Composition for activating plasmacytoid dendritic cells

Abstract

The present invention addresses the problem of providing a composition, for activating plasmacytoid dendritic cells, which has a high level of safety and can be taken by a large number of people more easily. A composition for activating plasmacytoid dendritic cells according to the present invention contains one or more lactic acid bacteria selected from Lactobacillus lactic acid bacteria (excluding Lactobacillus helveticus), Lacticaseibacillus lactic acid bacteria, and lactic acid bacteria belonging to Streptococcus thermophilus. It is to be noted that the above-mentioned composition for activating plasmacytoid dendritic cells preferably contains Lactobacillus lactic acid bacteria (excluding Lactobacillus helveticus), Lacticaseibacillus lactic acid bacteria, and lactic acid bacteria belonging to Streptococcus thermophilus.

Description

Plasmacytoid composition for activating dendritic cells

[0001] The present invention relates to a plasmacytoid composition for activating dendritic cells.

[0002] Drugs that are effective against diseases such as cancer, AIDS, and herpes virus have been proposed (see, for example, Patent Documents 1, 2, and 3). Some of these drugs, when administered in combination with a dendritic cell activator to a subject in need thereof, enhance dendritic cell activity and treat or alleviate the symptoms of the diseases listed above. It has also been found that there is a close correlation between "activation of plasmacytoid dendritic cells (hereinafter referred to as "pDC")" and "maintenance or improvement of health status." Therefore, developing drugs and the like that can activate pDC is becoming increasingly important in today's world, where health awareness is on the rise.

[0003] However, taking these drugs solely for the purpose of activating pDCs is associated with some side effects. Therefore, for example, in humans, they may not necessarily be safe, particularly for young children and the elderly. In other words, the subjects who can take these drugs are limited by their age, health condition, and other factors. Therefore, there is a need for a composition for activating pDCs that has fewer side effects than the drugs described above and can be easily taken by many subjects, regardless of age, etc.

[0004] Special table 2003-502008 Publication Special table 2015-513401 Publication Special table 2021-531765

[0005] An object of the present invention is to provide a composition for activating pDCs that is highly safe and can be ingested more easily.

[0006] In order to solve the above problems, the present inventors conducted extensive research and found that pDCs in a subject such as a human can be activated by having the subject ingest a composition containing one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus, and thus completed the present invention.

[0007] That is, the present invention is as follows.

[0008] (1) A composition for activating pDC, comprising one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus.

[0009] (2) The composition for activating pDC described in (1), which contains the lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), the lactic acid bacteria of the genus Lacticaseibacillus, and the lactic acid bacteria belonging to Streptococcus thermophilus.

[0010] (3) The composition for activating pDC according to (1) or (2), wherein the lactic acid bacteria belonging to Streptococcus thermophilus are lactic acid bacteria belonging to Streptococcus thermophilus other than Streptococcus thermophilus TA-45.

[0011] (4) The composition for activating pDC described in (1) to (3), wherein the Lactobacillus lactic acid bacteria is at least one Lactobacillus lactic acid bacteria selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus gasseri, and Lactobacillus paragasseri.

[0012] (5) The plasmacytoid dendritic cell activation composition according to any one of (1) to (4), wherein the Lacticaceobacillus genus lactic acid bacteria is at least one Lacticaceobacillus genus lactic acid bacteria selected from Lacticaceobacillus paracasei and Lacticaceobacillus paracasei subsp. paracasei.

[0013] (6) The composition for activating pDC according to any one of (1) to (5), wherein the Lactobacillus lactic acid bacteria has a 16S rRNA gene that has 90% or more sequence identity with the base sequence of SEQ ID NO: 1 below. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0014] (7) A composition for activating pDCs described in (1) to (6), wherein the Lactobacillus lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus.

[0015] (8) The composition for activating pDC according to (7), wherein the Lactobacillus delbrueckii subsp. bulgaricus is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

[0016] (9) The composition for activating pDC according to any one of (1) to (8), wherein the lactic acid bacterium belonging to Streptococcus thermophilus has a 16S rRNA gene that has 90% or more sequence identity with the base sequence of SEQ ID NO: 3 below. <16S rRNA gene (SEQ ID NO: 3)> GCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGGGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACC TAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGAGGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAG CAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT

[0017] (10) The composition for activating pDC according to any one of (1) to (9), wherein the lactic acid bacterium belonging to the genus Streptococcus thermophilus is Streptococcus thermophilus OLS3059 (FERM BP-10740).

[0018] (11) A composition for activating pDC described in (1) to (10), which increases the amount of CD86 expression in the pDC in peripheral blood mononuclear cells (PBMC).

[0019] (12) A composition for activating pDC according to any one of (1) to (11), which increases the amount of HLA-DR expression on the pDC in peripheral blood mononuclear cells (PBMC).

[0020] (13) A composition for activating pDC described in (1) to (12), which increases the amount of CD40 expression in the pDC in peripheral blood mononuclear cells (PBMC).

[0021] (14) A composition for activating pDC described in (1) to (13), which increases the amount of CD80 expression in the pDC in peripheral blood mononuclear cells (PBMC).

[0022] (15) A composition for activating pDC described in (1) to (14), further comprising exopolysaccharides of the Lactobacillus lactic acid bacteria (excluding Lactobacillus helveticus) or exopolysaccharides of the Lacticaseibacillus lactic acid bacteria.

[0023] (16) A composition for activating pDC described in (1) to (15), wherein the lactic acid bacteria are killed bacteria.

[0024] (17) A composition for activating pDC described in (1) to (16), wherein the lactic acid bacteria are live cells.

[0025] The present invention also includes the following inventions.

[0026] (18) A method for activating pDC in a subject in need thereof, comprising administering to the subject a composition containing one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus.

[0027] (19) Use of one or more lactic acid bacteria selected from Lactobacillus lactic acid bacteria (excluding Lactobacillus helveticus), Lacticaceibacillus lactic acid bacteria, and Streptococcus thermophilus lactic acid bacteria that activate pDC.

[0028] (20) One or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus are used as an active ingredient of a composition for activating pDC.

[0029] (21) Use of one or more lactic acid bacteria selected from the group consisting of lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus, for the manufacture of a composition that activates pDC.

[0030] According to the present invention, it is possible to provide a composition for activating pDCs that is safer and easier to ingest than conventional methods, and by administering this composition to a subject in need thereof, pDCs in the subject can be activated.

[0031] 1 is a graph showing the expression intensity of CD86 of pDC in the group to which OLL1073R-1 and OLS3059 were not added and the group to which heat-killed bacteria of OLL1073R-1 and OLS3059 were added in Example 1. In the figure, "-" indicates the "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." Furthermore, Lot A and Lot B indicate that different lots of PBMC were used. 1 is a graph showing the expression intensity of HLA-DR in pDC in a group to which OLL1073R-1 and OLS3059 were not added and a group to which heat-killed cells of OLL1073R-1 and OLS3059 were added in Example 1. In the figure, "-" indicates the "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." Furthermore, Lot A and Lot B indicate that different lots of PBMC were used. 1 is a graph showing the expression intensity of CD40 of pDC in the group to which OLL1073R-1 and OLS3059 were not added and the group to which heat-killed bacteria of OLL1073R-1 and OLS3059 were added in Example 1. In the figure, "-" indicates the "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." Furthermore, Lot A and Lot B indicate that different lots of PBMC were used. 1 is a graph showing the expression intensity of CD80 of pDC in a group to which OLL1073R-1 and OLS3059 were not added, and a group to which heat-killed cells of OLL1073R-1 and OLS3059 were added in Example 1. In the figure, "-" indicates a "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059."Furthermore, Lot A and Lot B indicate that different lots of PBMC were used. This is a graph showing the expression intensity of CD86 in pDC in a group to which OLL1073R-1 and OLS3059 were not added, and in a group to which live bacteria OLL1073R-1 and OLS3059 were added in Example 2. In the figure, "-" indicates the "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." 1 is a graph showing the expression intensity of HLA-DR of pDC in a group to which OLL1073R-1 and OLS3059 were not added, and a group to which live bacteria of OLL1073R-1 and OLS3059 were added in Example 2. In the figure, "-" indicates a "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." This is a graph showing the expression intensity of CD40 of pDC in a group to which OLL1073R-1 and OLS3059 were not added, and a group to which live bacteria of OLL1073R-1 and OLS3059 were added in Example 2. In the figure, "-" indicates a "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." This is a graph showing the expression intensity of CD80 of pDC in the OLL1073R-1 and OLS3059 non-addition group and the OLL1073R-1 and OLS3059 live bacteria-addition group in Example 2. In the figure, "-" indicates a "non-addition group," "R-1" indicates "Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1," and "3059" indicates "Streptococcus thermophilus OLS3059." OLL1073R-1 and JCM1002 in Example 3. Ｔ1 is a graph showing the expression intensity of CD86 in pDC in the groups containing OLL1073R-1, OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, and JCM1130, as well as in the group to which OLS3059 was not added, and in the group to which heat-killed cells of these bacteria were added. Ｔ 10 is a graph showing the expression intensity of HLA-DR in pDC in a group to which OLL1073R-1, JCM1002, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, and JCM1130, as well as in a group to which OLS3059 was not added, and in a group to which heat-killed cells of these bacteria were added. Ｔ 10 is a graph showing the expression intensity of CD40 in pDC in the groups containing OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, and JCM1130, as well as in the group to which OLS3059 was not added, and in the group to which heat-killed cells of these bacteria were added.

[0032] The composition according to an embodiment of the present invention comprises one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria of the genus Streptococcus thermophilus, and has the function of activating pDC. Preferably, this composition is fermented milk. The definitions of each term in the present invention are described in detail below.

[0033] 1. Lactobacillus lactic acid bacteria The Lactobacillus lactic acid bacteria according to an embodiment of the present invention (excluding Lactobacillus helveticus) are those listed in Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): It is a general term for all bacteria that have been recognized as belonging to the genus Lactobacillus after the reclassification by M.S. 2782-2858, and includes Lactobacillus acidophilus, Lactobacillus amylovorus, Lactobacillus crispatus, Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, and Lactobacillus delbrueckii subsp. Examples of suitable Lactobacillus species include Lactobacillus bulgaricus, Lactobacillus gasseri, and Lactobacillus paragasseri, but are not limited to specific species or strains. Lactobacillus lactic acid bacteria are sometimes classified as either plant-derived or animal-derived depending on their origin, but both plant-derived and animal-derived lactic acid bacteria can be used in the present invention.The strain of Lactobacillus lactic acid bacteria of the present invention is preferably one or more strains of Lactobacillus lactic acid bacteria that can prepare fermented milk (e.g., yogurt) that has been widely consumed. Each of the lactic acid bacteria is described in detail below.

[0034] (1) Lactobacillus delbrueckii Lactobacillus delbrueckii is preferably Lactobacillus delbrueckii OLL204989 (hereinafter referred to as “OLL204989 or 204989”). Here, Lactobacillus delbrueckii OLL204989 was deposited by Meiji Co., Ltd. on February 5, 2019, at the Patent Microorganism Deposit Center of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, Room 122), and then on April 1, 2019, it was deposited under the accession number: NITE BP-02874.

[0035] Lactobacillus delbrueckii OLL204989 is a Lactobacillus delbrueckii strain classified into Cluster I in the MLSA classification based on seven housekeeping genes consisting of the fusA gene, the gyrB gene, the hsp60 gene, the ileS gene, the pyrG gene, the recA gene, and the recG gene, and satisfies the following conditions (i) to (vii): (i) possessing a fusA gene having an allele number of 2 or 14, (ii) possessing a gyrB gene having an allele number selected from 3, 17, 18, and 25, (iii) possessing an hsp60 gene having an allele number selected from 4, 18, 26, and 27, and (iv) possessing an ileS gene having an allele number selected from 16, 20, 21, 30, and 33. (v) possessing a pyrG gene with allele number 22 or 23, (vi) possessing a recA gene with allele number selected from 2, 7, 24, and 28, and (vii) possessing a recG gene with allele number 3. The present invention is also applicable to Lactobacillus delbrueckii that satisfies all of the above conditions (i) to (vii) in the MLSA classification based on seven housekeeping genes consisting of the fusA gene, gyrB gene, hsp60 gene, ileS gene, pyrG gene, recA gene, and recG gene. The present invention can be achieved with Lactobacillus delbrueckii strains classified as Lactobacillus delbrueckii OLL204989 in the MLSA classification.

[0036] (2) Lactobacillus delbrueckii subsp. bulgaricus Lactobacillus delbrueckii subsp. bulgaricus includes Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (hereinafter sometimes referred to as “R-1 lactic acid bacteria”) and Lactobacillus delbrueckii subsp. bulgaricus JCM1002. Ｔ (hereinafter referred to as “JCM1002 Ｔbulgaricus OLL1073R-1 was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) on February 22, 1999, at the National Institute of Advanced Industrial Science and Technology (National Institute of Advanced Industrial Science and Technology, Tsukuba Center Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture) under accession number FERM P-17227 on the same day. This deposit was transferred from the original deposit to a deposit under the Budapest Treaty on November 29, 2006. At the time of this transfer, the deposit was assigned the accession number FERM BP-10741. Incidentally, the patent microorganism deposit business of the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary was transferred to the National Institute of Technology and Evaluation (NITE) Patent Organism Depositary on April 1, 2012, and the NITE Patent Organism Depositary was relocated to the NITE office at Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan on April 1, 2013. Furthermore, Lactobacillus delbrueckii subsp. bulgaricus JCM1002 was also deposited here. Ｔ was obtained from the Japan Collection of Microorganisms (RIKEN BRC-JCM, Japan) under JCM number JCM1002. Ｔ The T at the end of the lower number indicates that it is the "type strain (taxonomic type strain)."

[0037] Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 and Lactobacillus delbrueckii subsp. bulgaricus JCM1002 Ｔ is capable of producing polysaccharides and is characterized by producing phosphorus-containing polysaccharides composed of galactose and glucose extracellularly.

[0038] (3) Lactobacillus gasseri and Lactobacillus paragasseri Lactobacillus gasseri and Lactobacillus paragasseri are preferably Lactobacillus gasseri JCM1131 (hereinafter sometimes referred to as "JCM1131"), Lactobacillus gasseri JCM5813 (hereinafter sometimes referred to as "JCM5813"), Lactobacillus paragasseri OLL2716 (hereinafter sometimes referred to as "OLL2716"), and Lactobacillus paragasseri JCM1130 (hereinafter sometimes referred to as "JCM1130"). Furthermore, Lactobacillus gasseri and Lactobacillus paragasseri, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813 and Lactobacillus paragasseri JCM1130 are available from the RIKEN BioResource Center (RIKEN BRC) Microorganism Materials Development Division (Japan Collection of Microorganisms) (RIKEN BRC-JCM, Japan) under JCM numbers JCM5813, JCM1130 and JCM1131. Lactobacillus paragasseri OLL2716 (this strain was reclassified from Lactobacillus gasseri to Lactobacillus paragasseri) was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) at the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (1-1-3 Higashi, Tsukuba City, Ibaraki Prefecture, Japan) on May 24, 1999, and was subsequently deposited under accession number FERM BP-6999 on January 14, 2000. On the same day, this deposit was transferred from the original deposit to a deposit under the Budapest Treaty. Incidentally, the patent microorganism deposit business of the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry was later centralized at the Patent Organism Deposit Center, National Institute of Technology and Evaluation (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan).

[0039] Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716 and Lactobacillus paragasseri JCM1130 are polysaccharide-producing strains, characterized by the extracellular production of phosphorus-containing polysaccharides composed of galactose and glucose.

[0040] The bacteriological properties of Lactobacillus paragasseri OLL2716 are as follows: Morphology: rod-shaped bacterium. No gas production from glucose. GC content: 36.4%. Gram-positive. Catalase-negative. Lactic acid optical rotation: DL-type. No growth at 15°C. Produces acid by assimilating glucose, mannose, fructose, galactose, sucrose, cellobiose, lactose, trehalose, starch, and dextrin.

[0041] (4) Others Examples of Lactobacillus lactic acid bacteria according to the present invention include Lactobacillus delbrueckii OLL204989, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, and Lactobacillus delbrueckii subsp. bulgaricus JCM1002. Ｔ Strains substantially equivalent to Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716, and Lactobacillus paragasseri JCM1130 can also be used.

[0042] Here, examples of substantially equivalent strains include, for example, Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 90% or more sequence identity with the base sequence of SEQ ID NO: 1 shown in the sequence listing below (i.e., the entire 16S rRNA gene sequence or a characteristic portion thereof (such as the V1 region, V2 region, V3 region, or the entire V1 region, V2 region, and V3 region, or a portion including the V1 region, V2 region, and V3 region)), more preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 95% or more sequence identity with the base sequence of SEQ ID NO: 1, and even more preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 98% or more sequence identity with the base sequence of SEQ ID NO: 1, and even more preferably Lactobacillus lactic acid bacteria having a 16S rRNA gene that has 99% or more sequence identity with the base sequence of SEQ ID NO: 1. It is even more preferable that the lactic acid bacteria be Lactobacillus bacteria having an rRNA gene, and it is particularly preferable that the lactic acid bacteria be Lactobacillus bacteria having a 16S rRNA gene that has 99.5% or more sequence identity with the base sequence of SEQ ID NO:1.

[0043] Regarding criteria for determining species identity based on 16S rRNA gene sequences, those skilled in the art can refer to Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today 2006;33:152-155.

[0044] For example, the sequence of the V1 to V3 regions of the 16S rRNA gene of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (corresponding to the 34th to 535th bases in the full-length sequence of the 16S rRNA gene) is shown below as SEQ ID NO: 1 (sometimes referred to as the "nucleotide sequence"). However, Lactobacillus helveticus is excluded from the Lactobacillus lactic acid bacteria according to the embodiments of the present invention.

[0045] (Sequence Listing) <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0046] For example, the sequence of the V1 to V3 regions of the 16S rRNA gene of Lactobacillus paragasseri OLL2716 (corresponding to the 34th to 535th bases in the full-length sequence of the 16S rRNA gene) is SEQ ID NO: 2 (sometimes referred to as the "nucleotide sequence") as follows:

[0047]

[0048] In embodiments of the present invention, unless otherwise specified, the term "sequence identity" refers to the percentage of the number of matching bases shared between two sequences when the two sequences are optimally aligned. Analysis of base sequence identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art. Commercially available genetic information processing software may be used to calculate identity.

[0049] The mycological properties of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 are as follows:

[0050] (4-1) Morphological characteristics Cell shape: rod-shaped Motility: none Presence or absence of spores: none Gram staining: positive

[0051] (4-2) Growth on Medium The strain was spread on a BL agar medium (Eiken Chemical) plate and cultured at 37°C for 48 hours using the steel wool method, resulting in the formation of opaque, rough colonies.

[0052] (4-3) Physiological properties Nitrate reduction: negative Indole production: negative Gelatin liquefaction: negative Catalase activity: negative Attitude towards oxygen: facultative anaerobic Produces D(-) lactic acid from glucose by homolactic fermentation, and in BL liquid medium (which does not produce gas), growth at 10°C is negative, and growth at 45°C is positive Arginine decomposition: negative Gas production from malic acid: negative Decomposition of various carbohydrates (positive +, negative -) Arabinose - Xylose - Rhamnose - Ribose - Glucose + Mannose + Fructose + Galactose - Sucrose - Maltose - Cellobiose - Lactose + Trehalose - Melibiose - Raffinose - Melezitose - Dextrin - Starch - Glycogen - Inulin - Mannitol - Sorbitol - Inositol - Esculin - Salicin -

[0053] (4-4) Polysaccharide Productivity The present R-1 lactic acid bacterium has the ability to produce polysaccharides, and is characterized by extracellularly producing polysaccharides containing galactose and glucose as constituent sugars and containing phosphorus.

[0054] 2. Lactic acid bacteria of the genus Lactic acid bacteria of the genus Lactic acid bacteria of the genus Lactic acid bacteria of the genus Lactic acid bacteria are a genus that was established by splitting from the genus Lactobacillus with Lactic acid bacteria of the genus Lactic acid bacteria (Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol 2020; 70:2782-2858.). The genus Lacticaseibacillus includes a total of 21 species, including Lacticaseibacillus casei, Lacticaseibacillus paracasei, and Lacticaseibacillus paracasei subsp. paracasei. Examples of Lacticase Bacillus paracasei subsp. paracasei include Lacticase Bacillus paracasei subsp. paracasei YIT9029 (old classification: Lacticase Bacillus casei YIT9029) (hereinafter sometimes referred to as "YIT9029"), Lacticase Bacillus paracasei subsp. paracasei NY1301 (hereinafter sometimes referred to as "NY1301"), Lacticase Bacillus paracasei subsp. paracasei P2303502, and Lacticase Bacillus paracasei subsp. paracasei JCM1053.Lacticase Bacillus paracasei subsp. paracasei YIT9029 has been deposited at the National Institute of Technology and Evaluation (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818) under accession number FERM BP-1366 (deposit date: May 1, 1981). Lacticase Bacillus paracasei subsp. paracasei YIT9029 can be isolated by standard methods using a selective medium for lactobacilli from Yakult (registered trademark) 400 manufactured by Yakult Honsha Co., Ltd. Lacticase Bacillus paracasei subsp. paracasei NY1301 can be isolated by standard methods using a selective medium for lactobacilli from Pirkul (registered trademark) 400 manufactured by Nisshin York Co., Ltd. Lacticase Bacillus paracasei subsp. paracasei P2303502 is available for distribution at the Meiji Innovation Center of Meiji Co., Ltd. (1-29-1 Shichikuni, Hachioji, Tokyo, Japan, 192-0919). Lacticase Bacillus paracasei subsp. paracasei JCM1053 is available from the Japan Collection of Microorganisms, RIKEN BioResource Center (RIKEN BRC) (RIKEN BRC-JCM, Japan) under JCM number JCM1053.

[0055] Lacticase Bacillus paracasei subsp. paracasei YIT9029, Lacticase Bacillus paracasei subsp. paracasei NY1301, Lacticase Bacillus paracasei subsp. paracasei P2303502, and Lacticase Bacillus paracasei subsp. paracasei JCM1053 are capable of producing polysaccharides.

[0056] 3. Lactic acid bacteria belonging to Streptococcus thermophilus The lactic acid bacteria belonging to Streptococcus thermophilus according to the embodiment of the present invention is a general term for all bacteria taxonomically recognized as belonging to the genus Streptococcus thermophilus, and are not limited by bacterial species or strains. Lactic acid bacteria belonging to Streptococcus thermophilus are sometimes classified as plant-derived or animal-derived depending on their origin, but both plant-derived and animal-derived lactic acid bacteria can be used in the present invention. The lactic acid bacteria strain belonging to Streptococcus thermophilus according to the present invention is preferably one or more strains of lactic acid bacteria belonging to Streptococcus thermophilus that can be used to prepare fermented milk (e.g., yogurt) that is widely consumed. Such lactic acid bacteria belonging to Streptococcus thermophilus are preferably lactic acid bacteria belonging to Streptococcus thermophilus having a 16S rRNA gene that has 90% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3 below (i.e., the entire sequence of the 16S rRNA gene or a characteristic portion thereof (such as the V1 region, V2 region, V3 region, or the entire sequence of the V1 region, V2 region, and V3 region, or a portion including the V1 region, V2 region, and V3 region)), more preferably lactic acid bacteria belonging to Streptococcus thermophilus having a 16S rRNA gene that has 95% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3, and even more preferably lactic acid bacteria belonging to Streptococcus thermophilus having a 16S rRNA gene that has 98% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3, and even more preferably lactic acid bacteria belonging to Streptococcus thermophilus having a 16S rRNA gene that has 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3). It is even more preferable that the lactic acid bacteria belong to Streptococcus thermophilus and have an rRNA gene, and it is particularly preferable that the lactic acid bacteria belong to Streptococcus thermophilus and have a 16S rRNA gene that has 99.5% or more sequence identity with the base sequence of SEQ ID NO: 3.SEQ ID NO: 3 shown in the sequence listing below is the base sequence (sometimes referred to as the "nucleotide sequence") of the V1 to V3 regions of the 16S rRNA gene of Streptococcus thermophilus OLS3059 (corresponding to the base sequence from bases 34 to 522 in the full-length sequence of the 16S rRNA gene). However, the lactic acid bacteria belonging to Streptococcus thermophilus according to an embodiment of the present invention are preferably lactic acid bacteria belonging to Streptococcus thermophilus other than Streptococcus thermophilus TA-45.

[0057] (Sequence Listing) <16S rRNA gene (SEQ ID NO: 3)> GCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGGGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACC TAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGAGGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAG CAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT

[0058] Furthermore, the lactic acid bacterium belonging to the genus Streptococcus thermophilus according to an embodiment of the present invention is preferably Streptococcus thermophilus OLS3059 (hereinafter sometimes referred to as "OLS3059").

[0059] The "OLS3059 strain" in the present invention may also include strains equivalent to the OLS3059 strain, as long as the effects of the present invention can be obtained. Here, the equivalent strain refers to a derivative or mutant strain of the OLS3059 strain, or a descendant strain of such a derivative or mutant strain, and has the same mycological properties as OLS3059.

[0060] It should be noted that "Streptococcus thermophilus OLS3059" was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) on February 29, 1996, with the National Institute of Advanced Industrial Science and Technology (AIST), Patent Organism Depositary (Tsukuba Center, Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture, Japan), and was subsequently internationally deposited on November 29, 2006 (deposit date) with the National Institute of Advanced Industrial Science and Technology (AIST), Patent Organism Depositary (Tsukuba Center, Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture, Japan) under deposit number FERM BP-10740 in accordance with the Budapest Treaty. The patent microorganism deposit business of the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center was transferred to the National Institute of Technology and Evaluation (NITE) on April 1, 2012, and the NITE Patent Organism Depositary Center was relocated to the NITE office at Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan on April 1, 2013.

[0061] The lactic acid bacteria according to the embodiment of the present invention can be obtained by culturing (growing) them using known medium components. For example, to obtain the lactic acid bacteria that serve as the active ingredient of the composition, a lactic acid bacteria culture solution itself may be used, or a culture solution obtained by centrifuging or otherwise treating it to increase the number of lactic acid bacteria per unit weight may be used. Furthermore, by centrifuging or filtering the lactic acid bacteria culture solution, components other than the bacterial cells can be substantially removed, and only the bacterial cells can be recovered and used as the active ingredient. Here, "substantially removing components other than the bacterial cells" means that the culture does not contain other components, such as exopolysaccharides, in amounts that would be effective.

[0062] The lactic acid bacteria according to the embodiment of the present invention may be in a state where they have just been cultured (grown), or may be in a state where they have been mixed with a cryoprotectant or the like and frozen, or may be in a freeze-dried state. The lactic acid bacteria according to the embodiment of the present invention may be contained in the composition in a state other than the above-mentioned state as long as they exert the intended effect, but it is preferable that they are contained in the composition as lactic acid bacteria cells themselves.

[0063] 4. Exopolysaccharides The exopolysaccharides according to the embodiment of the present invention are produced by the above-mentioned Lactobacillus lactic acid bacteria or Lacticaseibacillus lactic acid bacteria. As mentioned above, the Lactobacillus lactic acid bacteria is preferably at least one lactic acid bacterium selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri, and Lactobacillus paragasseri. Furthermore, the Lactobacillus lactic acid bacteria may be Lactobacillus delbrueckii OLL204989, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, or Lactobacillus delbrueckii subsp. bulgaricus JCM1002. Ｔ More preferably, the Lactobacillus is at least one lactic acid bacterium selected from the group consisting of Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716, and Lactobacillus paragasseri JCM1130. As mentioned above, the Lacticaceae Bacillus lactic acid bacterium is preferably Lacticaceae Bacillus paracasei. Furthermore, the Lacticaceae Bacillus paracasei is preferably at least one lactic acid bacterium selected from the group consisting of Lacticaceae Bacillus paracasei subsp. paracasei YIT9029 and Lacticaceae Bacillus paracasei subsp. paracasei NY1301.

[0064] The exopolysaccharide according to an embodiment of the present invention is preferably a polysaccharide containing galactose and glucose as constituent sugars, more preferably a polysaccharide containing galactose and glucose as constituent sugars, even more preferably a polysaccharide containing galactose and glucose as constituent sugars and containing phosphorus, and particularly preferably a polysaccharide containing galactose and glucose as constituent sugars and containing phosphorus. Furthermore, the exopolysaccharide preferably contains a phosphorylated polysaccharide. Furthermore, the exopolysaccharide may contain a non-phosphorylated polysaccharide, but preferably does not contain a sulfated polysaccharide.

[0065] The exopolysaccharides referred to herein are not particularly limited as long as they have the desired effect, but are preferably those produced by fermenting raw milk (preferably a raw material containing milk as defined in the Milk and Milk Products Ordinance) using the above-mentioned lactic acid bacteria. The exopolysaccharides used in the embodiments of the present invention may be one type or a combination of two or more types. Furthermore, exopolysaccharides produced by fermenting plants themselves (seeds, etc.) or plant-derived raw materials using the above-mentioned lactic acid bacteria may be excluded. Furthermore, exopolysaccharides produced by fermenting a medium or substrate that does not contain one or more of glucose, galactose, and lactose using the above-mentioned lactic acid bacteria may be excluded.

[0066] 5. Plasmacytoid Dendritic Cells pDCs are one of the cells contained in peripheral blood mononuclear cells (PBMCs). As described in the Examples below, a composition according to an embodiment of the present invention activates pDCs. CD86, HLA-DR, CD40, CD80, and the like are known as indicators (activation markers) for confirming that pDCs are activated. The degree of activation of pDCs can be confirmed by checking the expression intensities of CD86, HLA-DR, CD40, CD80, and the like in pDCs. The expression intensities of CD86, HLA-DR, CD40, and CD80 can be confirmed by the methods described in the Examples below, or the like.

[0067] 6. Compositions The term "compositions" as used herein includes preparations such as liquid diets, supplements, and food additives, foods and beverages (excluding plants and animals themselves), and food and beverage compositions (including processed foods and beverages) that can be ingested by animals (including humans). Food and beverages may also include fermented milk (yogurt).

[0068] The "composition" may be a drug or a quasi-drug.

[0069] As described above, the composition according to an embodiment of the present invention contains one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus.

[0070] The composition according to the embodiment of the present invention may contain not only the bacterial cells themselves, but also substances derived from the bacterial cells, such as crushed bacterial cells. The lactic acid bacteria according to the embodiment of the present invention may be live or killed, preferably live. Killed lactic acid bacteria can be obtained by sterilizing the lactic acid bacteria (effective bacteria) that serve as the active ingredient. The sterilization method is not particularly limited as long as it achieves the desired effect, and can be performed using heat, a germicidal lamp (UV irradiation), ozone, chemicals, high osmotic pressure, or the like. The killed bacteria are preferably heat-killed bacteria obtained by heat-treating live bacteria. The heat treatment to obtain heat-killed bacteria is not particularly limited as long as it achieves the desired effect, and is carried out at a temperature and for a time sufficient to kill the effective bacteria used. The conditions for this heat treatment vary depending on the effective bacteria used in the composition. For example, the heat treatment temperature may be 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 80°C or higher, or 90°C or higher. The upper limit of the heat treatment temperature is not particularly limited as long as the desired effect is achieved, but may be, for example, 121°C, 100°C, 90°C, or 80°C or lower. Depending on the heat treatment temperature, the heat treatment time may be 1 minute or longer. The heat treatment time may be 3 minutes or longer, 10 minutes or longer, 15 minutes or longer, 30 minutes or longer, or 45 minutes or longer. The upper limit of the heat treatment time may be, for example, 120 minutes, 100 minutes, 90 minutes, or 80 minutes. The composition according to the present invention can be prepared in the form of a dry product, suspension, paste, gel, or the like, regardless of whether the lactic acid bacteria contained in the composition are live or killed.

[0071] When the composition according to an embodiment of the present invention is used as a composition for activating pDC dendritic cells, the effective amount (amount of intake) per day for humans is preferably 1×10 ４ 5×10 pieces or more １２ in the range of 1×10 or less, more preferably 1×10 ５ 5×10 pieces or more１１ in the range of 1×10 or less, more preferably 1×10 ６ 5×10 pieces or more １０ in the range of 10 or less, more preferably 2 x 10 ７ 5×10 pieces or more ９ in the range of 10 or less, more preferably 2 x 10 ７ 3x10 pieces or more ９ It is desirable to incorporate it so that it is ingested in the range of 1×10 or less, and even more preferably 1×10 ６ More than 1×10 pieces ８ It is desirable that the amount of the compound contained be such that the intake is within the range of 100 or less. The upper and lower limits can be freely combined.

[0072] Furthermore, compositions according to embodiments of the present invention may contain exopolysaccharides produced by Lactobacillus or Lacticaseibacillus lactic acid bacteria. Exopolysaccharides are a type of metabolite produced by the cultivation or fermentation of these lactic acid bacteria. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (deposit number: FERM BP-10741), a lactic acid bacterium of the Lactobacillus genus, is known to produce exopolysaccharides during cultivation (hereinafter, exopolysaccharides may be referred to as "EPS," and in particular, exopolysaccharides produced by R-1 lactic acid bacteria may be referred to as "R1-EPS"). Compositions according to embodiments of the present invention may contain these exopolysaccharides as active ingredients. In the composition according to the embodiment of the present invention, the lower limit of the daily intake of these exopolysaccharides is 10 μg, preferably 15 μg, more preferably 25 μg, even more preferably 100 μg, even more preferably 200 μg, particularly preferably 500 μg, even more particularly preferably 1.0 mg, even more preferably 2.0 mg, and even more preferably 3.0 mg. The upper limit is not particularly limited, but is, for example, 200 mg, preferably 100 mg, more preferably 70 mg, even more preferably 30 mg, even more preferably 8.0 mg, particularly preferably 7.0 mg, and even more particularly preferably 5.0 mg. In the composition according to the embodiment of the present invention, the range of the daily intake of the exopolysaccharides can be set by freely combining the above upper and lower limits.

[0073] In the production of the composition according to the embodiment of the present invention, the stage of blending the exopolysaccharide can be appropriately selected. The stage of blending is not particularly limited as long as the properties of the exopolysaccharide are not significantly impaired. For example, a culture containing exopolysaccharide obtained by culturing exopolysaccharide-producing lactic acid bacteria of the genus Lactobacillus or Lacticaseibacillus, or a crude or purified product thereof, can be blended with the raw materials.

[0074] The composition according to the embodiment of the present invention may be in the form of a unit package per serving, and may also be in the form of a unit package containing effective bacterial cells.

[0075] For example, the effective ingredient, bacterial cells, can be contained in a unit package of 1 x 10 ４ pieces / g or more 1×10 １１ It is preferable that the amount of the ingested particles is in the range of 1×10 ５ pieces / g or more 5×10 １０ It is more preferable that the amount of the ingested amount is in the range of 1×10 ５ pieces / g or more 1×10 １０ It is more preferable that the amount of the ingested amount is within the range of 5×10 ５ pieces / g or more 5×10 ９ It is more preferable that the amount of the ingested amount is within the range of 5×10 ５ pieces / g or more 1×10 ９ pieces / g or less, 1×10 ６ pieces / g or more 5×10 ８ It is more preferable that the amount of the soluble fiber contained in the soluble fiber be in the range of 1.0×10 ６ pieces / g or more 1.0×10 7 It is even more preferable that the amount of bacteria contained is ingested within the range of 0.1g or less. The upper and lower limits can be freely combined. When the bacterial cells are live cells, the number of bacteria may be expressed in units of "CFU (Colony forming unit)". When the bacterial cells are dead cells or when both dead and live cells are present, and the number of bacteria is measured by directly counting the number of cells or measuring the number of DNA copies, the number of bacteria may be expressed in units of "cells". The number of bacteria may be the number of Lactobacillus lactic acid bacteria, the number of Lacticaceobacillus lactic acid bacteria, the number of Streptococcus thermophilus lactic acid bacteria, or the total number of Lactobacillus lactic acid bacteria, the number of Lacticaceobacillus lactic acid bacteria, and the number of Streptococcus thermophilus lactic acid bacteria.

[0076] Furthermore, for example, the exopolysaccharides contained per unit package are preferably ingested at a concentration in the range of 1 μg / g to 1000 μg / g, more preferably 10 μg / g to 800 μg / g, even more preferably 50 μg / g to 500 μg / g, still more preferably 100 μg / g to 500 μg / g, and even more preferably 200 μg / g to 400 μg / g, or 250 μg / g to 350 μg / g. Note that these upper and lower limits can be freely combined.

[0077] When packaging the composition according to an embodiment of the present invention per unit package, known packaging can be used. For example, there are no particular limitations on the packaging materials, such as paper, plastic, glass, nylon, stainless steel, aluminum, iron, copper, silver, bamboo, etc. However, considering that lactic acid bacteria are facultative anaerobes, it is preferable to use a form that does not come into contact with air or oxygen. For example, it is preferable to include a step in the manufacturing process or packaging process of the composition according to an embodiment of the present invention to eliminate the possibility of exposure to oxygen, and it is also preferable to select a packaging material that does not allow oxygen to penetrate into the package during storage after packaging.

[0078] The composition according to the embodiment of the present invention may be taken orally, although the route of intake is not particularly limited. Furthermore, the form of intake of the composition when taken orally is not particularly limited, although oral intake as "fermented milk" is particularly preferred.

[0079] Furthermore, the intake form of the composition according to the embodiment of the present invention is not limited to the above-mentioned "fermented milk," and may be, for example, chocolate, jelly, ice cream, frozen dessert, beverage, chewable tablet, tablet, gummy candy, cheese, spread, health food (nutrient functional food, food for specified health use, dietary supplement, functional food, supplement, etc.), pharmaceutical, quasi-drug, etc. Furthermore, in the present invention, "functional food" includes health food to which a health claim based on the food standards of Codex Alimentarius (Joint FAO / WHO Food Standards Commission) is applied. In addition, in the production of these compositions, the stage of blending the bacterial cells, which are the active ingredient, can be selected as appropriate.

[0080] 7. Fermented Milk As described above, the composition according to an embodiment of the present invention is preferably ingested as "fermented milk." The fermented milk according to an embodiment of the present invention refers to fermented milk (animal milk), and includes, but is not limited to, "fermented milk," "lactic acid bacteria beverage," "milk beverage," and "natural cheese" as defined in the Ministerial Ordinance on Milk and Dairy Products (Milk and Dairy Products Ordinance). For example, the fermented milk refers to "fermented milk" as defined in the Milk and Dairy Products Ordinance, i.e., milk such as raw milk, cow's milk, special cow's milk, raw goat's milk, pasteurized goat's milk, raw sheep's milk, adjusted milk, low-fat milk, non-fat milk, and processed milk, or milk containing an equivalent or higher non-fat milk solids, fermented with lactic acid bacteria or yeast, and made into a solid (hard type), pasty (soft type), or liquid (drink type), or frozen versions of these, but is not limited to these.

[0081] Alternatively, commercially available products containing the lactic acid bacteria of the present invention may be used for convenience. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 can be isolated from "Meiji Probio Yogurt R-1" sold by Meiji Co., Ltd.

[0082] In the fermented milk according to the embodiment of the present invention, the concentration of non-fat milk solids is, for example, preferably in the range of 4.0% to 12.0% by mass, more preferably in the range of 6.0% to 10.0% by mass, and even more preferably in the range of 7.0% to 9.0% by mass. The concentration of milk fat is, for example, preferably in the range of 0.2% to 4.0% by mass, more preferably in the range of 0.3% to 3.0% by mass, and even more preferably in the range of 0.4% to 2.0% by mass.

[0083] In the fermented milk according to the embodiment of the present invention, 1 x 10 Lactobacillus lactic acid bacteria cells are contained per unit package. ５ pieces / g or more 1×10 １１ It is preferable that the amount of the ingested particles is in the range of 1×10 ６ pieces / g or more 5×10 ９ It is more preferable that the amount of the ingested amount is in the range of 1×10 ７ pieces / g or more 1×10 ９ It is more preferable that the amount of the ingested amount is in the range of 5×10 ７ pieces / g or more 7×10 ８ It is more preferable that the amount of the stimulant contained be in the range of 100 pieces / g or less. The upper and lower limits can be freely combined.

[0084] In addition, 1 x 10 lactic acid bacteria belonging to Streptococcus thermophilus are contained in each unit package. ６ pieces / g or more 1×10 １２ It is preferable that the amount of the ingested particles is in the range of 1×10 ７ pieces / g or more 5×10 １１ It is more preferable that the amount of the ingested amount is in the range of 1×10 ８ pieces / g or more 5×10 ９ It is more preferable that the amount of the ingested amount is in the range of 5×10 ８ pieces / g or more 5×10 ９It is more preferable that the amount of the stimulant contained be in the range of 100 pieces / g or less. The upper and lower limits can be freely combined.

[0085] A typical example of fermented milk is yogurt. The international standards defined by the Food and Agriculture Organization of the United Nations (FAO) / World Health Organization (WHO) also stipulate that "products called yogurt are made from dairy products such as milk and skim milk powder through the lactic acid fermentation of both Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, with the two bacteria surviving in large quantities in the final product." In the present invention, "yogurt" encompasses the yogurt defined by the FAO / WHO. Examples of this yogurt include plain yogurt, hard yogurt (set yogurt), soft yogurt, and drinkable yogurt. As the yogurt according to the embodiment of the present invention, hard yogurt is particularly preferred from the viewpoint of satisfying texture and satisfaction. Furthermore, when the subject is elderly, hard yogurt is particularly preferred from the viewpoint of preventing aspiration.

[0086] An example of a method for preparing fermented milk according to an embodiment of the present invention is a method in which raw milk is sterilized and cooled, a lactic acid bacteria starter containing the above-mentioned lactic acid bacteria is added to the raw milk, and the raw milk containing the lactic acid bacteria starter is fermented at a fermentation temperature and for a fermentation time that results in a predetermined lactic acid acidity. In this method, the lactic acid acidity is preferably, for example, in the range of 0.6 to 1.2, and more preferably in the range of 0.6 to 0.8. The fermentation temperature is preferably, for example, in the range of 40°C to 45°C. The fermentation time is preferably, for example, in the range of 2 to 12 hours, and more preferably in the range of 3 to 8 hours.

[0087] In the fermented milk according to the embodiment of the present invention, fermentation microorganisms such as lactic acid bacteria other than those belonging to the genus Lactobacillus, Lacticaseibacillus, and Streptococcus thermophilus, bifidobacteria, yeast, etc. may be added as a lactic acid bacteria starter or for the purpose of imparting functionality, or bifidobacteria, yeast, etc. may not be included.

[0088] The fermented milk according to the embodiment of the present invention can be easily ingested. Furthermore, fermented milk has been widely consumed, is highly safe, and has no risk of side effects, so consumers can ingest it with peace of mind.

[0089] By packaging the fermented milk according to the embodiment of the present invention in a single package in an amount appropriate for one ingestion, the fermented milk according to the embodiment of the present invention can be ingested appropriately and easily, which is preferable from the standpoint of usability. Although the appropriate amount for one ingestion varies from person to person, in the case of fermented milk with a non-fat milk solids content of 8.0% by mass, the amount per ingestion is preferably in the range of 10 mL to 1000 mL, more preferably in the range of 30 mL to 500 mL, even more preferably in the range of 50 mL to 200 mL, and preferably in the range of 80 mL to 120 mL. Alternatively, the amount per ingestion is preferably in the range of 10 g to 1000 g, preferably in the range of 30 g to 500 g, preferably in the range of 50 g to 200 g, more preferably in the range of 80 g to 150 g, and even more preferably in the range of 100 g to 120 g.

[0090] In the embodiments of the present invention, the "form of a single package" includes all forms, for example, common packaging forms such as a container with a lid, a bottle with a cap, an individual bag, a pouch, a tube, etc. In the embodiments of the present invention, the use of the fermented milk according to the embodiments of the present invention can be clarified by describing the use, effects, intake method, etc. of the fermented milk according to the embodiments of the present invention in each individual package or in a package including multiple individual packages, and / or by enclosing an item or the like on which such an explanation is written, and / or by displaying an item or the like on which such explanation is written, such as a separate pamphlet.

[0091] From the viewpoint of enhancing the pDC dendritic cell activation effect, the composition according to the embodiment of the present invention is preferably taken continuously for 3 days or more, preferably for 5 days or more, preferably for 1 week or more, preferably for 2 weeks or more, preferably for 4 weeks or more, more preferably for 6 weeks or more, more preferably for 8 weeks or more, even more preferably for 10 weeks or more, even more preferably for 12 weeks or more, even more preferably for 24 weeks or more, and particularly preferably for 36 weeks or more. Since the composition according to the embodiment of the present invention has sufficient dietary experience and can be safely taken, there is no particular upper limit to the intake period, and it can be taken indefinitely. However, if an upper limit is imposed, it is, for example, 60 weeks or less. This upper limit may be, for example, 120 weeks or less, 100 weeks or less, or 80 weeks or less. The preferred mode of intake is oral ingestion.

[0092] When packaging the composition according to an embodiment of the present invention per unit package, known packaging can be used. For example, there are no particular limitations on the packaging materials, such as paper, plastic, glass, nylon, stainless steel, aluminum, iron, copper, silver, and bamboo. However, considering that lactic acid bacteria are facultative anaerobes, it is preferable to use a form that does not come into contact with air or oxygen. For example, in the manufacturing process or packaging process of the composition according to an embodiment of the present invention, it is preferable to include a step that eliminates the possibility of exposure to oxygen, and it is also preferable to select a packaging material that does not allow oxygen to penetrate into the package during storage after packaging.

[0093] The composition according to the embodiment of the present invention may be taken orally, although the route of intake is not particularly limited. Furthermore, the form of intake of the composition when taken orally is not particularly limited, although oral intake as "fermented milk" is particularly preferred.

[0094] Furthermore, the intake form of the composition according to the embodiment of the present invention is not limited to the above-mentioned "fermented milk," but may take the form of a food or beverage composition, a pharmaceutical product, a therapeutic diet, a supplement, a food additive, or other formulation.

[0095] In an embodiment of the present invention, the formulation is an oral formulation prepared in accordance with conventional methods using additives acceptable for formulation. This formulation may take the form of solid formulations such as tablets, powders, fine granules, granules, capsules, pills, or sustained-release preparations, or liquid formulations such as solutions, suspensions, or emulsions. Examples of additives acceptable for formulation include excipients, stabilizers, preservatives, humectants, emulsifiers, lubricants, sweeteners, colorants, flavorings, buffers, antioxidants, and pH adjusters. Specific examples of food additives include processed seasonings, flavor seasonings, and cooking mixes.

[0096] In addition, in the embodiment of the present invention, the food and drink and food and drink composition are processed for human or animal consumption, and are not particularly limited as long as they are in the form of an orally ingestible solution, suspension, emulsion, powder, solid molding, etc. Examples of the food and drink and food and drink composition include, specifically, dairy products such as milk drinks (including processed milk), yogurts, lactic acid bacteria drinks, fermented milk, ice creams, creams, cheeses, etc.; soft drinks, fruit juice drinks, vegetable drinks, soy milk drinks, coffee drinks, tea drinks, jelly drinks, cocoa, powdered drinks such as smoothies, powdered sports drinks, powdered nutritional drinks, powdered beauty foods, powdered soups, steamed bread bases, concentrated drinks, alcoholic drinks, etc.; wheat flour products such as bread, pasta, noodles, cake mix, fried chicken powder, breadcrumbs, etc.; chocolate, gum, candy, These include sweets such as cookies, gummies, snacks, Japanese sweets, jellies, puddings and other desserts; retort pouch foods such as curry, basmati sauce, pot-au-feu, stew and other Japanese-style foods; processed oils and fats such as butter, margarine, spreads and mayonnaise; instant foods such as freeze-dried foods; processed agricultural products such as canned agricultural products, jams and marmalades, pickles, boiled beans, cereals and rice porridge; processed seafood products; processed livestock products; frozen foods such as pizza, doria, gratin, prepared dishes and fries; liquid foods, as well as animal feed, tablets and cosmetics for oral use.

[0097] Furthermore, in an embodiment of the present invention, examples of foods, beverages, and food and beverage compositions include alcoholic beverages such as whiskey, bourbon, spirits, liqueur, wine, fruit wine, sake, Chinese sake, shochu, beer, non-alcoholic beer with an alcohol content of 1% or less, happoshu, other miscellaneous alcoholic beverages, and chuhai; processed foods using eggs, processed products (including delicacies) of seafood and meat (including liver and other offal), processed foods such as miso soup and other soups; condiments such as miso, soy sauce, furikake, and other seasonings; and liquid foods such as concentrated liquid foods. Note that mineral water includes both sparkling and non-sparkling mineral water.

[0098] In an embodiment of the present invention, the food and beverage products and food and beverage compositions include categories such as functional foods, health and nutritional foods, health foods, foods for specified health uses, foods with functional claims, foods with nutrient function claims, foods for the sick, infant formula, powdered milk for pregnant or nursing women, or foods and beverages with disease risk reduction claims. Here, disease risk reduction claims refer to claims of foods and beverages that may reduce disease risk, and are established or approved based on or with reference to the standards established by the Joint FAO / WHO Food Standards Commission (Codex Alimentarius Commission). Food functionality claims are made in accordance with each country's laws regarding functional foods and food safety (e.g., health food systems, functional health food systems, dietary supplement health education laws, Structure / Function Claims, European Food Safety Authority guidance, etc.). Food functionality claims are made only after approval by each country's laws regarding functional foods and food safety. Furthermore, when labeling the functionality of food, the labeling must be in accordance with each country's laws regarding functional foods and food safety.

[0099] It is preferable to label the composition according to the embodiment of the present invention with an explanation of its use, efficacy, function, type of active ingredient, method of use, etc. The term "labeling" as used herein includes all labeling intended to inform consumers of the above-mentioned effects. This labeling may be any labeling that can recall or infer the above-mentioned content, and may include any and all labeling regardless of the purpose, content, or object or medium on which it is displayed. Specifically, the term "labeling" includes labeling the above-mentioned explanation on product packaging or containers, displaying or distributing the above-mentioned explanation in product advertisements, price lists, or transaction documents, providing information containing these contents via electromagnetic means (e.g., the Internet), and sales pitches. The term "labeling" as used herein also includes labeling that recommends the intake of the composition according to the embodiment of the present invention to a specific target, i.e., so-called "notifications" (including notifications in dietary management apps, nutritional management apps, healthcare apps, etc.).

[0100] Products containing packaged compositions according to embodiments of the present invention are preferably labeled with, for example, "activates plasmacytoid dendritic cells," "supports plasmacytoid dendritic cells," "maintains the activity of plasmacytoid dendritic cells," "reduces the risk of decreased activity of plasmacytoid dendritic cells," "acts on plasmacytoid dendritic cells," "easily activates plasmacytoid dendritic cells," "easily maintains the activity of plasmacytoid dendritic cells," "for activating plasmacytoid dendritic cells," "for maintaining the activity of plasmacytoid dendritic cells," "supports the maintenance of activity of plasmacytoid dendritic cells," "helps enhance the activity of plasmacytoid dendritic cells," "activates plasmacytoid dendritic cells, which are the control center of the immune system," "maintains or improves people's health by acting on plasmacytoid dendritic cells," etc. Note that each of these phrases may be prefixed with a duration such as "temporary" or "long-term," as appropriate.

[0101] The wording used to make the above-mentioned display is not limited to the above-mentioned example, and may be a wording that has the same meaning as the above-mentioned.

[0102] In an embodiment of the present invention, the composition may contain other ingestible ingredients, various additives, pharmaceutical raw materials, etc. as ingredients other than lactic acid bacteria.

[0103] The composition can also be in the form of a food for special dietary uses, a comprehensive nutritional food, a nutritional supplement, a food for specified health uses, a food with functional claims, a processed food, etc. The composition can also be incorporated into beverages other than yogurt drinks, liquid foods, etc. The composition can also be used after being dried or concentrated.

[0104] The compositions or fermented milk according to the embodiments of the present invention are suitable for ingestion or administration to subjects for whom it is desirable to activate pDC dendritic cells. The subject referred to here is not particularly limited, but specific examples include subjects who wish to maintain their health, subjects who are aware of their frail constitution, subjects who are aware of vague symptoms, and subjects (including healthy individuals and sick individuals) for whom the effects of activating pDC dendritic cells are desired.

[0105] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0106] (Test for evaluating the pDC activity of heat-killed bacteria using human peripheral blood mononuclear cells) (1) Preparation of medium containing heat-killed bacteria of OLL1073R-1 and OLS3059. MRS (deMan, Rogosa, Sharp) liquid medium was prepared using Difco (registered trademark) Lactobacilli MRS Broth (manufactured by BD) according to the manufacturer's recommended procedure. Then, 10 μL of OLL1073R-1 bacterial solution was suspended in 5 mL of MRS liquid medium and activated at 37 ° C for 18 hours. Similarly, M17 liquid medium was prepared using Difco (registered trademark) M17 Broth (manufactured by BD) according to the manufacturer's recommended procedure, and 10 μL of OLS3059 bacterial suspension was suspended in 5 mL of M17 liquid medium, followed by activation culture of OLS3059 for 18 hours at 37° C. Subsequently, 50 μL of each activation culture was suspended in 5 mL of fresh MRS liquid medium or M17 liquid medium, and then cultured at 37° C. for 18 hours to obtain OLL1073R-1 culture medium and OLS3059 culture medium, respectively. Next, the obtained OLL1073R-1 culture medium and OLS3059 culture medium were centrifuged at 4°C and 8000 rpm for 5 minutes, and the supernatants of the obtained OLL1073R-1 culture medium and OLS3059 culture medium were removed to obtain OLL1073R-1 culture precipitates and OLS3059 culture precipitates. Thereafter, the obtained OLL1073R-1 culture precipitates and OLS3059 culture precipitates were washed twice with physiological saline and resuspended in physiological saline to obtain OLL1073R-1 suspensions and OLS3059 suspensions. Note that the OLL1073R-1 suspension and OLS3059 suspension were each diluted to 10 mL. ５ double or ten ６ After diluting the solution 1:1, the solution was smeared on an agar medium and the number of bacteria in OLL1073R-1 and OLS3059 was measured. The OLL1073R-1 suspension and OLS3059 suspension were then heated at 75°C for 1 hour to prepare solutions containing heat-killed cells of OLL1073R-1 and OLS3059.

[0107] (2) Evaluation of pDC activity using heat-killed OLL1073R-1 cells and heat-killed OLS3059 cells. PBMCs (manufactured by Precision for Medicine) were plated at 5 × 10 in a 96-well microwell plate (manufactured by Iwaki).６ Then, a solution containing heat-killed cells of OLL1073R-1 and OLS3059 was added to the 96-well microwell plate seeded with PBMCs at a final concentration of 1 × 10 ６The cells were added to the well plate at a concentration of 1000 cells / mL, and the cells were cultured in the well plate at 37°C and 5% CO2 for 24 hours. As a negative control, an equal volume of medium to the heat-killed cell-containing solution of OLL1073R-1 and OLS3059 was added to the well plate, and the cells were cultured in the well plate at 37°C and 5% CO2 for 24 hours in the same manner as above. The cultures were then collected, and the collected cultures were centrifuged at 1300 rpm for 3 minutes at 4°C. The supernatant obtained by centrifugation was removed, washed twice with PBS containing 2% FCS (FACS buffer), and Human BD Fc Block (registered trademark) (manufactured by BD) was added to the remaining precipitate and allowed to stand at room temperature for 10 minutes. The precipitate was then stained with cell staining dyes FVD780 (manufactured by eBioscience), Anti-Human Lineage Cocktail 1 (CD3, CD14, CD16, CD19, CD20, CD56) FITC (manufactured by BD), Anti-HLA-DR APC (manufactured by BD), Anti-CD11c BV421 (manufactured by BD), Anti-CD123 BV510 (manufactured by BD), Anti-CD304 PE (manufactured by BD), Anti-CD86 PE-Cy7 (registered trademark) (manufactured by BD), Anti-CD40- PerCP-Cy5.5 (registered trademark) (Biolegend) and Anti-CD80-BV605 (Biolegend) were added and incubated at 4 ° C for 30 minutes in the dark to obtain stained evaluation samples. Next, the evaluation samples were washed twice with FACS buffer, and Fixation and Permeabilization Solution (BD) was added and incubated at 4 ° C for 20 minutes in the dark to fix the evaluation samples. Thereafter, the precipitate was washed twice with 1 × Permeabilization buffer (BD), suspended in FACS buffer, and measured using a BD FACSVerse (BD).At this time, cells that were "Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, CD304 positive" were defined as "pDCs," and the expression intensities (geometric mean fluorescence intensity, gMFI) of CD86, HLA-DR, CD40, and CD80 were analyzed. Two PBMCs, Lot A and Lot B, purchased from Precision for Medicine, were used, and this evaluation was performed three times (N = 3). The medium used was RPMI 1640 (Gibco, Thermo Fisher Scientific) supplemented with 10% FCS (BioWest) and 1% Penicillin-Streptomycin (Gibco, Thermo Fisher Scientific).

[0108] In the groups treated with a solution containing heat-killed bacteria of OLL1073R-1 or OLS3059, the expression intensities of pDC activation markers CD86, HLA-DR, CD40, and CD80 were significantly higher in all PBMC lots compared to the control group (see Figures 1 to 4). These results demonstrate that OLL1073R-1 and OLS3059 increase the expression levels of CD86, HLA-DR, CD40, and CD80 in pDC.

[0109] (Test for evaluating pDC activity of viable bacterial cells using human peripheral blood mononuclear cells) (1) Preparation of media containing viable cells of OLL1073R-1 and OLS3059 A solution containing viable cells of OLL1073R-1 (solution containing viable OLL1073R-1 bacterial cells) and a solution containing viable cells of OLS3059 (solution containing viable OLS3059 bacterial cells) were prepared by the method described in Example 1, except that the OLL1073R-1 suspension and the OLS3059 suspension were not heated.

[0110] (2) Evaluation of pDC activity using live OLL1073R-1 cells and live OLS3059 cells. The live cells in the solution containing live OLL1073R-1 cells and the solution containing live OLS3059 cells were diluted to a final concentration of 1 × 10 ６pDC activity was evaluated by the method described in Example 1, except that the PBMCs were added so as to give a concentration of 1000 cfu / mL and that the evaluation was performed using one lot of PBMCs.

[0111] In the groups treated with a live cell solution of OLL1073R-1 or OLS3059, the expression intensities of pDC activation markers CD86, HLA-DR, CD40, and CD80 were significantly higher than in the control group (see Figures 5 to 8). These results demonstrate that OLL1073R-1 and OLS3059 increase the expression levels of CD86, HLA-DR, CD40, and CD80 in pDC.

[0112] (Test for evaluating the pDC activity of heat-killed bacteria using human peripheral blood mononuclear cells) (1) Preparation of medium containing heat-killed bacteria of the genus Lactobacillus and the genus Streptococcus Using Difco (registered trademark) Lactobacilli MRS Broth (manufactured by BD), MRS (deMan, Rogosa, Sharp) liquid medium was prepared according to the manufacturer's recommended procedure. Then, OLL1073R-1, JCM1002 Ｔ 10 μL of each of the bacterial suspensions of OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, and JCM1130 was suspended in 5 mL of MRS liquid medium and activated at 37 ° C for 18 hours. Similarly, M17 liquid medium was prepared using Difco (registered trademark) M17 Broth (manufactured by BD) according to the manufacturer's recommended procedure, and 10 μL of the bacterial suspension of OLS3059 was suspended in 5 mL of M17 liquid medium and activated at 37 ° C for 18 hours. Thereafter, 50 μL of the activated culture was suspended in 5 mL of fresh MRS liquid medium or M17 liquid medium, and then cultured at 37 ° C for 18 hours to produce OLL1073R-1 culture, JCM1002 Ｔ The culture medium, OLL204989 culture medium, NY1301 culture medium, YIT9029 culture medium, JCM1131 culture medium, JCM5813 culture medium, OLL2716 culture medium, JCM1130 culture medium, and OLS3059 culture medium were obtained. Each of the culture mediums was then centrifuged at 4°C and 8000 rpm for 5 minutes, and the supernatant of each culture medium was removed to obtain OLL1073R-1 culture precipitate, JCM1002 culture precipitate, and OLL1073R-2 culture precipitate.Ｔ Culture precipitates were obtained from OLL1073R-1, OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, JCM1130, and OLS3059. Each culture precipitate was then washed twice with saline and resuspended in saline to give OLL1073R-1 suspension, JCM1002R-2 suspension, and OLS3059 culture precipitate. Ｔ A suspension, an OLL204989 suspension, an NY1301 suspension, a YIT9029 suspension, a JCM1131 suspension, a JCM5813 suspension, an OLL2716 suspension, a JCM1130 suspension, and an OLS3059 suspension were obtained. ５ double or ten ６ After diluting twice, the mixture was smeared on agar medium. Ｔ The bacterial counts of OLL1073R-1, JCM1002, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, JCM1130, and OLS3059 were measured. Ｔ Solutions containing heat-killed cells of OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, JCM1130, and OLS3059 were prepared.

[0113] (2) Evaluation of pDC activity using heat-killed bacteria of the genus Lactobacillus and the genus Streptococcus PBMC (manufactured by Precision for Medicine) were placed in a 96-well microwell plate (manufactured by Iwaki Co., Ltd.) at 5 × 10 ６ Then, OLL1073R-1, JCM1002, and PBMC were seeded into the 96-well microwell plate. Ｔ , OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, JCM1130, and OLS3059 at a final concentration of 1 × 10 ６The cells were added to the wells of the plate at a concentration of 1000 cells / mL, and cultured in the wells for 24 hours at 37°C and 5% CO2. The cultures were then collected and centrifuged at 1300 rpm for 3 minutes at 4°C. The supernatant obtained by centrifugation was removed, and Human BD Fc Block (registered trademark) (manufactured by BD) was added to the remaining precipitate, which was then allowed to stand at room temperature for 10 minutes. The precipitate was then stained with cell staining dyes FVD780 (manufactured by eBioscience), Anti-Human Lineage Cocktail 1 (CD3, CD14, CD16, CD19, CD20, CD56) FITC (manufactured by BD), Anti-HLA-DR APC (manufactured by BD), Anti-CD11c BV421 (manufactured by BD), Anti-CD123 BV510 (manufactured by BD), Anti-CD304 PE (manufactured by BD), Anti-CD86 PE-Cy7 (registered trademark) (manufactured by BD), Anti-CD40- PerCP-Cy5.5 (registered trademark) (Biolegend) was added and incubated at 4 ° C for 30 minutes in the dark to obtain a stained evaluation sample. Next, the evaluation sample was washed twice with FACS buffer, and Fixation and Permeabilization Solution (BD) was added and incubated at 4 ° C for 20 minutes in the dark to fix the evaluation sample. The precipitate was then washed twice with 1 × Permeabilization buffer (BD), suspended in FACS buffer, and measured using a BD FACSLyric (BD). At this time, cells that were "Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, CD304 positive" were defined as "pDCs," and the expression intensities (geometric mean fluorescence intensity, gMFI) of CD86, HLA-DR, and CD40 were analyzed.The PBMCs used were purchased from Precision for Medicine, and the medium used was RPMI 1640 (Gibco, Thermo Fisher Scientific) supplemented with 10% FCS (BioWest) and 1% Penicillin-Streptomycin (Gibco, Thermo Fisher Scientific).

[0114] As shown in Figures 9 to 11, OLL1073R-1, JCM1002 Ｔ In the groups treated with a solution containing heat-killed bacteria of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, OLL204989, NY1301, YIT9029, JCM1131, JCM5813, OLL2716, JCM1130, and OLS3059, the expression intensities of pDC activation markers CD86, HLA-DR, and CD40 were significantly higher in all PBMC lots than in the non-treated group. Ｔ ” is “Lactobacillus delbrueckii subsp. bulgaricus JCM1002 Ｔ", "204989" indicates "Lactobacillus delbrueckii OLL204989", "JCM1131" indicates "Lactobacillus gasseri JCM1131", "JCM5813" indicates "Lactobacillus gasseri JCM5813", "2716" indicates "Lactobacillus paragasseri OLL2716", "JCM1130" indicates "Lactobacillus paragasseri JCM1130", "YIT9029" indicates "Lacticaseibacillus paracasei subsp. paracasei YIT9029", "NY1301" indicates "Lacticaseibacillus paracasei subsp. paracasei NY1301", and "3059" indicates "Streptococcus thermophilus OLS3059". From the above, it has been revealed that several strains of five species of bacteria, Lactobacillus delbrueckii, Lactobacillus gasseri, Lactobacillus paragasseri, Lacticaseibacillus paracasei, and Streptococcus thermophilus, increase the expression levels of CD86, HLA-DR, and CD40 in pDC. Furthermore, since the effectiveness of each has been confirmed for multiple strains and for standard strains, it is thought that the same effect can be expected if the bacterial species is the same.

[0115] The composition according to the present invention can activate pDCs, and therefore, ingestion of the composition according to the present invention can help maintain or improve the health of humans and the like.

[0116] FERM BP-6999 FERM BP-10741 FERM BP-10740 NITE BP-02874

Claims

1. A composition for activating plasmacytoid dendritic cells, comprising one or more lactic acid bacteria selected from lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), lactic acid bacteria of the genus Lacticaseibacillus, and lactic acid bacteria belonging to Streptococcus thermophilus.

2. The plasmacytoid dendritic cell activation composition according to claim 1, comprising the lactic acid bacteria of the genus Lactobacillus (excluding Lactobacillus helveticus), the lactic acid bacteria of the genus Lacticaseibacillus, and the lactic acid bacteria belonging to Streptococcus thermophilus.

3. The plasmacytoid dendritic cell activation composition according to claim 1 or 2, wherein the lactic acid bacteria belonging to the genus Streptococcus thermophilus are lactic acid bacteria belonging to the genus Streptococcus thermophilus other than Streptococcus thermophilus TA-45.

4. A composition for activating plasmacytoid dendritic cells as described in claim 1 or 2, wherein the Lactobacillus lactic acid bacteria is at least one Lactobacillus lactic acid bacteria selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus gasseri, and Lactobacillus paragasseri.

5. A composition for activating plasmacytoid dendritic cells as described in claim 1 or 2, wherein the Lacticaceobacillus lactic acid bacteria is at least one species of Lacticaceobacillus lactic acid bacteria selected from Lacticaceobacillus paracasei and Lacticaceobacillus paracasei subsp. paracasei.

6. The composition for activating plasmacytoid dendritic cells according to claim 1 or 2, wherein the Lactobacillus lactic acid bacteria has a 16S rRNA gene that has 90% or more sequence identity with the base sequence of SEQ ID NO: 1 below. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT 7. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, wherein the Lactobacillus lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus.

8. The plasmacytoid composition for activating dendritic cells according to claim 7, wherein the Lactobacillus delbrueckii subsp. bulgaricus is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741).

9. The plasmacytoid dendritic cell activation composition according to claim 1 or 2, wherein the lactic acid bacteria belonging to the genus Streptococcus thermophilus are lactic acid bacteria belonging to the genus Streptococcus thermophilus having a 16S rRNA gene that has 90% or more sequence identity with the base sequence of SEQ ID NO: 3 below. <16S rRNA gene (SEQ ID NO: 3)> GCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGGGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACC TAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGAGGGCAGCAGTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAG CAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGGCTAACTACGT 10. The plasmacytoid composition for activating dendritic cells according to claim 1 or 2, wherein the lactic acid bacterium belonging to the genus Streptococcus thermophilus is Streptococcus thermophilus OLS3059 (FERM BP-10740).

11. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, which increases the amount of CD86 expression on plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

12. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, which increases the amount of HLA-DR expression on the plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

13. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, which increases the amount of CD40 expression on the plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

14. A composition for activating plasmacytoid dendritic cells described in claim 1 or 2, which increases the amount of CD80 expression on the plasmacytoid dendritic cells (pDC) in peripheral blood mononuclear cells (PBMC).

15. A composition for activating plasmacytoid dendritic cells as described in claim 1 or 2, further comprising exopolysaccharides of the Lactobacillus lactic acid bacteria (excluding Lactobacillus helveticus) or exopolysaccharides of the Lacticaseibacillus lactic acid bacteria.

16. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, wherein the lactic acid bacteria are killed.

17. A composition for activating plasmacytoid dendritic cells according to claim 1 or 2, wherein the lactic acid bacteria are viable cells.

Images