, Rev, Vif, Vpr, or Vpu, or fragments thereof, of HIV and other retroviruses (see, e.g., U.S. Pub. No. 2012 / 0076812, incorporated by reference herein); 9D antigen, or fragments thereof, of HSV; Env, or fragments thereof, of all envelope protein-containing viruses. For example, the viral protein, or fragment thereof, may be an Env protein or a structured protein. In a particular example, the viral protein may be an HIV or Zika virus Env protein. The viral protein may also be a Gag, Pol, Env, Nef, Tat, Rev, Vif, Vpr, or Vpu protein of a virus (e.g., HIV).

[0171] An immunogenic transgene may encode a parasitic protein (e.g., an antigen), or fragment thereof, may be from Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Trypanosoma spp., or Legionella spp. Non-limiting examples of parasitic gene products, or fragments thereof, include circumsporozoite (CS) protein, gamete surface proteins Pfs230 and Pfs48 / 45, and Liver Specific Antigens 1 or 3 (LSA-1 or LSA-3), or fragments thereof, of Plasmodium falciparum.

[0172] An immunogenic transgene may encode a fungal protein (e.g., an antigen), or fragment thereof, may be from Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum var. capsulatum, Paracoccidioides brasiliensis, Sporothrix schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomucor pusillus, or Rhizopus arrhizus. Non-limiting examples of fungal gene products, or fragments thereof, include any cell wall mannoprotein (e.g., Afmpl of Aspergillus fumigatus) or 54simert-expressed glycoprotein (e.g., SOWgp of Coccidioides immitis).

[0173] C. Polypeptides

[0174] The present disclosure also features polypeptides (e.g., capsid proteins, hypervariable regions of such capsid proteins, and neutralization domains of a hypervariable region of a capsid protein). Such polypeptides may be encoded by any one or more of the nucleic acid molecules described herein (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%,

[0175] 95%, 96%, 97%, 98%, 99% thereto) or any one or more of the vectors described above. Such polypeptides may be present in the capsid of a virus described herein (e.g., an adeno-associated virus or an adenovirus). For example, they may be used in place of a naturally occurring or endogenous capsid protein of a recombinant virus described herein. Exemplary polypeptides (e.g., capsid proteins) are provided in Table 3 and described further below. Underlined amino acids indicate hypervariable region IV; bold amino acids represent the neutralization epitope.

[0176] Table 3. Polypeptides of the disclosure

[0177]

[0178]

[0179] | | | Region IV) |

[0180] Polypeptides of the disclosure may include all or a portion of a capsid protein described herein. In particular, the amino acid sequence of the polypeptide can be at least 90% identical (e.g., at least 91 %, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 80-88. The polypeptides described herein may include at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, or 700 contiguous or non-contiguous amino acids of any one of SEQ ID NOs: 80-88 and have at least 90% identity (e.g., at least 91 %, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 80-88. Optionally, the polypeptide includes 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 96-102.

[0181] Polypeptides of the disclosure may include all or a portion of a hypervariable region of a capsid protein described herein. In particular, the polypeptide’s amino acid sequence can be at least 90% identical (e.g., at least 91 %, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: SOOS. The polypeptides described herein may include at least 5, 6, 7, 8, 9, 10, 20, or 30 contiguous or non-contiguous amino acids of SEQ ID NOs: 89-95 and have at least 90% identity (e.g., at least 91 %, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 89-95. Optionally, the polypeptide includes 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 96-102.

[0182] Polypeptides of the disclosure may also include all or a portion of a neutralization epitope that is within a hypervariable region of a capsid protein described herein. In particular, the amino acid sequence of the polypeptide can be at least 90% identical (e.g., at least 91 %, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 96-102. The polypeptides described herein may include at least 4, 5, 6, 7, or 8 contiguous or non-contiguous amino acids of SEQ ID NOs: 96-102 and have at least 90% identity (e.g., at least 91 %, 92%, 93%, or 94% identity), at least 95% identity (e.g., at least 96%, 97%, 98%, or 99% identity), or 100% identity to any one of SEQ ID NOs: 96-102. Optionally, the polypeptide includes 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 96-102.

[0183] / . Recombinant Polypeptides

[0184] Also provided herein are recombinant polypeptides that may be encoded by the nucleic acid molecules and / or vectors described above. Such polypeptides can be incorporated into a capsid of a virus or vp to create a recombinant virus, as described further below. Any capsid protein (e.g., VP1 , VP2, or VP3) that is encoded by one or more viral vectors known in the art (e.g., an AAV vector, a retroviral vector, or a lentiviral vector) may by modified to further include an amino acid sequence described herein (e.g., an amino acid sequence of Table 3, e.g., any one of SEQ ID NOs: 80-102). In other words, the polypeptide of the disclosure can be used to replace the corresponding sequence or region of an endogenous or naturally occurring capsid protein of a virus. For example, a surface exposed hypervariable region of a naturally occurring capsid protein can be replaced with the protein sequence of any one of SEQ ID NOs: 80-84 and 89-93. Such a modification can be accomplished by modifying the nucleotide sequence of the encoded capsid protein.

[0185] For example, a nucleotide sequence encoding an endogenous or naturally occurring capsid protein (e.g., VP1 , VP2, or VP3) in an AAV vector or adenoviral vector can be modified to include a hypervariable region that is least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 89-95. In another example, a nucleotide sequence encoding an endogenous or naturally occurring capsid protein (e.g., VP1 , VP2, or VP3) in an AAV vector or adenoviral vector can be modified to contain a neutralization epitope that is at least 90% identical (e.g., at least 91%, 92%, 93%, or 94% identical), at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical), or 100% identical to all or a portion of any one of SEQ ID NOs: 96-102 in place of the endogenous or naturally occurring epitope sequence. For example, SEQ ID NO: 87 is a recombinant AAV7 capsid containing the neutralization epitope of SEQ ID NO: 96 incorporated into its capsid sequence (see Example 1 for more details), thereby encoding a recombinant capsid polypeptide exhibiting reduced immunogenicity relative to the AAV7 virus containing the unmodified capsid protein.

[0186] Any of the polypeptides described herein may be modified to contain an amino acid sequence from a different capsid protein from one or more viral vectors known in the art (e.g., an adeno- associated virus (AAV) vector, a retroviral vector, or a lentiviral vector) resulting in a recombinant (e.g., a chimeric) polypeptide. For example, an amino acid sequence from a capsid protein from one or more AAV vectors known in the art (e.g., any AAV vector from the following serotypes: AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, and AAV13) can be incorporated into one of the AAV viruses described herein (e.g., RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, and RhAAV6674). By way of example, SEQ ID NO: 88 is a recombinant RhAAV4282 capsid that has been modified to contain a neutralization epitope from the capsid protein of AAV7 (SEQ ID NO: 101 ) (see Example 1 for more details).

[0187] D. Recombinant Viruses

[0188] The present disclosure also features recombinant viruses (e.g., recombinant adenoviruses, recombinant AAV (rAAV), recombinant retroviruses, or recombinant lentiviruses) that include any one or more of the nucleic acid molecules described above (e.g., the nucleic acid molecules of Table 1 , or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto), the vector described above, and / or the polypeptides described above (e.g., the polypeptides of Table 3, or variants thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto).

[0189] A recombinant virus (e.g., recombinant adenovirus, recombinant AAV, recombinant retrovirus, or recombinant lentivirus) may be rcsAAVs or rdsAAVs. rdsAAVs will include a deleted, disrupted, or mutational inactivation of the E1 , E2, E3, and / or E4 region. For example, the rdsAAVs may have a deleted, disrupted, or mutational inactivation of the E1 region and may further include a deletion, disruption, or mutational inactivation of the E2, E3, and / or E4 regions.

[0190] The nucleic acid molecule or vector of the recombinant virus (e.g., recombinant adenovirus, recombinant AAV, recombinant retrovirus, or recombinant lentivirus) may include a transgene (e.g., a therapeutic or immunogenic transgene) encoding a therapeutic or immunogenic (e.g., antigenic) gene product, or fragment thereof. Therapeutic and immunogenic transgenes are described further below.

[0191] / . Therapeutic Transgenes

[0192] The nucleic acid molecule or vector of a recombinant virus (e.g., recombinant adenovirus, recombinant AAV, recombinant retrovirus, or recombinant lentivirus) may include a therapeutic transgene encoding a gene product (e.g., a protein, an antibody (e.g., a bnAb or single-domain antibody, e.g., a NANOBODY®)), or an inhibitory nucleic acid, such as an siRNA, miRNA, or shRNA), or fragment thereof. For example, a therapeutic transgene may encode VEGF, HO-1 , IFN proteins, dystrophin (or a variant thereof, e.g., microdystrophin), Factor VIII, Factor IX, erythropoietin, alpha-1 antitrypsin, calcitonin, glucocerebrosidase, growth hormone, LDL, receptor IL-2 receptor and its antagonists, insulin, globin, immunoglobulins, catalytic antibodies, the interleukins, insulin-like growth factors, superoxide dismutase, immune responder modifiers, parathyroid hormone and interferon, nerve growth factors, tissue plasminogen activators, and / or colony stimulating factors (see, e.g., U.S. Pat. No. 6,054,288, incorporated by reference herein). For example, the IFN protein has an amino acid sequence substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% identical) to the sequence of a human IFN-a (e.g., IFN-a -1 a, IFN-a -1 b, IFN-a-2a, IFN-a-2b, and conIFN-a), a human IFN-p (e.g., IFN-p-1 a and IFN-p-1 b), a human IFN-y), or an IFN-T or a polypeptide that demonstrates the same or similar biological activity to an interferon (e.g., at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of a human IFN-a, a human IFN-p, a human IFN-y, an IFN-T, or a conIFN-a (see, e.g., U.S. Pat. No. 4,695,623 and U.S. Pub. No. 2011 / 0000480, incorporated by reference herein, for examples of specific IFN sequences).

[0193] Any transgene known in the art for treating a particular disease is envisioned for use with the methods described herein. For example, the aforementioned therapeutic transgenes, as well as additional therapeutic transgenes, for use in treating particular diseases are provided in Table 2.

[0194] In some embodiments, the methods described herein are directed to treating a metabolic disorder, a blood disorder, a cardiovascular disorder, a neurological disorder, an ocular or ophthalmological disorder, a reproductive disorder, an infectious disease, an autoimmune or immunological disorder, or a type of cancer. Exemplary transgenes for cloning into the nucleic acid molecules described here, as well as the disease to be treated by the transgene, are provided in Table 2.

[0195] In some particular instances, the therapeutic gene products may be a cancer antigen (e.g., a neoantigen) or TAA. TAAs include protein antigens that are overexpressed on the surface of a cancer cell relative to a non-cancerous cell, as well as proteins that arise from mutations of wild-type proteins. A TAA may be tumor-specific, in which case the expression of the antigen is restricted to a particular type of cancer cell. Alternatively, a TAA may be common to several cancers and thus expressed on the surface of a variety of cancer cell types. TAAs that can be expressed by any vector described herein include an ovarian cancer TAA, a breast cancer TAA, a testicular cancer TAA, a pancreatic cancer TAA, a liver cancer TAA, a colorectal cancer TAA, a thyroid cancer TAA, a lung cancer TAA, a prostate cancer TAA, a kidney cancer TAA, a melanoma TAA, a squamous cell carcinoma TAA, a chronic myeloid leukemia TAA, an acute lymphoblastic leukemia TAA, an acute myelogenous leukemia TAA, a chronic lymphocytic leukemia TAA, a promyelocytic leukemia TAA, a multiple myeloma TAA, a B cell lymphoma TAA, a bladder carcinoma TAA, a head and neck cancer TAA, an esophageal cancer TAA, a brain cancer TAA, a pharynx cancer TAA, a tumor of the tongue TAA, a synovial cell sarcoma TAA, a neuroblastoma TAA, or a uterine cancer TAA. Examples of TAAs are known in the art and are described, e.g., in Reuschenbach et al., Cancer Immunol. Immunother. 58:1535-1544 (2009); Parmiani et al., J. Nat. Cancer Inst. 94:805-818 (2002); Zarour et al., Cancer Medicine. (2003); Bright et al., Hum. Vaccin. Immunother. 10:3297-3305 (2014); Wurz et al., Ther. Adv. Med. Oncol. 8:4-31 (2016); Criscitiello, Breast Care 7:262-266 (2012); Chester et al., J. Immunother. Cancer3:7 (2015); Li et al., Mol. Med. Report s :589-594 (2008); Liu et al., J. Hematol. Oncol. 3:7 (2010); Bertino et al., Biomed. Res. Int. 731469 (2015); and Suri et al., World J. Gastrointest. Oncol. 7:492-502 (2015), the disclosures of each of which are incorporated herein by reference in their entirety.

[0196] In some instances, the therapeutic gene product may be a neoantigen. In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., E6 and / or E7) from human papillomavirus (HPV). In some instances, the therapeutic gene product may be an oncogenic antigen (e.g., EBNA1 , EBNA2, EBNA3A, EBNA3B, EBNA3C, and / or LP) from Epstein-Barr virus (EBV). In some instances, the therapeutic gene product may be an oncolytic agent, such as an oncolytic viral treatment (e.g., IMLYGIC®).

[0197] / ' / . Immunogenic Transgenes

[0198] The nucleic acid molecule or vector of a recombinant virus (e.g., recombinant adenovirus, recombinant AAV, recombinant retrovirus, or recombinant lentivirus) may include an immunogenic transgene encoding a gene product, or fragment thereof. For example, an immunogenic transgene may encode a bacterial, viral, parasitic, or fungal protein, or fragment thereof. When expressed in a host, or host cells, as an antigen, the immunogenic transgene is capable of eliciting an immune response (e.g., a B cell or T cell response).

[0199] An immunogenic transgene may encode a bacterial protein (e.g., an antigen), or fragment thereof, derived from Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium leprae, Pseudomonas aeruginosa, Salmonella typhimurium, Escherichia coli, Klebsiella pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus, Francisella tularensis, Brucella, Burkholderia mallei, Yersinia pestis, Corynebacterium diphtheria, Neisseria meningitidis, Bordetella pertussis, Clostridium tetani, or Bacillus anthracis. Non-limiting examples of bacterial gene products, or fragments thereof, include 10.4, 85A, 85B, 86C, CFP-10, Rv3871 , and ESAT-6 gene products, or fragments thereof, of Mycobacterium; O, H, and K antigens, or fragments thereof, of E. coli and protective antigen (PA), or fragments thereof, of Bacillus anthracis. An immunogenic transgene may encode a viral protein (e.g., an antigen), or fragment thereof, derived from a virus of a viral family selected from the group consisting of Retroviridae, Flaviviridae, Arenaviridae, Bunyaviridae, Filoviridae, Togaviridae, Poxviridae, Herpesviridae, Orthomyxoviridae, Coronaviridae, Rhabdoviridae, Paramyxoviridae, Picornaviridae, Hepadnaviridae, Papillomaviridae, Parvoviridae, Astroviridae, Polyomaviridae, Calciviridae, and Reoviridae. The virus may be human immunodeficiency virus (HIV), human papillomavirus (HPV), hepatitis A virus (Hep A), hepatitis B virus (HBV), hepatitis C virus (HCV), Variola major, Variola minor, monkeypox virus, measles virus, rubella virus, mumps virus, varicella zoster virus (VZV), poliovirus, rabies virus, Japanese encephalitis virus, herpes simplex virus (HSV), cytomegalovirus (CMV), rotavirus, influenza, Ebola virus, yellow fever virus, Zika virus, or Marburg virus. Non-limiting examples of viral gene products, or fragments thereof, include Gag, Pol, Nef, Tat, Rev, Vif, Vpr, or Vpu, or fragments thereof, of HIV and other retroviruses (see, e.g., U.S. Pub. No. 2012 / 0076812, incorporated by reference herein); 9D antigen, or fragments thereof, of HSV; Env, or fragments thereof, of all envelope protein-containing viruses. For example, the viral protein, or fragment thereof, may be an Env protein or a structured protein. In a particular example, the viral protein may be an HIV or Zika virus Env protein. The viral protein may also be a Gag, Pol, Env, Nef, Tat, Rev, Vif, Vpr, or Vpu protein.

[0200] An immunogenic transgene may encode a parasitic protein (e.g., an antigen), or fragment thereof, may be from Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Trypanosoma spp., or Legionella spp. Non-limiting examples of parasitic gene products, or fragments thereof, include circumsporozoite (CS) protein, gamete surface proteins Pfs230 and Pfs48 / 45, and Liver Specific Antigens 1 or 3 (LSA-1 or LSA-3), or fragments thereof, of Plasmodium falciparum.

[0201] An immunogenic transgene may encode a fungal protein (e.g., an antigen), or fragment thereof, may be from Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum var. capsulatum, Paracoccidioides brasiliensis, Sporothrix schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomucor pusillus, or Rhizopus arrhizus. Non-limiting examples of fungal gene products, or fragments thereof, include any cell wall mannoprotein (e.g., Afmpl of Aspergillus fumigatus) or62simerte-expressed glycoprotein (e.g., SOWgp of Coccidioides immitis).

[0202] E. Pharmaceutical Compositions

[0203] Any of the compositions described above, such as the nucleic acid molecules (e.g., a recombinant nucleic acid molecule), vectors (e.g., a recombinant vector), and recombinant viruses (e.g., recombinant adeno-associated viruses or recombinant adenoviruses (e.g., viruses having or encoding a modified capsid protein as described above) may be formulated with a pharmaceutically acceptable carrier to form a pharmaceutical composition. If a composition described above, such as a recombinant nucleic acid molecule, a recombinant vector, and a recombinant virus, contain an immunogenic transgene, the pharmaceutical composition thereof may be considered an immunogenic composition.

[0204] Pharmaceutical compositions can be prepared using standard methods known in the art, such as by mixing the composition with optional physiologically acceptable carriers, excipients or stabilizers (Remington’s Pharmaceutical Sciences (20thedition), ed. A. Gennaro, 2000, Lippincott, Williams & Wilkins, Philadelphia, PA). Acceptable carriers include saline and / or buffers, such as phosphate, citrate and other organic acids. Other components can include, e.g., antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as TWEEN™, PLURONICS™, or PEG. The carrier can be sufficiently pure to be administered therapeutically to a human subject. Those of relevant skill in the art are well able to prepare suitable solutions using, e.g., isotonic vehicles such as Sodium Chloride Injection, Ringer’s Injection, or Lactated Ringer’s Injection.

[0205] Optionally, pharmaceutical compositions can contain a pharmaceutically acceptable preservative. In some embodiments the preservative concentration can range from 0.1 to 2.0%, typically v / v. Suitable preservatives include those known in the pharmaceutical arts. Benzyl alcohol, phenol, m-cresol, methylparaben, and propylparaben are preferred preservatives. Optionally, the formulations of the disclosure can include a pharmaceutically acceptable surfactant at a concentration of 0.005 to 0.02%. Stabilizers, buffers, antioxidants and / or other additives may be included, as required.

[0206] Optionally, pharmaceutical compositions may further include an immunostimulatory agent, adjuvant, antibacterial agent, or other pharmaceutically active agent as are conventional in the art. Adjuvants may include but are not limited to salts, emulsions (including oil / water compositions), saponins, liposomal formulations, virus particles, polypeptides, pathogen-associated molecular patterns (PAMPS), nucleic acid-based compounds or other formulations utilizing certain antigens. Suitable adjuvants include, e.g., aluminum phosphate, aluminum hydroxide, OS21 , Quil A (and derivatives and components thereof), calcium phosphate, calcium hydroxide, zinc hydroxide, glycolipid analogs, vegetable oils, alum, Freund’s incomplete adjuvant, or Freund’s incomplete adjuvant, octodecyl esters of an amino acid, muramyl dipeptides, polyphosphazene, lipoproteins, DC- Chol, DDA, cytokines, and other adjuvants and derivatives thereof. Other adjuvants include agents such as immunestimulating complexes (ISCOMs), synthetic polymers of sugars (CARBOPOL®), aggregation of the protein in the vaccine by heat treatment, aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, endotoxins or lipopolysaccharide components of gram-negative bacteria, emulsion in physiologically acceptable oil vehicles such as mannide mono-oleate (Aracel A) or emulsion with 20 percent solution of a perfluorocarbon (Fluosol-DA) used as a block substitute may also be employed.

[0207] The pharmaceutical compositions described herein can be formulated, e.g., for administration subcutaneously, intranasally, intrapulmonarally, intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions.

[0208] Pharmaceutical compositions may be sterilized by conventional sterilization techniques or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation may be administered in powder form or combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11 , more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting pharmaceutical compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the composition (e.g., the nucleic acid molecule, vector, or virus) and, if desired, one or more immunomodulatory agents, such as in a sealed package of tablets or capsules, or in a suitable dry powder inhaler (DPI) capable of administering one or more doses.

[0209] The compositions may be sterilized by conventional sterilization techniques or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation may be administered in powder form or combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11 , more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the pharmaceutical composition described herein and, if desired, one or more immunomodulatory agents, such as in a sealed package of tablets or capsules, or in a suitable dry powder inhaler (DPI) capable of administering one or more doses.

[0210] II. METHODS

[0211] Featured below are methods that utilize any of the above-mentioned nucleic acid molecules (e.g., of Table 1 , or variants thereof), vectors, polypeptides (e.g., of Table 3, or variants thereof), recombinant viruses (e.g., recombinant adeno-associated viruses or recombinant adenoviruses), or any pharmaceutical compositions thereof, for use in, inter alia, gene therapy treatments and vaccination.

[0212] A. Methods of T eatment

[0213] Any of the compositions described above, such as the nucleic acid molecules, vectors (e.g., AAV vectors and rAAV vectors), recombinant viruses (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein described herein), and any pharmaceutical compositions thereof, can be engineered to contain a transgene (e.g., a therapeutic transgene described herein). Such compositions can be used in a method to treat, prevent, ameliorate, inhibit the progression of, or reduce the severity of one or more symptoms of a disease (e.g., a cardiovascular disease, a cancer, an infectious disease, and autoimmune disease, or a neurological disease) in a subject (e.g., a human).

[0214] In particular, the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus having a capsid protein as described herein), and any pharmaceutical composition thereof) can be used to treat or prevent a disease, e.g., a cancer, a cardiovascular disease, an infectious disease, an autoimmune disease, or a neurological disease. For example, the composition can be used to deliver a cancer-associated antigen or other anti-cancer therapeutic agent that treats or prevents a cancer.

[0215] Non-limiting examples of cancers that can be treated include carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. For instance, the cancer can be an ovarian cancer, a breast cancer, a testicular cancer, a pancreatic cancer, a liver cancer, a colorectal cancer, a thyroid cancer, a lung cancer, a prostate cancer, a kidney cancer, a melanoma, a squamous cell carcinoma, a chronic myeloid leukemia, an acute lymphoblastic leukemia, an acute myelogenous leukemia, a chronic lymphocytic leukemia, a promyelocytic leukemia, a multiple myeloma, a B cell lymphoma, a bladder carcinoma, a head and neck cancer, an esophageal cancer, a brain cancer, a pharynx cancer, a tumor of the tongue, a synovial cell sarcoma, a neuroblastoma, or a uterine cancer. More particular examples of such cancers include, but are not limited to, lung cancer, including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung; bladder cancer (e.g., urothelial bladder cancer (UBC), muscle invasive bladder cancer (MIBC), and BCG-refractory non-muscle invasive bladder cancer (NMIBC)); kidney or renal cancer (e.g., renal cell carcinoma (RCC)); cancer of the urinary tract; breast cancer (e.g., HER2+ breast cancer and triple-negative breast cancer (TNBC), which are estrogen receptors (ER-), progesterone receptors (PR-), and HER2 (HER2-) negative); prostate cancer, such as castration-resistant prostate cancer (CRPC); cancer of the peritoneum; hepatocellular cancer; gastric or stomach cancer, including gastrointestinal cancer and gastrointestinal stromal cancer; pancreatic cancer; glioblastoma; cervical cancer; ovarian cancer; liver cancer; hepatoma; colon cancer; rectal cancer; colorectal cancer; endometrial or uterine carcinoma; salivary gland carcinoma; prostate cancer; vulval cancer; thyroid cancer; hepatic carcinoma; anal carcinoma; penile carcinoma; melanoma, including superficial spreading melanoma, lentigo maligna melanoma, acral lentiginous melanomas, and nodular melanomas; multiple myeloma and B-cell lymphoma (including low grade / follicular non-Hodgkin’s lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade / follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom’s Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); acute myologenous leukemia (AML); hairy cell leukemia; chronic myeloblastic leukemia (CML); post-transplant lymphoproliferative disorder (PTLD); and myelodysplastic syndromes (MDS), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), Meigs’ syndrome, brain cancer, head and neck cancer, and associated metastases.

[0216] In some embodiments, any of the compositions described herein may be used to deliver a transgene encoding a protein (e.g, VEGF or HO-1 ) or a fragment thereof for the treatment of a cardiovascular disease or condition. Non-limiting examples of cardiovascular diseases include coronary artery disease, heart failure, atherosclerosis, stroke, arrhythmia, Brugada syndrome, hypertension, aortic aneurysm, vascular malformations, carotid disease, hypertrophic cardiomyopathy, idiopathic or familial dilated cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, peripheral artery disease, atrial tachycardia, supraventricular tachycardia, postphlebitic syndrome, thromboangiitis obliterans or Buerger disease, Raynaud syndrome, thoracic outlet syndrome, vasculitis, endocarditis, catecholaminergic polymorphic ventricular tachycardia, cyanotic heart disease, acyanotic heart disease, atrial septal defect, atrioventricular septal defect, coarctation of the aorta, double-outlet right ventricle, and pulmonary atresia.

[0217] Non-limiting examples of autoimmune diseases that can be treated include rheumatoid arthritis, lupus, celiac disease, Sjogren’s syndrome, multiple sclerosis, polymyalgia rheumatica, ankylosing spondylitis, type 1 diabetes, alopecia areata, vasculitis, and temporal arteritis. Any of the compositions described herein, such as the nucleic acid molecules, vectors (e.g., AAV vectors and rAAV vectors), recombinant viruses (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein described herein), and any pharmaceutical compositions thereof, can be engineered to contain a therapeutic transgene for treating the particular disease. While any therapeutic transgene known in the art is envisioned, exemplary therapeutic transgenes and their associated diseases are provided in Table 2.

[0218] / . Administration

[0219] The composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) can be administered to a subject (e.g., a human), pre- or post-diagnosis of a disease to treat, prevent, ameliorate, inhibit the progression of, or reduce the severity of one or more symptoms of a disease. Examples of symptoms of diseases include, but are not limited to, muscle aches, coughing, sneezing, runny nose, sore throat, headache, congestion, chills, diarrhea, vomiting, rash, weakness, dizziness, nausea, weight changes, swollen glands, joint pain or swelling, shortness of breath, changes in vision, chest pain, bleeding under the skin, in internal organs, or from body orifices like the mouth, eyes, or ears, shock, jaundice, numbness in extremities, nervous system malfunction, delirium, seizures, renal (kidney) failure, personality changes, neck stiffness, dehydration, seizures, lethargy, paralysis of the limbs, confusion, back pain, loss of sensation, impaired bladder and bowel function, and sleepiness that can progress into coma or death. These symptoms, and their resolution during treatment, may be measured by, for example, a physician during a physical examination or by other tests and methods known in the art.

[0220] The compositions utilized in the methods described herein (e.g., the nucleic acid molecules, vectors (e.g., AAV vectors or rAAV vectors), recombinant viruses (e.g., a recombinant adeno- associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical compositions thereof) can be formulated, for example, for administration intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions.

[0221] The method of administration can vary depending on various factors (e.g., the components of the composition being administered, and the severity of the condition being treated). Formulations suitable for oral or nasal administration may consist of liquid solutions, such as an effective amount of the composition dissolved in a diluent (e.g., water, saline, or PEG-400), capsules, sachets, tablets, or gels, each containing a predetermined amount of a pharmaceutical composition described herein. The pharmaceutical composition may also be an aerosol formulation for inhalation, for example, to the bronchial passageways. Aerosol formulations may be mixed with pressurized, pharmaceutically acceptable propellants (e.g., dichlorodifluoromethane, propane, or nitrogen). In particular, administration by inhalation can be accomplished by using, for example, an aerosol containing sorbitan trioleate or oleic acid, for example, together with trichlorofluoromethane, dichlorofluoromethane, dichlorotetrafluoroethane, or any other biologically compatible propellant gas.

[0222] The composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) may be formulated to release the composition immediately upon administration (e.g., targeted delivery) or at any predetermined time period after administration using controlled or extended release formulations. Administration of the composition in controlled or extended release formulations is useful where the composition, either alone or in combination, has (i) a narrow therapeutic index (e.g., the difference between the plasma concentration leading to harmful side effects or toxic reactions and the plasma concentration leading to a therapeutic effect is small; generally, the therapeutic index, Tl, is defined as the ratio of median lethal dose (LD50) to median effective dose (ED50)); (ii) a narrow absorption window at the site of release (e.g., the gastro-intestinal tract); or (Hi) a short biological half-life, so that frequent dosing during a day is required in order to sustain a therapeutic level.

[0223] The composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) may be administered, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45, 50, 55, or 60 minutes, 2, 4, 6, 10, 15, or 24 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, 3, 4, 6, or 9 months, or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 years or more pre-exposure or pre-diagnosis, or may be administered to the subject 15-30 minutes or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 20, 24, 48, or 72 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, 3, 4, 6, or 9 months, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 years or longer post-diagnosis or post-exposure to the infective agent.

[0224] When treating disease, the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) may be administered to the subject either before the occurrence of symptoms or a definitive diagnosis or after diagnosis or symptoms become evident. For example, the composition may be administered immediately after diagnosis or the clinical recognition of symptoms or 2, 4, 6, 10, 15, or 24 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, or even 3, 4, or 6 months after diagnosis or detection of symptoms.

[0225] / ' / . Dosages

[0226] The composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) can be administered in a therapeutically effective amount that provides an therapeutic effect. The dose or the number of treatments used may be increased or decreased based on the severity of, occurrence of, or progression of, the disease in the subject (e.g., based on the severity of one or more symptoms of the disease). Doses of the composition may be administered as a fixed dose or a weight-based dose.

[0227] For example, the subject can be administered at least about 10 pg to 100 pg (e.g., 10 pg, 1 1 pg, 12 pg, 13 pg, 14 pg, 15 pg, 16 pg, 17 pg, 18 pg, 19 pg, 20 pg, 21 pg, 22 pg, 23 pg, 24 pg, 25 pg, 26 pg, 27 pg, 28 pg, 29 pg, 30 pg, 31 pg, 32 pg, 33 pg, 34 pg, 35 pg, 36 pg, 37 pg, 38 pg, 39 pg, 40 pg, 41 pg, 42 pg, 43 pg, 44 pg, 45 pg, 46 pg, 47 pg, 48 pg, 49 pg, 50 pg, 51 pg, 52 pg, 53 pg, 54 pg, 55 pg, 56 pg, 57 pg, 58 pg, 59 pg, 60 pg, 61 pg, 62 pg, 63 pg, 64 pg, 65 pg, 66 pg, 67 pg, 68 pg, 69 pg, 70 pg, 71 pg, 72 pg, 73 pg, 74 pg, 75 pg, 76 pg, 77 pg, 78 pg, 79 pg, 80 pg, 81 pg, 82 pg, 83 pg, 84 pg, 85 pg, 86 pg, 87 pg, 88 pg, 89 pg, 90 pg, 91 pg, 92 pg, 93 pg, 94 pg, 95 pg, 96 pg, 97 pg, 98 pg, 99 pg, or 100 pg), 10 pg to 50 pg, 25 pg to 75 pg, or 50 pg to 100 pg of a fixed does of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof).

[0228] In another example, the subject can be administered at least about 0.01 pg per kilogram (kg) to 3 pg / kg (e.g., 0.01 pg / kg, 0.02 pg / kg, 0.03 pg / kg, 0.04 pg / kg, 0.05 pg / kg, 0.06 pg / kg, 0.07 pg / kg, 0.08 pg / kg, 0.09 pg / kg, 0.1 pg / kg, 0.2 pg / kg, 0.3 pg / kg, 0.4 pg / kg, 0.5 pg / kg, 0.6 pg / kg, 0.7 pg / kg, 0.8 pg / kg, 0.9 pg / kg, 1 pg / kg, 1 .1 pg / kg, 1 .2 pg / kg, 1 .3 pg / kg, 1 .4 pg / kg, 1 .5 pg / kg, 1 .6 pg / kg, 1 .7 pg / kg, 1 .8 pg / kg, 1 .9 pg / kg, 2 pg / kg, 2.5 pg / kg, or 3 pg / kg) of the subjects weight (e.g., a weight-based dose) of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof).

[0229] In yet another example, the subject can be administered at least 1 mg to 5000 mg (e.g., 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 1 1 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, 90 mg, 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 1 10 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, 350 mg, 360 mg, 370 mg, 380 mg, 390 mg, 400 mg, 410 mg, 420 mg, 430 mg, 440 mg, 450 mg, 460 mg, 470 mg, 480 mg, 490 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, 750 mg, 775 mg, 800 mg, 825 mg, 850 mg,

[0230] 875 mg, 900 mg, 925 mg, 950 mg, 975 mg, 1000 mg, 1 100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, 1600 mg, 1700 mg, 1800 mg, 1900 mg, 2000 mg, 2100 mg, 2200 mg, 2300 mg, 2400 mg, 2500 mg, 2600 mg, 2700 mg, 2800 mg, 2900 mg, 3000 mg, 3100 mg, 3200 mg, 3300 mg, 3400 mg, 3500 mg, 3600 mg, 3700 mg, 3800 mg, 3900 mg, 4000 mg, 4100 mg, 4200 mg, 4300 mg, 4400 mg, 4500 mg, 4600 mg, 4700 mg, 4800 mg, 4900 mg, or 5000 mg) of a fixed dose of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein described herein), and any pharmaceutical composition thereof).

[0231] In yet another example, the subject can be administered at least 0.01 mg / kg to 100 mg / kg (e.g., 0.01 mg / kg, 0.05 mg / kg, 0.10 mg / kg, 0.25 mg / kg, 0.50 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 1 1 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg,

[0232] 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg,

[0233] 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg,

[0234] 61 mg / kg, 62 mg / kg, 63 mg / kg, 64 mg / kg, 65 mg / kg, 66 mg / kg, 67 mg / kg, 68 mg / kg, 69 mg / kg, 70 mg / kg, 71 mg / kg, 72 mg / kg, 73 mg / kg, 74 mg / kg, 75 mg / kg, 76 mg / kg, 77 mg / kg, 78 mg / kg, 79 mg / kg,

[0235] 80 mg / kg, 81 mg / kg, 82 mg / kg, 83 mg / kg, 84 mg / kg, 85 mg / kg, 86 mg / kg, 87 mg / kg, 88 mg / kg, 89 mg / kg, 90 mg / kg, 91 mg / kg, 92 mg / kg, 93 mg / kg, 94 mg / kg, 95 mg / kg, 96 mg / kg, 97 mg / kg, 98 mg / kg,

[0236] 99 mg / kg, or 100 mg / kg) of a weight-based dose of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof).

[0237] In yet another example, the subject can be administered a recombinant adeno-associated virus or adenovirus as described herein at a dose of about 1 x103genome copies (gc) / kilogram (kg) or between 1 x101and 1 x1016gc / kg, preferably between 1 x103and 1 x 1014gc / kg, and more preferably between 1 x105and 1 x1011gc / kg. In some instances, the subject can be administered about 1 x101gc / kg, about 1 x102gc / kg, about 1 x103gc / kg, about 1 x104gc / kg, about 1 x105gc / kg, about 1 x106gc / kg, about 1 x107gc / kg, about 1 x108gc / kg, about 1 x109gc / kg, about 1 x1010gc / kg, about 1 x1011gc / kg, about 1 x1012gc / kg, about 1 x1013gc / kg, about 1 x1014gc / kg, about 1 x1015gc / kg, or about 1 x1016gc / kg.

[0238] In yet another example, the subject can be administered a recombinant adeno-associated virus or adenovirus as described herein at a dose of about 1 x103viral particles (vp) / dose or between 1 x101and 1 x1018vp / dose, preferably between 1 x103and 1 x1012vp / dose, and more preferably between 1 x105and 1 x1011vp / dose. In some instances, the subject can be administered about 1 x101vp / dose, about 1 x102vp / dose, about 1 x103vp / dose, about 1 x104vp / dose, about 1 x105vp / dose, about 1 x106vp / dose, about 1 x107vp / dose, about 1 x108vp / dose, about 1 x109vp / dose, about 1 x1010vp / dose, about 1 x1011vp / dose, about 1 x1012vp / dose, about 1 x1013vp / dose, about 1 x1014vp / dose, about 1x1015vp / dose, about 1x1016vp / dose, about 1x1017vp / dose, or about 1x1018vp / dose. Viral particles contain a nucleic acid molecule (e.g., vector) described herein which encodes, inter alia, an antigen (e.g., viral structural and non-structural proteins) by way of a transgene that was engineered into the nucleic acid molecule. The viral particles are surrounded by a protective coat, such as a polypeptide- based capsid (e.g., a polypeptide capsid described herein). Viral particle number can be measured based on, for example, lysis of vector particles, followed by measurement of the absorbance at 260 nm (see, e.g,. Steel, Curr. Opin. Biotech., 1999).

[0239] The dosage administered may depend on the subject to be treated (e.g., the age, body weight, capacity of the immune system, and general health of the subject being treated), the form of administration (e.g., as a solid or liquid), the manner of administration (e.g., by injection, inhalation, dry powder propellant), and the cells targeted (e.g., epithelial cells, such as blood vessel epithelial cells, nasal epithelial cells, or pulmonary epithelial cells). The composition is preferably administered in an amount that provides a sufficient level of the transgene (e.g., a therapeutic transgene).

[0240] Alternatively, the efficacy of treatment can be determined by monitoring the level of the therapeutic gene product, or fragment thereof, expressed in a subject (e.g., a human) following administration of the compositions described herein. For example, the blood or lymph of a subject can be tested for the transgene, or fragment thereof, using, for example, standard assays known in the art (see, e.g., Human Interferon-Alpha Multi-Species ELISA kit (Product No. 41105) and the Human Interferon-Alpha Serum Sample kit (Product No. 41110) from Pestka Biomedical Laboratories (PBL), Piscataway, New Jersey).

[0241] A single dose of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) may achieve protection pre-diagnosis or post-diagnosis of a disease. In addition, a single dose administered prediagnosis or post-diagnosis can function as a treatment according to the present invention. A single dose of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) can also be used to achieve therapy in subjects being treated for a disease. Multiple doses (e.g., 2, 3, 4, 5, or more doses) can also be administered, if necessary, to these subjects.

[0242] Single or multiple administrations of the composition (e.g., nucleic acid molecule, vector (e.g., AAV vector or rAAV vector), recombinant virus (e.g., recombinant adeno-associated virus or adenovirus having a capsid protein as described herein), and any pharmaceutical composition thereof) may be given to a subject (e.g., one administration or administration two or more times).

[0243] B. Methods of Reducing or Modifying Immunogenicity or Neutralization of a Gene Therapy Vector

[0244] Also provided herein are methods for reducing the immunogenicity of a gene therapy vector, modifying the immunogenicity of a gene therapy vector, reducing the neutralization (e.g., by a subject’s immune system) of a gene therapy vector, and / or modifying the neutralization of a gene therapy vector (e.g., reducing or modifying the immunogenicity or neutralization of the gene therapy vector relative to the naturally occurring or unmodified version of the gene therapy vector or changing the immune profile of the modified gene therapy vector relative to the unmodified gene therapy vector). One challenge with vector-mediated gene therapy is the acquired anti-vector immunity by a subject after receiving a vector-based gene therapy (e.g., an AAV vector). Advantageously, the methods provided herein can change the immune profile a vector-based gene therapy (e.g., a parental vector expressing a transgene) such that a nearly identical vector-based gene therapy (e.g., a modified viral vector, e.g., an AAV vector described herein) can be administered. The resulting recombinant vector can be provided as a efficacious therapeutic treatment because it will have a different immune profile in the subject (e.g., the subject will have fewer nAbs that recognize the modified vector). This means that the vector is less likely to be neutralized by a subject’s immune system; thus immunogenicity / neutralization of the vector is modified (e.g., reduced). Furthermore, this method is advantageous because it will have a minimal effect on the vector’s tropism (e.g., ability to target a tissue or cell in a tissue). For example, the gene therapy may include an rAAV vector (e.g., AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, or AAV13) having a therapeutic transgene encoding a therapeutic gene product (e.g., VEGF or HO-1 ). By simply replacing a site within the nucleic acid molecule of a viral component (e.g., the nucleic acid sequence encoding a capsid protein) of the vector with all or a part of the nucleic acid sequence set forth in any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto), one can reduce the immunes systems recognition of the viral component (e.g., the capsid protein) encoded by the nucleic acid molecule. To identify one or more sites for sequence modification, one may align any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) with the corresponding nucleic acid sequence of a given vector to be modified and identify the site(s) based on structural identity or location (e.g., any one of the hypervariable regions; e.g., hypervariable region I, hypervariable region II, hypervariable region III, hypervariable region IV, hypervariable region V, hypervariable region VI, hypervariable region VII, hypervariable region VIII, hypervariable region IX, or a subregion thereof; e.g., an HRNE). Following this sequence replacement strategy, incorporating any one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto) into a vector can reduce the neutralization of the viral vector by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, relative to the vector prior to incorporating one of SEQ ID NOs: 1 -23 (or a variant thereof having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% thereto). By way of example, SEQ ID NO: 8 is a nucleic acid molecule in which the neutralization epitope of SEQ ID NO:17 is used in place of the corresponding region of the parental capsid protein-encoding nucleic acid molecule (SEQ ID NO: 22). The modified capsid protein encoded by SEQ ID NO: 8 exhibits reduced neutralization or immunogenicity relative to the unmodified capsid protein (see Example 1 for more details). Reducing the neutralization or immunogenicity of a viral protein (e.g., a capsid protein) by using the replacement strategy described herein provides a significant advantage over the art. Namely, the replacement strategy allows for re-administration of a nearly identical viral vector to a subject, even in cases where the subject has recently acquired immunity against the initially administered (i.e., unmodified) viral vector (e.g., the viral vectors are the same except for the modification of the capsid component to contain a neutralization epitope that avoids the acquired immunity), thereby circumventing the need to implement additional therapies. Such compositions can be used further in a method to treat, prevent, ameliorate, inhibit the progression of, or reduce the severity of one or more symptoms of a disease (e.g., a cardiovascular disease, a cancer, an infectious disease, a neurological disease, an autoimmune disease, or other disease treatable using a gene therapy vector) in a subject (e.g., a human), as described above.

[0245] C. Methods of Vaccination

[0246] Any of the compositions described above, such as the nucleic acid molecules, vectors (e.g., AAVs and rAAVs), recombinant viruses (e.g., recombinant adeno-associated viruses and adenoviruses having a capsid protein as described herein), and any pharmaceutical compositions thereof, can be engineered to contain an immunogenic transgene (e.g., a transgene encoding an antigen) and, thus, be used as an immunogenic composition (e.g., vaccine). Such an immunogenic compositions can be used, e.g., as a vaccine, in a method to treat, prevent, ameliorate, inhibit the progression of, or reduce the severity of one or more symptoms of a disease (e.g., cancer) or a disease caused by an infective agent (e.g., AIDS, tuberculosis, etc.) in a subject (e.g., a human).

[0247] In particular, the immunogenic composition (e.g., vaccine) can contain or include a nucleic acid molecule encoding an immunogenic or antigenic protein that can be used to treat (pre- or postexposure) or reduce the risk or extent of an infection by bacteria, including Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium leprae, Pseudomonas aeruginosa, Salmonella typhimurium, Escherichia coli, Klebsiella pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus, Francisella tularensis, Brucella, Burkholderia mallei, Yersinia pestis, Corynebacterium diphtheria, Neisseria meningitidis, Bordetella pertussis, Clostridium tetani, or Bacillus anthracis; viruses of a viral family selected from the group consisting of Retroviridae, Flaviviridae, Arenaviridae, Bunyaviridae, Filoviridae, Togaviridae, Poxviridae, Herpesviridae, Orthomyxoviridae, Coronaviridae, Rhabdoviridae, Paramyxoviridae, Picornaviridae, Hepadnaviridae, Papillomaviridae, Parvoviridae, Astroviridae, Polyomaviridae, Calciviridae, and Reoviridae; parasites, including Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Trypanosoma spp., or Legionella spp.; and fungi, including Aspergillus, Blastomyces dermatitidis, Candida, Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum var. capsulatum, Paracoccidioides brasiliensis, Sporothrix schenckii, Zygomycetes spp., Absidia corymbifera, Rhizomucor pusillus, or Rhizopus arrhizus.

[0248] The immunogenic composition (e.g., vaccine) can contain or include a nucleic acid molecule encoding an immunogenic or antigenic protein that can be used to treat or prevent diseases caused by infectious agents (e.g., viral infections, e.g., AIDS or Zika infection). In non-limiting examples, the immunogenic composition (e.g., vaccine) can be used to treat a subject (e.g., a human) with acquired immune deficiency syndrome (AIDS), cancer, tuberculosis, leprosy, typhoid fever, pneumonia, meningitis, staphylococcal scalded skin syndrome (SSSS), Ritter’s disease, tularemia (rabbit fever), brucellosis, Glanders disease, bubonic plague, septicemic plague, pneumonic plague, diphtheria, pertussis (whooping cough), tetanus, anthrax, hepatitis, smallpox, monkeypox, measles, mumps, rubella, chicken pox, polio, rabies, Japanese encephalitis, herpes, mononucleosis, influenza, Ebola virus disease, hemorrhagic fever, yellow fever, Marburg virus disease, toxoplasmosis, malaria, trypanosomiasis, legionellosis, aspergillosis, blastomycosis, candidiasis (thrush), coccidioidomycosis, cryptococcosis, histoplasmosis, paracoccidioidomycosis, sporotrichosis, Zika infection, or sinus-orbital zygomycosis.

[0249] Further, the immunogenic composition (e.g., vaccine) can contain or include a nucleic acid molecule encoding an immunogenic or antigenic protein that can be used to treat or prevent cancer. Non-limiting examples of cancers that can be treated using the immunogenic composition include carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. For instance, the cancer can be an ovarian cancer, a breast cancer, a testicular cancer, a pancreatic cancer, a liver cancer, a colorectal cancer, a thyroid cancer, a lung cancer, a prostate cancer, a kidney cancer, a melanoma, a squamous cell carcinoma, a chronic myeloid leukemia, an acute lymphoblastic leukemia, an acute myelogenous leukemia, a chronic lymphocytic leukemia, a promyelocytic leukemia, a multiple myeloma, a B cell lymphoma, a bladder carcinoma, a head and neck cancer, an esophageal cancer, a brain cancer, a pharynx cancer, a tumor of the tongue, a synovial cell sarcoma, a neuroblastoma, or a uterine cancer. More particular examples of such cancers include, but are not limited to, lung cancer, including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung; bladder cancer (e.g., urothelial bladder cancer (UBC), muscle invasive bladder cancer (MIBC), and BCG-refractory non-muscle invasive bladder cancer (NMIBC)); kidney or renal cancer (e.g., renal cell carcinoma (RCC)); cancer of the urinary tract; breast cancer (e.g., HER2+ breast cancer and triple-negative breast cancer (TNBC), which are estrogen receptors (ER-), progesterone receptors (PR-), and HER2 (HER2-) negative); prostate cancer, such as castration-resistant prostate cancer (CRPC); cancer of the peritoneum; hepatocellular cancer; gastric or stomach cancer, including gastrointestinal cancer and gastrointestinal stromal cancer; pancreatic cancer; glioblastoma; cervical cancer; ovarian cancer; liver cancer; hepatoma; colon cancer; rectal cancer; colorectal cancer; endometrial or uterine carcinoma; salivary gland carcinoma; prostate cancer; vulval cancer; thyroid cancer; hepatic carcinoma; anal carcinoma; penile carcinoma; melanoma, including superficial spreading melanoma, lentigo maligna melanoma, acral lentiginous melanomas, and nodular melanomas; multiple myeloma and B-cell lymphoma (including low grade / follicular non-Hodgkin’s lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade / follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom’s Macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); acute myologenous leukemia (AML); hairy cell leukemia; chronic myeloblastic leukemia (CML); post-transplant lymphoproliferative disorder (PTLD); and myelodysplastic syndromes (MDS), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), Meigs’ syndrome, brain cancer, head and neck cancer, and associated metastases.

[0250] / ' / . Inducing an Immune Response

[0251] An immunogenic composition (e.g., a vaccine) can be used in a method of inducing an immune response in a subject (e.g., a human) following an ex vivo or in vivo administration. For example, a nucleic acid molecule, a vector (e.g., an AAV vector), or a recombinant virus (e.g., a recombinant RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, or RhAAV6674 adeno- associated virus or a different virus (e.g., a different AAV or adenovirus) that is modified to contain a capsid protein including a neutralization epitope (e.g., an epitope from hypervariable region IV) from one or more of these AAVs) as described herein can be engineered to express the Env glycoprotein of HIV or Zika virus and administered to a subject (e.g., a human) to treat infection by HIV or Zika virus, respectively. As another example, a nucleic acid molecule, a vector (e.g., an AAV vector), or a recombinant virus (e.g., a recombinant RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, or RhAAV6674 adeno-associated virus or a different virus (e.g., a different AAV or adenovirus) that is modified to contain a capsid protein including a neutralization epitope (e.g., an epitope from hypervariable region IV) from one or more of these AAVs) as described herein can be engineered to express a cancer antigen or a tumor-associated antigen and used to treat cancer.

[0252] In one instance, the immune response induced is a humoral (i.e., antibody) response to the immunogenic transgene expressed by the immunogenic composition (e.g., the antigen encoded by the transgene). Depending upon the immunogenic transgene that is expressed, such an antibody response can be specific to the immunogenic transgene or cross-reactive with other, related gene products. In another instance, the immune response can be a cellular (e.g., cytotoxic T lymphocyte (CTL)) response. Depending upon the immunogenic transgene, such a CTL response can be specific to the immunogenic transgene or cross-reactive with other, related gene products. In still other instances, both an antibody response and a CTL response may be induced.

[0253] The immunogenic composition can be used in immunization regimens that can be applied either in prophylactic or therapeutic compositions. The levels of immunity can be monitored to determine the need, if any, for boosters. Following an assessment of antibody titers in the serum, optional booster immunizations may be desired (see “Prime-Boost Regimens” below).

[0254] In some instances, immune responses induced by administration of the immunogenic composition may involve upregulation (e.g., upregulation by a log fold change of about +1 , +2, +3, +4, +5, +6, +7, +8, +9, +10, +11 , +12, +13, +14, or +15) or downregulation (e.g., downregulation by a log fold change of about -1 , -2, -3, -4, -5, -6, -7, -8, -9, -10, -11 , -12, -13, -14, or -15) of a one or more genes. For example, the immune response may involve upregulation and / or downregulation of one or more genes in pro-inflammatory signaling pathways, TCR signaling pathways, BCR signaling pathways, T-help cells markers, NK cells activation markers, growth factors, T cell proliferation and differentiation markers, program cell death markers, NFKB signaling markers, STAT signaling markers, TGF-beta signaling markers, or negative immune regulators. In some instances, an immune response may include upregulation (e.g., upregulation by a log fold change of about +1 , +2, +3, +4, +5, +6, +7, +8, +9, +10, +11 , +12, +13, +14, or +15) or downregulation (e.g., downregulation by a log fold change of about -1 , -2, -3, -4, -5, -6, -7, -8, -9, -10, -11 , -12, -13, -14, or -15) of expression of a gene, such as, e.g., one or more of TNF-a, IL1 -a, IL1 -p, IL-2, ll-2ra, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-13, IL-15, IP10 (CXCL10), IL-12 (P40), IL-12 (P70), IL-18, Eotaxin (CCL11 ), KC (CXCL1 ), MCP-1 (CCL2), MIP-1 a (CCL3), MIP-1 b (CCL4), MIP2 (CXCL2), MIG (CXCR3), LIX (CXCL5), RANTES (CCL5), IFN-Y, G-CSF, CCL19, CXCL11 , GM-CSF, CD40, CD40LG, NFATC3, NFATC4, CD28, CCR4, CD34, CD38, CD3e, CD4, CD68, CD80, CD86, CD8a, LY96, VCAM1 , C3, CD19, ICOS, TBX21 , IL-15, VEGF, CSF1 , CSF2, CSF3, BCL2, BCL2L1 , AGTR2, BAX, FAS, FASL, GZMB, LCAM1 , PRF1 , SOCS1 , SOCS2, Tnfrsfl 8, NFKB1 , NFKB2, IKBKB, Statl , Stat2, Stat3, STAT4, STAT6, SMAD3, SMAD7, TGFB1 , CTLA4, ACE, EDN1 , FN1 , H2-Ea, H2-Eb1 , LIF, LRP2, NOS2, PTGS2, PTPRC, SELE, SELP, or SKI. For example, the immunogenic composition may induce an immune response that involves downregulation of IL-9 relative to a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).

[0255] In some instances, the immune response induced by administration of the immunogenic composition may include downregulation (e.g., decreased expression) of a gene described herein, in which the expression of the gene is decreased by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% or greater as compared to a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points). In certain instances, downregulation of the gene involves a decrease in gene expression that is at least about 1 .5x, 1 ,75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 100x fold less than a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).

[0256] In some instances, the immune response induced by administration of the immunogenic composition may include upregulation (e.g., increased expression) of a gene described herein, in which the expression of the gene is increased by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% or more as compared to a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points). In certain instances, upregulation of the gene involves an increase in gene expression that is at least about 1 .5x, 1 .75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 100x fold less than a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points). Hi. Administration

[0257] The immunogenic composition of the present disclosure can be administered to a subject (e.g., a human), pre- or post-exposure to an infective agent (e.g., bacteria, viruses, parasites, fungi) or pre- or post-diagnosis of a disease of a disease without an etiology traceable to an infective agent (e.g., cancer), to treat, prevent, ameliorate, inhibit the progression of, or reduce the severity of one or more symptoms of the disease in the subject. For example, the immunogenic composition can be administered to a subject having AIDS to treat an HIV infection. Examples of symptoms of diseases caused by a viral infection, such as AIDS, include muscle aches, coughing, sneezing, runny nose, sore throat, headache, chills, diarrhea, vomiting, rash, weakness, dizziness, bleeding under the skin, in internal organs, or from body orifices like the mouth, eyes, or ears, shock, nervous system malfunction, delirium, seizures, renal (kidney) failure, personality changes, neck stiffness, dehydration, seizures, lethargy, paralysis of the limbs, confusion, back pain, loss of sensation, impaired bladder and bowel function, and sleepiness that can progress into coma or death. These symptoms, and their resolution during treatment, may be measured by, for example, a physician during a physical examination or by other tests and methods known in the art.

[0258] The compositions utilized in the methods described herein can be formulated, for example, for administration intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions.

[0259] The method of administration can vary depending on various factors (e.g., the components of the composition being administered, and the severity of the condition being treated). Formulations suitable for oral or nasal administration may consist of liquid solutions, such as an effective amount of the composition dissolved in a diluent (e.g., water, saline, or PEG-400), capsules, sachets, tablets, or gels, each containing a predetermined amount of a pharmaceutical composition described herein. The pharmaceutical composition may also be an aerosol formulation for inhalation, for example, to the bronchial passageways. Aerosol formulations may be mixed with pressurized, pharmaceutically acceptable propellants (e.g., dichlorodifluoromethane, propane, or nitrogen). In particular, administration by inhalation can be accomplished by using, for example, an aerosol containing sorbitan trioleate or oleic acid, for example, together with trichlorofluoromethane, dichlorofluoromethane, dichlorotetrafluoroethane, or any other biologically compatible propellant gas.

[0260] Immunogenicity of the immunogenic composition (e.g., vaccine) may be improved if it is coadministered with an immunostimulatory agent or adjuvant. Suitable adjuvants well-known to those skilled in the art include, for example, aluminum phosphate, aluminum hydroxide, QS21 , Quil A (and derivatives and components thereof), calcium phosphate, calcium hydroxide, zinc hydroxide, glycolipid analogs, octodecyl esters of an amino acid, muramyl dipeptides, polyphosphazene, lipoproteins, ISCOM matrix, DC-Chol, DDA, cytokines, and other adjuvants and derivatives thereof. Immunogenic compositions (e.g., vaccines) may be formulated to release the composition immediately upon administration (e.g., targeted delivery) or at any predetermined time period after administration using controlled or extended release formulations. Administration of the immunogenic composition in controlled or extended release formulations is useful where the composition, either alone or in combination, has (i) a narrow therapeutic index (e.g., the difference between the plasma concentration leading to harmful side effects or toxic reactions and the plasma concentration leading to a therapeutic effect is small; generally, the therapeutic index, Tl, is defined as the ratio of median lethal dose (LD50) to median effective dose (ED50)); (ii) a narrow absorption window at the site of release (e.g., the gastro-intestinal tract); or (iii) a short biological half-life, so that frequent dosing during a day is required in order to sustain a therapeutic level.

[0261] Immunogenic compositions (e.g., vaccines) may be administered to provide pre-exposure prophylaxis or after a subject has been diagnosed with an infection or a disease without an etiology traceable to an infective agent (e.g., cancer), or after exposure to an infective agent, such as a bacterium, virus, parasite, or fungus. The composition may be administered, for example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 35, 40, 45, 50, 55, or 60 minutes, 2, 4, 6, 10, 15, or 24 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, or even 3, 4, or 6 months pre-exposure or pre-diagnosis, or may be administered to the subject 15-30 minutes or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 20, 24, 48, or 72 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, 3, 4, 6, or 9 months, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 years or longer post-diagnosis or post-exposure to the infective agent.

[0262] When treating disease, the compositions may be administered to the subject either before the occurrence of symptoms or a definitive diagnosis or after diagnosis or symptoms become evident. For example, the composition may be administered immediately after diagnosis or the clinical recognition of symptoms or 2, 4, 6, 10, 15, or 24 hours, 2, 3, 5, or 7 days, 2, 4, 6 or 8 weeks, or even 3, 4, or 6 months after diagnosis or detection of symptoms. iv. Dosages

[0263] The immunogenic composition of the present disclosure can be administered in a therapeutically effective amount that provides an immunogenic and / or protective effect against an infective agent or target protein for a disease caused by a non-infective agent. The dose of the immunogenic composition or the number of treatments using the immunogenic composition may be increased or decreased based on the severity of, occurrence of, or progression of, the disease in the subject (e.g., based on the severity of one or more symptoms of, e.g., viral infection or cancer). Doses of the immunogenic composition may be administered as a fixed dose or a weight-based dose.

[0264] For example, the subject can be administered at least about 10 pg to 100 pg (e.g., 10 pg, 11 pg, 12 pg, 13 pg, 14 pg, 15 pg, 16 pg, 17 pg, 18 pg, 19 pg, 20 pg, 21 pg, 22 pg, 23 pg, 24 pg, 25 pg,

[0265] 26 pg, 27 pg, 28 pg, 29 pg, 30 pg, 31 pg, 32 pg, 33 pg, 34 pg, 35 pg, 36 pg, 37 pg, 38 pg, 39 pg, 40 pg, 41 pg, 42 pg, 43 pg, 44 pg, 45 pg, 46 pg, 47 pg, 48 pg, 49 pg, 50 pg, 51 pg, 52 pg, 53 pg, 54 pg,

[0266] 55 pg, 56 pg, 57 pg, 58 pg, 59 pg, 60 pg, 61 pg, 62 pg, 63 pg, 64 pg, 65 pg, 66 pg, 67 pg, 68 pg, 69 pg, 70 pg, 71 pg, 72 pg, 73 pg, 74 pg, 75 pg, 76 pg, 77 pg, 78 pg, 79 pg, 80 pg, 81 pg, 82 pg, 83 pg,

[0267] 84 pg, 85 pg, 86 pg, 87 pg, 88 pg, 89 pg, 90 pg, 91 pg, 92 pg, 93 pg, 94 pg, 95 pg, 96 pg, 97 pg, 98 lag , 99 gg , or 100 ig), 10 pig to 50 pig , 25 pig to 75 pig , or 50 pig to 100 pig of a fixed does of the immunogenic composition.

[0268] In another example, the subject can be administered at least about 0.01 pg per kilogram (kg) to 3 pg / kg (e.g., 0.01 pg / kg, 0.02 pg / kg, 0.03 pg / kg, 0.04 pg / kg, 0.05 pg / kg, 0.06 pg / kg, 0.07 pg / kg, 0.08 pg / kg, 0.09 pg / kg, 0.1 pg / kg, 0.2 pg / kg, 0.3 pg / kg, 0.4 pg / kg, 0.5 pg / kg, 0.6 pg / kg, 0.7 pg / kg, 0.8 pg / kg, 0.9 pg / kg, 1 pg / kg, 1 .1 pg / kg, 1 .2 pg / kg, 1 .3 pg / kg, 1 .4 pg / kg, 1 .5 pg / kg, 1 .6 pg / kg, 1 .7 pg / kg, 1 .8 pg / kg, 1 .9 pg / kg, 2 pg / kg, 2.5 pg / kg, or 3 pg / kg) of the subjects weight (e.g., a weight-based dose) of the immunogenic composition.

[0269] In yet another example, the subject can be administered at least 1 mg to 5000 mg (e.g., 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 1 1 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg,

[0270] 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg,

[0271] 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg,

[0272] 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, 90 mg, 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 1 10 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, 350 mg, 360 mg, 370 mg, 380 mg, 390 mg, 400 mg, 410 mg,

[0273] 420 mg, 430 mg, 440 mg, 450 mg, 460 mg, 470 mg, 480 mg, 490 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, 750 mg, 775 mg, 800 mg, 825 mg, 850 mg,

[0274] 875 mg, 900 mg, 925 mg, 950 mg, 975 mg, 1000 mg, 1 100 mg, 1200 mg, 1300 mg, 1400 mg, 1500 mg, 1600 mg, 1700 mg, 1800 mg, 1900 mg, 2000 mg, 2100 mg, 2200 mg, 2300 mg, 2400 mg, 2500 mg, 2600 mg, 2700 mg, 2800 mg, 2900 mg, 3000 mg, 3100 mg, 3200 mg, 3300 mg, 3400 mg, 3500 mg, 3600 mg, 3700 mg, 3800 mg, 3900 mg, 4000 mg, 4100 mg, 4200 mg, 4300 mg, 4400 mg, 4500 mg, 4600 mg, 4700 mg, 4800 mg, 4900 mg, or 5000 mg) of a fixed dose of the immunogenic composition.

[0275] In yet another example, the subject can be administered at least 0.01 mg / kg to 100 mg / kg (e.g., 0.01 mg / kg, 0.05 mg / kg, 0.10 mg / kg, 0.25 mg / kg, 0.50 mg / kg, 0.75 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 1 1 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 61 mg / kg, 62 mg / kg, 63 mg / kg, 64 mg / kg, 65 mg / kg, 66 mg / kg, 67 mg / kg, 68 mg / kg, 69 mg / kg, 70 mg / kg, 71 mg / kg, 72 mg / kg, 73 mg / kg, 74 mg / kg, 75 mg / kg, 76 mg / kg, 77 mg / kg, 78 mg / kg, 79 mg / kg, 80 mg / kg, 81 mg / kg, 82 mg / kg, 83 mg / kg, 84 mg / kg, 85 mg / kg, 86 mg / kg, 87 mg / kg, 88 mg / kg, 89 mg / kg, 90 mg / kg, 91 mg / kg, 92 mg / kg, 93 mg / kg, 94 mg / kg, 95 mg / kg, 96 mg / kg, 97 mg / kg, 98 mg / kg, 99 mg / kg, or 100 mg / kg) of a weight-based dose of the immunogenic composition. In yet another example, the subject can be administered a recombinant adeno-associated virus or adenovirus as described herein at a dose of about 1 x103genome copies (gc) / kilogram (kg) or between 1 x101and 1 x1016gc / kg, preferably between 1 x103and 1 x 1014gc / kg, and more preferably between 1 xt 05and 1 xt 011gc / kg. In some instances, the subject can be administered about 1 xt 01gc / kg, about 1 x102gc / kg, about 1 xt 03gc / kg, about 1 xt 04gc / kg, about 1 xt 05gc / kg, about 1 xt 06gc / kg, about 1 xt 07gc / kg, about 1 xt 08gc / kg, about 1 x109gc / kg, about 1 xt 010gc / kg, about 1 xt 011gc / kg, about 1 x1012gc / kg, about 1 xt 013gc / kg, about 1 xt 014gc / kg, about 1 xt 015gc / kg, or about 1 xt 016gc / kg.

[0276] In yet another example, the subject can be administered a recombinant adeno-associated virus or adenovirus as described herein at a dose of about 1 x103viral particles (vp) / dose or between 1 x101and 1 x1018vp / dose, preferably between 1 x103and 1 x1012vp / dose, and more preferably between 1 x105and 1 x1011vp / dose. In some instances, the subject can be administered about 1 x101vp / dose, about 1 x102vp / dose, about 1 x103vp / dose, about 1 x104vp / dose, about 1 x105vp / dose, about 1 x106vp / dose, about 1 x107vp / dose, about 1 x108vp / dose, about 1 x109vp / dose, about 1 x1010vp / dose, about 1 x1011vp / dose, about 1 x1012vp / dose, about 1 x1013vp / dose, about 1 x1014vp / dose, about 1 x1015vp / dose, about 1 x1016vp / dose, about 1 x1017vp / dose, or about 1 x1018vp / dose. Viral particles contain a nucleic acid molecule (e.g., vector) described herein which encodes, inter alia, an antigen (e.g., viral structural and non-structural proteins) by way of a transgene that was engineered into the nucleic acid molecule. The viral particles are surrounded by a protective coat, such as a polypeptide- based capsid (e.g., a polypeptide capsid described herein). Viral particle number can be measured based on, for example, lysis of vector particles, followed by measurement of the absorbance at 260 nm (see, e.g,. Steel, Curr. Opin. Biotech., 1999).

[0277] The dosage administered may depend on the subject to be treated (e.g., the age, body weight, capacity of the immune system, and general health of the subject being treated), the form of administration (e.g., as a solid or liquid), the manner of administration (e.g., by injection, inhalation, dry powder propellant), and the cells targeted (e.g., epithelial cells, such as blood vessel epithelial cells, nasal epithelial cells, or pulmonary epithelial cells). The immunogenic composition is preferably administered in an amount that provides a sufficient level of the immunogenic transgene.

[0278] Alternatively, the efficacy of treatment can be determined by monitoring the level of the antigenic or therapeutic gene product, or fragment thereof, expressed in a subject (e.g., a human) following administration of the compositions described herein. For example, the blood or lymph of a subject can be tested for the immunogenic transgene, or fragment thereof, using, for example, standard assays known in the art (see, e.g., Human Interferon-Alpha Multi-Species ELISA kit (Product No. 41 105) and the Human Interferon-Alpha Serum Sample kit (Product No. 41 1 10) from Pestka Biomedical Laboratories (PBL), Piscataway, New Jersey).

[0279] A single dose of the immunogenic composition may achieve protection, pre-exposure or prediagnosis. In addition, a single dose administered post-exposure or post-diagnosis can function as a treatment according to the present disclosure. A single dose of the immunogenic composition can also be used to achieve therapy in subjects being treated for a disease. Multiple doses (e.g., 2, 3, 4, 5, or more doses) can also be administered, if necessary, to these subjects.

[0280] Single or multiple administrations of the immunogenic composition may be given (pre- or post-exposure and / or pre- or post-diagnosis) to a subject (e.g., one administration or administration two or more times). For example, subjects who are particularly susceptible to, for example, viral infection may require multiple treatments to establish and / or maintain protection against the virus. Levels of induced immunity provided by the immunogenic composition can be monitored by, for example, measuring amounts of neutralizing secretory and serum antibodies. The dosages may then be adjusted or repeated as necessary to trigger the desired level of immune response. For example, the immune response triggered by a single administration (prime) of an immunogenic composition may not be sufficiently potent and / or persistent to provide effective protection. Accordingly, in some instances, repeated administration (boost), such that a prime-boost regimen is established, can significantly enhance humoral and cellular responses to the immunogenic composition. Such regimens may involve delivery of one or more immunogenic compositions either simultaneously or sequentially with another immunogenic compositions (e.g., an AAV vector, a vaccine, etc.) known in the art. A prime-boost regimen may be either a homologous prime-boost or a heterologous primeboost. Such uses will be readily apparent to one of skill in the art and are described further below. v. Prime-Boost Regimens

[0281] The immunogenic compositions described herein can be used in prime-boost treatment regimens. Prime-boost regimens involve the administration of a first immunogenic composition (the priming composition) followed by administration of a second immunogenic composition (the boosting composition) to a subject to induce an immune response. The boosting composition is administered to the subject after the priming composition; the skilled artisan will understand a suitable time interval between administration of the priming composition and the boosting composition, and examples of such time frames are disclosed herein.

[0282] The primary requirements of the boosting composition are that the antigen (which is encoded by the immunogenic transgene) is the same antigen, or a cross-reactive antigen, as that encoded by the priming composition. The boosting composition may be derived from the same viral source or from another source relative to the priming composition (e.g., a homologous or heterologous primeboost regimen). Alternatively, the boosting composition may contain the same antigen as is encoded in the priming composition, but in the form of a protein or peptide. In other instances, the boosting composition contains an immunogenic transgene sequence encoding the antigen under the control of a regulatory sequence directing its expression in a mammalian cell.

[0283] The prime-boost regimens may deliver any antigen(s) known in the art, including those described herein, e.g., a bacterial antigen, a viral antigen, a fungal antigen, or a cancer antigen described herein.

[0284] For example, priming may involve delivering a first immunogenic composition (e.g., a vector having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1 -9) followed by boosting with a second immunogenic composition (e.g., a different vector including a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1 -9) or, alternatively, a second immunogenic composition containing the antigen itself in protein form. In one example, the prime- boost regimen can provide a protective immune response to the virus, bacteria, or other organism from which the antigen is derived. In another instance, the prime-boost regimen provides a therapeutic effect that can be measured using conventional assays for detection of the presence of, or amelioration of, the condition for which therapy is being administered. The level of an immunogenic response against the selected antigen(s) can be monitored to determine the need, if any, for a booster(s). An assessment of CD8+ T cell response, or optionally, antibody titers, in the serum, can be used to determine whether optional booster immunizations may be needed.

[0285] In some instances, the same immunogenic composition (e.g., a different vector including a nucleotide sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1 -9) is used to deliver one or more antigens in the priming composition and in the boosting composition. Alternatively, the immunogenic composition may be delivered in a combination regimen involving sequential administration, or co-administration, with a different immunogenic composition. Delivery may further include sequential or coadministration administration with one or more additional immunogenic compositions (e.g., a functionally E1 -deleted and / or functionally E4-deleted virus or one or more additional vectors or other therapeutic and / or vaccine agents).

[0286] Additional vectors known in the art may be used as an immunogenic composition in the prime-boost regimen described herein. Examples of suitable non-human primate vectors that can be used as part of a prime-boost regimen herein include simian adenoviruses, such as, Pan5 (also C5), Pan6 (also C6), Pan7 (also C7), SV1 , SV25, SV39 (see, WO 02 / 33645, incorporated by reference), and Pan 9 (also C68) and C1 (U.S. Pat. No. 6,083,716, incorporated by reference), and SA 18 (U.S. Pat. No. 7,291 ,498) and its international counterpart WO 2005 / 001103, incorporated herein by reference). Other vectors that can be used in a prime-boost regimen include pseudotyped adenoviruses, chimeric and hybrid adenoviral vectors. See, e.g., U.S. Pat. No. 7,291 ,498 and WO 2005 / 001103, incorporated herein by reference.

[0287] The priming composition or boosting composition can be administered at various sites In the body. The regimen may involve a priming and boosting step, each of which may include a dose or dosage that is administered one or more times hourly, daily, weekly, biweekly , monthly, bi-monthly, or yearly. The amount or site of delivery is or may be selected based upon the identity and condition of the subject.

[0288] The dosage unit of the priming or boosting composition suitable for delivery of the antigen to the subject can be based on the dosages described herein. For example, the priming or boosting composition can be prepared for administration by being suspended or dissolved in a pharmaceutically or physiologically acceptable carrier such as isotonic saline; isotonic salts solution or other formulations that will be apparent to those skilled in such administration. The appropriate carrier will be evident to those skilled in the art and will depend in large part upon the route of administration. The compositions described herein may be administered to a subject according to administration routes described herein, in a sustained release formulation using a biodegradable biocompatible polymer, or by on-site delivery using micelles, gels and liposomes. Optionally, the priming step also includes administering with the priming composition, a suitable amount of an adjuvant, such as are defined herein.

[0289] Depending upon the desired routes of administration, one of skill in the art can select an appropriate regimen. In general, a second, or subsequent immunization, composition can be administered about 2 to about 27 weeks after administering the preceding immunization composition, to the mammalian subject. The administration of the subsequent composition is accomplished using an effective amount of a composition containing or capable of delivering the same antigen as administered by the prior composition. Desirably, the product of the boosting composition is the same, or cross-reactive, as that encoded by the priming composition.

[0290] The time period between sequential administrations, according to the present invention, can be adjusted according to the order of vector-mediated delivery, and any optional additional priming or boosting compositions (e.g., DNA-based or protein-based immunogenic compositions). For example, peak immune response is generally observed about 10 to 14 days following an Ad-mediated delivery. However, boosting following this peak may generate a second peak. Thus, it may be desirable to time expression of a boosting antigen to express from about 10 to 21 days, or 18 to 28 days, or 28 days to 27 weeks following Ad-mediated delivery.

[0291] D. Combination Therapies

[0292] The pharmaceutical compositions described herein may be administered in combination with an additional therapeutic agent. For example, the pharmaceutical compositions may be formulated for co-administration or sequential administration with one or more additional active agents that can be used to treat a disease or disorder described herein (e.g., a cardiovascular disease, a cancer, a neurological disease, an autoimmune disease, or an infectious disease). For instance, administration of an additional therapeutic agent may be prior to, concurrent with, or subsequent to the administration of a pharmaceutical composition described herein.

[0293] Pharmaceutical compositions may also be used in combination with one or more antibiotics that can be administered to a subject (e.g., a human) suffering from an infectious disease. For instance, pharmaceutical compositions described herein may be admixed with, or administered separately from, an antibiotic useful for treating one or more infectious diseases, such as amikacin, gentamicin, kanamycin, neomycin, netilmicin, tobramycin, paromomycin, streptomycin, spectinomycin, geldanamycin, herbimycin, rifaximin, loracarbef, ertapenem, doripenem, imipenem, meropenem, cefadroxil, cefazolin, cefazlexin, cefaclor, cefoxitin, cefprozil, cefuroxime, cefdinir, cefditoren, cefoperazone, clindamycin, lincomycin, daptomycin, erythromycin, linezolid, torezolid, amoxicillin, ampicillin, bacitracin, ciprofloxacin, doxycycline, and tetracycline, among others.

[0294] The pharmaceutical composition can be administered in combination with one or more additional therapeutic agents, for example, for treating a viral infection, such as an HIV infection (e.g., an HIV-1 infection) in a subject. Such additional therapeutic agents can include, for example, a broadly neutralizing antibody (bnAb), e.g., those described in PCT Application No. PCT / US14 / 58383, WO 2012 / 030904, and WO 2013 / 055908, each of which is incorporated by reference herein in its entirety. Further bnAbs that can be administered in combination with the pharmaceutical composition include, for example, a CD4 binding site (CD4bs)-specific antibody (e.g., 3BNC117 or VRC07-523) or a V2 glycan-dependent antibody (e.g., CAP256-VRC26).

[0295] The additional therapeutic agent can also be an antiretroviral therapy (ART), which may, e.g., be selected from any one or more of the following, or combinations thereof: efavirenz, emtricitabine, and tenofovir disoproxil fumarate (Atripla); emtricitabine, rilpivirine, and tenofovir disoproxil fumarate (Complera); elvitegravir, cobicistat, emtricitabine, and tenofovir disoproxil fumarate (Stribild); lamivudine and zidovudine (Combivir); emtricitabine, FTC (Emtriva); lamivudine, 3TC (Epivir); abacavir and lamivudine (Ebzicom); zalcitabine, dideoxycytidine, ddC (Hivid); zidovudine, azidothymidine, AZT, ZDV (Retrovir); abacavir, zidovudine, and lamivudine (Trizivir); tenofovir disoproxil fumarate and emtricitabine (Truvada); enteric coated didanosine, ddl EC (Videx EC); didanosine, dideoxyinosine, ddl (Videx); tenofovir disoproxil fumarate, TDF (Viread); stavudine, d4T (Zerit); abacavir sulfate, ABC (Ziagen); Rilpivirine (Edurant); Etravirine (Intelence); delavirdine, DLV (Rescriptor); efavirenz, EFV (Sustiva); nevirapine, NVP (Viramune or Viramune XR); amprenavir, APV (Agenerase); tipranavir, TPV (Aptivus); indinavir, IDV (Crixivan); saquinavir (Fortovase); saquinavir mesylate, SQV (Invirase); lopinavir and ritonavir, LPV / RTV (Kaletra); Fosamprenavir Calcium, FOS- APV (Lexiva); ritonavir, RTV (Norvir); Darunavir (Prezista); atazanavir sulfate, ATV (Reyataz); nelfinavir mesylate, NFV (Viracept); enfuvirtide, T-20 (Fuzeon); maraviroc (Selzentry); raltegravir, RAL (Isentress); and dolutegravir (Tivicay).

[0296] The additional therapeutic agent can be an immunomodulator. The immunomodulator may, e.g., be selected from any one or more of the following, or combinations thereof: AS-101 , Bropirimine, Acemannan, CL246,738, EL10, FP-21399, Gamma Interferon, Granulocyte Macrophage Colony Stimulating Factor, HIV Core Particle Immunostimulant, IL-2, Immune Globulin Intravenous, IMREG-1 , IMREG-2, Imuthiol Diethyl Dithio Carbamate, Alpha-2 Interferon, Methionine-Enkephalin, MTP-PE Muramyl-Tripeptide, Granulocyte Colony Stimulating Factor, Remune, CD4 (e.g., recombinant soluble CD4), rCD4-lgG hybrids, SK&F106528 Soluble T4, Thymopentin, Tumor Necrosis Factor, and Infliximab.

[0297] The additional therapeutic agent can be a reservoir activator. The reservoir activator may, e.g., be selected from any one or more of the following, or combinations thereof: histone deacytelase (HDAC) inhibitors (e.g., romidepsin, vorinostat, and83simertinib83t), immunologic activators (e.g., cytokines and TLR agonists (e.g., TLR7 agonist, such as GS-986), and dedicated small molecule drugs.

[0298] The additional therapeutic agent can be a chemotherapy agent. Exemplary chemotherapy agents include: Abiraterone Acetate, ABITREXATE® (Methotrexate), ABRAXANE® (Paclitaxel Albumin), ADRIAMYCIN®, bleomycin, vinblastine, and dacarbazine (ABVD), ADRIAMYCIN®, bleomycin, vincristine sulfate, and etoposide phosphate (ABVE), ADRIAMYCIN®, bleomycin, vincristine sulfate, etoposide phosphate, prednisone, and cyclophosphamide (ABVE-PC), doxorubicin and cyclophosphamide (AC), doxorubicin, cyclophosphamide, and paclitaxel or docetaxel (AC-T), ADCETRIS® (Brentuximab Vedotin), cytarabine, daunorubicin, and etoposide (ADE), ado- trastuzumab emtansine, ADRIAMYCIN® (doxorubicin hydrochloride), afatinib dimaleate, AFINITOR® (Everolimus), AKYNZEO® (netupitant and palonosetron hydrochloride), ALDARA® (imiquimod), aldesleukin, ALECENSA® (alectinib), alectinib, alemtuzumab, ALKERAN® for Injection (Melphalan Hydrochloride), ALKERAN® tablets (melphalan), ALIMTA® (pemetrexed disodium), ALOXI® (palonosetron hydrochloride), AMBOCHLORIN® (chlorambucil), AMBOCLORIN® (Chlorambucil), aminolevulinic acid, anastrozole, aprepitant, AREDIA® (pamidronate disodium), ARIMIDEX® (anastrozole), AROMASIN® (exemestane), ARRANON® (nelarabine), arsenic trioxide, ARZERRA® (ofatumumab), asparaginase Erwinia chrysanthemi, AVASTIN® (bevacizumab), axitinib, azacitidine, BEACOPP Becenum (carmustine), BELEODAQ® (Belinostat), belinostat, bendamustine hydrochloride, bleomycin, etoposide, and cisplatin (BEP), bevacizumab, bexarotene, BEXXAR® (tositumomab and iodine1311 tositumomab), bicalutamide, BiCNU (carmustine), bleomycin, blinatumomab, BLINCYTO® (blinatumomab), bortezomib, BOSULIF® (bosutinib), bosutinib, brentuximab vedotin, busulfan, BUSULFEX® (busulfan), cabazitaxel, cabozantinib-S-malate, CAF, CAMPATH® (alemtuzumab), CAMPTOSAR® (irinotecan hydrochloride), capecitabine, CAPOX, CARAC® (fluorouracil), carboplatin, CARBOPLATIN-TAXOL®, carfilzomib, CARMUBRIS® (carmustine), carmustine, carmustine implant, CASODEX® (bicalutamide), CEENU (lomustine), cisplatin, etoposide, and methotrexate (CEM), ceritinib, CERUBIDINE® (daunorubicin hydrochloride), CERVARIX® (recombinant HPV bivalent vaccine), cetuximab, chlorambucil, chlorambucil-prednisone, CHOP, cisplatin, CLAFEN® (cyclophosphamide), clofarabine, CLOFAREX® (clofarabine), CLOLAR® (Clofarabine), CMF, cobimetinib, cometriq (cabozantinib-S-malate), COPDAC, COPP, COPP-ABV, COSMEGEN® (dactinomycin), COTELLIC® (cobimetinib), crizotinib, CVP, cyclophosphamide, CYFOS® (ifosfamide), CYRAMZA® (ramucirumab), cytarabine, cytarabine liposome, CYTOSAR-U® (cytarabine), CYTOXAN® (cyclophosphamide), dabrafenib, dacarbazine, DACOGEN® (decitabine), dactinomycin, daratumumab, DARZALEX® (daratumumab), dasatinib, daunorubicin hydrochloride, decitabine, degarelix, denileukin diftitox, denosumab, DEPOCYT® (cytarabine liposome), dexamethasone, dexrazoxane hydrochloride, dinutuximab, docetaxel, DOXIL® (doxorubicin hydrochloride), doxorubicin hydrochloride, DOX-SL® (doxorubicin hydrochloride), DTIC-DOME® (dacarbazine), EFUDEX (fluorouracil), ELITEK® (rasburicase), ELLENCE® (epirubicin hydrochloride), elotuzumab, ELOXATIN® (oxaliplatin), eltrombopag olamine, EMEND® (aprepitant), EMPLICITI® (elotuzumab), enzalutamide, epirubicin hydrochloride, EPOCH, ERBITUX® (cetuximab), eribulin mesylate, ERIVEDGE® (vismodegib), erlotinib hydrochloride, ERWINAZE® (asparaginase Erwinia chrysanthemi), ETOPOPHOS® (etoposide phosphate), etoposide, etoposide phosphate, EVACET® (doxorubicin hydrochloride liposome), everolimus, EVISTA® (raloxifene hydrochloride), EVOMELA® (melphalan hydrochloride), exemestane, 5-FU (5-fluorouracil), FARESTON® (toremifene), FARYDAK® 84simertinib84t), FASLODEX® (fulvestrant), FEC, FEMARA® (letrozole), filgrastim, FLUDARA® (fludarabine phosphate), fludarabine phosphate, FLUOROPLEX® (fluorouracil), fluorouracil injection, flutamide, FOLEX® (methotrexate), FOLEX® PFS (methotrexate), FOLFIRI, FOLFIRI-bevacizumab, FOLFIRI-cetuximab, FOLFIRINOX, FOLFOX, FOLOTYN® (pralatrexate), FU- LV, fulvestrant, GARDASIL® (recombinant HPV quadrivalent vaccine), GARDASIL 9® (recombinant HPV nonavalent vaccine), GAZYVA® 84simertinib84b), gefitinib, gemcitabine hydrochloride, gemcitabine-cisplatin, gemcitabine-oxaliplatin, gemtuzumab ozogamicin, GEMZAR® (gemcitabine hydrochloride), GILOTRIF® (afatinib dimaleate), GLEEVEC® (imatinib mesylate), GLIADEL® (carmustine implant), GLIADEL® wafer (carmustine implant), glucarpidase, goserelin acetate, HALAVEN® (eribulin mesylate), HERCEPTIN® (trastuzumab), HPV bivalent vaccine, HYCAMTIN® (topotecan hydrochloride), Hyper-CVAD, IBRANCE (palbociclib), IBRITUMOMAB® tiuxetan, ibrutinib, ICE, ICLUSIG® (ponatinib hydrochloride), IDAMYCIN® (idarubicin hydrochloride), idarubicin hydrochloride, idelalisib, IFEX® (ifosfamide), ifosfamide, ifosfamidum, IL-2 (aldesleukin), imatinib mesylate, IMBRUVICA® (ibrutinib), ilmiquimod, IMLYGIC® (talimogene laherparepvec), INLYTA (axitinib), recombinant interferon alpha-2b, intron A, tositumomab, such as1311 tositumomab, ipilimumab, IRESSA® (gefitinib), irinotecan hydrochloride, ISTODAX® (romidepsin), ixabepilone, ixazomib citrate, IXEMPRA® (ixabepilone), JAKAFI® (ruxolitinib phosphate), JEVTANA® (cabazitaxel), KADCYLA® (ado-trastuzumab emtansine), KEOXIFENE® (raloxifene hydrochloride), KEPIVANCE® (palifermin), KEYTRUDA® (pembrolizumab), KYPROLIS® (carfilzomib), lanreotide acetate, lapatinib ditosylate, lenalidomide, 85simertinib mesylate, LENVIMA® 85simertinib mesylate), letrozole, leucovorin calcium, leukeran (chlorambucil), leuprolide acetate, levulan (aminolevulinic acid), LINFOLIZIN® (chlorambucil), LIPODOX® (doxorubicin hydrochloride liposome), lomustine, LONSURF® (trifluridine and tipiracil hydrochloride), LUPRON® (leuprolide acetate), LYNPARZA® 85simertib), MARQIBO® (vincristine sulfate liposome), MATULANE® (procarbazine hydrochloride), mechlorethamine hydrochloride, megestrol acetate, MEKINIST® (trametinib), melphalan, melphalan hydrochloride, mercaptopurine, MESNEX® (mesna), METHAZOLASTONE® (temozolomide), methotrexate, methotrexate LPF, MEXATE® (methotrexate), MEXATE-AQ® (methotrexate), mitomycin C, mitoxantrone hydrochloride, MITOZYTREX® (mitomycin C), MOPP, MOZOBIL® (plerixafor), MUSTARGEN® (mechlorethamine hydrochloride), MUTAMYCIN® (mitomycin C), MYLERAN® (busulfan), MYLOSAR® (azacitidine), MYLOTARG® (gemtuzumab ozogamicin), nanoparticle paclitaxel, NAVELBINE® (vinorelbine tartrate), NECITUMUMAB, nelarabine, NEOSAR® (cyclophosphamide), netupitant and palonosetron hydrochloride, NEUPOGEN® (filgrastim), NEXAVAR® (sorafenib tosylate), NILOTINIB, NINLARO® (ixazomib citrate), nivolumab, NOLVADEX® (tamoxifen citrate), NPLATE® (romiplostim),85simertinib85b, ODOMZO® (sonidegib), OEPA, ofatumumab, OFF,85simertib, omacetaxine mepesuccinate, ONCASPAR® (pegaspargase), ondansetron hydrochloride, ONIVYDE® (irinotecan hydrochloride liposome), ONTAK® (denileukin diftitox), OPDIVO® (nivolumab), OPPA,85simertinibb, oxaliplatin, paclitaxel, paclitaxel albumin- stabilized nanoparticle formulation, PAD, palbociclib, palifermin, palonosetron hydrochloride, palonosetron hydrochloride and netupitant, pamidronate disodium, panitumumab,85simertinib85t, PARAPLAT® (carboplatin), PARPLATIN® (carboplatin), pazopanib hydrochloride, PCV, pegaspargase, peginterferon alpha-2b, PEG-INTRON® (peginterferon alpha-2b), pembrolizumab, pemetrexed disodium, PERJETA® (pertuzumab), pertuzumab, PLATINOL® (cisplatin), PLATINOL- AQ® (cisplatin), plerixafor, pomalidomide, POMALYST® (pomalidomide), ponatinib hydrochloride, PORTRAZZA® (necitumumab), pralatrexate, prednisone, procarbazine hydrochloride, PROLEUKIN® (aldesleukin), PROLIA® (denosumab), PROMACTA (eltrombopag olamine), PROVENGE® (sipuleucel-T), PURINETHOL® (mercaptopurine), PURIXAN® (mercaptopurine),223Ra dichloride, raloxifene hydrochloride, ramucirumab, rasburicase, R-CHOP, R-CVP, recombinant human papillomavirus (HPV), recombinant interferon alpha-2b, regorafenib, R-EPOCH, REVLIMID® (lenalidomide), RHEUMATREX® (methotrexate), RITUXAN® (rituximab), rolapitant hydrochloride, romidepsin, romiplostim, rubidomycin (daunorubicin hydrochloride), ruxolitinib phosphate, SCLEROSOL® intrapleural aerosol (talc), siltuximab, sipuleucel-T, somatuline depot (lanreotide acetate), sonidegib, sorafenib tosylate, SPRYCEL® (dasatinib), STANFORD V, sterile talc powder (talc), STERITALC® (talc), STIVARGA® (regorafenib), sunitinib malate, SUTENT® (sunitinib malate), SYLATRON® (peginterferon alpha-2b), SYLVANT® (siltuximab), SYNOVIR® (thalidomide), SYNRIBO® (omacetaxine mepesuccinate), thioguanine, TAC, TAFINLAR® (dabrafenib), TAGRISSO® 86simertinibb), talimogene laherparepvec, tamoxifen citrate, tarabine PFS (cytarabine), TARCEVA (erlotinib hydrochloride), TARGRETIN® (bexarotene), TASIGNA® (nilotinib), TAXOL® (paclitaxel), TAXOTERE® (docetaxel), TEMODAR® (temozolomide), temsirolimus, thalidomide, THALOMID® (thalidomide), thioguanine, thiotepa, TOLAK® (topical fluorouracil), topotecan hydrochloride, toremifene, TORISEL® (temsirolimus), TOTECT® (dexrazoxane hydrochloride), TPF, trabectedin, trametinib, TREANDA® (bendamustine hydrochloride), trifluridine and tipiracil hydrochloride, TRISENOX® (arsenic trioxide), TYKERB® (lapatinib ditosylate), UNITUXIN® (dinutuximab), uridine triacetate, VAC, vandetanib, VAMP, VARUBI® (rolapitant hydrochloride), vectibix (panitumumab), VelP, VELBAN® (vinblastine sulfate), VELCADE® (bortezomib), VELSAR (vinblastine sulfate), VEMURAFENIB, VIADUR (leuprolide acetate), VIDAZA (azacitidine), vinblastine sulfate, VINCASAR® PFS (vincristine sulfate), vincristine sulfate, vinorelbine tartrate, VIP, vismodegib, VISTOGARD® (uridine triacetate), VORAXAZE® (glucarpidase), vorinostat, VOTRIENT® (pazopanib hydrochloride), WELLCOVORIN® (leucovorin calcium), XALKORI® (crizotinib), XELODA® (capecitabine), XELIRI, XELOX, XGEVA® (denosumab), XOFIGO® (223Ra dichloride), XTANDI® (enzalutamide), YERVOY® (ipilimumab), YONDELIS® (trabectedin), ZALTRAP® (ziv-aflibercept), ZARXIO® (filgrastim), ZELBORAF® (vemurafenib), ZEVALIN® (ibritumomab tiuxetan), ZINECARD® (dexrazoxane hydrochloride), ziv-aflibercept, ZOFRAN® (ondansetron hydrochloride), ZOLADEX® (gGoserelin acetate), zoledronic acid, ZOLINZA® (vorinostat), ZOMETA® (zoledronic acid), ZYDELIG® (idelalisib), ZYKADIA® (ceritinib), and ZYTIGA (abiraterone acetate).

[0299] III. Methods of Production

[0300] Also featured herein are methods of producing a recombinant adeno-associated virus or adenovirus or a viral vector as described herein. To produce recombinant adeno-associated viruses, adenoviruses, or viral vectors of the present disclosure, a cell can be transfected with an isolated nucleic acid molecule described herein or a complement thereof. Cells that can be transfected include mammalian cells. For example, the transfected cell may be a Chinese hamster overy (CHO) cell, or other cell types known in the art. Following transfection, the cell may be cultured in a suitable medium to allow replication of the nucleic acid molecule or the vector in said cell and the recombinant virus or vector may be harvested from the cell and / or from the medium for use in accordance with any of the methods described herein. Methods of transfecting plasmids (and cosmids) are well known in the art. Moreover, suitable medium for packaging cells have also been described in the art and are not elaborated on herein. Harvesting methods are also known to the skilled person. Methods for producing recombinant adeno-associated viruses and adenoviruses, suitable cell lines for recombinant vector production, and transfection methods are known in the art (See, e.g., U.S. Patent No. 8, 394, 386, incorporated herein by reference).

[0301] IV. Kits

[0302] Also featured herein are kits that include one or more of the compositions described herein, such as the nucleic acid molecules, vectors (e.g., AAV vectors and rAAV vectors), recombinant viruses (e.g., recombinant adeno-associated viruses or adenoviruses having a capsid protein as described herein), and any pharmaceutical compositions thereof (e.g., immunogenic compositions), in a therapeutically effective amount for treating and / or reducing the symptoms of a disease. The kits can include instructions directing a clinician (e.g., a physician or nurse) in methods for administering the composition contained therein. The kits may include packages of single-doses or multiple doses of the immunogenic compositions. Optionally, instruments or devices necessary for administering the pharmaceutical composition(s) may be included in the kits. For instance, a kit of this invention may provide one or more pre-filled syringes containing an effective amount of the immunogenic composition. Furthermore, the kits may also include additional components, such as instructions or schedules for administration of the composition.

[0303] EXAMPLES

[0304] Example 1 : Identification of a Major Neutralization Epitope for Rhesus Adeno-Associated Viruses

[0305] This example illustrates the discovery and functional characterization of capsid proteins from a previously unidentified virome to add to the repertoire of AAV capsids and further characterizing a small neutralization determinant region (i.e., a neutralization domain, e.g., hypervariable region IV neutralization epitope (HRNE)) of an identified capsid.

[0306] A. Discovery of AAV Capsids

[0307] / . Methods of isolating and vectorizing rhesus macaque adeno-associated viruses

[0308] Stool samples from rhesus macaques (Macaca mulatta) that tested positive for the presence of AAV by metagenomics sequencing were resuspended in unsupplemented Dulbecco modified Eagle medium (DMEM) and filtered through a 0.45 pm pore size filter. Human E1 -complementing cells were infected with the filtrates, incubated at 37°C with 10% CO2, and monitored for cytopathic effects (CPEs) (Abbink et al. J. Virol. 89:1512-1522, 2015). DNA was extracted from infected cell supernatants and subjected to PCR amplification using degenerate primers targeting the Cap gene of AAV. Primers were designed to an alignment of readily available Cap genes from the Genbank database. PCR fragments were analyzed on agarose gel, and those of the expected size were extracted and cloned into an in-house constructed AAV2 RepCap plasmid, using Gibson assembly (Abbink et al. J. Virol. 92:10.1128 / jvi.01924-01917, 2018). Isolated Cap genes were blasted via Genbank databases to confirm the gene sequences have not been identified. Recombinant AAVs were rescued by transfecting human embryonic kidney cells by triple transfection together with a generated AAV2 ITR plasmid carrying a transgene expression cassette consisting of a cytomegalovirus (CMV) promoter, a multiple-cloning site, and a simian virus 40 (SV40) polyadenylation signal, together with a helper plasmid carrying helper genes E2, E4 and VA RNA. Virus particles were purified through iodixanol density centrifugation through standard protocols (Fripont et al. J Vis Exp. Doi:10.3791 / 58960, 2019).

[0309] / ' / . Methods of growing and purifying AA Vs

[0310] A transgene cassette containing a CMV promoter and a transgene of interest (e.g., Luciferase or eGFP) was cloned into an AAV2.ITR plasmid. The AAV2.ITR plasmid was co-transfected with the Rep / Cap plasmid and a pHelper plasmid (Applied Viromics) into 293T / 17 cells plated 1 day prior to transfection. Cells were incubated at 37°C with 10% CO2. After 72 hours, cell supernatants were harvested and combined with 5x PEG solution (Teknova catalog #P4190) and incubated at 4°C overnight. Supernatants were then centrifuged at 8000 x <7 for 30 minutes to pellet the virus. Pellets were resuspended and treated with benzonase. Virus was purified using iodixonal gradient centrifugation. Packaged virus particles were quantified by qPCR using primers targeting the CMV promoter region.

[0311] Hi. Results

[0312] When infected with SIV, rhesus macaques (Macaca mulatta) were observed to have a significant increase in viral reads within stool samples in many viral families including Parvoviridae. To investigate if these samples included new AAV capsids stool samples were harvested from rhesus macaques that had tested positive for parvoviruses. The stool was filtered and then used to infect human E1 -complementing cells. Cells were monitored for cytopathic effect as indicative of helper virus necessary for AAV replication. If cytopathic effect was observed, cell supernatants were harvested and subjected to PCR amplification using degenerative AAV capsid primers targeting the capsid genes (e.g., VP1 , VP2, and VP3) of AAVs. PCR products were sequenced and then cloned into AAV2 RepCap plasmids. Five previously unidentified capsids were discovered (RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, and RhAAV6674).

[0313] Phylogenetic analysis of the capsid VP1 proteins showed that RhAAV4282 (e.g., SEQ ID NOs: 1 and 80) was closely related to AAV7 (SEQ ID NOs: 6, 85), whereas RhAAV4302A.1 (e.g., SEQ ID NOs: 2 and 81 ), RhAAV4302A.2 (e.g., SEQ ID NOs: 3 and 82), RhAAV4302B (e.g., SEQ ID NOs: 4 and 83), and RhAAV6674 (e.g., SEQ ID NOs: 5 and 84) were more closely related to AAV8 and AAV9 (e.g., SEQ ID NOs: 7 and 86) (FIG. 1 A). All five capsids shared >85% amino acid similarity among themselves, although RhAAV4282 was the most divergent capsid among the five isolates. The RhAAV4282 VP1 protein shared 91 .4% protein sequence similarity to AAV7 VP1 with only 65 amino acid differences. RhAAV4302A.1 (89.7%), RhAAV4302A.2 (89.5%), RhAAV4302B (91.6%), and RhAAV6674 (92.8%) all shared most sequence homology with AAV8 (FIG. 1 B). RhAAV4282 was the most divergent capsid and exhibited the best growth profile due to higher production titers. All capsids could be used to generate functional vectors with normal size (e.g., 25 nm diameter) and shape (FIG. 1 C), and each capsid had the capacity to infect cells as measured by eGFP expression (FIG. 1 D). B. Biochemical Characterization of Capsid Protein

[0314] / . In vitro receptor assays

[0315] AAVR-KO HeLa cells, H1 HeLa wildtype cells, CMAS-KO HEK293T cells, and HEK293T WT cells were seeded in a 96 well plate at 10,000 cells per well. After overnight incubation AAV vectors encoding eGFP were added at the following multiplicity of infections (MOIs): 0, 1 ,000, 5,000, 10,000, 50,000, and 100,000. After 72 hours (or 24 hours in the case of FIG. 9 and FIG. 10) cells were harvested and stained with live-dead stain (ThermoFisher Scientific: L34976) and fixed with paraformaldehyde. GFP-positive live cells were quantified by flow cytometry, in which GFP positivity was used as a surrogate for successful infection. For each vector, the selected MOI was based on the lowest MOI in which a majority of wildtype cells were GFP positive. In instances where none of the tested MOIs yielded over 50% GFP-positive cells, the highest tested MOI was used.

[0316] For heparin attachment factor testing, HEK293T cells were plated for knockout experiments. The following day, cells were incubated with successive dilutions of Heparinase III from Flavobacterium heparinum (Sigma Aldrich H8891 -10UN) for 1 hour at room temperature. Cells were washed with PBS and were transfected with AAV vectors encoding eGFP at the following MOIs per serotype: AAV1 : 10000 MOI, AAV2: 1000 MOI, AAV9: 100000 MOI, and RhAAV4282: 100000 MOI. After 72 hours cells were harvested and stained with live-dead stain (ThermoFisher Scientific: L34976) and fixed with paraformaldehyde. GFP-positive live cells were quantified by flow cytometry.

[0317] HeLa cells were purchased from Canopy Biosciences. AC16 cells were purchased from Sigma Aldrich (SCC109). A549 (CCL-185) and HepG2 (HB-8065) cells were obtained from American Type Culture Collection (ATCC). All cells except AC16 cells were grown in DMEM with 10% FBS and 1% MgCl2. AC16 cells were grown in DMEM:F12 (ThermoFisher) with 12.5% FBS, 2 nM Glutamine, and 1% Pen-Strep.

[0318] / ' / . Capsid stability assay

[0319] SYPRO Orange (ThermoFisher: S6651 ) was diluted 1 :100 (v / v) in PBS and then 2.5 pL of the diluted SYPRO™ Orange was combined with an AAV of interest (5 pL) and dPBS (17.5 pL). Sample fluorescence readings were monitored using a QUANTSTUDIO™ 6 and 7 Flex Real-Time PCR System (Applied Biosciences). Samples were incubated at 25°C for 2 minutes, then a temperature gradient from 25°C to 99°C was conducted at 0.05°C per step.

[0320] Hi. Results

[0321] First, RhAAV4282 cell transduction efficacy was compared to closely related AAV7 and commonly used AAV9. Transduction efficiency was similar in all cell lines tested (FIGS. 15A-15E). Next, RhAAV4282 mechanisms of receptor attachment and cellular entry were evaluated via in vitro methods. The two common AAV attachment factors, heparin sulfate and sialic acid, were tested in addition to the AAV receptor (AAVR) KIAA0319L (Pillay et al. Nature. 530:108-112, 2016, and Pillay et al. J. Virol. 91 :10.1128 / jvi.00391 -00317, 2017). RhAAV4282 expressing eGFP was used, and resulting eGFP positive cells were used as a proxy for transduction. To test heparin sulfate usage, HEK293T cells were treated with increasing levels of heparinase III enzyme. A dose dependent decrease in the percentage of GFP positive cells would indicate that RhAAV enters the cell via heparin sulfate. Such a decrease was observed with the positive control AAV2.eGFP (FIG. 8A), but no decrease was observed in RhAAV4282 samples (FIG. 2A) or other control vectors (FIGS. 8B-8C). Sialic acid-mediated cellular attachment and entry were tested by using a cell line in which cytidine monophosphate N-acetylneuraminic acid synthetase (CMAS), a sialic acid transporter important for the sialylation of glycoproteins and glycolipids, was knocked out. Depletion of sialic acid also indirectly tests for the use of galactose, as removal of sialic acid exposes more galactose leading to an increase in transduction by AAVs using galactose as an attachment factor (Bell et al. J. Clin. Investig. 121 :2427-2435, 2011 ). CMAS-KO cells showed a decrease in AAV1 GFP signal (sialic acid virus) (FIG. 9A) and an increase in AAV9 GFP signal (galactose virus) (FIG. 9C) but no difference in RhAAV4282 transduction (FIG. 2B and FIG. 9D) or AAV2 transduction (FIG. 9B). In contrast, knockout of the KIAA0319L AAVR resulted in nearly complete loss of transduction by RhAAV4282 and other control viruses (FIG. 2C and FIGS. 10A-10C). These results demonstrate that RhAAV4282, like the vast majority of AAVs, uses the KIAA0319L AAVR for entry. Like the closely related AAV7, the attachment factor for RhAAV4282 is unknown.

[0322] AAVs are generally thermostable but the stability of the capsid can vary significantly based on serotype. RhAAV4282 capsid thermostability was tested by differential scanning fluorimetry (DSF). AAV particles were mixed with SYPRO™ Orange dye then heated while monitoring fluorescence. SYPRO™ Orange dye binds to hydrophobic protein regions and then emits fluorescent signal. As the AAV capsid denatures due to increased temperature fluorescent signal can be detected to determine the melting temperature of the capsid. RhAAV4282 (Tm= 71 ,1 °C) was found to have nearly the same melting temperature as its close relative AAV7 (Tm= 71 ,2°C) (FIG. 2D). AAV9 instead showed a more stable capsid with a melting temperature of 78.2°C.

[0323] C. Human Seroprevalence

[0324] Anti-AAV antibodies can be a major limitation in gene therapy administration. For example, over 70% of the population is thought to be seropositive for AAV2. Moreover, seroprevalence of other commonly used AAVs is thought to be rather high. To investigate the seroprevalence of RhAAV4282 in the general population 69 patient samples from a hospital biorepository were used to measure neutralizing antibody titers against RhAAV4282, closely related AAV7, and human virus AAV2. In about 80% of patients, no neutralization was observed for RhAAV4282, AAV7, and AAV2 (FIG. 14A). Among the individuals that showed neutralization, the highest NAb titers were against AAV2. RhAAV4282 was found to have the lowest NAb titers of the three viruses tested (FIG. 14B and FIGS. 16-18). There were no clear differences in sex or age when comparing positive and negative patients.

[0325] Cryopreserved, de-identified samples from 2020-2021 were utilized for testing neutralizing antibody titers against RhAAV4282 and AAV7. The Beth Israel Deaconess Medical Center institutional review board approved the biorepository study and the parent biorepository study. All participants provided informed consent.

[0326] D. Innate Immune Response

[0327] / . Mice

[0328] Female 6- to 10-week-old BALB / c mice (The Jackson Laboratory) were randomly allocated to groups. Mice received AAV administrations at 5E11 genome copies (GC) through retro-orbital injection. Peripheral blood was collected through submandibular bleeds to isolate serum for immunological assays. All animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committees.

[0329] / ' / . Cytokine analyses

[0330] Concentration of 19 cytokines was measured using the V-PLEX Plus Mouse Cytokine 19-Plex Kit (K15255G-1 ) (Meso Scale Discovery, Rockville, MD). The lower limit of detection (LLOD) for each cytokine was listed as follows: IFN-y (0.04 pg I ml), IL-1 p (0.11 pg I ml), IL-5 (0.06 pg I ml), IL-6 (0.61 pg / ml), IL-10 (0.94 pg / ml), IP-10 (0.328 pg / ml), KC / GRO (0.24 pg / ml), MCP-1 (0.672 pg / ml), MIP-1 a (0.081 pg I ml), MIP-2 (0.053 pg I ml), TNF-a (0.13 pg I ml). Samples were run in singlets. The assay was conducted by the Metabolism and Mitochondrial Research Core (Beth Israel Deaconess Medical Center, Boston, MA) following the manufacture’s instruction. Assay plates were read by a MESO™ QuickPlex SQ120 instrument, and the data was analyzed using Discovery Workbench 4.0 software.

[0331] Hi. Results

[0332] To further characterize RhAAV4282, early innate immune responses were assessed following injection of mice with control (sham), RhAAV4282, AAV7, and AAV9I vectors expressing a luciferase transgene. Serum cytokine levels were measured at 0 hour (h), 2h, 6h, 24h, 48h, and 72h time points.

[0333] The median of select cytokine responses were plotted to identify differences in temporal responses among the viral vectors. RhAAV4282 and AAV7 cytokine responses were expected to be most similar due to their high sequence similarity. RhAAV4282 exhibited a unique innate immune profile, although RhAAV4282 was surprisingly more similar to AAV9 than AAV7. The levels of IFN-y, IL-10, IP-10, MCP-1 , and MIP-1 a induced by RhAAV4282 closely matched AAV9 instead of AAV7 (FIGS. 3A-3E). This effect was observed for both pro-inflammatory cytokines (IFN-g, IP-10, MCP-1 , and MIP-1 a) and anti-inflammatory cytokines (IL-10). The only cytokine in which RhAAV4282 showed similarities to AAV7 was MIP-2 (FIG. 3F). The other measured cytokines showed no discernible differences between viral vectors (FIGS. 11 A-11 E).

[0334] E. Tissue Tropism

[0335] I. Nucleic acid extraction

[0336] Reverse transcription PCR (RT-PCR) and quantitative (qPCR) assays were performed according to standard methods (Cadena et al. Nat. Common. 12:1474, 2021 ). Briefly RNA was extracted from tissues using a QIACUBE™ HT (Qiagen, Hilden, Germany) and the rNeasy 96 QIACUBE™ HT kit. DNA was extracted from tissues using a QIAcube™ HT and the QIAamp™ 96 QIACUBE™ HT kit. Briefly, two samples from each tissue were removed and placed in separate 2 mL Eppendorf tubes containing a 5 mm stainless-steel bead and either 700 pL of QIAzol lysis buffer or 450 pL of ATL buffer + proteinase k for RNA and DNA extraction respectively. RNA extraction tubes were shaken twice at 25 Hz for 5 minutes using the Qiagen TissueLyser II (Qiagen, Hilden, Germany). Following lysis, 200 pL of chloroform was added and manually shaken. Samples were then incubated for 3 minutes at room temperature and centrifuged for 15 minutes at 4°C. Following centrifugation, the aqueous phase was transferred to a deep-well, 96-well plate and total RNA was isolated using the QIACUBE™ HT system. For the DNA extraction, tissue tubes were shaken twice for 1 minute at 25 Hz in the Qiagen TissueLyser II. Afterwards, 50 pL of proteinase K was added to the samples and incubated at 56°C with shaking overnight. Genomic DNA was then extracted using the QIACUBE™ HT system.

[0337] RNA was reverse transcribed using SUPERSCRIPT™ VILO™ (Invitrogen) and run in duplicate using the QUANTSTUDIO™ 6 and 7 Flex Real-Time PCR System (Applied Biosciences) according to manufacturer’s instructions. RNA concentration was calculated using 2'AACTmethod (Schmittgen et al. Nat. Protoc. 3:1 101 -1 108, 2008) using GAPDH (ThermoFisher: 4352339E) as a house keeping gene and Luciferase (ThermoFisher: 4351370) as the gene of interest. DNA concentration was determined using primers targeting the CMV promoter region of the AAV vector transgene (Forward primer: TGCCCACTTGGCAGTACATCA (SEQ ID NO: 159); Reverse primer: GCCAAGTAGGAAAGTCCCATAAGGT (SEQ ID NO: 160); and Probe: TGGCCCGCCTGGCATTATGCCCAGT (SEQ ID NO: 161 )), the amount of DNA per genome was normalized using a Tfrc kit. Genome copies per diploid genome were determined using COPYCALLER® Software v2.1 software (ThermoFisher Scientific) according to manufacturer’s instructions. iv. In vivo I VIS imaging

[0338] To image luciferase expression mice were injected with 150 pL luciferin (I VISbrite D-Luciferin Ultra Bioluminescent Substrate in REDIJECT™ Solution Perkin Elmer: 770505) through the intraperitoneal route. Mice were then kept awake for 6 minutes, after which mice were anesthetized using isofluorane for 3 minutes. Mice were then imaged in the I VIS Lumina LT Instrument Series III for 3 minutes to collect whole mice images. To determine luciferase tissue signal, mice were administered luciferin and then euthanized with CO2 following 3 minutes of isofluorane administration. Tissues of interest were then harvested, briefly washed in PBS, and then placed into 6-well plate filled with 3 mL PBS mixed with 75 pL luciferin. Tissues were imaged for 3 minutes and then placed into RNALATER® (ThermoFisher Scientific: AM7021 ) solution for DNA and RNA extraction. v. Results

[0339] RhAAV4282 in vivo tissue tropism was determined to assess clinical utility of the AAV vector. RhAAV4282, AAV7, and AAV9 expressing a luciferase transgene were administered to BALB / c mice intravenously. Four weeks later, whole mouse In Vivo Imaging System (IVIS) imaging was used to determine viral transduction, and quadriceps, liver, diaphragm, and heart tissues were harvested to quantify tissue specific signal differences between the tested AAVs. After measuring luciferase signal, tissues were processed to extract nucleic acids to determine the DNA and RNA localization in each tissue. DNA was extracted from select tissues and genome copies per diploid genome were calculated. The liver contained the largest amount of genome copies as has been reported with other AAVs (Tabebordbar et al. Cell. 184:4919-4938, 2021 ). RhAAV4282 had modestly lower tropism for the liver than AAV7. Other tested tissues showed no statistically significant differences (FIG. 4A).

[0340] Since DNA localization can be unrelated to tissue transduction, RNA localization was assessed in the same tissues to evaluate potential differences in the tropism profile (FIG. 4B). AAV7 had significantly higher liver RNA levels compared to RhAAV4282. In other tissues, no significant differences were found. Surprisingly, despite AAV9 DNA levels being lower than RhAAV4282 and AAV7 in the quadriceps, RNA measurements in the quadriceps showed much higher levels of AAV9 RNA compared to RhAAV4282 and AAV7.

[0341] Luciferase protein localization was determined by I VIS signal (average radiance per second) (FIGS. 4C-4D). Protein levels between RhAAV4282 and AAV7 recapitulated the RNA and DNA levels, with similar signals in all tissues tested except the liver where AAV7 exhibited higher levels of luciferase. AAV9 transduced the quadriceps and the diaphragm at a higher rate than RhAAV4282 and AAV7. Whole mouse imaging confirmed that AAV9 had higher transduction levels than RhAAV4282 and AAV7 (FIG. 4E). Whole mouse imaging also demonstrated that AAV7 had slightly higher transduction levels than RhAAV4282. These results indicate that RhAAV4282 has a similar tissue transduction profile to AAV7, except RhAAV4282 is significantly less liver tropic.

[0342] F. Structural Analysis of RhAAV4282 Capsid Protein

[0343] / . Specimen preparation and cryo-EM data collection

[0344] Purified AAV (3.5 pL) [2.1 E13GC I ml] was applied to a glow-discharged, 400 mesh copper Quantifoil R1 .2 / 1 .3 holey carbon grid (Quantifoil). Grids were blotted for 7 s at -80% humidity and flash frozen by liquid nitrogen-cooled liquid ethane using a FEI Vitrobot Mark I (FEI). The grid was then loaded onto an FEI TF30 Polara electron microscope operating at 300 kV accelerating voltage. Image stacks were recorded on a GATAN K2™ Summit (Gatan) direct detector set in counting mode with gain-reference correction applied using SerialEM, with a defocus range between 1 .5 to 3.0 pm. The electron dose was set to 8 e / physical pixel / s and the sub-frame time to 200 ms. A total exposure time of 10 s resulted in 50 sub-frames per image stack. The total electron dose was 52.8 e- per A2(~1 .1 e- per A2per sub-frame).

[0345] / ' / . Cryo-EM data processing

[0346] Frames from 4525 movies were aligned using MotionCor2 with 5x5 patch alignment to calculate summed micrographs. Template matching routines from cisTEM (match_template, version 1 .00; refine_template, version 1 .00; make_template_result, version 1 .00) were used to pick 69365 virus particles from the summed micrographs. Matching was done at 5 A resolution with two times binned micrographs, 1 .43° initial angular sampling, and a template reference obtained from cryoSPARC with h icosahedral symmetry setting. With Gctf, contrast transfer function (CTF) parameters from the total-summed micrographs with local refinement at particle positions were estimated. Relion_preprocess was used for particle extraction and normalization (box size of 384x384 pixels). After 2D classification with relion_refine, 69220 particles were retained for subsequent analysis. To obtain the best icosahedral reconstructions, cisTEM (refine3d version 1 .01 , reconstruct3d version 1 .02) was used with h symmetry imposed for particle alignment and classification, relion_motion_refine, and relion_ctf_ref ine in two iterations. The spherical shell mask that were used for the calculations had an inner radius of 74 A and an outer radius of 150 A. The alignment resolution in the last step was 3.4 A, and relion_ctf_refine was run with the with the following input options: - fit_defocus— kmin_defocus 30— fit_mode fpmfp— fit_beamti It— kmin tilt 30— fit_aniso— odd_aberr_max_n 3— fit_aberr. Maps were reconstructed with relion_reconstruct with the option- fom_weighting, where per particle figure of merits FOM was assigned based on the cisTEM alignment score, where S, is the score of particle / , and Smax and Sm / nare the highest and lowest scores, respectively:

[0347] For a map calculated with the full particle stack, the Fourier shell correlation (FSC) calculated from half map densities within the volume of the spherical shell mask dropped below 0.143 at a spatial frequency corresponding to 2.49 A (which was almost Nyquist frequency given a pixel size of 1 .23 A). To separate empty from full viral particles, a 3D classification was used in cisTEM with a spherical mask (inner radius of 0 A and an outer radius of 150 A). This yielded two image stacks, with 35328 empty particles (51%) and 33892 full particles (49%). The reconstructions calculated from these two stacks had a nominal resolution of 2.57 A and 2.58 A, respectively. FSC curves from masked half maps were calculated with phenix. mtriage and local resolutions were estimated with relion_postprocess. Maps were sharpened with sharpen_map from cisTEM.

[0348] Hi. Model building and refinement

[0349] A predicted dimer structure of two RhAAV4282 protomers from AlphaFold 2 was obtained and then placed one protomer into the density map, which refined the protomer structure, followed by expansion to generate the viral capsid by applying icosahedral symmetry and refinement of the capsid. After an initial round of refinement with phenix. real_space_refine, models were manually checked in O and Coot, and a few minor adjustments were made where necessary. The final structure refinement was performed with global minimization, local grid searches, and 8 factor adjustment, and with a target function that contained standard stereochemical and 8 factor restraints, rotamer and Ramachandran restraints, secondary structure restraints, and non-crystallographic symmetry (NCS) constraints. Modeled residues for the empty and full capsid are listed in Table S1 . The stereochemistry of the structures was probed with Mol Probity and assessed their fit to the cryo- EM reconstructions with phenix. mtriage. iv. Results

[0350] RhAAV4282 and AAV7 capsids share 91 .4% sequence homology (FIG. 1 B) but exhibit differences in seroprevalence, liver tropism, and innate immune signaling. Potential structural differences may underlie these key differences, so the next step required generating a structural model of the RhAAV4282 capsid. Structural maps of the RhAAV4282 capsid was determined using cryo-EM. 69,365 particles were classified into empty (35,328; 51%) or full (33,892; 49%) particles to generate two reconstructions structural models for the RhAAV4282 capsid in either an empty or full configuration, respectively. The overall resolution of the empty capsid was 2.57 A (FIG. 5A), and the overall resolution of the full capsid was 2.58A (FIG. 5B and FIG. 19). As with previous AAV capsid structures, the N-terminus of VP1 and VP2 were not resolved, so the extent of the structural model extends from amino acids Ala220-Leu733 of the VP1 capsid. These models showed many common characteristics of AAV capsids, such as a 3-fold protrusion, a pore at the 5-fold axis, and valleys at the 2-fold axis. The models fit the electron density maps well, particularly for the core of the structure (FIG. 5D). As expected, less electron density was observed in the outer loops of the capsid due to increased flexibility of these segments (FIG. 5E). Few differences were found between the empty and full capsid maps, which is consistent with previously reported models of AAV capsids (FIG. 19).

[0351] Comparing the RhAAV4282 and AAV7 capsids showed many structural similarities (FIG. 5C). The largest structural difference in structure corresponded to a 7 amino acid sequence different that was located at the threefold proximal loop within hypervariable region IV (FIG. 5C, inset), where the AAV7 loop was longer and extended further into solution that the RhAAV4282 loop. This region also varies when compared to the AAV9 capsid, which had a shorter loop than AAV7 but longer than RhAAV4282 (FIG. 12).

[0352] Sequence alignment of RhAAV4282 and AAV7 shows a high degree of sequence similarity throughout VP1 , consistent with the cryo-EM structural data (FIGS. 6A-6B). Within the VP1 protein, only 65 amino acids differ between RhAAV4282 and AAV7. Clustal omega alignments revealed that 47.7% (31 / 65) of these differences were between amino acids of strongly similar physicochemical properties, 33.8% (22 / 65) of these differences were changes to amino acids that share weakly similar physicochemical properties, and 18.5% (12 / 65) of these differences were changes to amino acids that did not share physicochemical properties or were deletions. Seven amino acids that either shared weak or no physicochemical similarities included a three amino acid deletion were located between residues Asn453-Asn460 of the AAV7 sequence. This region denotes the same region identified by structural analysis near the threefold proximal peak contained within hypervariable region IV (FIG. 6C). This region with the greatest structural differences was then coined as the hypervariable region IV neutralization epitope (HRNE) (FIG. 6D, denoted by brackets). The region with the second most differences would be between residues Ala587-Ala592 of the AAV7 sequence, which is within hypervariable region IX. This region contains six amino acid differences, of which half share strongly similar physicochemical properties, as compared to 0 / 7 similarities in the HRNE. Both the alignment and structural analysis demonstrated that HRNE is the region between AAV7 (SEQ ID NOs: 22 and 101 ) and RhAAV4282 (SEQ ID NOs: 17 and 96) with the most differences, indicating that these structural differences most likely underlie the observed differences in liver tropism and innate immune signaling between the two AAVs. A summary of the sequences of all hypervariable regions for RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, RhAAV6674, AAV7, and AAV9 is provided in Table 4 below.

[0353] Table 4: Hypervariable Regions l-IX of Selected AAVs

[0354] G. Neutralizing Antibody Profile for Capsids

[0355] / . Assay

[0356] Mice were injected with 5E11 GC of AAVs and then serum was collected 4 weeks following injection. Serum was heat inactivated for 30 minutes at 56°C. HEK293T cells were seeded in 96 well plates at 10,000 cells per well then incubated overnight. The next day serum was serial diluted at either 2-fold or 4-fold. 3.13E9GC of the appropriate AAV vector was mixed with diluted serum at either 1 :1 or 1 :3 ratios and then incubated at 37°C for 1 hour with. Simultaneously, cells were incubated with 20 pM dorsomorphin (Abeam: ab120843) at 37°C for 1 hour. After incubation, 15 pL of the AAV vector and serum mixture was added to the dosmorphin-containing cells to a final concentration of 9.77E7GC per well. Cells were incubated for 48 hours at 37°C and were then lysed in STEADY-GLO® luciferase assay (Promega, Madison, Wl) according to manufacturer’s instructions. AAV neutralization titers were defined as the sample dilution at which a 50% reduction in luciferase signal (RLU) is observed relative to the average of the virus control wells.

[0357] / ' / . Results

[0358] Anti-AAV antibodies can be a major limitation in gene therapy administration. Over 70% of the population is seropositive for AAV2 and seroprevalence of other commonly used AAVs is high (Boutin et al. Hum. Gene Ther. 21 :704-712). Some AAV gene therapies have shown the need for a booster shot overtime to maintain efficacy. Unfortunately, boosters with the same viral vector are difficult to administer due to anti-vector immunity generated from the original gene therapy. To combat this problem, it is necessary to have a large amount of AAVs with similar tropisms that are serologically distinct.

[0359] RhAAV4282 is largely like its closest relative AAV7 in tropism and expression levels. To assess whether RhAAV4282 and AAV7 generate cross-neutralizing antibodies (NAbs) for therapeutic applications, mice were injected with AAV7, RhAAV4282, or AAV9 vectors expressing luciferase. After four weeks following the injection, the serum was collected to evaluate neutralization against AAV7, RhAAV4282, or AAV9 viral vectors carrying a luciferase transgene. Each vector was primarily self-neutralizing (FIGS. 7A-7C). Interestingly, RhAAV4282 and AAV9 were slightly more selfneutralizing than AAV7. There was no cross-neutralization between AAV9 and the other two tested vectors (Median AAV9 NAb titer was the following: AAV9: 4842.5, AAV7: 4, RhAAV4282: 4) (FIG. 7C). Between AAV7 and RhAAV4282, minimal cross-neutralization was observed (Median AAV7 NAb titer was the following: AAV7: 702.75, AAV7(4282L): 116, RhAAV4282: 16.5, RhAAV4282(AAV7L): 240.5, AAV9: 4. Median RhAAV4282 NAb titer was the following: AAV7: 7.5, AAV7(4282L): 179, RhAAV4282: 1567, RhAAV4282(AAV7L): 1797, AAV9: 4) (FIGS. 7A-7B).

[0360] Despite extremely similar capsid sequences, significant neutralization differences were observed between AAV and RhAAV4282 vectors, prompting identification of anti-vector neutralization determinants. Based on the described structure and sequence analysis (FIGS. 5-6), HRNE was identified as a potential neutralization determinant. To test this hypothesis, two hybrid vectors were generated: an AAV7 capsid with an RhAAV4282 HRNE (AAV7(4282L)) (SEQ ID NOs: 8 and 87) and an RhAAV4282 capsid with an AAV7 HRNE (RhAAV4282(AAV7L)) (SEQ ID NOs: 9 and 88). These hybrid mutants exhibited similar growth profiles to the parent strains. To test neutralization and tropism, 5E11 genome copies (GC) of AAV7, RhAAV4282, AAV7(4282L), RhAAV4282(AAV7L), or sham were administered to mice via intravenous. After four weeks, tissue tropism was evaluated and no significant differences were observed between the parental strains or the hybrid mutants, demonstrating functionality of the hybrid viruses (FIG. 13).

[0361] Additionally, serum was collected after four weeks, and neutralizing antibody titers against AAV7 and RhAAV4282 were measured. Surprisingly, by swapping just seven amino acids, the neutralizing antibody titers significantly changed. Mice injected with AAV7 showed the highest neutralizing antibody titers against AAV7 (FIG. 7A). When mice were injected with AAV7(4282L), neutralizing antibody titers against AAV7 were significantly decreased compared to the parental strain. RhAAV4282 injected mice showed the lowest neutralizing antibody titers against AAV7; however, mice injected with RhAAV4282(AAV7L) exhibited a significant increase in AAV7 NAbs compared to RhAAV4282. These results demonstrate that the levels of AAV7 NAbs can be modulated solely by the presence or absence of seven amino acids in the HRNE.

[0362] It was then tested whether this same phenomenon was observed with the RhAAV4282 NAb titer. As expected RhAAV4282, injection yielded the highest titer of NAbs against RhAAV4282, and AAV7 injection yielded the lowest titer of NAbs against RhAAV4282 (FIG. 7B). After administering AAV7(4282L), there was a statistically significant increase in RhAAV4282 NAbs compared to the parental AAV7 strain. This result shows that changing seven amino acids in the AAV7 capsid background is sufficient to significantly transform the neutralization profile of the virus from solely targeting AAV7 to targeting both AAV7 and RhAAV4282. Mice injected with RhAAV4282(AAV7L) did not show any differences in RhAAV4282 Nab titers compared to the RhAAV4282 parental strain, potentially suggesting that the RhAAV4282 capsid has some features capable of inducing capsidspecific neutralizing antibodies that the AAV7 capsid lacks.

[0363] H. Mouse Heterologous Boost Experiment

[0364] Mice were injected with 5E11 GC of AAV7 vectors encoding eGFP intravenously. Four weeks later, mice were administered 5E11 GC of either AAV7 or RhAAV4282 vectors encoding luciferase. Luminescence was measured and compared to mice receiving a single dose of AAV7 encoding luciferase.

[0365] Whole mouse imaging showed high signal for mice having received single shot AAV7 or RhAAV4282 expressing luciferase (FIG. 20A). Mice injected with AAV7.eGFP followed by AAV7.Luc primarily showed signal at the site of administration (right eye) in 4 / 5 mice due to substantial suppression by anti-vector immunity induced by the initial inoculation. Homologous administration of RhAAV4282.eGFP followed by RhAAV4282.Luc showed complete removal of luciferase signal due to anti-vector immunity. In comparison, mice administered RhAAV4282.Luc following AAV7.eGFP injections showed systemic signal in 4 / 5 mice. Whole mouse luminescence quantification showed that heterologous boosting resulted in at least a one log increase in signal compared to homologous boosting (FIG. 20B).

[0366] I. HRNE Modifications Alter Neutralization Profiles for RhAAV4282 and AAV7

[0367] Some AAV gene therapies have shown that in certain disease settings durability may be a concern and, therefore, booster shots may become necessary to maintain efficacy. To evaluate whether RhAAV4282 and AAV7 generated cross neutralizing antibodies, and whether these NAb profiles could be altered by changing the HRNE, mice were injected with 5E11 GC AAV7, RhAAV4282, and AAV9.

[0368] To confirm that the HRNE is a neutralization determinant, an AAV7 capsid with the RhAAV4282 HRNE (AAV7(4282L)) and a RhAAV4282 capsid with an AAV7 HRNE (RhAAV4282(AAV7L)) was generated. These mutants grew similarly to the parental strains and were included in NAb tests at the same dosage as three wildtype vectors. Mouse tissue tropism was not significantly changed in the HRNE mutants (FIG. 13). Mouse serum was collected four weeks after injection and tested for NAbs against AAV7 (FIG. 7A), RhAAV4282 (FIG. 7B), and AAV9 (FIG. 7C). Each vector primarily induced autologous neutralization with low heterologous neutralization (FIGS 7A-7C), although a limited degree of cross neutralization was observed for AAV7 and RhAAV4282 (FIG 7A and FIG. 7B, respectively).

[0369] Swapping the seven amino acids constituting the HRNE produced modified neutralizing antibody titers. Mice injected with AAV7 showed the highest neutralizing antibody titers against AAV7 (median NT50: 702.8) (FIG. 7A), whereas mice injected with AAV7(4282L) (median NT50: 116.0) showed significantly decreased neutralizing antibody titers against AAV7. RhAAV4282 (median NT50: 16.5) injected mice showed the lowest neutralizing antibody titers against AAV7, but RhAAV4282(AAV7L) (median NT50: 240.5) induced significantly increased AAV7 NAbs compared with RhAAV4282. These data show that the HRNE is an important neutralizing determinant for AAV7.

[0370] Similarly, RhAAV4282 led to robust NAbs against RhAAV4282 (median NT50: 1567.0), and AAV7 (median NT50: 7.5) injection led to minimal NAbs against RhAAV4282 (FIG. 7B). AAV7(4282L) (median NT50: 179.0) induced significantly increased NAbs to RhAAV4282 compared with AAV7. These data suggest that the HRNE is also a partial neutralization epitope for RhAAV4282.

[0371] J. Conclusions

[0372] AAV vectors for gene therapy can be limited by pre-existing immunity to the vector or immunity induced by previous treatments. This example addresses these concerns by identifying a panel of new AAV capsids from rhesus macaques. In this example, five AAV capsids were identified and RhAAV4282 was characterized. RhAAV4282 shared 91 .4% sequence homology with AAV7. In vitro experiments demonstrated that RhAAV4282, like AAV7, does not use common AAV attachment factors (e.g., sialic acid, heparin sulfate, and galactose) for cellular entry. AAV7 and RhAAV4282 also shared nearly identical capsid stability. These in vitro results indicate that RhAAV4282 and AAV7 capsids are highly similar and may even share a currently unknown attachment factor. These vectors also showed similar in vivo tropisms. Surprisingly, these two vectors differed in innate immune responses and neutralization profiles. A cryo-EM structure of RhAAV4282 at 2.57A and identified a 7 amino acid region within hypervariable region IV that differed substantially (e.g., HRNE). Heterologous boosting of RhAAV4282 and AAV7 was more successful than homologous boosting. Mutant RhAAV4282 and AAV7 capsids with this region swapped demonstrated that this the identified HRNE region was a neutralization epitope for AAV7 and RhAAV4282. HRNE is likely more immunodominant in AAV7 due to its longer length, as compared to the shorter RhAAV4282 HRNE. RhAAV4282 may also have additional neutralization epitopes that account for its higher overall antivector immunity.

[0373] In some cases, gene therapies may not be durable for the lifetime of the patient necessitating repeat treatments. Unfortunately, it is rarely possible to give the same treatment due to the generation of neutralizing antibodies against the original treatment AAV capsid. This presents three options: excluding patients, immunosuppressing patients, or utilizing an alternative AAV capsid with a different neutralization profile. Modifications to the HRNE or loop swap mutants can provide an alternative to these options and may allow more efficient sequential dosing.

[0374] In conclusion, five AAV capsids from rhesus macaques were identified. RhAAV4282 was charactered both biochemically and structurally. Utilizing the cryo-EM structure, mutant vectors identified HRNE as a neutralization determinant for these AAVs. Taken together, this work provides for the development of immune evasion strategies for AAV vectors.

[0375] Example 2: A method of treating a subject

[0376] This example illustrates that an AAV vector (e.g., RhAAV4282, RhAAV4302A.1 , RhAAV4302A.2, RhAAV4302B, or RhAAV6674) that contains a transgene encoding a protein of interest can be administered to a subject undergoing treatment (e.g., gene therapy or a vaccine) for a disease or condition.

[0377] A subject is undergoing gene therapy to treat a congenital disease following diagnosis. A clinician determines that the subject is a suitable candidate for transgene delivery by an adeno- associated viral (AAV) vector. The subject is administered an AAV vector comprising an RhAAV4282 capsid protein having the amino acid sequence of SEQ ID NO: 80 and a transgene encoding a protein for the treatment of the disease. The AAV vector and an optional pharmaceutically acceptable carrier is intravenously administered to the subject at a single dose between 1 x105and 1 x1016gc / dose (e.g., 1 x105gc / dose, about 1 x106gc / dose, about 1 x107gc / dose, about 1 x108gc / dose, about 1 x109gc / dose, about 1 x1010gc / dose, about 1 x1011gc / dose, about 1 x1012gc / dose, about 1 x1013gc / dose, about 1 x1 O14gc / dose, about 1 x1015gc / dose, or about 1 x1016gc / dose.). The subject is then monitored for an adverse reaction to the AAV vector using standard practices known in the art. After about a week following the administration of the AAV vector (e.g., about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days), expression levels of the protein encoded by the transgene are measured in one or more blood samples from the subject. ELISA data demonstrates that the protein encoded by the transgene is expressed at levels comparable to a healthy subject control sample, confirming that the treatment with an AAV vector comprising an RhAAV4282 capsid protein is working.

[0378] Example 3: A method of reducing immunogenicity in a subject

[0379] This example illustrates that an AAV vector comprising the RhAAV4282 hypervariable region neutralization epitope (e.g., HRNE) can be administered to a subject to reduce immunogenicity (e.g., levels of neutralization antibodies) during a method of treatment for a disease or condition.

[0380] A subject undergoing gene therapy is administered an AAV vector (e.g., an AAV7 vector or an AAV9 vector) that contains a transgene encoding a protein of interest. About a week following administration of the AAV vector, both protein and gene expression levels in a blood sample (e.g., as measured by ELISA and RT-PCR) from the subject demonstrate that the protein encoded by the transgene and the AAV vector are expressed at sub-therapeutic levels (e.g., the protein is expressed at levels significantly lower than a healthy subject control sample). The blood sample from the subject is also determined by ELISA and antibody array data to have high levels of neutralizing antibodies against the AAV vector (e.g., levels higher than an acceptable reference value), thus confirming that the treatment with the AAV is not effective and induces an immunogenic response.

[0381] To circumvent the immunogenicity of the first AAV vector (e.g., an AAV7 vector or AAV9 vector), the subject is administered a second AAV vector that comprises the HRNE of RhAAV4282 in the hypervariable region IV of the capsid (e.g., in the AAV7 or AAV9 capsid). Non-limiting examples of a suitable second AAV vector include, e.g., a hybrid AAV7 vector with the RhAAV4282 HRNE (e.g., an AAV vector with a capsid protein sequence of SEQ ID NO: 87) and a transgene encoding the protein of interest, a hybrid AAV7 vector in which the naturally occurring hypervariable region IV is replaced with the hypervariable region IV of RhAAV4282 (e.g., an AAV vector with the capsid protein sequence of SEQ ID NO: 85, in which the residues corresponding to SEQ ID NO: 94 are replaced with residues corresponding to SEQ ID NO: 89) and a transgene encoding the protein of interest, and a RhAAV4282 vector and a transgene encoding the protein of interest. The subject is administered a hybrid AAV7 vector with the RhAAV4282 HRNE (e.g., a vector comprising the amino acid sequence of SEQ ID NO: 87), a transgene encoding the protein of interest, and an optional pharmaceutically acceptable carrier.

[0382] Following administration of the second AAV vector, a blood sample from the subject is determined by ELISA to contain expression levels of the protein that comparable to a healthy subject control sample, indicating administration of the second AAV vector is an effective method of treatment. Moreover, ELISA and antibody array data of the blood sample demonstrated that the subject has lower levels of neutralization antibodies, confirming that administration of the second AAV vector that comprises the HRNE sequence of RhAAV4282 does not induce an immunogenic response in the subject. OTHER EMBODIMENTS

[0383] All publications, patents, and patent applications mentioned in the above specification are hereby incorporated by reference. Various modifications and variations of the described compositions and methods of use thereof of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, methods, and kits of the invention without departing from the spirit or scope of the invention. Thus, it is intended that the invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

[0384] Other embodiments are within the claims.

Claims

CLAIMS1 . An isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 96-100.

2. The isolated nucleic acid molecule of claim 1 , wherein the nucleotide sequence encoding the polypeptide comprises:(a) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 17, or a complementary sequence thereto;(b) 100% sequence identity to SEQ ID NO: 18 or SEQ ID NO: 19, or a complementary sequence thereto; or(c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 20 or SEQ ID NO: 21 , or a complementary sequence thereto.

3. The isolated nucleic acid molecule of claim 2, wherein the nucleotide sequence encoding the polypeptide comprises:(a) 100% sequence identity to SEQ ID NO: 10, or a complementary sequence thereto;(b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 11 or SEQ ID NO: 12, or a complementary sequence thereto;(c) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 13, or a complementary sequence thereto; or(d) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 14, or a complementary sequence thereto.

4. The isolated nucleic acid molecule of claim 3, wherein the nucleotide sequence encoding the polypeptide comprises:(a) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 5, or a complementary sequence thereto;(b) at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 3, or a complementary sequence thereto;(c) at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 4, or a complementary sequence thereto;(d) 100% sequence identity to SEQ ID NO: 8, or a complementary sequence thereto; or(e) at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 9, or a complementary sequence thereto.

5. The isolated nucleic acid molecule of claim 3, wherein the nucleotide sequence comprises a region having at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a region of at least 100, 250, 500, 750, 1000, 1500, or 2000 contiguous nucleotides or more set forth in any one of SEQ ID NOs: 1 -5, 8, and 9, or a complementary sequence thereto.

6. A recombinant vector comprising the isolated nucleic acid molecule of any one of claims 1 -5.

7. The recombinant vector of claim 6, wherein the polypeptide comprises an amino acid sequence having:(a) 100% sequence identity to SEQ ID NO: 89;(b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 91 ;(c) at least 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 92; or(d) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 93.

8. The recombinant vector of claim 7, wherein the polypeptide comprises an amino acid sequence having:(a) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 80, SEQ ID NO: 81 , or SEQ ID NO: 88;(b) 100% sequence identity to SEQ ID NO: 82 or SEQ ID NO: 87;(c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 83;(d) at least 99% or 100% sequence identity to SEQ ID NO: 84; or(e) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 88.

9. A recombinant adeno-associated virus (rAAV), comprising (i) an AAV capsid, and (ii) the isolated nucleic acid molecule of any one of claims 1 -5 or the recombinant vector of any one of claims 6-8.

10. The rAAV of claim 9, wherein the AAV capsid comprises a polypeptide comprising an amino acid sequence having:(a) 100% sequence identity to SEQ ID NO: 89;(b) at least 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 90 or SEQ ID NO: 91 ;(c) at least 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 92; or(d) at least 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 93.1 1 . The rAAV of claim 10, wherein the AAV capsid comprises a polypeptide comprising an amino acid sequence having:(a) at least 98%, 99%, or 100% sequence identity to SEQ ID NO: 80, SEQ ID NO: 81 , or SEQ ID NO: 88;(b) 100% sequence identity to SEQ ID NO: 82 or SEQ ID NO: 87;(c) at least 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 83; or(d) at least 99% or 100% sequence identity to SEQ ID NO: 84.

12. A composition comprising:(a) the isolated nucleic acid molecule or complement thereof of any one of claims 1 -5;(b) the recombinant vector of any one of claims 6-8; or(c) the rAAV of any one of claims 9-11 ; and a transgene encoding a protein of interest.

13. The composition of claim 12, wherein the composition further comprises a pharmaceutically acceptable excipient.

14. A method of treating a subject with a disease, the method comprising administering to the subject the nucleic acid molecule of any one of claims 1 -5, the vector of any one of claims 6-8, the rAAV of any one of claims 9-11 , or the composition of claim 12 or 13, wherein the nucleic acid molecule, vector, rAAV or composition further comprises a transgene encoding a protein for treating the disease.

15. The method of claim 14, wherein the subject is first administered a different adeno-associated viral (AAV) vector.

16. The method of claim 15, wherein the AAV vector is a serotype selected from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV11 , AAV12, and AAV13.

17. The method of any one of claims 14-16, wherein the nucleic acid molecule, the vector, the rAAV, or the composition is administered intramuscularly, intravenously, intradermally, percutaneously, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, peritoneally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilicaly, intraocularly, orally, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, by catheter, by lavage, by gavage, in cremes, or in lipid compositions.

18. The method of claim 17, wherein the subject is administered at least one dose of the nucleic acid molecule, the vector, the rAAV, or the composition.

19. The method of claim 18, wherein the subject is administered at least two doses of the nucleic acid molecule, the vector, the rAAV, or the composition.

20. The method of claim 19, wherein the subject is administered the nucleic acid molecule, the vector, the rAAV, or the composition as a prime boost.21 . The method of any one of claims 14-20, wherein the disease is a cardiovascular disease, a cancer, an infectious disease, an autoimmune disease, or a neurological disease.

22. The method of claim 21 , wherein the cardiovascular disease is selected from coronary artery disease, heart failure, atherosclerosis, stroke, arrhythmia, Brugada syndrome, hypertension, aortic aneurysm, vascular malformations, carotid disease, hypertrophic cardiomyopathy, idiopathic or familial dilated cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, peripheral artery disease, atrial tachycardia, supraventricular tachycardia, postphlebitic syndrome, thromboangiitis obliterans or Buerger disease, Raynaud syndrome, thoracic outlet syndrome, vasculitis, endocarditis, catecholaminergic polymorphic ventricular tachycardia, cyanotic heart disease, acyanotic heart disease, atrial septal defect, atrioventricular septal defect, coarctation of the aorta, double-outlet right ventricle, and pulmonary atresia.

23. A method of reducing or modifying immunogenicity or neutralization of a gene therapy vector, the method comprising administering to the subject the nucleic acid molecule of any one of claims 1 -5, the vector of any one of claims 6-8, the rAAV of any one of claims 9-11 , or the composition of claim 12 or 13, wherein the gene therapy vector comprises an AAV vector.

24. The method of claim 23, wherein the AAV vector is a serotype selected from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV11 , AAV12, and AAV13.

25. A method of producing a recombinant AAV (rAAV) comprising transfecting a cell with (a) the isolated nucleic acid molecule or complement thereof of any one of claims 1 -5 or (b) the recombinant vector of any one of claims 6-8; culturing the cell in a suitable medium to allow replication of the nucleic acid molecule or the vector in said cell; and harvesting the rAAV from the cell and / or from the medium.

26. The method of claim 25, wherein the cell is a bacterial cell, a plant cell, or a mammalian cell.

27. The method of claim 26, wherein the mammalian cell is a human embryonic kidney cell.

28. A kit comprising a package insert that instructs a user to perform the method of producing the rAAV of any one of claims 25-27.

29. A kit comprising a package insert that instructs a user to perform the method of treatment of any one of claims 14-22 or the method of reducing immunogenicity of claim 23 or 24.

30. The kit of claim 28 or 29, wherein the kit comprises a syringe or device for administering the nucleic acid molecule, the vector, the rAAV, or the composition.31 . The kit of any one of claims 28-30, wherein the kit comprises one or more binding molecules to detect the expression or activity of a protein of interest.

Images