Phage tail spike recombinant protein fused with silica binding domain or fluorescent protein for detecting salmonella, and method for producing same

Abstract

The present invention relates to identifying and engineering a tail spike protein gene from a genome of bacteriophage SFP10 infected with a Salmonella strain, purifying and producing a recombinant protein using mSFP10TSP, which is a recombinant protein formulation for detecting Salmonella enterica, EGFP-mSFP10TSP fused with a green fluorescent protein, and SiBD-mSFP10TSP fused with an SiBD, and thereby specifically detecting the Salmonella strain.

Description

Phage tail spike recombinant protein fused with silica binding domain or fluorescent protein for detection of salmonella and method for producing same

[0001] This specification claims the benefit of Korean Patent Application No. 10-2024-0019296 filed with the Korean Intellectual Property Office on February 8, 2024, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for specifically detecting Salmonella enterica by finding a tail spike protein gene from the genome of bacteriophage SFP10 infecting Salmonella enterica, engineering the same, purifying and producing a recombinant protein using engineered tail spike protein (mSFP10TSP) derived from bacteriophage SFP10 for detecting Salmonella enterica, EGFP-mSFP10TSP fused with enhanced green fluorescent protein (hereinafter referred to as EGFP), and SiBD-mSFP10TSP fused with a silica binding domain (hereinafter referred to as SiBD). The fields of application of this study include food hygiene, biology, medicine, environment, and health, and can be used in genome analysis, molecular biology, and protein engineering technology.

[0003]

[0004] Salmonella enterica is a representative waterborne infection, and it is transmitted to humans through contaminated drinking water, food consumption, or contact with animals infected with Salmonella. According to the European Food Safety Authority (EFSA) in 2021, Salmonella is the second most common cause of infection in Europe after Campylobacter, and the CDC estimates that it causes 1.35 million infections and 420 deaths across the United States each year. Salmonella infection is characterized by high fever, abdominal pain, vomiting, and inflammatory diarrhea, and occurs in approximately 10 3 Because even a small number of bacteria at the CFU level is sufficient to cause symptoms, proactive detection is required to ensure a safe food environment.

[0005] Immunomagnetic separation (IMS) is a method for selectively isolating and purifying specific target bacteria or cells using magnetic particles bound to affinity molecules, such as antibodies. It is widely used in various biotechnology fields, including clinical diagnostics. While IMS boasts a relatively simple separation process, high specificity, and compatibility with a variety of samples, its effective detection relies on the specificity of the immunoaffinity molecules used in IMS for the target.

[0006] Although antibodies remain widely used in various fields, including immunological monitoring (IMS), they still face challenges in terms of production and functionality. Traditionally, antibodies are produced using the vertebrate immune system, which is time-consuming and expensive. Recently, attempts to produce antibodies using mammalian cell expression systems in ex vivo environments have been successful.

[0007] However, antibodies also tend to aggregate during the production process, forming inclusion bodies that reduce protein production efficiency, exhibit cross-reactivity, and are vulnerable to biochemical changes such as pH and temperature.

[0008] Therefore, the present inventors sought to discover a novel detection agent capable of specifically binding to Salmonella enterica as a substitute for antibodies by utilizing the tail spike protein (hereinafter, TSP) of bacteriophage. The phage SFP10 that infects Salmonella enterica uses its own TSP to recognize and simultaneously degrade the O-antigen in the Lipopolysaccharide (hereinafter, LPS) present in the outer membrane of Gram-negative bacteria in the first stage of infection, thereby facilitating DNA injection into the host bacteria. The present inventors mutated the amino acid sequence of the TSP active site of phage SFP10 to eliminate the enzymatic activity that degrades the O-antigen and generated a recombinant protein (mSFP10TSP) in which the N-terminus of TSP was removed without affecting the binding ability. In addition, by fusing green fluorescent protein and silica binding domains to the above recombinant protein, a green fluorescent recombinant protein (EGFP-mSFP10TSP) and a recombinant protein preparation capable of binding to silica (SiBD-mSFP10TSP) were developed, and it was confirmed that Salmonella enterica in a sample can be separated by an IMS method using silica magnetic particles.

[0009]

[0010] Currently, the most widely used antibodies in pathogen diagnostics suffer from several limitations, including high production costs, complex production processes, and difficulties in producing active antibodies. The tail spike protein of bacteriophages, which host bacteria, mediates binding between phage and host cells in the initial stage of infection, demonstrating high host specificity and effective host bacterial detection. Furthermore, phage proteins can be overexpressed and purified using an Escherichia coli expression system, resulting in highly cost-effective production.

[0011] Therefore, the recombinant protein fused with a silica binding domain can be applied to an immunomagnetic separation method to rapidly and selectively separate and concentrate only target bacteria in a sample.

[0012] Accordingly, the present invention aims to provide a novel recombinant protein comprising microbial-specific binding activity, and to provide a method for industrially utilizing the recombinant protein.

[0013]

[0014] The present invention finds a tail spike protein gene from the genome of bacteriophage SFP10 infecting Salmonella enterica, engineers it, and prepares a recombinant protein preparation for detecting Salmonella enterica (engineered tail spike protein (mSFP10TSP) derived from bacteriophage SFP10 and EGFP-mSFP10TSP fused with enhanced green fluorescent protein (hereinafter referred to as EGFP) and SiBD-mSFP10TSP fused with a silica binding domain (hereinafter referred to as SiBD)), and then produces and purifies the preparation using an expression system of Escherichia coli to confirm whether the recombinant protein actually binds to Salmonella enterica. In addition, it was confirmed that Salmonella enterica in a sample can be specifically detected through a fluorescence signal using the recombinant proteins (EGFP-mSFP10TSP and SiBD-mSFP10TSP), and it was also confirmed that Salmonella enterica in a sample can be rapidly separated using silica-coated magnetic particles.

[0015]

[0016] The tail spike protein of phages that infect Gram-negative bacteria is a major factor in determining the host range and thus has high specificity for the host bacteria. This study not only discovered a novel recombinant detection agent with high specificity for Salmonella enterica by genetically modifying phage SFP10 TSP, which uses the O-antigen of the LPS of Salmonella enterica as a receptor, but also enabled simple and efficient bacteria detection and separation and concentration by fusing green fluorescent protein and silica binding domains to the recombinant protein, and furthermore, the recombinant protein produced using the expression system of Escherichia coli can reduce production costs and efficiency compared to antibodies, so the present invention is expected to be widely utilized in the fields of public health, environment, and food hygiene in the future.

[0017]

[0018] Figure 1 is a schematic diagram showing a method for confirming whether a TSP conjugated to EGFP can attach to a specific strain.

[0019] FIG. 2 is a diagram showing the production of mSFP10TSP having the N-terminal head binding domain removed and a mutation in the active site, FIG. 2A shows the modular structure of ORF162 of phage SFP10 used in the invention and recombinant proteins, FIG. 2B shows the amino acid sequence alignment result between ORF162 of phage SFP10 and tail spike proteins (Det7 and P22) of other Salmonella enterica phages, FIG. 2C shows the SDS-PAGE results of wild-type SFP10TSP, mSFP10TSP with mutations in its active site, a recombinant protein to which green fluorescent protein is bound (EGFP-mSF10TSP), and a recombinant protein to which a silica binding domain is bound (SiBD-mSFP10TSP), and FIG. 2D shows the results of a halo assay of SFP10TSP and mSFP10TSP against Salmonella entericaserovar Typhimurium SL1344.

[0020] Figure 3 shows the results of confirming the binding specificity of EGFP-SFP10TSP and EGFP-mSFP10TSP. Figure 3A is a graph showing the binding activity of EGFP-mSFP10TSP to various serotypes of the host Salmonella enterica, and Figure 3B is a fluorescence microscope photograph taken after treating Salmonella entericaserovar Enteritidis ATCC 13076 with EGFP-mSFP10TSP.

[0021] Figure 4 shows the results of fluorescence microscopy analysis for confirming the receptor of SFP10TSP.

[0022] Figure 5 shows the binding characteristics of EGFP-mSFP10TSP to Salmonella enterica. Figure 5A is a photograph taken with a fluorescence microscope after treating Salmonella entericaserovar Typhimurium UK1, S. aureusNewman, and B. subtilisSRCM 100333 with EGFP-mSFP10TSP. Figure 5B is a graph showing the binding ability of mSFP10TSP to bacteria in different growth cycles. Figure 5C is a graph of the binding saturation curve of EGFP-mSFP10TSP.

[0023] Figure 6 is a schematic diagram showing a method for confirming the recovery experiment of SFP10TSP2-MNB.

[0024] Figure 7 shows the results of confirming the optimization of variables for isolating and recovering Salmonella enterica with mSFP10TSP-MNB in ​​a 0.1% PBS-T buffer environment. Figure 7A shows the results of measuring the recovery rate with 0.3 μL, 1 μL, 3 μL, and 10 μL of mSFP10TSP-MNB, Figure 7B shows the results when the incubation time after mSFP10TSP-MNB treatment was set as a variable, Figure 7C shows the results when the number of Salmonella enterica was set as a variable, and Figure 7D shows the results of confirming whether mSFP10TSP-MNB can selectively isolate only Salmonella enterica cells in a single strain suspension.

[0025] Figure 8 is a schematic diagram showing a method for confirming the food application results of TSP-MNB.

[0026] Figure 9 shows the results of confirming the ability of EGFP-mSFP10TSP to detect Salmonella enterica cells in various food substrates.

[0027] Figure 10 shows the results of confirming the ability of mSFP10TSP-MNB to detect Salmonella enterica cells in various foods.

[0028]

[0029] The present invention relates to a magnetic separation detection material for detecting Salmonella and a recombinant protein in which a detection fluorescent protein is bound to a tail spike protein derived from a bacteriophage.

[0030] As a specific example of the invention, the Salmonella may be Salmonella sp., and specifically, may be Salmonella enterica, Salmonella arizonae, Salmonella indica, Salmonella houtenae, Salmonella diarizonae, and Salmonella salamae, and more specifically, may be Salmonella enterica.

[0031] As a specific example of the invention, the magnetic separation detection material may be a silica binding domain (SiBD), His-tag (histidine-tag), Strep-tag (streptavidin-tag), FLAG-tag, HA-tag (Human influenza hemagglutinin-tag), c-Myc-tag, V5-tag, and S-tag, and specifically, may be a His-tag, a Strep-tag, and a SiBD, and more specifically, may be a SiBD.

[0032] As a specific example of the invention, the fluorescent protein for detection is EGFP (Enhanced Green Fluorescent Protein), EBFP (Enhanced Blue Fluorescent Protein), EYFP (Enhanced Yellow Fluorescent Protein), ECFP (Enhanced Cyan Fluorescent Protein), ERFP (Enhanced Red Fluorescent Protein), NanoLuciferase (luminescent enzyme) and Luciferase (luminescent enzyme), specifically EBFP, EGFP and Luciferase, and more specifically EGFP.

[0033] As a specific example of the invention, the bacteriophage may be Det7, P22 and SFP10, and specifically, SFP10.

[0034] As a specific example of the invention, the Tail spike protein (hereinafter, TSP) derived from the SFP10 may have an amino acid sequence similarity of 40 to 55% with Det7 TSP, specifically 45 to 53, and more specifically 49%.

[0035] As a specific example of the invention, the TSP derived from the SFP10 may have an amino acid sequence similarity of 20 to 35% with the P22 TSP, specifically 25 to 30%, and more specifically 28%.

[0036] In one embodiment of the present invention, SFP10_ORF162 utilizes a TSP naturally possessed by SFP10, and uses a recombinant protein in which the head binding domain located at the N-terminus of SFP10_ORF162 is removed and a 6X His-tag is linked to the N-terminus.

[0037] In the present invention, TSPs produced through point mutation or recombination using the above SFP10_ORF162 are used, and their types are SFP10TSP and mSFP10TSP, respectively.

[0038] As a specific example of the invention, the head binding domain located at the N-terminus removed from the TSP may be composed of 140 to 160 amino acids, specifically, may be composed of 145 to 155 amino acids, and more specifically, may be composed of 151 amino acids.

[0039] In the present invention, TSP is obtained by separating and purifying only the tail from the head-tail structure constituting a bacteriophage, and the TSP specifically attaches to Salmonella, and at this time, the TSP recognizes the O-antigen present in the outer membrane LPS of Salmonella as a receptor.

[0040] As one specific example of the invention, the recombinant TSP has enhanced binding activity against Salmonella and / or reduced outer wall decomposition activity against Salmonella.

[0041] The above TSP has been mutated into a protein in which the head attachment region has disappeared through genetic modification and point mutation, and in the present invention, a magnetic separation detection material and a detection fluorescent protein are attached to the mutated TSP to obtain a recombinant protein that recognizes and separates Salmonella bacteria.

[0042] As a specific example of the present invention, the mSFP10TSP may be one in which at least one amino acid among the 400th to 440th amino acids of SFP10_ORF162 is substituted with another amino acid and / or deleted, specifically, at least one amino acid selected from the group consisting of the 400th, 433rd, and 436th amino acid positions may be substituted with another amino acid and / or deleted, and more specifically, glutamate at the 400th position, aspartate at the 433rd position, and aspartate at the 436th position are all substituted with Alanine.

[0043] As a specific example of the present invention, a magnetic separation detection protein and / or a luminescent separation detection protein may be combined with the SFP10TSP and mSFP10TSP.

[0044] As one specific example of the present invention, the binding of the magnetic separation detection protein to the SFP10TSP and mSFP10TSP may be by attachment to the C-terminus of TSP.

[0045] As one specific example of the present invention, the attachment of the luminescent separation detection protein to the SFP10TSP and mSFP10TSP may be by attachment together with a 6X His-Tag to the N-terminus of TSP.

[0046] As an embodiment of the invention, the recombinant protein having a magnetic separation detection material and a detection fluorescent protein attached to the above-described mutated TSP may further have a magnetic nanobead (MNB) attached thereto.

[0047] The TSP with the magnetic nano beads attached thereto is referred to as mSFP10TSP-MNB.

[0048] As one embodiment of the invention, a magnetic separation detection material for detecting Salmonella or a recombinant protein in which a detection fluorescent protein and a bacteriophage-derived tail spike protein are combined is a detection composition.

[0049] As an embodiment of the invention, a magnetic separation detection material for detecting the Salmonella bacteria or a recombinant protein in which a detection fluorescent protein and a bacteriophage-derived tail spike protein are combined and a composition including the protein may be included in a kit.

[0050] As one specific example of the invention, a process of optimizing variables may be further included to perform the binding conditions of mSFP10TSP-MNB.

[0051] As one specific example of the invention, the above variable optimization process is for measuring the recovery rate of Salmonella strains according to mSFP10TSP-MNB.

[0052] As a specific example of the invention, the number of Salmonella strains in the above variable optimization process is 10 3 10 inland 7 It may be CFU / mL, specifically 10 4 10 inland 6 It may be CFU / mL, more specifically 10 4 The recovery rate may be 90% or higher in the number of strains greater than CFU / mL.

[0053] As a specific example of the invention, the amount of mSFP10TSP-MNB added according to the Salmonella strain in the above variable optimization process is 10 5 It may be included in the range of 0.3 to 10 μL based on CFU / mL, may be included in the range of 1 to 5 μL, and more specifically, when it is included in the range of 3 μL, the recovery rate may be 80% or higher. In one specific embodiment of the invention, the incubation time after treatment of mSFP10TSP-MNB in ​​the variable optimization process may be 1 to 60 minutes, and specifically, may be 5 to 40 minutes, and more specifically, the recovery rate may be 80% or higher after 5 minutes.

[0054] As one embodiment of the invention, the food that can utilize the recombinant protein may be vegetables, meat, composite cooked food, and dairy products, and specifically, it may be a food that has been stored at room temperature or in which Salmonella bacteria have grown due to contaminants, and more specifically, it may be a food in which pathogenic Salmonella bacteria have grown.

[0055] As one embodiment of the invention, the TSP to which the manufactured fluorescent protein is attached may be EGFP-mSFP10TSP, and the EGFP-mSFP10TSP may include an amino acid sequence of SEQ ID NO: 6 decoded from a gene of SEQ ID NO: 5, specifically, may be a combination of EGFP including a gene of SEQ ID NO: 3 and mSFP10TSP including a gene of SEQ ID NO: 1, and more specifically, may be a combination of EGFP including an amino acid sequence of SEQ ID NO: 4 decoded from SEQ ID NO: 3 and mSFP10TSP including an amino acid sequence of SEQ ID NO: 2 decoded from SEQ ID NO: 1.

[0056] As an embodiment of the invention, the TSP attached to the manufactured magnetic separation detection material is mSFP10TSP_SiBD, and the mSFP10TSP_SiBD may include an amino acid sequence of SEQ ID NO: 10 decoded from a gene of SEQ ID NO: 9, and specifically, may be a combination of SiBD including a gene of SEQ ID NO: 7 and mSFP10TSP including a gene of SEQ ID NO: 1, and more specifically, may be a combination of SiBD including an amino acid sequence of SEQ ID NO: 8 decoded from SEQ ID NO: 7 and mSFP10TSP including an amino acid sequence of SEQ ID NO: 2 decoded from SEQ ID NO: 1.

[0057] The above mSFP10TSP_SiBD may be combined with magnetic nano beads to become mSFP10TSP-MNB.

[0058] In the present invention, the method for producing the EGFP-mSFP10TSP and mSFP10TSP_SiBD may be composed of the following steps.

[0059] (a) A step of producing a mutant TSP by inducing a point mutation in the TSP of a bacteriophage that specifically attaches to Salmonella;

[0060] (b) a step of producing a recombinant protein by combining a magnetic detection material and a fluorescent protein with the above mutant TSP;

[0061] (c) A step of confirming the adhesion ability of the recombinant protein to Salmonella.

[0062] The bacteriophage-derived TSP recombinant protein with the magnetic detection material attached thereto may further include magnetic nanobeads.

[0063] As a specific example of the invention, in the step (a), the bacteriophage may be Det7, P22 and SFP10, and specifically, SFP10.

[0064] As a specific example of the invention, in the step (a), the Salmonella may be Salmonella sp., specifically, Salmonella enterica, Salmonella arizonae, Salmonella indica, Salmonella houtenae, Salmonella diarizonae, and Salmonella salamae, and more specifically, Salmonella enterica.

[0065] As a specific example of the invention, in the step (b), the magnetic separation detection material may be a silica binding domain (SiBD), His-tag (histidine-tag), Strep-tag (streptavidin-tag), FLAG-tag, HA-tag (Human influenza hemagglutinin-tag), c-Myc-tag, V5-tag, and S-tag, and specifically, may be a His-tag, a Strep-tag, and a SiBD, and more specifically, may be a SiBD.

[0066] As a specific example of the invention, in the step (b), the fluorescent protein for detection is EGFP (Enhanced Green Fluorescent Protein), EBFP (Enhanced Blue Fluorescent Protein), EYFP (Enhanced Yellow Fluorescent Protein), ECFP (Enhanced Cyan Fluorescent Protein), ERFP (Enhanced Red Fluorescent Protein), NanoLuciferase (luminescent enzyme) and Luciferase (luminescent enzyme), specifically EBFP, EGFP and Luciferase, and more specifically EGFP.

[0067] In the present invention, the magnetic separation detection material may bind to a tail spike protein (TSP) derived from a bacteriophage capable of infecting Salmonella.

[0068] In the present invention, the fluorescent protein for detection may bind to a tail spike protein (TSP) derived from a bacteriophage capable of infecting Salmonella.

[0069] As a specific example of the invention, in the step (c), the TSP further including magnetic nano beads may further include a step (d) of attaching mSFP10TSP-MNB.

[0070] As a specific example of the invention, in the step (d), a process of optimizing variables may be further included to perform the binding conditions of mSFP10TSP-MNB.

[0071] As one specific example of the invention, the above variable optimization process is for measuring the recovery rate of Salmonella strains according to mSFP10TSP-MNB.

[0072] As a specific example of the invention, the number of Salmonella strains in the above variable optimization process is 10 3 10 inland 7 It may be CFU / mL, specifically 10 4 10 inland 6 It may be CFU / mL, more specifically 10 4 The recovery rate may be 90% or higher in the number of strains greater than CFU / mL.

[0073] As a specific example of the invention, the amount of mSFP10TSP-MNB added according to the Salmonella strain in the above variable optimization process is 10 5 It may be included in the range of 0.3 to 10 μL based on CFU / mL, may be included in the range of 1 to 5 μL, and more specifically, when it is included in the range of 3 μL, the recovery rate may be 80% or higher. In one specific embodiment of the invention, the incubation time after treatment of mSFP10TSP-MNB in ​​the variable optimization process may be 1 to 60 minutes, and specifically, may be 5 to 40 minutes, and more specifically, the recovery rate may be 80% or higher after 5 minutes.

[0074] As one embodiment of the invention, one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a therapeutic pharmaceutical preparation that can be used for a subject in need of treatment.

[0075] As a specific example of the invention, the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be therapeutic pharmaceutical preparations that can be used for a subject in need of treatment.

[0076] As one embodiment of the invention, one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be used to produce a composition for detecting Salmonella.

[0077] As a specific example of the invention, the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be used to produce a composition for detecting Salmonella.

[0078] As one embodiment of the invention, a composition comprising one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a pharmaceutical preparation for preventing Salmonella.

[0079] As one embodiment of the invention, a composition comprising at least one recombinant protein selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be used in a test kit for preventing Salmonella.

[0080] As one embodiment of the invention, one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a diagnostic composition that can be used for an individual requiring examination.

[0081] As a specific example of the invention, the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be diagnostic compositions for use in an individual requiring examination.

[0082] As one embodiment of the invention, a composition comprising one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be produced as a kit.

[0083] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be produced as a kit.

[0084] As one embodiment of the invention, the kit may include the following steps:

[0085] (a) a step of attaching mSFP10TSP_SiBD or mSFP10TSP_MNB to a specimen to be confirmed;

[0086] (b) a step of attaching the mSFP10TSP_SiBD or mSFP10TSP_MNB to the applied strain;

[0087] (c) a step of collecting the strain to which the mSFP10TSP_SiBD or mSFP10TSP_MNB is attached using a permanent magnet;

[0088] (d) a step of attaching EGFP-mSFP10TSP to the collected strain; and

[0089] (e) A step of collecting and detecting the strain to which the mSFP10TSP_SiBD or mSFP10TSP_MNB and EGFP-mSFP10TSP are attached.

[0090] The food in the above step (a) may include meat, seafood, poultry, dairy products, food and beverages, dairy products, and vegetables, and more specifically, may include meat, seafood, poultry, dairy products, and vegetables, and more specifically, may include meat, dairy products, and vegetables.

[0091] The applied strain in the above step (b) may be Salmonella sp., specifically Salmonella enterica, Salmonella arizonae, Salmonella indica, Salmonella houtenae, Salmonella diarizonae, and Salmonella salamae, and more specifically Salmonella enterica.

[0092] The permanent magnet in the above step (c) may be, but is not limited to, neodymium, ferrite, samarium cobalt, alnico, or rubber magnets, and is not limited to any object having a magnetic form that is easy to use in the kit.

[0093] Detection in the above step (e) may be performed using a fluorescence microscope, detection device, detection solution, chromatography, fluorescence microplate reader, etc., but is not limited thereto.

[0094] The present invention may provide a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB used in the manufacture of a Salmonella diagnostic kit composition.

[0095] The present invention may provide a composition comprising a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB used in a Salmonella diagnostic kit.

[0096] As one embodiment of the invention, a composition comprising one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be used in a diagnostic kit for preventing Salmonella.

[0097] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be used in a diagnostic kit for preventing Salmonella.

[0098] As a specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for a diagnostic kit for preventing Salmonella. The present invention may provide a recombinant protein comprising EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB used in the manufacture of a pharmaceutical preparation for treating Salmonella infection.

[0099] The present invention may provide a composition comprising a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a pharmaceutical preparation for treating Salmonella infection.

[0100] As one embodiment of the invention, a composition comprising at least one recombinant protein selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a pharmaceutical preparation for use in treating an individual infected with Salmonella.

[0101] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a pharmaceutical preparation for use in treating an individual infected with Salmonella.

[0102] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for treating an individual infected with Salmonella.

[0103] The present invention may provide a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB used in the manufacture of a composition for detecting an individual infected with Salmonella.

[0104] As one embodiment of the invention, a composition comprising one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a pharmaceutical preparation for use in detecting an individual infected with Salmonella.

[0105] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a pharmaceutical preparation for use in detecting an individual infected with Salmonella.

[0106] As one specific example of the invention, the composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for detecting an individual infected with Salmonella.

[0107] The present invention may provide a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB used in the manufacture of a composition for isolating an individual infected with Salmonella.

[0108] The present invention may provide a composition comprising a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a pharmaceutical preparation for isolating an individual infected with Salmonella.

[0109] As one embodiment of the invention, a composition comprising at least one recombinant protein selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a pharmaceutical preparation for use in isolating an individual infected with Salmonella.

[0110] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a pharmaceutical preparation for use in isolating an individual infected with Salmonella.

[0111] As one specific example of the invention, the composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for isolating an individual infected with Salmonella.

[0112] The present invention may provide a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a preservative for preventing infection by Salmonella.

[0113] The present invention may provide a composition comprising a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a preservative for preventing infection by Salmonella.

[0114] As one specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a pharmaceutical preparation for use in isolating an individual infected with Salmonella.

[0115] As one embodiment of the invention, a composition comprising at least one recombinant protein selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a preservative for preventing Salmonella infection of foodstuffs.

[0116] The present invention may provide a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a preservative for preventing Salmonella infection of food.

[0117] The present invention may provide a composition comprising a recombinant protein composed of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB, which is used in the manufacture of a preservative for preventing Salmonella infection of food.

[0118] As a specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a preservative for preventing Salmonella infection in foodstuffs.

[0119] As one embodiment of the invention, a composition comprising one or more recombinant proteins selected from the group consisting of EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB may be a preservative for use in foodstuffs.

[0120] As one specific example of the invention, the composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for isolating Salmonella from foodstuffs.

[0121] As one specific example of the invention, the composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for detecting Salmonella in foodstuffs.

[0122] As a specific example of the invention, a composition comprising the EGFP-mSFP10TSP, mSFP10TSP_SiBD and mSFP10TSP_MNB recombinant proteins may be a composition for use in preventing spoilage of foodstuffs.

[0123] The sequences used in the present invention are as shown in Table 1 below.

[0124] 서열번호sequencemSFP10TSP(gene)서열번호 1TTGTTACTTATGAGGCCCATAAGGAAGGCGTCTTCGATAGGGGTACTAACAATGATATTACTAACATTACTGTAGTAGGTGCGAATAAGGATTTAACTAACCTAAATCAGCTTACCTGTGAGGGAGGTAGTAGACTTCGTGGTATTAACATCCATGCATATACTACACAAGGTTACGCTATATACGCTCCGTCTTCAGAAGTAAGTAATGTTTCCTGTGCTGGTTCCGGTACTAAGAAATTACTATGTACCTATATAAGCGATATTCAGGGAGGTAATATCAATGTTCAGCATAGTGCCAACCAAATGACACTTGCAATGCAACCTGCTATGGGTGGTACTACAAACCCATCTTTGCTTATGACGGCAGATTGCCAGGTTGCTACACCAGGGGGTGAGGCAAGTATTGTCAAGCTTTCGGCAATTCAGGAGGGTGTACGTGTAGGTGAGTTTCAGCTTAACCGCTTAGGCTTTAAGCATATGAGTATACCTGCTGCCCCTTTACAATTACCAGAGAGCGCTCTGGAACATAATTCATCTATAGGATTCTTCTTCGGAAGTGACGGAGCATTGAGGTTGCTTGCTAAAAAACCAGATGGAAGTTATGTAACATACACACTTTAAmSFP10TSP(AA)서열번호2SVGDAAFRQEANKKFKYSVKLSDYSTLQDAATAAVDGLLIDVDYTFTADENVDFSGKVLIIECKGKFIGDGMLVWNGLGAGSVIKKPHMHTKTTPYTVYRFDANGNWVTDPTQVLASVQQRLDVGYKPNINDLDIWDDLPDNVKNQVAGATLRIMSGDNIIVENPEATFGGYLFTLCNRILVKNPRNFIALESGITFENHHTTAWGTGNWVVGGEIKYGSGSAVLFIRNDGGTDHDGGVRDLISYRVGASGIKTYQNEIGGRSARNYRLVFDNITTIQCYYAGIAVNADTGSPTERVDDYSLAEYPWFHLPTQHIIRNIITRDCMGIGAWWDGQKNIIDNVVTYEAHKEGVFDRGTNNDITNITVVGANKDLTNLNQLTCEGGSRLRGINIHAYTTQGYAIYAPSSEVSNVSCAGSGTKKLLCTYISDIQGGNINVQHSANQMTLAMQPAMGGTTNPSLLMTADCQVATPGGEASIVKLSAIQEGVRVGEFQLNRLGFKHMSIPAAPLQLPESALEHNSSIGFFFGSDGALRLLAKKPDGSYVTYTLEGFP(gene)서열번호3ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGEGFP(AA)서열번호 4MVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKEGFP-mSFP10TSP(gene)서열번호5GAAATTACTATGTACCTATATAAGCGATATTCAGGGAGGTAATATCAATGTTCAGCATAGTGCCAACCAAATGACACTTGCAATGCAACCTGCTATGGGTGGTACTACAAACCCATCTTTGCTTATGACGGCAGATTGCCAGGTTGCTACACCAGGGGGTGAGGCAAGTATTGTCAAGCTTTCGGCAATTCAGGAGGGTGTACGTGTAGGTGAGTTTCAGCTTAACCGCTTAGGCTTTAAGCATATGAGTATACCTGCTGCCCCTTTACAATTACCAGAGAGCGCTCTGGAACATAATTCATCTATAGGATTCTTCTTCGGAAGTGACGGAGCATTGAGGTTGCTTGCTAAAAAACCAGATGGAAGTTATGTAACATACACACTTTAAEGFP- mSFP10TSP(AA)서열번호6MGSSHHHHHHSSGLVPRGSHMMVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKGSSVGDAAFRQEANKKFKYSVKLSDYSTLQDAATAAVDGLLIDVDYTFTADENVDFSGKVLIIECKGKFIGDGMLVWNGLGAGSVIKKPHMHTKTTPYTVYRFDANGNWVTDPTQVLASVQQRLDVGYKPNINDLDIWDDLPDNVKNQVAGATLRIMSGDNIIVENPEATFGGYLFTLCNRILVKNPRNFIALESGITFENHHTTAWGTGNWVVGGEIKYGSGSAVLFIRNDGGTDHDGGVRDLISYRVGASGIKTYQNEIGGRSARNYRLVFDNITTIQCYYAGIAVNADTGSPTERVDDYSLAEYPWFHLPTQHIIRNIITRDCMGIGAWWDGQKNIIDNVVTYEAHKEGVFDRGTNNDITNITVVGANKDLTNLNQLTCEGGSRLRGINIHAYTTQGYAIYAPSSEVSNVSCAGSGTKKLLCTYISDIQGGNINVQHSANQMTLAMQPAMGGTTNPSLLMTADCQVATPGGEASIVKLSAIQEGVRVGEFQLNRLGFKHMSIPAAPLQLPESALEHNSSIGFFFGSDGALRLLAKKPDGSYVTYTLSiBD (gene)서열번호 7GTCGACAAGCTTGGTGGCGGTGGCTCCGGTGGCGGTGGCTCCTCGGGTCGTGCTCGTGCCCAGCGTCAGTCAAGCCGTGGTCGTTAASiBD (AA)서열번호8MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSVDKLGGGGSGGGGSSGRARAQRQSSRGRmSFP10TSP_SiBD(gene)서열번호 9TTGTTACTTATGAGGCCCATAAGGAAGGCGTCTTCGATAGGGGTACTAACAATGATATTACTAACATTACTGTAGTAGGTGCGAATAAGGATTTAACTAACCTAAATCAGCTTACCTGTGAGGGAGGTAGTAGACTTCGTGGTATTAACATCCATGCATATACTACACAAGGTTACGCTATATACGCTCCGTCTTCAGAAGTAAGTAATGTTTCCTGTGCTGGTTCCGGTACTAAGAAATTACTATGTACCTATATAAGCGATATTCAGGGAGGTAATATCAATGTTCAGCATAGTGCCAACCAAATGACACTTGCAATGCAACCTGCTATGGGTGGTACTACAAACCCATCTTTGCTTATGACGGCAGATTGCCAGGTTGCTACACCAGGGGGTGAGGCAAGTATTGTCAAGCTTTCGGCAATTCAGGAGGGTGTACGTGTAGGTGAGTTTCAGCTTAACCGCTTAGGCTTTAAGCATATGAGTATACCTGCTGCCCCTTTACAATTACCAGAGAGCGCTCTGGAACATAATTCATCTATAGGATTCTTCTTCGGAAGTGACGGAGCATTGAGGTTGCTTGCTAAAAAACCAGATGGAAGTTATGTAACATACACACTTGTCGACAAGCTTGGTGGCGGTGGCTCCGGTGGCGGTGGCTCCTCGGGTCGTGCTCGTGCCCAGCGTCAGTCAAGCCGTGGTCGTTAAmSFP10TSP_SiBD(AA)서열번호

[0125]

[0126] Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0127]

[0128]

[0129] Experimental Example 1. Production of Engineered Phage Tail Spike Protein (mSFP10TSP)

[0130]

[0131] 1-1. Overview

[0132] ​Bacteriophages that use Gram-negative bacteria as their hosts recognize and degrade the O-antigen of the host bacteria using their own TSP. Therefore, in the present invention, the amino acid sequence of the domain exhibiting O-antigen degrading enzyme activity was mutated to eliminate the enzyme activity. In addition, the head binding domain portion located at the N-terminus of TSP was removed because it does not affect the O-antigen recognition and binding ability. In addition, in order to detect the binding of bacteria to the recombinant protein (mSFP10TSP) with a fluorescent signal, green fluorescent protein (EGFP) was fused, and in order to more conveniently detect the target bacteria in the sample using silica magnetic particles, a silica binding domain (hereinafter referred to as SiBD) was fused to design novel recombinant proteins (EGFP-mSFP10TSP, SiBD-mSFP10TSP, respectively) (Fig. 1).

[0133]

[0134] 1-2. Production of recombinant proteins

[0135] SFP10_ORF162 is the tail spike protein naturally found in bacteriophage SFP10, and SFP10TSP is a schematic diagram of a recombinant protein (hereinafter referred to as SFP10TSP) in which the head binding domain (151 amino acids) located at the N-terminus of SFP10_ORF162 is removed and a 6X His-tag is attached to the N-terminus (Fig. 2A). mSFP10TSP was generated by changing all of the 400th amino acid Glutamate and 433rd and 436th amino acids Aspartate of SFP10_ORF162 to Alanine, and then removing the N-terminus of the protein and attaching a 6X His-tag in the same manner as SFP10TSP. EGFP-SFP10TSP and EGFP-mSFP10TSP were designed by linking a 6X His-tag and EGFP to the N-terminus of SFP10TSP and mSFP10TSP, respectively, and SiBD-mSFP10 TSP was designed by linking the silica binding domain to the C-terminus of mSFP10TSP.

[0136] The amino acid sequence similarity between SFP10_ORF162 and the TSPs of other Salmonella strain-infecting phages, Det7 and P22, was analyzed. The results of the analysis showed that SFP10TSP showed 49% and 28% amino acid sequence homology with Det7 and P22 TSPs, respectively (Fig. 2B).

[0137]

[0138] 1-3. Amplification of recombinant proteins

[0139] To produce the recombinant proteins listed above, the TSP (SFP10 ORF162) gene was amplified from the phage SFP10 genome by PCR. For easy restriction enzyme treatment, the recognition sites of each restriction enzyme were inserted into the primers and synthesized, and then used for PCR. The amplified PCR products were inserted into each vector after restriction enzyme treatment, resulting in the generation of recombinant plasmids pET28a::SFP10TSP, pET28a::mSFP10TSP, pET28a::EGFP::SFP10TSP, pET28a::EGFP::mSFP10TSP, and pET28a::mSFP10TSP::SiBD. Afterwards, the recombinant plasmids were transformed into E. coli BL21 (DE3), a protein strain, for expression of the recombinant proteins, and E. coli containing the recombinant plasmids were transformed. After inoculating the coliBL21 (DE3) clone into 50 mL of LB medium, OD was measured at 37°C and 250 rpm. 600 After culturing until the value reached 0.6, IPTG was treated to a final concentration of 0.5 mM and cultured with shaking at 18℃ for 20 hours. After culturing, the bacterial culture was centrifuged at 4,000 Xg at 4℃ for 15 minutes, and the pellet was resuspended in 5 mL of Phosphate Buffered Saline (PBS) and the cells were disrupted by sonication. Afterwards, insoluble proteins and cell debris were removed by centrifugation (21,000 Xg, 4℃, 60 minutes), and only the target recombinant protein with a 6X His-tag was selectively purified from the soluble fraction using Ni-NTA chromatography. The concentration of the obtained protein was confirmed through Bradford assay, and the purification was confirmed through SDS-PAGE (Fig. 2C).

[0140]

[0141] 1-4. Comparison of enzyme activities

[0142] The proteins expressed and purified through the above method were stored at -80℃ after desalting and thawed just before use. A halo assay was performed to determine if there was a difference in enzyme activity between the SFP10TSP and mSFP10TSP obtained as described above. To determine this, a single colony of the S. entericaserovar Typhimurium SL1344 strain was taken and inoculated into 5 mL of LB broth. The culture solution cultured for one day was added to 5 mL of 0.7% DW soft agar (top agar) and mixed. This was overlaid on base agar (1.5% LB agar) and solidified at room temperature. After that, 60 μg each of SFP10TSP and mSFP10TSP were dropped onto the solidified top agar, dried, and cultured at 37℃ for one day. The formation of rings was observed. As a result, it was confirmed that the wild-type (SFP10TSP) showed enzyme activity that decomposes LPS and formed a ring, whereas the mutant strain (mSFP10TSP) did not form a ring because the enzyme activity was eliminated (Fig. 2D).

[0143]

[0144]

[0145] Experimental Example 2. Characterization of Engineered SFP10 Tail Spike Protein

[0146]

[0147] 2-1. Confirmation of binding activity of EGFP-SFP10TSP and EGFP-mSFP10TSP recombinant proteins.

[0148] In order to confirm the effect of the mutation of the present invention on the binding activity of TSP, the recombinant proteins EGFP-SFP10TSP and EGFP-mSFP10TSP linked to green fluorescent protein were treated to Salmonella strains, and the fluorescent signals were quantitatively and qualitatively analyzed. After treating the bacteria with each fluorescent recombinant protein to a final concentration of 0.5 μM, the unbound residual proteins were removed by washing twice with PBS buffer. After resuspending the bacteria in 200 μL of PBS buffer, 150 μL was taken and the fluorescent signal (excitation: 485 nm, emission: 520 nm) was measured using a microplate reader, and then OD 600 The relative fluorescence intensity (RFI) was expressed as the value divided by the value. As a result, the RFI value of the group treated with EGFP-mSFP10TSP was approximately 100 times higher than that of the EGFP-SFP10TSP treated group, indicating that the mutated protein could bind to the Salmonella strain (Fig. 3A). However, neither protein showed binding activity to the E. coliMG1655 strain, which is not a host of phage SFP10. When the same sample was observed under a fluorescence microscope for cross-validation, the mutant strain (mSFP10TSP) was indeed able to bind to the bacteria, while SFP10TSP did not show binding ability (Fig. 3B).

[0149]

[0150] 2-2. Confirmation of binding ability between salmonella enterica typhimurium and SFP10TSP.

[0151] To identify the receptor for SFP10TSP, binding of EGFP-mSFP10TSP was examined by treating Salmonella enterica Typhimurium SL1344 (wild-type), Salmonella enterica Typhimurium SL1344 ΔwaaL strain lacking the O-antigen ligase gene, and Salmonella enterica Typhimurium SL1344 ΔwaaL complementation strains lacking the O-antigen ligase gene. After treating each strain with the fluorescent recombinant protein to a final concentration of 0.5 μM, unbound residual protein was removed by washing three times with 0.1% PBS-T buffer. After resuspending the bacteria in 200 μL of 0.1% PBS-T buffer, 3 μL was taken and observed under a microscope. As a result, it was confirmed that EGFP-mSFP10TSP could bind to Salmonella entericaTyphimurium SL1344,Salmonella entericaTyphimurium SL1344 ΔwaaL complementation bacteria that actually had O-antigens, but could not bind to Salmonella entericaTyphimurium SL1344 ΔwaaL that lacked O-antigens because the O-antigen binding enzyme was removed (Fig. 4).

[0152]

[0153]

[0154] Experimental Example 3. Results of confirmation of specific bacterial binding.

[0155]

[0156] 3-1. Results regarding specific strain combinations

[0157] Table 2 shows the results confirming the binding specificity of mSFP10TSP to fungi of other genera.

[0158] speciesStrain NO.EGFP-mSFP10 TSPGram-positiveBacillus subtilisSRCM 100333-Staphylococcus aureusNewman-Gram-negativeSalmonella enterica Typhimurium1344+LT2+DT104+UK1+ATCC14028s+ATCC19586+ATCC43174+Salmonella enterica EnteritidisATCC13076+Salmonella enterica Paratyphi AIB 211+Salmonella enterica Paratyphi BIB231+Salmonella enterica DublinIB2973+Salmonella enterica salamaeKCCM 41762+E. coli O157:H7ATCC 700728-E. coliMG1655-KlebsiellapneumoniaeKCTC 2422-Shigella flexneri2a strain 24571-Cronobacter sakazakiiATCC29544-

[0159]

[0160] As can be seen from the table above, mSFP10TSP selectively binds only to strains corresponding to Salmonella.

[0161]

[0162] 3-2. Confirming the possibility of selective targeting in a mixed strain environment

[0163] To determine whether the recombinant protein could bind only to Salmonella strains even in an environment where other bacteria exist, EGFP-mSFP10TSP was treated in a suspension containing Salmonella enterica, Serovar Typhimurium UK1, S. aureus Newman, and B. subtilis SRCM 100333, and images were taken using a fluorescence microscope. As a result, mSFP10TSP specifically bound to Salmonella enterica without being hindered by the presence of other bacteria (Fig. 5A).

[0164]

[0165] 3-3. Confirmation of changes in binding affinity according to the fungal growth period

[0166] To confirm whether the binding affinity of mSFP10TSP changes depending on the growth phase of the fungus, an experiment was conducted, and it was found to bind well to both logarithmic and stationary phase fungi without any problems (Fig. 5B). Afterwards, the change in the concentration-dependent binding activity of EGFP-mSFP10TSP was confirmed, and as a result, the detected fluorescence intensity increased as the amount of protein processed increased, confirming that EGFP-mSFP10TSP exhibits concentration-dependent binding activity (Fig. 5C).

[0167]

[0168]

[0169] Experimental Example 4. Binding between mSFP10TSP_SiBD containing a silica binding domain and magnetic particles.

[0170]

[0171] 4-1. Evaluation of SiBD's ability using immunomagnetic separation (IMS)

[0172] To effectively concentrate and separate Salmonella strains in samples using immunomagnetic separation (IMS), the binding ability between mSFP10TSP-SiBD and silica-coated magnetic particles was confirmed. The concentration of the magnetic particles used was 1.23 X 10 10 beads / 100 μL, and after treating an excess of mSFP10TSP-SiBD, which is 10,000 times more than the number of magnetic particles, they were combined for one hour at room temperature using a rotator. The remaining proteins that were not bound to the magnetic particles were separated using a permanent magnet, and then washed twice with 100 μL of lysis buffer (200 mM NaCl, 50 mM Tris-Cl; pH 8.0) to obtain mSFP10TSP-MNB (magnetic nanobeads) in which silica magnetic particles and mSFP10TSP-SiBD were combined (Fig. 6).

[0173]

[0174] 4-2. Confirmation of optimal binding conditions between mSFP10TSP-MNB and Salmonella strains and optimization of variables.

[0175] To identify the optimal binding conditions between mSFP10TSP-MNB and Salmonella strains in a buffer environment, variable optimization was performed. The culture broth of Salmonella entericaTyphimurium LT2 in the logarithmic growth phase was diluted with 0.1% PBS-T buffer until the desired number of bacteria was reached, and 200 μL of the diluted solution was added with the desired amount of mSFP10TSP-MNB. After that, the bacteria and mSFP10TSP-MNB were cultured for the target time using a rotator, and the unbound cell fraction (UBF) was separated using a permanent magnet. Then, the sample (WF) was washed with 200 μL of 0.1% PBS-T buffer, and the sample (BBF) was resuspended with 200 μL of 0.1% PBS-T buffer to obtain the bacteria bound to the magnetic particles. The number of bacteria in each sample obtained in this way was plated on LB agar medium and cultured in an incubator at 37℃ for 24 hours. The number of single colonies generated in each fraction was counted to determine the recovery rate. The recovery rate was calculated using the following mathematical formula.

[0176] [Mathematical Formula 1]

[0177]

[0178]

[0179] 4-3. Measurement of bacterial recovery rate

[0180] In order to measure the recovery rate of Salmonella strains according to the amount of mSFP10TSP-MNB processed, the number of Salmonella entericaTyphimurium LT2 was 10 5 CFU / mL, and the amount of mSFP10TSP-MNB was varied from 0.3 μL, 1 μL, 3 μL, and 10 μL, and the cells were bound for 40 minutes. The recovery rate was more than 80% from 3 μL or more (Fig. 7A). In addition, when 10 μL of mSFP10TSP-MNB was treated and the number of cells was 10 5After fixing the CFU / mL, the incubation time was divided into 5, 10, 20, and 40 minutes to check the recovery rate of bacteria according to the incubation time. As a result, it was shown that the recovery rate was over 80% from 5 minutes after the mSFP10TSP-MNB treatment to the bacteria (Fig. 7B). Next, the recovery rate according to the number of bacteria was checked by treating 10 μL of mSFP10TSP-MNB and fixing the incubation time to 40 minutes, and as a result, 10 3 , 10 4 , 10 5 10 of CFU / mL 4 A recovery rate of 90% was observed from the bacterial counts above the CFU / mL level (Fig. 7C). Finally, to determine whether mSFP10TSP-MNB could specifically bind only to Salmonella enterica cells even in the presence of other Gram-negative bacteria, the recovery rate of mSFP10TSP-MNB was measured in a sample containing Salmonella enterica LT2, E. coli O11, and C. sakazakii ATCC 29544 cells. As a result, it was confirmed that mSFP10TSP-MNB selectively showed a high recovery rate for Salmonella enterica LT2 without being affected by other bacteria (Fig. 7D).

[0181]

[0182]

[0183] Example 1. Food application of engineered SFP10 tail spike protein

[0184]

[0185] 1-1. Food application (sterilized milk, ground beef)

[0186] To verify whether EGFP-mSFP10TSP can be applied to the actual food industry, the ability to detect Salmonella strains in sterilized milk and ground beef was tested. Sterilized milk was used as is, and ground beef was homogenized by adding 1 g to 10 mL of PBS buffer, and 1 mL of the supernatant was used. 1 mL of each food sample was taken, and the final bacterial concentration was 4.25 × 10 6 Salmonella enterica LT2 strains were artificially inoculated to a final concentration of 1 CFU / mL. Afterwards, each inoculated sample was cultured for one hour in a 37℃ incubator, treated with EGFP-mSFP10TSP to a final concentration of 30 μg / mL, and washed twice using PBS buffer. Finally, the strains were resuspended in 50 μL of PBS buffer, and 3 μL of it was used for microscopic observation (Fig. 8). As a result, EGFP-mSFP10TSP showed the ability to detect Salmonella enterica strains in various food substrates (Fig. 9). The ability and stability of EGFP-mSFP10TSP to detect Salmonella strains were confirmed even in food environments with different conditions such as pH and NaCl.

[0187]

[0188] 1-2. Confirmation of the binding capacity of mSFP10TSP-MNB according to food

[0189] In addition, the ability of mSFP10TSP-MNB to detect Salmonella strains in sterilized milk, pork, lettuce, and other foods where Salmonella strains are a problem, was confirmed. Sterilized milk was used as is, and 10 mL was taken to determine the final bacterial concentration of 10 3 , 10 4 , 10 5After artificially inoculating Salmonella enterica LT2 to CFU / mL, the inoculated samples were cultured in a refrigerator at 4°C for two hours. 10 g of pork and lettuce were each taken, and the concentration of bacteria was 10 3 , 10 4 , 10 5 After artificially inoculating Salmonella entericaLT2 strains to CFU / mL, they were dried on an aseptic test bench at room temperature for two hours, homogenized in 90 mL of LB broth, and 200 μL of the supernatant was used. 200 μL of each food sample was treated with 20 μL of mSFP10TSP-MNB, and the strains and mSFP10TSP-MNB were combined using a rotator at room temperature for 20 minutes. Afterwards, the cell fraction that was not bound to mSFP10TSP-MNB was separated using a permanent magnet, and the mSFP10TSP-MNB bound to the bacteria was resuspended in 200 μL of 0.1% PBS-T buffer and washed on a rotator for 5 minutes. The washed fraction was magnetically separated, and the magnetically bound mSFP10TSP-MNB was resuspended in 200 μL of 0.1% PBS-T buffer to obtain the bound fraction. Each fraction was diluted to the desired concentration in 0.1% PBS-T buffer, and 100 μL was dispensed onto LB agar plates and XLD agar plates, and then plated to measure the recovery rate (Fig. 7). As a result, mSFP10TSP-MNB showed effective detection ability for Salmonella strains in various food substrates (Fig. 10).

[0190]

[0191]

[0192] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0193]

[0194]

[0195] The present invention aims to provide a novel recombinant protein comprising a microbial-specific binding activity, and to provide a method for industrially utilizing the recombinant protein. Specifically, the silica-binding recombinant protein of the present invention can rapidly isolate Salmonella sp., a pathogen causing food poisoning, through screening, thereby helping to prevent food poisoning in advance. It can be utilized in the analysis of the causative agent of food poisoning, kits using the same, pharmaceutical compositions, food control agents, and experimental aspects. In addition, compared to purifying antibodies, which are conventional pathogen diagnostic tools, it has superior host specificity and production cost efficiency, making it an invention with excellent industrial applicability.

[0196]

[0197] Attach an electronic file of the sequence list

Claims

1. One or more proteins selected from the group consisting of proteins for magnetic separation detection and proteins for fluorescent separation detection; and A recombinant protein for detecting Salmonella, comprising a bacteriophage-derived tail spike protein (hereinafter, TSP).

2. In claim 1, The recombinant protein for detecting Salmonella further comprises a magnetic nanobead (MNB) recombinant protein in which a magnetic particle is bound to the recombinant protein for detecting magnetic separation.

3. In claim 1, The above TSP is a recombinant protein in which some amino acids have been modified from a natural bacteriophage-derived TSP.

4. In claim 3, A recombinant protein in which the above amino acid modification is one or more amino acids among the 400th to 440th amino acids of the TSP sequence derived from a natural bacteriophage, substituted with another amino acid and / or deleted.

5. In claim 4, A recombinant protein wherein the substituted amino acid is alanine (Ala).

6. In claim 1, A recombinant protein wherein the above magnetic separation detection protein is at least one selected from the group consisting of SiBD, His-tag, Strep-tag, FLAG-tag, HA-tag, c-Myc-tag, V5-tag, and S-tag.

7. In claim 1, A recombinant protein wherein the protein for the above fluorescence separation detection is at least one selected from the group consisting of nanoluciferase, EGFP, EBFP, EYFP, ECFP, ERFP, and luciferase.

8. A composition for detecting Salmonella comprising the recombinant protein of claim 1.

9. A method for producing a recombinant protein for detecting Salmonella comprising the following steps: (a) A step of producing a mutant TSP by inducing a point mutation in the TSP of a bacteriophage that specifically attaches to Salmonella; (b) a step of producing a recombinant protein by combining a magnetic detection material and a fluorescent protein with the above mutant TSP; (c) A step of confirming the adhesion ability of the recombinant protein to Salmonella.

10. In claim 9, A method further comprising a step (d) of attaching magnetic nanobeads (MNB) to the recombinant protein of step (c).

Images