Pharmaceutical composition and use thereof

By using a pharmaceutical composition containing more than 2 tandem RNA and drug delivery vectors, the off-target effect and immunogenicity of linear siRNA were solved, and the efficient silencing and cholesterol-lowering effect of PCSK9 gene was achieved.

WO2025171684A1PCT designated stage Publication Date: 2025-08-21SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV

Patent Information

Application Number
PCT/CN2024/082054
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-18
Filing Date
2024-03-15
Publication Date
2025-08-21

AI Technical Summary

Technical Problem

Linear siRNA has off-target effects, easy degradation and significant immunogenicity problems in its application, which affects its therapeutic effect.

Method used

A pharmaceutical composition containing more than 2 tandem RNA and a drug delivery vehicle (such as nanoparticles) is used to deliver through lipid nanoparticles to enhance targeting and stability and reduce immune response.

Benefits of technology

It significantly enhanced the silencing effect on the PCSK9 gene, reduced the expression of PCSK9 protein, reduced arterial plaque load, reduced cholesterol, reduced atherosclerosis, and had no obvious liver and renal toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024082054-FTAPPB-I100001
    Figure PCTCN2024082054-FTAPPB-I100001
  • Figure PCTCN2024082054-FTAPPB-I100002
    Figure PCTCN2024082054-FTAPPB-I100002
  • Figure PCTCN2024082054-FTAPPB-I100003
    Figure PCTCN2024082054-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a pharmaceutical composition, comprising a circular RNA and a drug delivery carrier. It is surprisingly found that compared with conventional linear 1 x siRNAs and circular 1 x siRNAs, increasing the number of tandem repeats in the sense strand to two or more significantly enhances the silencing effect, significantly reduces the expression level of the PCSK9 gene, and mediates the degradation of the PCSK9 protein mRNA. The use of nano-particles for delivering oligonucleotides features improved stability, reduced immunogenicity, improved cholesterol-lowering, aortic plaque load-reducing and anti-atherosclerotic effects, good safety, no significant liver and kidney toxicity, and therefore good prospects in preparing medicaments for treating hypercholesterolemia and a coronary heart disease.
Need to check novelty before this filing date? Find Prior Art

Description

A pharmaceutical composition and its application Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to a pharmaceutical composition and its application. Background Technology

[0002] Small interfering RNA (siRNA) is a double-stranded small RNA formed by the binding of a sense strand and an antisense strand. A key characteristic is that the 3' end of the antisense strand has at least two free bases. When siRNA is recognized by the Argonaute-2 (AGO2) protein, the 5' end of the antisense strand binds to the MID subunit of AGO2. Under the action of the N subunit of AGO2, the siRNA unwinds, and the 3' end of the antisense strand binds to the PAZ subunit of AGO2. The sense and antisense strands separate, and the antisense strand forms an RNA-induced silencing complex (RISC) with the AGO2 protein. This RISC is then guided by the antisense strand to the complementary target messenger RNA (mRNA) region, thereby utilizing the endonuclease activity of the AGO protein to mediate the degradation of the target mRNA.

[0003] Linear siRNA exhibits strong complementary binding ability between its double strands, making complete unwinding and separation of the sense and antisense strands relatively difficult. In partially unwound siRNA, the antisense strand may bind to non-target mRNAs with similar sequences, mediating non-specific mRNA degradation; this is known as the off-target effect of siRNA. Linear RNA can also be degraded by various RNases through various pathways. For example, RNase A attacks the phosphodiester bonds within RNA from the 3' end, degrading it to single bases; RNase R can unwind RNA duplexes with higher-order structures, making them more easily degraded. Furthermore, exogenous linear RNA exhibits significant immunogenicity. Specifically, linear RNA modified with 5' triphosphates is readily recognized by RIG-I, activating an antiviral response to clear exogenous linear RNA; and in vitro synthesized RNA, lacking modified nucleotides, exhibits increased immunogenicity.

[0004] Circular RNA (circRNA) is a covalently closed single-stranded RNA. Due to the lack of a 5' triphosphate modification and a 3' polyadenylated tail, it can avoid being cleared by the innate immune response caused by the recognition of exogenous nucleic acid sensing proteins such as retinoic acid-induced gene protein I (RIG-I) and MDA5. Therefore, in vitro synthesized circRNAs are believed to have a longer half-life and perform specific functions in vivo. Synthetic biology can be used to create new circRNA molecules that encode target proteins with therapeutic effects. Covalently closed circRNA molecules may also be beneficial for applications such as the generation of antisense RNA, aptamers, ribozymes, or siRNAs.

[0005] Summary of the Invention

[0006] To address at least one of the aforementioned technical problems, the present invention discloses a pharmaceutical composition comprising circular RNA and a drug delivery vector, wherein the circular RNA comprises two or more tandemly linked RNA positive strand sequences, for example, 2 to 8, such as 2, 3, 4, 5, 6, 7, or 8 RNA positive strand sequences, and any two adjacent RNA positive strand sequences are separated by at least one spacer sequence.

[0007] In some embodiments, the drug delivery carrier is selected from one or more of nanosuspensions, nanoparticles, micelles, liposomes, nanoemulsions, lipid nanoparticles, and in-situ gels, preferably nanoparticles.

[0008] In some embodiments, the nanoparticles are selected from lipid nanoparticles (LNP), core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polymeric complexes, or biodegradable polymer nanoparticles.

[0009] In some embodiments, the circular RNA is bound to a drug delivery vector.

[0010] In some embodiments, the combination of the circular RNA and the drug delivery vector includes filling, embedding, coating, covalent conjugation, or non-covalent conjugation.

[0011] In some embodiments, the drug delivery carrier is selected from lipid nanoparticles, which include: 1) cationic lipids or lipid polymers, 2) non-cationic lipids, 3) PEG-modified lipids, and 4) sterols.

[0012] In some embodiments, the sterol is selected from at least one of cholesterol, lanosterol, 5α-cholestane-3β-ol, coccosterol, sitosterol, ergosterol, campesterol, stigmasterol, phytosterol, tomatine, ursolic acid, or α-tocopherol.

[0013] In some embodiments, the sterol is cholesterol.

[0014] In some embodiments, the molar ratio of cationic lipids: sterols: non-cationic lipids: PEG-modified lipids in the lipid nanoparticles is (25-100):(20-80):(5-20):(0.4-5), preferably 50:38:10:1.5.

[0015] In some embodiments, the molar ratio of lipid polymer: sterol: non-cationic lipid: PEG-modified lipid in the lipid nanoparticles is (1-20):(20-80):(5-20):(0.2-5), preferably 4.5:31:10:0.4.

[0016] In some embodiments, the cationic lipid is selected from: ALC-0315 (CAS No.: 2036272-55-4), N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 1,2-dioleoyltrimethylammonium chloride propane (DOTAP), C12-200 (CAS No.: 1220890-25-4), DLin-KC2-DMA (CAS No.: 1190197-97-7), DODAP (CAS No.: 127512-29-2), or HGT4003 (CAS No.: 1415795-37-7); and / or, the non-cationic lipid comprises neutral lipids. The PEG-modified lipid is selected from distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), or dimyristoylphosphatidylethanolamine (DMPE); and / or, the PEG-modified lipid is selected from polyethylene glycol diacylglycerol (PEG-DAG).

[0017] In some embodiments, the PEG-modified lipid is selected from 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (DMG-PEG), PEGylated phosphatidylethanolamine (PEG-PE), and PEG-succinate-diacylglycerol (PEG-S-DAG).

[0018] In some embodiments, the PEG-succinate-diacylglycerol (PEG-S-DAG) is selected from 4-O-(2',3'-bis(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG), PEGylated ceramide (PEG-Cer), or PEG dialkoxypropyl carbamate.

[0019] In some embodiments, the lipid nanoparticles further comprise DMG-PEG2K.

[0020] In some embodiments, the average molecular weight of the PEG moiety in the PEG-modified lipid can be in the range of about 500 to about 8000 Daltons, for example 1000, 2000, 3000, 4000, 5000, 6000, 7000 or 8000 Daltons.

[0021] In some embodiments, the lipid nanoparticles further comprise polyethyleneimine (PEI).

[0022] In some embodiments, the lipid polymer is obtained by reacting a compound of formula (I) or polyethyleneimine with a compound of formula (II).

[0023] In some embodiments, the compound of formula (II) is selected from:

[0024] In some embodiments, the lipid polymer is P6-Cit-100, which is obtained by reacting polyethyleneimine and citronellol acrylate.

[0025] In some embodiments, the polyethyleneimine is branched polyethyleneimine.

[0026] In some embodiments, the branched polyethyleneimine has a molecular weight of 300-10000.

[0027] In some embodiments, the branched polyethyleneimine has a molecular weight of 400-2000.

[0028] In some embodiments, the branched polyethyleneimine has a molecular weight of 500-1800.

[0029] In some embodiments, the branched polyethyleneimine has a molecular weight of 500-700.

[0030] In some embodiments, the branched polyethyleneimine has a molecular weight of 600.

[0031] In some embodiments, the reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg: 0.4-1.8 mmol / L.

[0032] In some embodiments, the reaction feed ratio of the compound of formula (I) or the compound of formula (II) is 40 mg: 0.7-1.5 mmol / L.

[0033] In some embodiments, the reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg: 0.8-0.9 mmol / L, or 40 mg: 1.3-1.4 mmol / L.

[0034] In some embodiments, the lipid nanoparticles comprise: (1) C12-200, DOPE, cholesterol, DMG-PEG; or (2) ALC-0315, cholesterol, DSPC, and DMG-PEG; or (3) P6-Cit-100, cholesterol, DSPC, and DMG-PEG.

[0035] In some embodiments, the lipid nanoparticles have a diameter of about 50 nm to about 300 nm, such as about 50 nm to about 250 nm, for example, about 50 nm to about 200 nm. In some embodiments, smaller lipid nanoparticles may be used. Such particles may include diameters from 0.1 μm to 100 nm. In other embodiments, smaller lipid nanoparticles may be used to deliver nucleic acids, for example, with diameters of about 1 nm to about 100 nm, about 1 nm to about 20 nm, about 1 nm to about 40 nm, about 1 nm to about 60 nm, about 1 nm to about 80 nm, about 5 nm to about 100 nm, about 10 nm to about 50 nm, about 20 nm to about 50 nm, about 30 nm to about 50 nm, about 30 nm to about 60 nm, about 40 nm to about 60 nm, about 20 nm to about 70 nm, about 50 nm to about 70 nm, about 60 nm to about 70 nm, about 30 nm to about 80 nm, or about 20 nm to about 90 nm. In some embodiments, the lipid nanoparticles may have a diameter greater than 100 nm, greater than 200 nm, greater than 300 nm, greater than 400 nm, greater than 500 nm, greater than 600 nm, greater than 700 nm, greater than 800 nm, greater than 900 nm, or greater than 1000 nm.

[0036] In some embodiments, the lipid nanoparticles have a particle size of 78.88 nm.

[0037] In some embodiments, the particle size of the pharmaceutical composition includes 100 to 1000 nm.

[0038] In some embodiments, the pharmaceutical composition has a particle size of about 200 nm to about 800 nm, such as a diameter of about 200 nm to about 700 nm. In some embodiments, smaller lipid nanoparticles may be used. Such particles may include diameters from 200 nm to 500 nm. In other embodiments, smaller lipid nanoparticles may be used to deliver nucleic acids, for example, with diameters from about 2 nm to about 300 nm. In some embodiments, the lipid nanoparticles may have diameters greater than 300 nm, greater than 400 nm, greater than 500 nm, or greater than 600 nm.

[0039] In some embodiments, the mass ratio of the drug delivery vector to the circular RNA is selected from 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.

[0040] In some embodiments, the circular RNA is annealed with at least one linear antisense strand to form a circular siRNA.

[0041] In some embodiments, the molar ratio of linear antisense strand to circular RNA in the composition is selected from 1:1 to 8:1.

[0042] In some embodiments, the molar ratio of linear antisense strand to circular RNA in the composition is selected from 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1 or 8:1.

[0043] In some embodiments, the circular RNA comprises four tandemly linked positive strand sequences. In other embodiments, the circular RNA may also comprise more tandemly linked positive strand sequences, such as 5 to 16, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 positive strand sequences. In still other embodiments, the circular RNA may also comprise fewer tandemly linked positive strand sequences, such as 2 or 3 positive strand sequences. When comprising more than 2 positive strand sequences, preferably, these positive strand sequences are identical to each other, and / or any two adjacent positive strand sequences are separated by at least one spacer sequence. In some embodiments, these positive strand sequences may also be different, for example, completely different from each other, or at least partially different from the rest.

[0044] In some embodiments, the positive strand sequence has a length of 18 to 24 nucleotides, for example 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides, and / or the linear antisense strand has a length of 21 to 27 nucleotides, for example 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides.

[0045] In some embodiments, the sense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 6 or 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it, and / or the antisense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 36 or 41, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0046] In some embodiments, the circular RNA and / or the at least one linear antisense strand sequence comprises at least one nucleotide modification and / or at least one chemical modification.

[0047] In some other embodiments, the number of antisense strand sequences in the circular RNA differs from the number of sense strand sequences, for example, by being less than the number of sense strand sequences.

[0048] In some embodiments, the circular RNA has low immunogenicity.

[0049] In some embodiments, the linear antisense strand sequence targets the translation of PCSK9 protein mRNA.

[0050] In some embodiments, the circular RNA and / or the at least one linear antisense strand is formed from unmodified, partially modified, or fully modified linear RNA polynucleotides.

[0051] In some embodiments, the circular RNA is formed by self-splicing of unmodified, partially modified, or fully modified linear RNA polynucleotides mediated by guanosine triphosphate (GTP).

[0052] In some embodiments, the circular RNA and / or the at least one linear antisense strand comprises at least one nucleotide modification. In some embodiments, the at least one nucleotide modification is a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5molU).

[0053] In some embodiments, the circular RNA and / or the at least one linear antisense strand further comprises at least one chemical modification. The chemical modification may include internucleotide bonding modification, nucleobase modification, sugar modification, or a combination thereof.

[0054] In some embodiments, the chemical modification is selected from LNA, ENA, HNA, CeNA, 2'-O-methoxyalkyl (e.g., 2'-O-methoxymethyl, 2'-O-methoxyethyl, or 2'-O-2-methoxypropyl), 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluorine, 2'-deoxy, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 2'-ara-F, L-nucleoside modification (e.g., 2'-modified L-nucleoside, such as 2'-deoxy-L-nucleoside), BNA racemic sugar, racemic cyclic alkyl and open-chain alkyl, and combinations thereof.

[0055] In some embodiments, the chemical modification is a 2'-modification, selected from 2'-O-methyl, 2'-deoxy, 2'-fluorine, and combinations thereof.

[0056] In some embodiments, about 100%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, or 30% of all nucleotides are modified, meaning that the above proportions of all nucleotides present in the circular siRNA include modifications as described herein.

[0057] In some embodiments, all nucleotides in the sense strand are modified. In some embodiments, each nucleotide in the sense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluorine, and combinations thereof. In some embodiments, all nucleotides in the antisense strand are modified. In some embodiments, each nucleotide in the antisense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluorine, and combinations thereof.

[0058] In some embodiments, at least 50% of the nucleotides in the circular siRNA are independently modified with 2'-O-methyl, 2'-O-allyl, 2'-deoxy, or 2'-fluorine.

[0059] In some embodiments, the circular RNA further comprises a 5' exon element and a 3' exon element, wherein the 5' exon element and the 3' exon element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from class I introns of Anabaena, class I introns of T4 bacteriophage, or class I introns of BH72, a nitrogen-fixing bacterium.

[0060] In some embodiments, the circular RNA is derived from a nucleic acid construct that includes, in the order from 5' to 3', a first circularization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second circularization element, wherein the RNA positive strand sequence is transcribed from the target sequence.

[0061] In some embodiments, the first cyclization element comprises a 5' intron element and a 5' exon element in sequence, and the second cyclization element comprises a 3' exon element and a 3' intron element in sequence.

[0062] In some embodiments, the 5' intron element and the 3' intron element are derived from the same self-splicing intron. In particular, the 5' intron element is derived from or contains the 5' end portion of the self-splicing intron, and the 3' intron element is derived from or contains the 3' end portion of the self-splicing intron.

[0063] In some embodiments, the 5' intron element includes a first portion from an Anabaena class I intron, and the 3' intron element includes a second portion from an Anabaena class I intron, or

[0064] The 5' intron element comprises a first portion from a T4 phage class I intron, and the 3' intron element comprises a second portion from a T4 phage class I intron, or

[0065] The 5' intron element comprises a first portion of a class I intron from the nitrogen-fixing bacterium species BH72, and the 3' intron element comprises a second portion of a class I intron from the nitrogen-fixing bacterium species BH72.

[0066] In some embodiments, the 5' intron element comprises a sequence as shown in SEQ ID NO.4, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it; and / or, the 5' exon element comprises a sequence as shown in SEQ ID NO.5, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it; and / or, the 3' intron element comprises a sequence as shown in SEQ ID NO.13, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it; and / or, the 3' exon element comprises a sequence as shown in SEQ ID NO.12, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0067] In some embodiments, the first restriction enzyme recognition sequence is the same as or different from the second restriction enzyme recognition sequence, and at least one of them is selected from the recognition sequences of the following restriction endonucleases: Spe I, Age I, Hind III, Bgl II, Kpn I, Xho I, Sac II, Not I, BamH I, or Xba I.

[0068] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the following: ACTAGT (SEQ ID NO.14 (Spe I)), ACCGGT (SEQ ID NO.15 (Age I)), AAGCTT (SEQ ID NO.43 (Hind III)), AGATCT (SEQ ID NO.44 (Bgl II)), GGTACC (SEQ ID NO.45 (Kpn I)), CTCGAG (SEQ ID NO.46 (Xho I)), CCGCGG (SEQ ID NO.47 (Sac II)), GCGGCCGC (SEQ ID NO.48 (Not I)), GGATCC (SEQ ID NO.49 (BamH I)), TCTAGA (SEQ ID NO.50 (Xba I)).

[0069] In some embodiments, the spacer sequence has a length of 2 to 40 nucleotides, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides.

[0070] In some embodiments, the spacer sequence is a polyAC sequence. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC. In another embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content. As used herein, "polyAC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.

[0071] In some embodiments, the spacer sequence comprises any one or a combination of the following sequences: sequences shown in SEQ ID NOs.7 to 11, or sequences having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with them.

[0072] As used herein, the term "spacer region" or "spacer sequence" refers to a non-functional sequence that physically separates two functional sequences from each other. In some embodiments, the nucleic acid construct further comprises at least one spacer sequence. In other embodiments, the nucleic acid construct comprises two or more spacer sequences. In some embodiments, where the nucleic acid construct comprises more than two target sequences, any two adjacent target sequences are separated by at least one spacer sequence.

[0073] In some embodiments, the spacer sequence comprises any one or a combination of the following sequences: sequences shown in SEQ ID NOs.7 to 11, or sequences having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with them.

[0074] In some embodiments, the target sequence comprises a sequence as shown in SEQ ID NO. 6 or SEQ ID NO. 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0075] In some embodiments, the circular RNA comprises, in sequence, a 5' exon element, optionally a first spacer sequence, optionally a first restriction enzyme recognition sequence, at least one RNA positive strand sequence, optionally a second restriction enzyme recognition sequence, optionally a second spacer sequence, and a 3' exon element.

[0076] In some embodiments, the linear RNA polynucleotide is transcribed from a nucleic acid construct, for example, by in vitro transcription.

[0077] In some embodiments, the nucleic acid construct includes, in the following order: a first cyclization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second cyclization element.

[0078] In some embodiments, the nucleic acid construct comprises two or more tandemly linked target sequences, for example, 2 to 8, such as 2, 3, 4, 5, 6, 7, or 8 target sequences. In some embodiments, the nucleic acid construct comprises four tandemly linked target sequences. In other embodiments, the nucleic acid construct may also comprise more tandemly linked target sequences, for example, 8 to 16, such as 8, 9, 10, 11, 12, 13, 11, 14, 15, or 16 target sequences. When comprising two or more target sequences, preferably, these target sequences are identical to each other.

[0079] In some embodiments, the target sequence has a length of 18 to 24 nucleotides, for example 18, 19, 20, 21, 22, 23, or 24, preferably 21 nucleotides.

[0080] The first and second cyclization elements include homologous sequences complementary to nucleic acid and / or protein-based systems capable of RNA ligation, said systems being selected from RNA-ligating DNAases, CRISPR / dCas9-DNALigase, and intron-exon mediated ligation.

[0081] The first and second circularization elements are designed to enable the production of circular positive-strand RNA through different methods, including but not limited to DNase-mediated RNA circularization, CRISPR-dCas9-ligase-mediated RNA circularization, and self-splicing-mediated RNA circularization.

[0082] The most studied circularization strategy is self-splicing-mediated RNA circularization, which utilizes intron ribozymes to autocatalyze splicing reactions and constructs a PIE (permuted intron-exon) system based on different types of introns to achieve RNA circularization. This system splices and repositions natural introns and exons to form new intron-exon constructs, inserts the target sequence into these constructs, and synthesizes circular RNA via in vitro backsplicing after transcription. In this system, intron fragments are dropped during self-splicing, and circularization is completed by the connection of the two flanking exon fragments.

[0083] Therefore, in some embodiments, the first cyclization element comprises a 5' intron element and a 5' exon element in sequence, and the second cyclization element comprises a 3' exon element and a 3' intron element in sequence.

[0084] In some embodiments, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, such as a natural self-splicing intron. In some embodiments, the 5' intron element is derived from or contains the 5' end portion of the self-splicing intron, and therefore the 3' intron element is derived from or contains the 3' end portion of the self-splicing intron. In some embodiments, the combination of the 5' intron element and the 3' intron element preserves the self-splicing activity of the self-splicing intron.

[0085] In some embodiments, the 5' intron element comprises a first portion of an Anabaena class I intron, particularly an enhanced Anabaena class I intron, and the 3' intron element comprises a second portion of an Anabaena class I intron, particularly an enhanced Anabaena class I intron. In still other embodiments, the 5' intron element comprises a first portion of a T4 phage class I intron, particularly an enhanced T4 phage class I intron, and the 3' intron element comprises a second portion of a T4 phage class I intron, particularly an enhanced T4 phage class I intron.

[0086] In some embodiments, the 5' exon region is derived from the 5' natural exon of the class I intron of the Anabaena pre-tRNA-Leu gene. The 5' natural exon of the class I intron of the Anabaena pre-tRNA-Leu gene contains the nucleotide sequence of SEQ ID NO. 5. In some embodiments, the 3' exon region is derived from the 3' natural exon of the class I intron of the Anabaena pre-tRNA-Leu gene. The 3' natural exon of the class I intron of the Anabaena pre-tRNA-Leu gene contains the nucleotide sequence of SEQ ID NO. 12.

[0087] In some embodiments, the 5' exon region is derived from the 5' natural exon of the class I intron of the T4 phage td gene. The 5' natural exon of the T4 phage td gene contains the nucleotide sequence of SEQ ID NO. 52. In some embodiments, the 3' exon region is derived from the 3' natural exon of the class I intron of the T4 phage td gene. The 3' natural exon of the T4 phage td gene contains the nucleotide sequence of SEQ ID NO. 54.

[0088] In some embodiments, the 5' exon region is derived from the 5' natural exon of the class I intron of the pre-tRNA-Ile gene of *B. tH72*. The 5' natural exon of the pre-tRNA-Ile gene of *B. tH72* contains the nucleotide sequence of SEQ ID NO. 56. In some embodiments, the 3' exon region is derived from the 3' natural exon of the class I intron of the pre-tRNA-Ile gene of *B. tH72*. The 3' natural exon of the pre-tRNA-Ile gene of *B. tH72* contains the nucleotide sequence of SEQ ID NO. 58.

[0089] In some embodiments, the 5' intron element comprises a sequence as shown in SEQ ID NO. 51, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 5' exon element comprises a sequence as shown in SEQ ID NO. 52, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' intron element comprises a sequence as shown in SEQ ID NO. 53, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' exon element comprises a sequence as shown in SEQ ID NO. 54, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0090] In some embodiments, the 5' intron element comprises a sequence as shown in SEQ ID NO. 55, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 5' exon element comprises a sequence as shown in SEQ ID NO. 56, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' intron element comprises a sequence as shown in SEQ ID NO. 57, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' exon element comprises a sequence as shown in SEQ ID NO. 58, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0091] In some embodiments, the 5' intron element comprises a sequence as shown in SEQ ID NO. 4, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 5' exon element comprises a sequence as shown in SEQ ID NO. 5, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' intron element comprises a sequence as shown in SEQ ID NO. 13, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it. In some embodiments, the 3' exon element comprises a sequence as shown in SEQ ID NO. 12, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0092] In some embodiments, the 5' exon element and the 3' exon element are covalently linked. In some embodiments, the 5' end of the 5' exon element is covalently linked to the 3' end of the 3' exon element. In some embodiments, the positive strand sequence has a length of 18 to 24 nucleotides, for example 18, 19, 20, 21, 22, 23, or 24, preferably 21 nucleotides.

[0093] The first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence may be the same or different. In some embodiments, the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence are different.

[0094] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence is selected from the recognition sequences of the following restriction endonucleases: Spe I, Age I, Hind III, Bgl II, Kpn I, Xho I, Sac II, Not I, BamH I, Xba I.

[0095] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the following: A↓CTAGT (SEQ ID NO.14 (SpeⅠ)), A↓CCGGT (SEQ ID NO.15 (AgeⅠ)), A↓AGCTT (SEQ ID NO.39 (HindIII)), A↓GATCT (SEQ ID NO.40 (Bgl II)), GGTAC↓C (SEQ ID NO.41 (KpnI)), C↓TCGAG (SEQ ID NO.42 (XhoI)), CCGC↓GG (SEQ ID NO.43 (SacII)), GC↓GGCCGC (SEQ ID NO.44 (NotI)), G↓GATCC (SEQ ID NO.45 (BamHI)), T↓CTAGA (SEQ ID NO.46 (XbaI)). Wherein ↓ represents the restriction enzyme cleavage site.

[0096] Inserting a first restriction enzyme recognition sequence and a second restriction enzyme recognition sequence into the nucleic acid construct allows for easy replacement of the at least one target sequence with any desired target sequence, such as a DNA polynucleotide sequence corresponding to a therapeutic RNA, siRNA, or miRNA.

[0097] In some embodiments, the nucleic acid construct is contained on the expression vector, which further contains at least one RNA polymerase promoter.

[0098] In some embodiments, the at least one RNA polymerase promoter is derived from a virus and is selected from the T7 RNA polymerase promoter, SP6 RNA polymerase promoter, T3 RNA polymerase promoter, T6 RNA polymerase promoter, T4 RNA polymerase promoter, and K11 RNA polymerase promoter.

[0099] In some embodiments, the expression vector is a plasmid expression vector, preferably an Escherichia coli plasmid expression vector, such as pET-28a, pET-32a, pGEX4T-1, or pUC57 plasmid expression vectors.

[0100] In some embodiments, the RNA polymerase promoter has a sequence as shown in SEQ ID NO.3, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0101] In some embodiments, the expression vector comprises a sequence as shown in SEQ ID NO.51, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity with it.

[0102] In some embodiments, linear RNA polynucleotides are transcribed from the nucleic acid construct. These linear RNA polynucleotides may be unmodified, partially modified, or fully modified. In some embodiments, the linear RNA contains at least one nucleotide modification. In some embodiments, up to 100% of the nucleotides of the linear RNA are modified. In some embodiments, the at least one nucleotide modification is cytidine modification, uridine modification, or adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5mol). In some embodiments, the circular RNA contains less than 100%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% of a specific nucleotide modification. As used herein, the percentage of a specific nucleotide modification refers to the ratio of nucleotides in a sequence that have undergone that specific modification to nucleotides that can undergo that specific modification. In some embodiments, the circular RNA is unmodified. In some embodiments, the circular RNA does not contain nucleotide modifications.

[0103] In some embodiments, the linear RNA polynucleotide undergoes self-splicing mediated by guanosine triphosphate (GTP) to form a circular or substantially circular structure.

[0104] In some embodiments, the transcription takes place in cells selected from E. coli cells, particularly BL21(DE3) competent cells.

[0105] In some embodiments, the method further includes the step of amplifying the recombinant host cells. In some embodiments, the amplification involves a bacterial culture volume of 50 ml to 1 L, theoretically amplifying the circRNA volume by 20 times.

[0106] In a second aspect of the invention, a method for producing the circular RNA is provided, comprising at least the following steps: a. transforming host cells using the expression vector; b. incubating the resulting recombinant host cells under growth conditions to allow replication of the expression vector; c. inducing expression of the circular RNA by adding an inducer; and optionally, d. purifying the resulting circular RNA.

[0107] In some embodiments, the host cell is selected from Escherichia coli cells, especially BL21(DE3) competent cells.

[0108] In some embodiments, the inducing agent is selected from isopropyl thiogalactoside (IPTG).

[0109] In some embodiments, the induction step with the inducer is performed at 18°C ​​for approximately 12–24 hours, for example, approximately 12h, 13h, 14h, 15h, 16h, 17h, 18h, 19h, 20h, 21h, 22h, 23h, 24h, or any value between these times, preferably approximately 18h. The inventors have found that prolonged induction at 18°C, such as overnight induction, produces more circular RNA compared to shorter induction at higher temperatures (e.g., 3h) with shorter durations. In some embodiments, induction at 18°C ​​for 18 hours produces at least 6, at least 7, at least 8, at least 9, at least 10, or more times more circular RNA than induction at 37°C for 3 hours.

[0110] In a third aspect of the invention, a method for inhibiting the expression of disease-related proteins in cells is provided, the method comprising:

[0111] (a) The cell is exposed to the pharmaceutical composition as described in the first aspect for a period of time, thereby inhibiting the expression of disease-related proteins in the cell.

[0112] In some implementations, the cells are in the body of the subject.

[0113] In some implementations, the disease-related protein is suppressed by at least about 50%.

[0114] In a fourth aspect of the invention, the use of the pharmaceutical composition described in the first aspect in the preparation of a medicament for treating a disease in a subject is provided.

[0115] In some embodiments, the drug mediates the degradation of mRNA of disease-related proteins.

[0116] In some embodiments, the disease-related protein is selected from PCSK9, APOC3, ANGPTL4, LPA, ATN1 protein, ataxia protein, huntingtin protein, and BACE1.

[0117] In some embodiments, the drug is used to treat subjects suffering from PCSK9 expression-mediated dysregulation.

[0118] In some embodiments, the disorder includes hypercholesterolemia, atherosclerosis, hypertriglyceridemia, familial hypercholesterolemia, fatty liver disease, dyslipidemia, hyperlipoproteinemia, atherosclerosis, diabetes and its complications, metabolic syndrome, cardiovascular disease, or elevated cholesterol due to genetic conditions.

[0119] In some embodiments, the hypertriglyceridemia includes severe hypertriglyceridemia.

[0120] In some embodiments, the fatty liver disease includes non-alcoholic fatty liver disease (NFLD) and non-alcoholic steatohepatitis (NASH).

[0121] In some embodiments, the hyperlipoproteinemia includes type I hyperlipoproteinemia and type V hyperlipoproteinemia.

[0122] In some embodiments, the lipid disorder includes mixed lipid disorder.

[0123] In some implementations, the type I hyperlipoproteinemia includes three subtypes: type Ia, also known as Berg-Grütz syndrome or familial hyperchylomicronemia; type Ib, also known as familial apolipoprotein CII deficiency; and type Ic.

[0124] In some embodiments, the diabetes and its complications include type 2 diabetes, diabetic nephropathy, diabetic neuropathy, and diabetic retinopathy.

[0125] In some implementations, the cardiovascular disease includes coronary heart disease.

[0126] In some implementations, the subjects include mammals.

[0127] In some embodiments, the mammal includes primates or rodents.

[0128] In some implementations, the primates include humans, orangutans, or monkeys.

[0129] In some embodiments, the rodents include rats, mice, guinea pigs, hamsters, or voles.

[0130] In some embodiments, the pharmaceutical composition degrades to mRNA capable of translating the disease-related protein.

[0131] In some embodiments, the antisense strand in the pharmaceutical composition is complementary or anticomplementary to the mRNA of the disease-associated protein.

[0132] In some embodiments, the pharmaceutical composition has one or more of the following effects:

[0133] 1) Reduce the expression level of the PCSK9 gene;

[0134] 2) Mediates the degradation of PCSK9 protein mRNA;

[0135] 3) Increase LDLR protein levels;

[0136] 4) Lower LDL-C levels;

[0137] 5) Reduce aortic plaque burden;

[0138] 6) No significant liver or kidney toxicity;

[0139] 7) It has low immunogenicity.

[0140] In some embodiments, the low immunogenicity includes not increasing or not significantly increasing the mRNA levels of TNF, IFNB1, RIG-I, or IL-6.

[0141] In some embodiments, the drug is in one or more of the following forms: solution, powder, microencapsulated powder, capsule, tablet, ointment, lozenge, granule, emulsion, suspension, spray formulation, aerosol, electrostatic spray formulation, suppository, etc.

[0142] In some embodiments, the drug is administered via systemic and / or local administration.

[0143] In some embodiments, the systemic administration includes oral and parenteral administration methods, such as intravenous administration, intraperitoneal administration, etc.

[0144] In some embodiments, the local administration includes transdermal, intranasal, and inhalation administration. Beneficial effects

[0145] This invention discloses a pharmaceutical composition comprising circular RNA and a drug delivery carrier. Compared with traditional linear 1×siRNA and circular 1×siRNA, this disclosure increases the number of tandem repeats on the sense strand to, but is not limited to, more than two, unexpectedly revealing a significantly enhanced silencing effect, significantly reducing the expression level of the PCSK9 gene and mediating the degradation of PCSK9 protein mRNA. The use of nanoparticles to deliver oligonucleotides increases stability, reduces immunogenicity, and enhances the effects of lowering cholesterol, reducing aortic plaque burden, and anti-atherosclerosis, while remaining safe with no significant hepatotoxicity or nephrotoxicity. This composition shows broad application prospects in the preparation of therapeutic drugs for hypercholesterolemia and coronary heart disease. Attached Figure Description

[0146] Figure 1 illustrates the design principle of the positive strand RNA of the circular 4×siRNA.

[0147] Figure 2 shows that after adding IPTG to 50 ml of bacterial culture, the expression level of circular RNA was higher when induced at 18°C ​​for 18 hours than when induced at 18°C ​​for 3 hours, 37°C for 3 hours, and 37°C for 18 hours, suggesting that 18°C ​​induction for 18 hours was the most effective in increasing the yield of circular RNA.

[0148] Figure 3 shows that circular 4×siRNA, after being processed with DNase I, RNase R, and gel extraction, can accumulate a significant band at the 200 nt position.

[0149] Figure 4 shows the successful ligation of exon 5' and exon 3'.

[0150] Figure 5 shows the bands of circular 4× sense RNA binding to linear antisense RNA. As the number of circular sense strands increases, the charge carried by the double-stranded siRNA increases, and the band migration distance gradually increases.

[0151] Figure 6 shows the qRT-PCR results, which indicate that circular 4×siCopGFP reduced CopGFP mRNA expression levels compared to linear siCopGFP, circular and linear negative control siRNA, and the control group.

[0152] Figure 7 shows that under a fluorescence microscope, the circular 4×siCopGFP reduced the green fluorescence density of CopGFP compared to linear siCopGFP, circular and linear negative control siRNA, and the control group.

[0153] Figure 8 shows the qRT-PCR results, demonstrating the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RIG-I mRNA.

[0154] Figure 9 shows the qRT-PCR results, demonstrating the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on PCSK9 mRNA on day 3 (A) and day 7 (B) after transfection, and in the absence of atorvastatin and in combination with high-intensity atorvastatin (C).

[0155] Figure 10 shows the Western blot results, showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP and C-4×-siPCSK9 on LDLR, PCSK9 and GAPDH on day 3 (A) and day 7 (B) after transfection, and the effects on LDLR, PCSK9 and GAPDH in the absence of atorvastatin and in combination with high-intensity atorvastatin (C).

[0156] Figure 11 shows the qRT-PCR results, indicating the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RGIG-I mRNA on days 3 and 7 after transfection.

[0157] Figure 12 shows the qRT-PCR results, demonstrating the effects of atorvastatin-free and high-intensity atorvastatin combined with control, AS-siPCSK9, L-1×-siPCSK9, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RGIG-I mRNA.

[0158] Figure 13 shows the inhibitory effect of different numbers of tandemly linked circular siPCSK9 molecules on PCSK9 mRNA.

[0159] Figure 14 shows the structural formulas of citronellol acrylate, PEI600, and P6-Cit-100. Figure 14A shows the structural formula of citronellol acrylate, Figure 14B shows the structural formula of PEI600, Figure 14C shows the structural formula of P6-Cit-100, where n = 5-50, and Figure 14D shows the NMR spectrum of P6-Cit-100.

[0160] Figure 15 shows the particle size distribution of LNP-encapsulated linear and cyclic siPcsk9.

[0161] Figure 16 shows the charge changes after LNP wraps linear and cyclic siPcsk9.

[0162] Figure 17 shows the morphology of LNP-encapsulated linear and cyclic siPcsk9 under negative staining electron microscopy.

[0163] Figure 18 shows the effects of LNP-encapsulated linear and cyclic siPcsk9 on ApoE after 8 weeks of high-fat diet. - / - Effect of mouse serum PCSK9 protein concentration.

[0164] Figure 19 shows the effects of LNP-encapsulated linear and cyclic siPcsk9 on ApoE after 8 weeks of high-fat diet. - / - Effects of LDL-C concentration in mouse serum.

[0165] Figure 20 shows the effects of LNP-encapsulated linear and cyclic siPcsk9 on ApoE after 12 weeks of high-fat diet. - / - The effect of aortic plaque burden on mice.

[0166] Figure 21 shows the changes in PCSK9 and LDL-C over time after injecting C57BL6 mice with PBS, circ-siPcsk9 without LNP encapsulation, and circ-siPcsk9 encapsulated with LNP.

[0167] Figure 22 shows the serum ALT and creatinine levels in C57BL6 mice at week 12 after injection of PBS, circ-siPcsk9 without LNP encapsulation, and circ-siPcsk9 with LNP encapsulation. Detailed Implementation

[0168] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0169] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0170] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references.

[0171] As used herein, the terms “including,” “comprising,” “having,” “may,” “containing,” and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. The term “consisting of” generally indicates that no other components can exist (or similarly, features, integers, steps, etc.).

[0172] As used herein, the term “about” may be used to cover changes of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a particular value.

[0173] The term "nucleic acid" refers to any DNA or RNA molecule.

[0174] As used in this article, the terms “ribonucleic acid,” “RNA,” and “polynucleotide” refer to polymers composed of ribonucleotides.

[0175] The terms “circRNA,” “circular RNA,” and “circular RNA” are used interchangeably throughout this patent.

[0176] The term "DNA" refers to a polymer composed of deoxyribonucleotides.

[0177] The term "oligonucleotide" refers to single-stranded or double-stranded nucleotide polymers with a length ranging from about 2 to a maximum of about 200 nucleotides. Suitable oligonucleotides can be prepared by chemical methods such as the phosphoramidite method or enzymatic methods.

[0178] The term "polynucleotide" refers to a single-chain or double-chain polymer composed of nucleotide monomers.

[0179] The term "nucleic acid construct" refers to an RNA or polypeptide that, when introduced into a cell, results in transcription and / or translation.

[0180] In some embodiments, the nucleic acid construct includes a terminator or termination sequence operatively linked to an open reading frame.

[0181] In some implementations, the nucleic acid construct comprises at least one synthetic or non-natural promoter, at least one synthetic or non-natural coding sequence, and at least one synthetic or non-natural terminator.

[0182] The term "codon-optimized" refers to altering the codons in the open reading frame of a nucleic acid sequence to reflect typical codon usage in a selected organism, without changing the polypeptide encoded by the sequence. This optimization includes replacing at least one, more than one, or a significant number of codons with one or more codons that are more frequently used in the genes of the selected organism.

[0183] When a nucleic acid sequence is placed in a functional relationship with another nucleic acid sequence, that nucleic acid sequence is "operably linked".

[0184] As used herein, the term "antisense strand" refers to an oligomeric compound that is substantially or 100% complementary to the target nucleic acid or target sequence. In some embodiments, the antisense strand comprises at least two nucleotides in length. In some embodiments, the antisense strand comprises at least 40 nucleotides in length. In some embodiments, each of the antisense strands has a length of about 18 to about 28 nucleotides. The antisense strand sequence can be predicted by consulting previous literature or by importing the mRNA sequence of the target protein into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The target protein may be a protein associated with a specific disease.

[0185] The linear RNA polynucleotide provided by this invention can form covalently linked closed circular RNA molecules through self-splicing under the action of a cyclization element. The cyclization element contains a self-splicing intron; the term "self-splicing intron" refers to an intron with self-splicing ribozyme activity that can cleave itself and connect to two flanking exons. In some embodiments, the splicing is autocatalytic splicing.

[0186] As used herein, "self-splicing introns" include, but are not limited to, class I and class II introns. Class I introns comprise 14 subgroups, with most belonging to the IC3 subgroup. For example, a class I intron can be a class I intron from *Anabaena* belonging to the IC3 subgroup, a class I intron from T4 phage belonging to the IA2 subgroup, or a class I intron from *B. H72*, a nitrogen-fixing bacterium belonging to the IC3 subgroup. Other examples of self-splicing introns that can be used in this invention include, but are not limited to, self-splicing introns derived from the following organisms: Anabaena PCC7120, bacteriophage Twort, bacteriophage SpO1, bacteriophage S3b, Synechococcus elongatus PCC 6301, Enterobacteriophage T4, Bacillus anthracis, Clostridium botulinum, Tetrahymena thermophila, Dunaliella parva, Pneumocystis carinii, Physarum polycephalum, Scytonema hofmanni, Agrobacterium tumefaciens, Synechocystis PCC 6803, etc.

[0187] As used in this paper, an "exon element" is a sequence of natural exons derived from self-splicing introns (i.e., exons flanking self-splicing introns) that can be recognized and / or spliced ​​by self-splicing introns and is therefore required for circularization.

[0188] In some implementations, the 5' exon element is derived from the natural 5' exon of the self-splicing intron (the exon flanking (or downstream) of the 5' end of the self-splicing intron) or a continuous segment thereof starting from the 3' end nucleotide.

[0189] In some embodiments, the 5' exon element is the entire natural 5' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with it, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire natural 5' exon of the self-splicing intron.

[0190] In some embodiments, the 5' exon element is a continuous segment beginning with the 3' nucleotide of the native 5' exon. In some embodiments, the 5' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with the continuous segment beginning with the 3' nucleotide of the native 5' exon. In some embodiments, the 5' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the continuous segment beginning with the 3' nucleotide of the native 5' exon.

[0191] In some embodiments, the continuous fragment beginning with the 3' end nucleotide of the natural 5' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the natural 5' exon nucleotides. In some embodiments, the length of the continuous fragment beginning with the 3' end nucleotide of the natural 5' exon is at least 1 nucleotide, for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more nucleotides. In some embodiments, the length of the continuous segment starting from the 3' end nucleotide of the natural 5' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides or the total length of the natural 5' exon.

[0192] In some implementations, the 3' exon element is derived from the natural 3' exon of the self-splicing intron (the exon flanking (or downstream) of the 3' end of the self-splicing intron) or a continuous segment thereof starting from the 5' end nucleotide.

[0193] In some embodiments, the 3' exon element is the entire natural 3' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with it, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire natural 3' exon of the self-splicing intron.

[0194] In some embodiments, the 3' exon element is a continuous segment beginning with the 5' nucleotide of the native 3' exon. In some embodiments, the 3' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with the continuous segment beginning with the 5' nucleotide of the native 3' exon. In some embodiments, the 3' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the continuous segment beginning with the 5' nucleotide of the native 3' exon.

[0195] In some embodiments, the continuous fragment beginning with the 5' nucleotide of the natural 3' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the natural 3' exon nucleotides. In some embodiments, the length of the continuous fragment beginning with the 5' nucleotide of the natural 3' exon is at least 1 nucleotide, for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more nucleotides. In some embodiments, the length of the continuous segment starting from the 5' end nucleotide of the natural 3' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides or the total length of the natural 3' exon.

[0196] As used in this article, “host” means an individual and may include domestic animals such as cats and dogs; livestock such as cattle, horses, pigs, sheep and goats; laboratory animals such as mice, rabbits, rats and guinea pigs; mammals such as humans, non-human primates and primates; and other animals such as rodents, birds, reptiles, amphibians and fish.

[0197] As used herein, “gene silencing” of small interfering RNA molecules refers to a reduction in the mRNA level of a target gene in a cell of at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, and at most and including 100%. In a preferred embodiment, the mRNA level is reduced by at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, and at most and including 100%.

[0198] The term "lipid nanoparticle" is not limited to any particular form and includes any form produced when cationic lipids and optionally one or more other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipid complexes, emulsions, micelles, lipid nanocapsules, nanosuspensions, etc., are all within the scope of lipid nanoparticles. In some embodiments, the LNP comprises (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid in a molar ratio of approximately 20-60% cationic lipids: 5-25% neutral lipids; 25-55% sterols; and 0.5-15% PEG-lipids.

[0199] The following embodiments and accompanying drawings are provided to aid in understanding the present invention. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0200] Example

[0201] The names and sources of the experimental reagents used in the embodiments of this disclosure are shown in Table 1, and the main consumables and instruments are shown in Table 2.

[0202] Table 1: Experimental reagents used

[0203] Table 2: Major Consumables and Instruments

[0204] Example 1: Construction of a circular 4×siRNA vector

[0205] 1.1. Sequence design of circular 4×siRNA

[0206] The circular 4× siRNA consists of a circular 4× sense strand RNA and a linear 1× antisense strand RNA. The antisense strand sequence is predicted by searching previous literature or by importing the mRNA sequence of the target protein into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ).

[0207] The antisense and sense strands of the circular siRNA are 24 and 21 bases in length, respectively, with a 5' monophosphate modification. Taking CopGFP as an example, the antisense strand sequence is 5'GCTCTTCATCTTGTTGGTCATGCG 3' (SEQ ID NO.1), and the sense strand sequence is 5'ATGACCAACAAGATGAAGAGC 3' (SEQ ID NO.2). The circular 4× sense strand RNA consists of four RNA elements: a T7 promoter, an Anabaena class I intron and exon, and a 4× sense strand tandem sequence, with spacer sequences of a certain length between the elements (Figure 1). Taking the template DNA sequence corresponding to the sense strand RNA of the circular 4×siCopGFP as an example, it is formed by sequentially linking the sequences shown in Table 3. Those skilled in the art will understand that the sense strand sequence of CopGFP can be replaced by any desired target sequence.

[0208] Table 3: Exemplary DNA template sequences

[0209] The T7 promoter initiates in vitro transcription of circular 4×siCopGFP positive-strand RNA via T7 RNA polymerase recognition. The class I introns and exons at both ends of the RNA are ribozymes derived from *Anabaena*, which undergo GTP-mediated self-splicing to excise introns and simultaneously loop exons. The 4× positive-strand RNA pairs complementaryly with the antisense strand, binding the antisense strand to the circular RNA. Adding SpeⅠ (5'A↓CTAGT 3' (SEQ ID NO.14)) at both ends and AgeⅠ (5'A↓CCGGT 3' (SEQ ID NO.15)) and at the middle of the 4× positive-strand RNA, respectively, facilitates the replacement of repetitive positive-strand sequences of varying lengths. Depending on the required number of antisense strands to bind, the positive-strand sequence can be repeated more than four times.

[0210] 1.2 Similarly, a non-functional negative control siRNA was designed as a control.

[0211] The 21nt sense strand sequence of the control siRNA is: 5'-GCAACGATCATGGTTGCACAA-3' (SEQ ID NO.16), and the 24nt antisense strand sequence is: 5'-GTGCAACCATGATCGTTGCGGCAG-3' (SEQ ID NO.17).

[0212] 1.3 EcoRI and BamHI sequences were added to both ends of the template DNA sequence of the circular 4× positive strand RNA, and cloned into the corresponding restriction sites of the pUC57 vector by EcoRI and BamHI restriction endonuclease digestion and homologous recombination.

[0213] 1.4 The recombinant product was transformed into 100 μL of DH5α competent cells and placed on ice for 30 minutes. After heat shock in a 45°C water bath for 45 seconds, 1 ml of LB medium was added, and the cells were incubated at 37°C and 200 rpm for 1 hour. After centrifugation at 6000 rpm for 3 minutes, the bacterial culture was resuspended in 50 μL of LB medium and spread on ampicillin-resistant LB agar plates. After incubation overnight at 37°C, single colonies were picked with an inoculation loop and dissolved in 1.5 ml of ampicillin-resistant LB liquid medium, and incubated at 37°C and 200 rpm until the culture became turbid. 20 μL of the bacterial culture was retained, and the remaining culture was subjected to small-scale plasmid extraction. Colony PCR was performed on a 1% agarose gel in 1×TAE buffer at 110V for 30 minutes to observe whether the band sizes were consistent. The bacterial culture transformed with the circular 4× positive strand RNA template vector that had successfully undergone homologous recombination was inoculated into 250 ml of LB liquid medium and incubated at 37°C and 200 rpm until the bacterial culture became turbid. A large amount of plasmid was then extracted using a plasmid extraction kit.

[0214] Example 2: In vitro transcription of circular 4× positive strand RNA

[0215] 2.1. Linearization of template DNA

[0216] Take 65 μg of PUC57 plasmid containing circular 4× positive strand RNA, add 25 μL of 10× digestion buffer and 10 μL of SmaⅠ restriction endonuclease to prepare a 250 μL digestion system, and incubate overnight at 37℃ and 1000 rpm. After adding 1.25 ml of isopropanol to precipitate the DNA, purify and recover 200 μL of plasmid DNA by column chromatography.

[0217] 2.2. PCR amplification of template DNA

[0218] Prepare a 3.2 ml PCR system [3 μg / ml plasmid DNA, 5× reaction buffer, 200 μM dNTP, 0.5 μM universal front primer (5'AAACGACGGCCAGTGAATTCTAATACGAC 3'(SEQ ID NO.18)) and back primer (5'ACGGCCCGGGATCC 3'(SEQ ID NO.19))], unwind at 95℃ for 30 seconds, anneal at 58℃ for 30 seconds, extend at 72℃ for 3 minutes, cycle 35 times, cool from 72℃ to 4℃ for 5 minutes, and store at 4℃.

[0219] 2.3. In vitro transcription

[0220] At 37°C and 1000 rpm, 200 μL of linearized plasmid (or 3.2 ml of PCR product) and 10 μL of T7 RNA polymerase were transcribed for 2 hours in a system of 5 mM each of ATP, CTP, GTP, and UTP. After incubation with 5 μL of DNase I for 30 minutes, the DNase was inactivated at 65°C for 3 minutes, and immediately placed on ice for 5 minutes. 10× cyclization buffer and 2 mM GTP were added, and cyclization was performed at 55°C for 15 minutes. 2 μL of RNase R was added to digest the linear RNA precursor. 100 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) was added and thoroughly mixed. The mixture was centrifuged at 20,000 rpm for 5 minutes, and the supernatant was carefully extracted. 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol were added to precipitate the supernatant, which was then added to a 2 ml 8-layer nucleic acid purification column. The column was centrifuged at 12,000 rpm for 1 minute, the filtrate was discarded, and the centrifugation was repeated until all solutions passed through the purification column. Add 600 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute to wash the precipitate from the purification column, repeat twice. Centrifuge at 12000 rpm for 3 minutes, thoroughly remove the ethanol, add 120 μL of 1×TE buffer to thoroughly wet the purification column and let stand for 5 minutes. Centrifuge at 12000 rpm for 1 minute to recover the filtrate and store at -80℃.

[0221] After digestion of template DNA with DNase I, digestion of linear precursor RNA with RNase R, and gel recovery, a significant band of circular 4× positive strand RNA was enriched at the 200 nt position (Figure 3).

[0222] Example 3: Amplification and extraction of circular 4× positive strand RNA from E. coli

[0223] 3.1 Chemical transformation of Escherichia coli

[0224] The pUC57 vector containing the T7 promoter and a circular 4× positive-strand RNA template sequence was transformed into 100 μL of BL21(DE3) competent cells and incubated on ice for 30 minutes. After heat shock at 42°C for 45 seconds, 1 ml of LB broth was added, and the cells were amplified at 37°C and 200 rpm for 1 hour. After centrifugation at 6000 rpm for 3 minutes, most of the supernatant was discarded, and the bacterial pellet was resuspended in approximately 50 μL of medium. The bacterial culture was then spread on ampicillin-resistant LB agar plates and incubated overnight at 37°C in a 5% CO2 incubator.

[0225] 3.2 Escherichia coli amplification and induction

[0226] The following day, single colonies were picked from the plate using a sterile inoculation loop and resuspended in 50 ml of LB broth containing 0.1% ampicillin. The culture was incubated at 37°C and 200 rpm for 3 hours until turbidity was achieved. The culture was then transferred to 250 ml to 1000 ml of LB broth and incubated at 37°C and 200 rpm for another 3 hours until turbidity was achieved. 800 μL of the culture was added to 200 μL of glycerol and stored at -30°C. 1 mM isopropyl-β-D-thiogalactoside (IPTG) was added, and the culture was induced for 18 hours at 18°C ​​and 200 rpm.

[0227] 3.3 RNA extraction and recovery

[0228] The following day, the bacterial precipitate was recovered after centrifugation at 4000 rpm for 20 minutes, typically about 5 ml. 5 ml of bacterial lysis buffer (50 mM NaCl, 250 mM Tris-HCl, pH 8.0) was added to resuspend the bacteria. Then, 2 ml of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) was added and thoroughly mixed. After lysis, the mixture was centrifuged at 12000 rpm for 10 minutes. The supernatant (approximately 7.5 ml) was collected. 300 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) was added to the supernatant and thoroughly mixed. The mixture was centrifuged at 12000 rpm for 10 minutes to fully precipitate the protein. The supernatant was collected again, and 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol were added to precipitate the protein. 800 μL of the suspension was transferred to a 2 ml nucleic acid purification column. The column was centrifuged at 12000 rpm for 1 minute, the filtrate was discarded, and the centrifugation was repeated until all the suspension was filtered. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 200 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and collect the filtrate.

[0229] Add 50 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) to 200 μL of filtrate and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes. Collect the supernatant, add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to the supernatant to precipitate, and transfer to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute and discard the filtrate. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the washing of the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 120 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate.

[0230] In 50 ml of bacterial culture, the levels of circular RNA expression were compared after induction at 18°C ​​for 3 hours, 18°C ​​for 18 hours, 37°C for 3 hours, and 37°C for 18 hours following the addition of IPTG. It was found that the expression level of circular RNA was highest after induction at 18°C ​​for 18 hours (Figure 2).

[0231] Example 4: In vitro transcription of linear siRNA antisense and sense strands

[0232] A T7 promoter sequence (SEQ ID NO. 3) was added to the 5' end of both the sense and antisense strands, and two short, inversely complementary single-stranded DNA molecules were synthesized. After unwinding at 95°C for 5 minutes, the mixture was gradually annealed to room temperature to form template double-stranded DNA. 25 μL of a transcription reagent containing 25 mM each of ATP, CTP, GMP, and pseudouridine triphosphate, and 5 mM GTP (0.5 M HEPES-K pH 7.9, 60 mM MgCl2, 150 mM DTT, and 10 mM spermidine) and 100 μg of T7 RNA polymerase were added to 400 μL of the template double-stranded DNA at a concentration of 500 ng / μL. Transcription was performed overnight at 37°C and 1000 rpm. 10 U of DNase I was added, and the mixture was incubated at 37°C and 1000 rpm for 30 minutes to eliminate the DNA template. Add 50 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol in a 25:24:1 ratio and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes and carefully extract the supernatant. Add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to precipitate the solution. Add the precipitate to a 2 mL 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat centrifugation until all solution passes through the purification column. Add 600 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute to wash the column precipitate. Repeat twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove ethanol. Add 120 μL of 1×TE buffer to thoroughly wet the purification column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.

[0233] Example 5: Formation of circular and linear siRNAs

[0234] 5.1 Purification of circular 4× sense RNA and linear sense and antisense RNA

[0235] Purifying circular 4× positive strand RNA requires preparing a 1.5 mm thick 5% urea-polyacrylamide gel (13 ml / gel): 8.3 M urea, 0.5× TBE buffer, 5% acrylamide / methylenebis(methyl)ethylene 19:1, and inserting it into a 10-well sample comb. After solidification at room temperature for 30 minutes, perform pre-electrophoresis at 10 W constant power for 30 minutes in 0.5× TBE buffer. Before electrophoresis, rinse the sample wells to remove any remaining urea.

[0236] Add an equal volume of 2×RNA loading buffer (containing xylene cyanide) to 120 μL of RNA sample, heat at 70°C for 3 minutes, and place on ice for 5 minutes. Rinse the loading wells to remove urea, load 30 μL of sample into each well, and perform electrophoresis at a constant power of 10 W until the xylene cyanide reaches the bottom of the urea gel. Electrophoresis should be stopped at a constant power of 10 W, which takes about 35 minutes.

[0237] The urea gel was completely scraped off and placed on a thin-layer chromatography silica gel plate covered with transparent plastic wrap. The black band on the top of the urea gel was observed under 254nm UV light using a handheld UV analyzer. The gel corresponding to the band was cut off, placed in a 5ml centrifuge tube, and crushed with a pipette tip. 5ml of sol buffer (0.3M sodium acetate, pH 5.2, 0.1% SDS) was added and vortexed to mix. The mixture was then left to stand overnight at room temperature.

[0238] Aliquot the urea gel suspension into four 1.5ml centrifuge tubes, centrifuge at 12000 rpm for 1 minute, collect the supernatant into a new 1.5ml centrifuge tube, and discard the gel layer. Add 50μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes to fully precipitate impurities. Collect the supernatant into a new 5ml centrifuge tube, add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to the supernatant, precipitate, and transfer 800μL of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat centrifugation until all suspension has been filtered. Add 500μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 20 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate. After detecting the RNA concentration with Nanodrop, store at -80℃.

[0239] Take 1 μg of circular 4× positive strand RNA, design primers for the 5' and 3' ends of the looping site, add 1.25 μM of the front primer (5'ACCGGTAAAAAGGCGAGACG 3' (SEQ ID NO.20)) and the back primer (5'CGACCGTTTAAGGTCAACGGATTTT 3' (SEQ ID NO.21)) and 1 μL of reverse transcriptase, and incubate in a conventional PCR instrument with programmed heating at 25℃ for 5 minutes, 42℃ for 30 minutes, and 85℃ for 5 minutes. Store the cDNA product at 4℃. Send for Sanger sequencing to verify the presence of the looping site. As shown in Figure 4, the circular 4× positive strand RNA gel-recovered product, after being reverse transcribed using the designed primers before and after the looping site, yielded a cDNA fragment for Sanger sequencing. The intron sequence was cleaved and not detected, and the 5' and 3' exons were successfully ligated.

[0240] In this disclosure, taking siCopGFP as an example, "circular 4×siCopGFP" is written as "C-4×-siCopGFP", "linear 1×siCopGFP" is written as "L-1×-siCopGFP", the sense strand of siCopGFP is written as "S-siCopGFP", and the antisense strand of siCopGFP is written as "AS-siCopGFP".

[0241] 5.2 The combination of justice chain and antithesis chain

[0242] Equal amounts of circular 4× sense strands and linear antisense strands (e.g., a mixture of 60 pmol linear antisense strands and 60 pmol circular 4× sense strands) and equal amounts of linear sense strands and linear antisense strands (e.g., a mixture of 60 pmol linear antisense strands and 60 pmol linear sense strands) were mixed, and enzyme-free water was added to bring the volume to 60 μL. The mixture was heated at 95°C for 5 minutes to fully open the higher-order structure of the RNA, and then gradually cooled to room temperature to allow the sense and antisense strands to fully pair and bind. The mixture was briefly centrifuged for 10 seconds to collect the liquid at the bottom of the centrifuge tube and stored at 4°C for up to 24 hours. Non-denaturing agarose gel electrophoresis showed that the bands of circular 4× sense strands binding to linear antisense strands increased with the increase of the circular sense strand, indicating an increase in the charge carried by the double-stranded siRNA and a gradual increase in the band migration distance, suggesting a decrease in the free antisense strand (Figure 5).

[0243] Example 6: Evaluation of the efficacy and immunogenicity of circular 4×siCopGFP

[0244] Inoculate 1×10⁻⁶ cells into a 24-well plate. 5HEK293 human embryonic kidney cell line (ATCC CRL-1573) was cultured for 1 day at 37°C and 5% CO2 in 500 μL of high-glucose DMEM complete medium containing 10% fetal bovine serum. The next day, after HEK293 cells adhered, the medium was discarded, and the cells were washed twice with PBS to thoroughly remove serum. 1.25 mL of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. 600 μL of Opti-MEM was then mixed with 6 μg of pCDH-CopGFP plasmid and 6 μg of pmCherry-N1 plasmid. Five tubes of 100 μL Opti-MEM were mixed with C-4×-siCopGFP containing 60 pmol of antisense strand, L-1×-siCopGFP containing 60 pmol of antisense strand, AS-siCopGFP containing 60 pmol of antisense strand, C-4×- negative control containing 60 pmol of antisense strand, and L-1×- negative control containing 60 pmol of antisense strand, respectively. 200 μL of Opti-MEM containing transfection reagent was mixed with 100 μL of Opti-MEM containing siRNA, and 100 μL of Opti-MEM was added to the control group. The mixtures were incubated for 25 minutes. Add 75 μL of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, then add 25 μL of Opti-MEM containing pCDH-CopGFP plasmid and pmCherry-N1 plasmid. Mix gently, then add serum-free DMEM high-glucose medium to bring the volume to 500 μL. Incubate at 37°C for 6 hours, then replace the medium with DMEM high-glucose complete medium containing 10% serum and continue incubation for 24 hours.

[0245] The following day, cells expressing the green fluorescent protein CopGFP were observed under an inverted fluorescence microscope with a green filter, and cells expressing the red fluorescent protein mCherry were observed under a red filter. ImageJ software (National Institutes of Health, V1.8.0) was used to count the areas of green and red fluorescence and calculate their ratios to compare the proportion of green fluorescence in different groups.

[0246] Forty-eight hours later, discard the culture medium and wash twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix by pipetting, and incubate on ice for 5 minutes. Transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cap the 1.5 ml centrifuge tube, and mix by inverting until the mixture turns pale pink. Incubate for 2-3 minutes. Centrifuge at 12000×g, 4°C for 15 minutes. The liquid will separate into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer from top to bottom. Carefully aspirate the colorless transparent layer to another enzyme-free 1.5 ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol, mix, and incubate at 4°C for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat centrifugation until all the suspension has been filtered. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 15 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using Nanodrop.

[0247] Take 1 μg of total RNA sample, 2 μL of 5×g DNA digestion buffer, and 1 μL of gDNA digestion enzyme, and add enzyme-free water to a final volume of 10 μL. Incubate at 42°C for 2 min. Add 2 μL of... II Buffer plus, 2μL II. Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT) 18 Add enzyme-free water to a final volume of 20 μL. Incubate in a standard PCR instrument using programmed heating: 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Store the cDNA product at 4°C.

[0248] Prepare a 500 μL qPCR reaction system for CopGFP and mCherry: Add 200 μL enzyme-free water, 25 μL of the first primer, 25 μL of the second primer, and 250 μL of 2×SYBR Green qPCR Mix. Add 9 μL of the qPCR reaction system to each of the 24 wells of a 384-well plate, and add 1 μL of cDNA product from different samples. Each sample has two auxiliary wells. In a real-time quantitative PCR instrument, perform one cycle of 95℃ pre-denaturation for 2 minutes; 45 cycles of 95℃ denaturation for 10 seconds, 60℃ annealing for 20 seconds, and 72℃ extension for 1 minute; followed by 2 minutes of melting. Calculate the difference (ΔCt) between the average Ct value of the intervention group samples amplified with the target primers and the average CT value amplified with the internal control mCherry primers using the second derivative method. 干预The difference between the average Ct value of the target primer amplification and the average CT value of the control samples amplified with the internal reference mCherry primer (ΔCt) 对照 Subtracting these two values ​​yields the difference (ΔCt). (-ΔΔCt) This refers to the multiple by which the mRNA level in the intervention group changed compared to the control group.

[0249] qRT-PCR showed that circular C-4×-siCopGFP reduced CopGFP mRNA expression levels compared to linear L-1×-siCopGFP, circular C-4×-NC siRNA (circular negative control RNA), linear L-1×-NC siRNA (linear negative control RNA), and the control group (Figure 6). Fluorescence microscopy showed that circular C-4×-siCopGFP significantly reduced CopGFP green fluorescence density compared to other groups (Figure 7). A 500 μL qPCR reaction system containing IL-6, TNF, IFNB1, and RIG-I was prepared, with two sub-wells for each sample. The reaction was performed in a real-time quantitative PCR instrument with the following settings: 95℃ pre-denaturation for 2 minutes, 1 cycle; 95℃ denaturation for 10 seconds, 60℃ annealing for 20 seconds, 72℃ extension for 1 minute, 45 cycles; and melting for 2 minutes. (-ΔΔCt) This refers to the multiple by which the mRNA level in the intervention group changed compared to the control group.

[0250] qRT-PCR showed that transfection of HEK293 cells with circular 4×siCopGFP and pseudouridine-modified linear siCopGFP did not affect the expression levels of intracellular innate immune factors interleukin-6 (IL-6), tumor necrosis factor (TNF), interferon β1 (IFNB1), and retinoic acid-induced gene protein I (RIG-Ⅰ mRNA), with no significant difference in immunogenicity (Figure 8). Primers used in Example 6 are listed in Table 4.

[0251] Table 4: Primers used in Example 6

[0252] Example 7: Preparation of circular 4×siPCSK9 targeting human PCSK9 mRNA

[0253] The circular 4×siPCSK9 targeting human Pcsk9 mRNA was designed and prepared according to the method in Example 1.

[0254] The 21-base sense strand sequence of PCSK9 is: 5'CCAAGATCCTGCATGTCTTCC 3' (SEQ ID NO. 6). The 24-base antisense strand sequence is: 5'GGAAGACATGCAGGATCTTGGTGA 3' (SEQ ID NO. 36). SpeⅠ (5'A↓CTAGT 3' (SEQ ID NO. 14)) and AgeⅠ (5'A↓CCGGT 3' (SEQ ID NO. 15)) were added to both ends of the 4×siPCSK9 sense strand, and then ligated into the pUC57-circular RNA expression vector that had been double-digested with SpeⅠ and AgeⅠ via homologous recombination.

[0255] Then, the method of Example 3 was used to amplify and extract cyclic 4× positive-strand siPCSK9 using *E. coli*, and the method of Example 5 was used to prepare cyclic 4×siPCSK9 and the corresponding linear siPCSK9. Specifically, equal amounts of linear L-1×-AS-siPCSK9 and cyclic C-4×-S-siPCSK9 (e.g., a mixture of 60 pmol L-1×-AS-siPCSK9 and 60 pmol C-4×-S-siPCSK9), and equal amounts of linear L-1×-AS-siPCSK9 and linear L-1×-S-siPCSK9 (e.g., 60 pmol L-1×-AS-siPCSK9 and 60 pmol L-1×-S-siPCSK9) were mixed separately, heated at 95°C for 5 minutes, and gradually annealed to room temperature. The preparation of the control group linear L-1×-siCopGFP and cyclic C-4×-siCopGFP followed the same steps as the preparation of linear L-1×-siPCSK9 and cyclic C-4×-siPCSK9.

[0256] Example 8: Evaluation of the efficacy and immunogenicity of circular 4×siPCSK9 targeting human PCSK9 mRNA.

[0257] Inoculate 1×10⁻⁶ cells into a 24-well plate. 5One HepG2 human hepatocellular carcinoma cell line was cultured for one day at 37°C and 5% CO2 in 500 μL of high-glucose DMEM complete medium containing 10% fetal bovine serum. The next day, after HepG2 cells adhered, the medium was discarded, and the cells were washed twice with PBS to thoroughly remove serum. 1.25 ml of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. Five tubes of 200 μL Opti-MEM were mixed with C-4×-siPCSK9 containing 60 pmol of antisense strand, L-1×-siPCSK9 containing 60 pmol of antisense strand, AS-siPCSK9 containing 60 pmol of antisense strand, C-4×-siCopGFP containing 60 pmol of antisense strand, and L-1×-siCopGFP containing 60 pmol of antisense strand, respectively. 200 μL of Opti-MEM containing transfection reagent was mixed with 200 μL of Opti-MEM containing siRNA, and 200 μL of Opti-MEM was added to the control group. All mixtures were incubated for 25 minutes. Add 100 μL of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, mix gently, and add serum-free DMEM high-glucose medium to bring the volume to 500 μL. Incubate at 37°C for 6 hours, then replace the medium with DMEM high-glucose complete medium containing 10% serum and continue incubation for 72 or 168 hours.

[0258] Separately, five tubes containing 300 μL of Opti-MEM were mixed with C-4×-siPCSK9 containing 90 pmol of antisense strand, L-1×-siPCSK9 containing 90 pmol of antisense strand, and AS-siPCSK9 containing 90 pmol of antisense strand, respectively. 200 μL of Opti-MEM containing transfection reagent was mixed with 200 μL of Opti-MEM containing siRNA. 200 μL of Opti-MEM was added to the control group, and the mixture was incubated for 25 minutes. 100 μL of Opti-MEM containing siRNA coated with the transfection reagent was added to each well, gently mixed, and serum-free DMEM high-glucose medium was added to bring the volume to 500 μL. Then, 22 μM atorvastatin calcium was added to three wells from each group, and the mixture was incubated for 72 hours.

[0259] After the incubation time is reached, discard the culture medium and wash twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix by pipetting, and incubate on ice for 5 minutes. Transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cap the 1.5 ml centrifuge tube, and mix by inverting until the mixture turns pale pink. Incubate for 2-3 minutes. Centrifuge at 12000×g, 4℃ for 15 minutes. The liquid will separate into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer from top to bottom. Carefully aspirate the colorless transparent layer to another enzyme-free 1.5 ml centrifuge tube, and the pink organic layer to another enzyme-free 1.5 ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix well. Incubate at 4℃ for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat centrifugation until all suspension has been filtered. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 15 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using Nanodrop.

[0260] Take 1 μg of total RNA sample, 2 μL of 5×g DNA digestion buffer, and 1 μL of gDNA digestion enzyme, and add enzyme-free water to a final volume of 10 μL. Incubate at 42°C for 2 min. Add 2 μL of... II Buffer plus, 2μL II. Add Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18, and bring the volume to 20 μL with enzyme-free water. Incubate in a standard PCR instrument using programmed heating: 25 °C for 5 minutes, 42 °C for 30 minutes, and 85 °C for 5 minutes. Store the cDNA product at 4 °C.

[0261] Prepare a 500 μL qPCR reaction system for PCSK9, LDLR, IL-6, TNF, IFNB1, RIG-I, and ACTB: Add 200 μL enzyme-free water, 25 μL of the first primer, 25 μL of the second primer, and 250 μL of 2×SYBR Green qPCR Mix. Add 9 μL of the qPCR reaction system to each of the 24 wells of a 384-well plate, and add 1 μL of cDNA product from different samples. Each sample has two auxiliary wells. In a real-time quantitative PCR instrument, perform one cycle of 95℃ pre-denaturation for 2 minutes; 45 cycles of 95℃ denaturation for 10 seconds, 60℃ annealing for 20 seconds, and 72℃ extension for 1 minute; followed by 2 minutes of melting. Calculate the difference (ΔCt) between the average Ct value of the intervention group samples amplified with the target primers and the average CT value amplified with the internal control ACTB primers, obtained by the second derivative method. 干预The difference between the average Ct value of the target primer amplification and the average CT value of the control sample amplification with the internal control ACTB primer (ΔCt) 对照 Subtracting these two values ​​yields the difference (ΔCt). (-ΔΔCt) This refers to the multiple by which the mRNA level in the intervention group changed compared to the control group.

[0262] Add 1.5 times the volume of isopropanol to the pink organic layer and incubate on ice for 20 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4°C; a white precipitate will appear. Discard the pink supernatant. Add 200 μL of 0.3 M guanidine hydrochloride in 95% ethanol and incubate on ice for 10 minutes. Centrifuge at 7,500 rpm for 5 minutes at 4°C and discard the supernatant. Repeat once. Add 200 μL of anhydrous ethanol and incubate on ice for 10 minutes. Centrifuge at 7,500 rpm for 5 minutes at 4°C and discard the supernatant. Dissolve the protein by heating at 99°C for 10 minutes with 50 μL of 10% SDS solution.

[0263] Take 4 μL of each protein solution and dilute it 5-fold with 16 μL of deionized water. Add 200 μL of BCA working solution (solution A:solution B = 50:1). Incubate at 37℃ for 30 minutes, and measure the absorbance at 562 nm using a multi-mode microplate reader. Fit the absorbance of the standard to a linear function curve based on the protein concentration values, and the fitting coefficient R is... 2 ≥0.99, and calculate the protein concentration of each well according to the curve equation. Add deionized water to each group of protein solutions to make up the volume and adjust the concentration to be consistent. Add 0.25 times the volume of 5×SDS loading buffer to each group and mix well. Heat at 99℃ for 10 minutes, centrifuge at 12000 rpm for 10 minutes, and store at -80℃.

[0264] A 10-well 10% SDS-polyacrylamide gel was prepared, with 100 μg of protein loaded into each well. Electrophoresis was performed at 80 V for 25 minutes in an electrophoresis buffer prepared with 3.03 g / L Tris, 14.40 g / L glycine, and 1.00 g / L SDS. After clear separation of protein markers, electrophoresis was continued at 120 V for 80 minutes. In a transfer buffer prepared with 2.42 g / L Tris, 11.52 g / L glycine, and 20% methanol, two layers of sponge, two layers of filter paper, an inner gel, and a methanol-activated 0.45 μm filter membrane were sandwiched together and inserted into the correct electrode positions according to the electrophoresis direction. Transfer was performed at 230 mA for 160 minutes. The membrane was washed twice with TBST for 10 minutes each time. Blocking was performed with a protein-free rapid blocking buffer for 30 minutes. The membrane was then washed three times with TBST for 8 minutes each time. Filter membranes with bands of 95kD or higher, 55-95kD, and 33-46kD were incubated overnight at 4°C with LDLR, PCSK9, and GAPDH primary antibodies diluted 1:1000, respectively.

[0265] The next day, the primary antibody was recovered. The membrane was washed three times with TBST for 8 minutes each time. The membrane was incubated with a 1:5000 diluted secondary antibody for 1 hour. The membrane was washed three times with TBST for 8 minutes each time. The chemiluminescent membrane was exposed on an exposure unit. ImageJ was used to correct the background and measure the band grayscale, comparing the ratios of grayscale values ​​for LDLR, PCSK9, and GAPDH bands in each group.

[0266] On day 3 after HepG2 transfection, qRT-PCR experiments showed that circular C-4×siPCSK9 transfection significantly reduced PCSK9 mRNA levels compared to the linear siPCSK9 group, the negative control group (L-1×-siCopGFP and C-4×-siCopGFP), and the positive control group (AS-siPCSK9). Furthermore, the reduction in PCSK9 mRNA levels induced by circular C-4×-siPCSK9 transfection persisted until day 7 after transfection. High-intensity atorvastatin induced an increase in PCSK9 mRNA levels in HepG2 cells. Only circular C-4×-siPCSK9 significantly reduced PCSK9 mRNA levels in HepG2 cells; neither AS-siPCSK9 nor linear L-1×-siPCSK9 could reduce the increase in PCSK9 mRNA levels in HepG2 cells induced by high-intensity atorvastatin (Figure 9). Western blot analysis showed that on day 3 after transfection with cyclic C-4×-siPCSK9, the LDLR protein level in HepG2 hepatocytes was higher than in other groups, while the PCSK9 protein level was lower. On day 7 after transfection, the LDLR protein level in HepG2 hepatocytes was still higher than in other groups, while the difference in PCSK9 protein level between the two groups decreased. High-intensity atorvastatin induced an increase in PCSK9 protein levels in HepG2 cells, and the PCSK9 protein level in combination with high-intensity atorvastatin and cyclic C-4×-siPCSK9 was lower than that in combination with linear L-1×-siPCSK9 (Figure 10). This indicates that cyclic C-4×-siPCSK9 can reduce the PCSK9 protein level and increase the LDLR level in HepG2 cells on day 3, and the effect of increasing LDLR level can be sustained until day 7. Moreover, only cyclic C-4×-siPCSK9 can avoid the increase in PCSK9 induced by high-intensity atorvastatin.

[0267] On day 3 of HepG2 transfection, qRT-PCR experiments showed that circular C-4×-siPCSK9 transfection significantly increased IL-6 mRNA levels compared to the linear siPCSK9 group and the negative control group. By day 7 of circular C-4×-siPCSK9 transfection, IL-6 mRNA levels decreased to a level not significantly different from the control group. On day 3 of transfection, circular C-4×-siPCSK9 transfection did not increase TNF, IFNB1, or RIG-I mRNA levels. On day 7 of transfection, circular C-4×-siPCSK9 transfection significantly reduced IFNB1 mRNA levels compared to the circular C-4×-negative control siRNA group and the other negative control groups, and significantly reduced RIG-I mRNA levels compared to the circular C-4×-negative control siRNA group (Figure 11).

[0268] High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 significantly increased IL-6 levels compared to cyclic C-4×-siPCSK9 alone, and both groups showed higher IL-6 levels than other groups. High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 did not increase TNF, IFNB1, or RIG-I levels compared to the control group. Since cyclic C-4×-siPCSK9 transiently increases IL-6 levels on day 3 of transfection, the elevated IL-6 levels from high-intensity atorvastatin combined with cyclic C-4×-siPCSK9 may return to normal by day 7. Therefore, high-intensity atorvastatin combined with cyclic C-4×-siPCSK9 essentially does not affect immunogenicity (Figure 12).

[0269] Example 9: Comparison of PCSK9 mRNA levels inhibited by circular siPCSK9 targeting human PCSK9 mRNA with different numbers of tandem sense strands.

[0270] Inoculate 1×10⁻⁶ cells into a 24-well plate. 5One HepG2 human hepatocellular carcinoma cell line was cultured for one day at 37°C and 5% CO2 in 500 μL of high-glucose DMEM complete medium containing 10% fetal bovine serum. The next day, after HepG2 cells adhered, the medium was discarded, and the cells were washed twice with PBS to thoroughly remove serum. 1.25 ml of Opti-MEM was mixed with 25 μL of transfection reagent and incubated at room temperature for 5 minutes. Five tubes containing 200 μL of Opti-MEM were then mixed with linear L-1×-siPCSK9 containing 60 pmol of antisense strand, circular C-1×-siPCSK9 containing 60 pmol of antisense strand (containing only one sense strand sequence), circular C-4×-siPCSK9 containing 60 pmol of antisense strand (containing four repeated sense strand sequences), C-4×-siPCSK9 containing 120 pmol of antisense strand, and C-8×-siPCSK9 containing 60 pmol of antisense strand (containing eight repeated sense strand sequences), respectively. Mix 200 μL of Opti-MEM containing transfection reagent and 200 μL of Opti-MEM containing siRNA. Add 200 μL of Opti-MEM to the control group and incubate for 25 minutes. Add 100 μL of Opti-MEM containing siRNA coated with transfection reagent to each well, mix gently, and add serum-free DMEM high-glucose medium to bring the volume to 500 μL. Incubate at 37°C for 6 hours, then replace the medium with DMEM high-glucose complete medium containing 10% serum and continue incubation for 72 hours.

[0271] After the incubation time is reached, discard the culture medium and wash twice with PBS. Add 200 μL of total RNA extraction reagent to each well, mix by pipetting, and incubate on ice for 5 minutes. Transfer to an enzyme-free 1.5 ml centrifuge tube. Add 40 μL of chloroform, carefully cap the 1.5 ml centrifuge tube, and mix by inverting until the mixture turns pale pink. Incubate for 2-3 minutes. Centrifuge at 12000×g, 4℃ for 15 minutes. The liquid will separate into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer from top to bottom. Carefully aspirate the colorless transparent layer to another enzyme-free 1.5 ml centrifuge tube, and the pink organic layer to another enzyme-free 1.5 ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix well. Incubate at 4℃ for 10 minutes. Transfer 800 μL of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat centrifugation until all suspension has been filtered. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 15 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using Nanodrop.

[0272] Take 1 μg of total RNA sample, 2 μL of 5×g DNA digestion buffer, and 1 μL of gDNA digestion enzyme, and add enzyme-free water to a final volume of 10 μL. Incubate at 42°C for 2 min. Add 2 μL of... II Buffer plus, 2μL II. Add Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18, and bring the volume to 20 μL with enzyme-free water. Incubate in a standard PCR instrument using programmed heating: 25 °C for 5 minutes, 42 °C for 30 minutes, and 85 °C for 5 minutes. Store the cDNA product at 4 °C.

[0273] Prepare a 500 μL qPCR reaction system for PCSK9 and ACTB: Add 200 μL enzyme-free water, 25 μL of the first primer, 25 μL of the second primer, and 250 μL of 2×SYBR Green qPCR Mix. Add 9 μL of the qPCR reaction system to each of the 24 wells of a 384-well plate, along with 1 μL of cDNA product from different samples. Each sample has two auxiliary wells. In a real-time quantitative PCR instrument, perform one cycle of 95℃ pre-denaturation for 2 minutes; followed by 45 cycles of 95℃ denaturation for 10 seconds, 60℃ annealing for 20 seconds, and 72℃ extension for 1 minute; and a 2-minute melting period. Calculate the difference (ΔCt) between the average Ct value of the intervention group samples amplified with the target primers and the average CT value amplified with the internal control ACTB primers, using the second derivative method. 干预 The difference between the average Ct value of the target primer amplification and the average CT value of the control sample amplification with the internal control ACTB primer (ΔCt) 对照 Subtracting these two values ​​yields the difference (ΔCt). (-ΔΔCt) This refers to the multiple by which the mRNA level in the intervention group changed compared to the control group.

[0274] Three days after transfection, cyclic C-4×-siPCSK9 showed the greatest reduction in PCSK9 levels. Using twice the dose of cyclic C-4×-siPCSK9 or cyclic C-8×-siPCSK9 did not reduce PCSK9 levels better than a single dose (15 pmol) of cyclic C-4×-siPCSK9. Circular C-1×-siPCSK9 failed to inhibit PCSK9 expression levels (Figure 13). The test results indicate that the four tandem repeats of the sense strand provided the best silencing effect.

[0275] Example 10: Preparation of circ-siRNA targeting mouse Pcsk9 mRNA

[0276] ① Sequence design of circular circ-siPcsk9

[0277] Circular RNA targeting mouse Pcsk9 mRNA was designed and prepared according to the method in Example 1.

[0278] The circular 4× siRNA consists of a circular 4× sense strand RNA and a linear 1× antisense strand RNA. The antisense strand sequence was predicted by importing the mouse Pcsk9 mRNA sequence (NM_153565.2) into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The antisense strand in the circular siRNA is 24 bases long and contains a 5' monophosphate modification. The sense strand is 21 bases long, with the sequence: GTGGTGATTGGATTGAGGCCA (SEQ ID NO: 42). The antisense strand sequence is: GGCCTCAATCCAATCACCACGACG (SEQ ID NO: 41). The 3' end of the antisense strand is a free 3 base. The circular 4× sense strand RNA consists of 4 RNA elements: a T7 promoter, an Anabaena class I intron and exon, and a 4× sense strand tandem sequence, with spacer sequences of a certain length between the elements. Taking the template DNA sequence corresponding to the positive strand RNA of circular 4×siCopGFP as an example:

[0279] The T7 promoter initiates in vitro transcription of circ-siPcsk9 positive-strand RNA via recognition by T7 RNA polymerase. The class I introns and exons at both ends of the RNA are ribozymes derived from *Anabaena*, which undergo GTP-mediated self-splicing to excise introns and simultaneously loop exons together.

[0280] ② Amplification of the positive strand of circular siRNA in E. coli

[0281] EcoRI and BamHI sequences were added to both ends of the template DNA sequence of the positive strand of the circular 4×siPcsk9. The cloned product was then cloned into the corresponding restriction sites of the pUC57 vector using EcoRI (5'G↓AATTC 3') and BamHI (5'G↓GATCC 3') restriction endonucleases and homologous recombination. The recombinant product was transformed into 100 μL of BL21 competent cells and incubated on ice for 30 minutes. After heat shock at 45°C for 45 seconds, 1 ml of LB medium was added, and the cells were incubated at 37°C and 200 rpm for 1 hour. After centrifugation at 6000 rpm for 3 minutes, the bacterial culture was resuspended in 50 μL of LB medium and plated on ampicillin-resistant LB agar plates. The cells were incubated overnight at 37°C with 5% CO2. Single colonies were picked from a plate using a sterile inoculation loop and resuspended in 30 ml of LB broth containing 0.1% ampicillin. The culture was incubated at 37°C and 200 rpm for 3 hours until turbidity was achieved. The culture was then transferred to 250 ml of LB broth and incubated again at 37°C and 200 rpm for 3 hours until turbidity was achieved. 800 μL of the culture was added to 200 μL of glycerol and stored at -30°C. 1 mM isopropyl-β-D-thiogalactoside (IPTG) was added, and the culture was induced for 18 hours at 18°C ​​and 200 rpm.

[0282] The following day, the bacterial precipitate was recovered after centrifugation at 4000 rpm for 20 minutes, typically about 5 ml. 5 ml of bacterial lysis buffer (50 mM NaCl, 250 mM Tris-HCl, pH 8.0) was added to resuspend the bacteria. Then, 2 ml of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) was added and thoroughly mixed. After lysis, the mixture was centrifuged at 12000 rpm for 10 minutes. The supernatant (approximately 7.5 ml) was collected. 300 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) was added to the supernatant and thoroughly mixed. The mixture was centrifuged at 12000 rpm for 10 minutes to fully precipitate the protein. The supernatant was collected again, and 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol were added to precipitate the protein. 800 μL of the suspension was transferred to a 2 ml nucleic acid purification column. The column was centrifuged at 12000 rpm for 1 minute, the filtrate was discarded, and the centrifugation was repeated until all the suspension was filtered. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 200 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and collect the filtrate.

[0283] Add 50 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) to 200 μL of filtrate and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes. Collect the supernatant, add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to the supernatant to precipitate, and transfer to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute and discard the filtrate. Add 500 μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the washing of the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 120 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate.

[0284] ③ In vitro transcription of linear siRNA antisense strand

[0285] A T7 promoter sequence (5'TAATACGACTCTATAGG 3', SEQ ID NO:3) was added to the 5' end of the antisense strand, and two short, inversely complementary single-stranded DNA molecules were synthesized. After unwinding at 95°C for 5 minutes, the mixture was gradually annealed to room temperature to form template double-stranded DNA. 25 μL of a transcription reagent containing 25 mM each of ATP, CTP, GMP, and pseudouridine triphosphate sodium, and 5 mM GTP (0.5 M HEPES-K pH 7.9, 60 mM MgCl2, 150 mM DTT, and 10 mM spermidine) and 100 μg T7 RNA polymerase were added to 400 μL of template double-stranded DNA at a concentration of 500 ng / μL. Transcription was performed overnight at 37°C and 1000 rpm. 10 U DNase I was added, and the mixture was incubated at 37°C and 1000 rpm for 30 minutes to eliminate the DNA template. Add 50 μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol in a 25:24:1 ratio and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes and carefully extract the supernatant. Add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to precipitate the solution. Add the precipitate to a 2 mL 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat centrifugation until all solution passes through the purification column. Add 600 μL of 80% ethanol and centrifuge at 12,000 rpm for 1 minute to wash the column precipitate. Repeat twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove ethanol. Add 120 μL of 1×TE buffer to thoroughly wet the purification column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.

[0286] ④ Purification of circular sense RNA and linear sense and antisense RNA

[0287] Purifying circular positive-strand RNA requires preparing a 1.5 mm thick 5% urea-polyacrylamide gel (13 ml / gel): 8.3 M urea, 0.5 × TBE buffer, 5% acrylamide / methylenebis(methyl)ethylene 19:1, and inserting it into a 10-well sample comb. After solidification at room temperature for 30 minutes, perform pre-electrophoresis at 10 W constant power for 30 minutes in 0.5 × TBE buffer. Before electrophoresis, rinse the sample wells to remove any remaining urea.

[0288] Add an equal volume of 2×RNA loading buffer (containing xylene cyanide) to 120 μL of RNA sample, heat at 70°C for 3 minutes, and place on ice for 5 minutes. Rinse the loading wells to remove urea, load 30 μL of sample into each well, and perform electrophoresis at a constant power of 10 W until the xylene cyanide reaches the bottom of the urea gel. Electrophoresis should be stopped at a constant power of 10 W, which takes about 35 minutes.

[0289] The urea gel was completely scraped off and placed on a thin-layer chromatography silica gel plate covered with transparent plastic wrap. The black band on the top of the urea gel was observed under 254nm UV light using a handheld UV analyzer. The gel corresponding to the band was cut off, placed in a 5ml centrifuge tube, and crushed with a pipette tip. 5ml of sol buffer (0.3M sodium acetate, pH 5.2, 0.1% SDS) was added and vortexed to mix. The mixture was then left to stand overnight at room temperature.

[0290] Aliquot the urea gel suspension into four 1.5ml centrifuge tubes, centrifuge at 12000 rpm for 1 minute, collect the supernatant into a new 1.5ml centrifuge tube, and discard the gel layer. Add 50μL of phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes to fully precipitate impurities. Collect the supernatant into a new 5ml centrifuge tube, add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to the supernatant, precipitate, and transfer 800μL of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat centrifugation until all suspension has been filtered. Add 500μL of 80% ethanol, centrifuge at 12000 rpm for 1 minute, discard the filtrate, and rinse the filter column twice. Centrifuge at 12000 rpm for 3 minutes to remove excess ethanol. Add 20 μL of 1×TE buffer to the filter column and let stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12000 rpm for 1 minute and recover the filtrate. After detecting the RNA concentration with Nanodrop, store at -80℃.

[0291] ⑤ Binding of linear siPcsk9 and cyclic circ-siPcsk9 sense and antisense strands

[0292] Mix equimolar amounts of the circular circ-siPcsk9 sense strand and the linear antisense strand, the linear siPcsk9 sense strand and the linear antisense strand, and add nuclease-free water to make the volume up to 60 μL. After heating at 95 °C for 5 minutes for sufficient denaturation, gradually cool to room temperature to allow the sense strand and the antisense strand to fully complementarily pair and bind. Centrifuge briefly for 10 seconds to collect the liquid at the bottom of the centrifuge tube and store it at 4 °C for use within 24 hours.

[0293] Example 11 Preparation of LNP / circ-siPcsk9 and the effect of LNP / circ-siPcsk9 on lipid metabolism and atherosclerosis in ApoE - / - Experimental study on mice

[0294] ① Preparation and characterization of LNP

[0295] LNP was prepared by mixing P6-Cit-100 (structural formula shown in Figure 14C, where n = 5 - 50), cholesterol, DSPC, and DMG-PEG2000 in a molar ratio of 4.5:31:10:0.4 (mass ratio 16:12:8:1) and dialyzed overnight. LNP was mixed with the circular siPcsk9 prepared in Example 10 at a mass ratio of 10:1 on ice for 30 minutes and kept in the dark for further use.

[0296] The preparation method of P6-Cit-100 can refer to the patent document with the application number CN202310278694.4. Specifically, the method includes the following steps: Weigh 40 mg of PEI600 (structural formula shown in Figure 14B) and 202 mg of citronellyl acrylate (structural formula shown in Figure 14A), heat to 75 °C, and stir and react for 3 days. The product was separated by column chromatography to obtain P6-Cit-100, with a theoretical molecular weight of about 3544.2 and a yield of 39%. The 1H NMR spectrum of P6-CIT-100 is shown in Figure 14D.

[0297] ② Feeding ApoE - / - mice

[0298] Male ApoE - / - mice are all of C57BL6 background and are purchased from Guangdong Medicilon Biotech Co., Ltd. (SCXK(Guangdong)2020 - 0054). Breeding environment: The temperature is controlled at 20 - 26 °C, and the humidity is controlled at 40 - 70%. Animals can freely access water and feed.

[0299] A total of 24 experimental animals were used. After a one-week quarantine, they were introduced into the barrier environment. They were divided into 6 groups according to the experimental purpose: (1) PBS group (n=6): 200 μL PBS; (2) LNP group (n=6): 150 μg LNP; (3) LNP / siPcsk9 group (n=6): 150 μg LNP + 10 μg siPcsk9; (4) LNP / circ-siPcsk9 group (n=6): 150 μg LNP + 15 μg circ-siPcsk9. Each mouse was injected with 200 μL of liquid. After injection, all mice in each group were fed a high-fat diet (40% fat, 20% carbohydrates, 20% protein, 1.25% cholesterol) for 12 weeks, with no restriction on water intake. Weight was measured on the day of injection, and 50 μL of blood was collected from the orbital cavity at weeks 2, 4, 8 and 12 after injection. After euthanizing the mice in week 12, liver, heart, kidney, and aortic tissues were harvested for further experiments.

[0300] ③ Enzyme-linked immunosorbent assay (ELISA) was used to detect the concentration of PCSK9 in mouse serum.

[0301] (1) Allow the PCSK9 ELISA kit to warm to room temperature for 15 minutes;

[0302] (2) Add 100 μL of PCSK9 standard (0.00 ng / ml, 1.56 ng / ml, 3.13 ng / ml, 6.25 ng / ml, 12.50 ng / ml, 25.00 ng / ml, 50.00 ng / ml and 100.00 ng / ml) and 95 μL of universal diluent + 5 μL of serum to the ELISA microplate, mix gently, seal with sealing film and incubate at 37°C for 1 hour;

[0303] (3) Discard the liquid, add 100 μL of biotinylated antibody working solution to each well, mix gently, seal the plate with sealing film, and incubate at 37°C for 1 hour.

[0304] (4) Discard the liquid in the microplate, add 300 μL of 1× washing solution to each well, let stand for 1 minute and then discard, pat dry and repeat 3 times;

[0305] (5) Add 100 μL of enzyme conjugate working solution to each well, mix gently, seal with sealing film and incubate at 37°C for 30 minutes.

[0306] (6) Discard and shake off the liquid in the microplate, fill each well with 1× washing solution, let stand for 30 seconds and then discard, repeat 5 times and pat dry;

[0307] (7) Add 90 μL of TMB substrate to each well, gently shake to mix, seal with sealing film and incubate at 37°C for 15 minutes;

[0308] (8) Add 50 μL of stop solution to each well and measure the absorbance (OD450) of each well at a wavelength of 450 nm using a multi-functional microplate reader. The measurement should be performed within 15 minutes after adding the stop solution.

[0309] (9) Calculate the difference between the OD values ​​of the standard and serum samples and the OD values ​​of the blank wells as the correction values. Plot the concentration on the x-axis and the correction values ​​on the y-axis, and fit a standard curve and equation using ELISA Calc software (v 0.2). Substitute the serum correction values ​​and multiply the results by 20 to calculate the pcsk9 concentration in the serum samples.

[0310] ④ Serum LDL-C concentration measurement

[0311] (1) Add 2.5 μL of serum sample or 2.5 μL of LDL-C standard (4.10 mmol / L) or 2.5 μL of ultrapure water to each well of a 96-well plate;

[0312] (2) Add 180 μL of reagent 1 to each well, incubate at 37°C for 5 minutes, and measure the absorbance OD1 at 600 nm using a multi-functional microplate reader;

[0313] (3) Add 60 μL of reagent 2 to each well, incubate at 37°C for 5 minutes, and measure the absorbance OD2 at 600 nm using a multi-functional microplate reader;

[0314] (4) Calculate the correction value ΔOD = OD2 - OD1. Serum LDL-C concentration = [(serum ΔOD - ultrapure water ΔOD) / (standard ΔOD - ultrapure water ΔOD)] × 4.10 mmol / L.

[0315] ⑤ Gross Oil Red O staining of the aorta and analysis of plaque area

[0316] (1) Take out the entire aorta of a mouse fixed with 4% paraformaldehyde for 24 hours and wash it twice with PBS;

[0317] (2) Carefully cut the blood vessel longitudinally along the vessel wall with dissecting scissors and rinse with tap water for 5 seconds;

[0318] (3) Immerse the blood vessel in 60% isopropanol for 3 seconds, then immerse it in Oil Red O staining solution and stain at 37°C in the dark for 1 hour.

[0319] (4) Immerse the blood vessel in 60% isopropanol to differentiate until the fatty plaque in the lumen turns bright red, and wash with ultrapure water to terminate the differentiation.

[0320] (5) Use filter paper to absorb excess water, keep the ruler length and the shooting height unchanged, and the camera captures the image;

[0321] (6) ImageJ calculates the total area of ​​the aorta and the area of ​​the plaque portion when the saturation is 0 and 70 in Color Threshold, respectively, and calculates the percentage of the total area of ​​the aorta occupied by the plaque.

[0322] Under dynamic light scattering detection, the LNP particle size was mainly distributed at 78.88 nm. After LNP encapsulated linear siPcsk9, the particle size increased to 204.91 nm, while after LNP encapsulated circ-siPcsk9, the particle size increased to 602.42 nm (Figure 15). This indicates that LNP successfully encapsulated siRNA and caused an increase in particle size.

[0323] The average potential of the LNP was 25.33 MV. After LNP encapsulated linear siPcsk9, the potential decreased to 0.352 mV, while after LNP encapsulated circ-siPcsk9, the particle size decreased to -0.539 mV, indicating that the positively charged LNP can effectively encapsulate the negatively charged siRNA (Figure 16). This demonstrates that the cationic lipid-containing LNP successfully encapsulated the negatively charged siRNA.

[0324] Under negative staining electron microscopy, LNP, LNP / siPcsk9, and LNP / circ-siPcsk9 were found to be spherical with uniform particle size distribution (Fig. 17).

[0325] LNP / circ-siPcsk9 can reduce ApoE levels in patients on a high-fat diet. - / - The PCSK9 level in mice remained the lowest among the four groups, and decreased by 27% compared to the LNP group with the highest level at week 8. In contrast, the LNP / siPcsk9 level decreased by only 9% compared to the LNP group with the highest level (Figure 18).

[0326] LNP / circ-siPcsk9 can reduce ApoE levels in patients on a high-fat diet. - / - The mice maintained the lowest LDL-C levels among the four groups, and at week 8, the levels were 70% lower than those in the PBS group, which had the highest levels. In contrast, the LNP / siPcsk9 levels were only 42% lower than those in the LNP group, which had the highest levels (Figure 19).

[0327] Gross Oil Red O staining of the aorta showed that LNP / circ-siPcsk9 significantly reduced ApoE after 12 weeks of high-fat diet. - / - The number of aortic plaques in mice was reduced, while LNP / siPcsk9 decreased ApoE levels after 12 weeks of high-fat diet. - / - The aortic plaque burden effect in mice was weaker than that of LNP / circ-siPcsk9 (Figure 20).

[0328] Example 12: Delivery of circ-siPcsk9 using lipid nanoparticles

[0329] Nine female C57BL / 6 mice fed with normal diet for 12 weeks were divided into three groups: (1) PBS group (n=3): 200 μL PBS; (2) naked circ-siPcsk9 group (n=3): 15 μg circ-siPcsk9; (3) LNP / siPcsk9 group (n=3): 150 μg LNP + 15 μg circ-siPcsk9 (the mass ratio of cyclic sense strand to linear antisense strand was 2:1, and the molar ratio was 1:4). LNP was prepared by mixing ALC-0315, cholesterol, DSPC and DMG-PEG in a molar ratio of 50:38:10:1.5, and then mixing it with / C-4×-siPcsk9 in a mass ratio of 10:1. The antisense sequence of mouse PCSK9 is 5'GGCCTCAATCCAATCACCACGACG3' (SEQ ID NO.41), and the sense sequence is 5'GTGGTGATTGGATTGAGGCCA3' (SEQ ID NO.42). Each mouse was injected with 200 μL of fluid. All mice were fed a standard diet. Blood samples of 50 μL were collected from the orbital sinus on the day of injection and at weeks 2, 4, 8, and 12 post-injection. The blood samples were centrifuged at 5500 rpm for 15 minutes, and mouse serum was collected and stored at -80℃. Serum PCSK9 levels were measured using a mouse PCSK9 ELISA kit according to the manufacturer's instructions. Serum LDLR was measured using an LDL-C assay kit. Serum ALT and creatinine levels were measured at week 12 using an alanine aminotransferase (ALT) and creatinine assay kit.

[0330] Following LNP / circ-siPcsk9 injection, serum PCSK9 levels in C57BL6 mice consistently decreased for the first four weeks, showing a significant reduction of 52% at week 2 compared to the naked 15 μg circ-siPcsk9 group and the PBS group. Serum PCSK9 levels consistently increased across all three groups from weeks 8 to 12, with no significant differences among the three groups. LDL-C levels in C57BL6 mice consistently decreased after LNP / circ-siPcsk9 injection, while the other two groups showed no significant changes. From weeks 8 to 12, the LDL-C level in the LNP / circ-siPcsk9 group was significantly lower than the other two groups, reaching a maximum of 85% (Figure 21). At week 12, there were no significant differences in serum ALT and creatinine levels among the three groups (Figure 22). This indicates that LNP / circ-siPcsk9 can effectively reduce LDL-C levels in C57BL6 mice without significant hepatotoxicity or nephrotoxicity.

[0331] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A pharmaceutical composition comprising a circular RNA and a drug delivery vector, wherein the circular RNA comprises two or more RNA sense strand sequences connected in series, and any two adjacent RNA sense strand sequences in the RNA sense strand sequences are separated by at least one spacer sequence.

2. The pharmaceutical composition of claim 1, wherein the drug delivery vehicle is selected from one or more of nanosuspensions, nanoparticles, micelles, liposomes, nanoemulsions, lipid nanoparticles, and in situ gels, preferably nanoparticles, and further preferably, the nanoparticles are selected from lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polyplexes, or biodegradable polymer nanoparticles.

3. The pharmaceutical composition of claim 1, wherein the circular RNA is combined with a drug delivery carrier, and the combination includes filling, embedding, coating, covalent conjugation or non-covalent conjugation.

4. The pharmaceutical composition of claim 1, wherein the drug delivery vehicle is selected from lipid nanoparticles, the lipid nanoparticles comprising: 1) cationic lipids or lipid polymers, 2) non-cationic lipids, 3) PEG-modified lipids, and 4) sterols; Preferably, in the lipid nanoparticles, the molar ratio of cationic lipid:sterol:non-cationic lipid:PEG-modified lipid is (25-100):(20-80):(5-20):(0.4-5), preferably 50:38:10:1.5; Alternatively, preferably, in the lipid nanoparticles, the molar ratio of lipid polymer:sterol:non-cationic lipid:PEG-modified lipid is (1-20):(20-80):(5-20):(0.2-5), preferably 4.5:31:10:0.

4.

5. The pharmaceutical composition of claim 4, wherein the cationic lipid is selected from the group consisting of: ALC-0315, N,N-dioleoyl-N,N-dimethylammonium chloride, N,N-distearoyl-N,N-dimethylammonium bromide, 1,2-dioleoyltrimethylammonium chloride propane, C12-200, DLin-KC2-DMA, DODAP, or HGT4003; and / or, The sterol is selected from the group consisting of cholesterol, lanosterol, 5α-cholestane-3β-ol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid or α-tocopherol; and / or, The non-cationic lipid comprises a neutral lipid and is selected from distearoylphosphatidylcholine, dioleoylphosphatidylcholine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, dioleoylphosphatidylethanolamine, palmitoyloleoylphosphatidylcholine, palmitoyloleoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate, dipalmitoylphosphatidylethanolamine, or dimyristoylphosphatidylethanolamine; and / or, The PEG-modified lipid is selected from DSPE-PEG or DMG-PEG; and / or, The lipid polymer is obtained by reacting a compound of formula (I) or polyethyleneimine with a compound of formula (II). The compound of formula (II) is selected from:

6. The pharmaceutical composition of claim 4, wherein the lipopolymer is P6-Cit-100, which is obtained by reacting polyethyleneimine and citronellol acrylate, preferably, the polyethyleneimine is a branched polyethyleneimine.

7. The pharmaceutical composition of claim 6, wherein the molecular weight of the branched polyethyleneimine is 300-10000, preferably 400-2000, more preferably 500-1800, more preferably 500-700, more preferably 600.

8. The pharmaceutical composition according to claim 5, characterized in that The reaction feed ratio of the compound of formula (I) or polyethyleneimine and the compound of formula (II) is 40 mg:0.4-1.8 mmoL, preferably 40 mg:0.7-1.5 mmoL, more preferably 40 mg:0.8-0.9 mmoL, or 40 mg:1.3-1.4 mmoL.

9. The pharmaceutical composition of claim 1, wherein the lipid nanoparticles comprise: (1) C12-200, DOPE, cholesterol, DMG-PEG; or (2) ALC-0315, cholesterol, DSPC, and DMG-PEG; or (3) P6-Cit-100, cholesterol, DSPC, and DMG-PEG.

10. The pharmaceutical composition of claim 1, wherein the mass ratio of the drug delivery vector to the circular RNA is selected from 5:1 to 20:1, more preferably 10:

1.

11. The pharmaceutical composition of claim 1, wherein the circular RNA anneals with at least one linear antisense strand to form a circular siRNA, preferably, the molar ratio of the linear antisense strand to the circular RNA in the composition is selected from 1:1 to 8:

1.

12. The pharmaceutical composition of claim 11, wherein the sense strand sequence has a length of 18 to 24 nucleotides, for example, 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides, and / or the linear antisense strand has a length of 21 to 27 nucleotides, for example, 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides; Preferably, the positive sense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 6 or 42, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto, and / or the linear antisense strand sequence comprises an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO. 36 or 41, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

13. The pharmaceutical composition of claim 11, wherein the circular RNA and / or the at least one linear antisense strand sequence comprises at least one nucleotide modification and / or at least one chemical modification.

14. The pharmaceutical composition of claim 1, wherein the circular RNA further comprises a 5' exonic element and a 3' exonic element, wherein the 5' exonic element and the 3' exonic element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from Anabaena group I introns, T4 phage group I introns, or Azotobacter sp. BH72 group I introns.

15. The pharmaceutical composition of claim 1, wherein the circular RNA is derived from a nucleic acid construct comprising, in the following order from 5' to 3' direction, a first cyclization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence, and a second cyclization element, wherein the RNA sense strand sequence can be transcribed from the target sequence.

16. The pharmaceutical composition of claim 15, wherein the first circularization element comprises, in sequence, a 5' intronic element and a 5' exonic element, and the second circularization element comprises, in sequence, a 3' exonic element and a 3' intronic element; Preferably, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, in particular, the 5' intron element is derived from or contains the 5' terminal part of the self-splicing intron, and the 3' intron element is derived from or contains the 3' terminal part of the self-splicing intron. terminal part; Also preferably, the 5' intron element comprises a first portion of a group I intron from Anabaena and the 3' intron element comprises a second portion of a group I intron from Anabaena, or The 5' intron element comprises a first portion from a class I intron of bacteriophage T4, and the 3' intron element comprises a second portion from a class I intron of bacteriophage T4, or The 5' intronic element includes a first portion of a group I intron from Azotobacter sp. BH72, and the 3' intronic element includes a second portion of a group I intron from Azotobacter sp. BH72.

17. The pharmaceutical composition of claim 16, wherein the 5' intronic element comprises the sequence of SEQ ID NO. 4, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 5' exonic element comprises the sequence of SEQ ID NO. 5, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' intronic element comprises the sequence of SEQ ID NO. 13, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' exonic element comprises the sequence of SEQ ID NO. 12, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.

18. The pharmaceutical composition of claim 15, wherein the first restriction enzyme recognition sequence is identical to or different from the second restriction enzyme recognition sequence, and at least one of the first and second restriction enzyme recognition sequences is selected from the group consisting of the recognition sequences of the following restriction endonucleases: Spe I, Age I, Hind III, Bgl II, Kpn I, Xho I, Sac II, Not I, BamH I, or Xba I; Preferably, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the group consisting of: ACTAGT, ACCGGT, AAGCTT, AGATCT, GGTACC, CTCGAG, CCGCGG, GCGGCCGC, GGATCC, and TCTAGA.

19. The pharmaceutical composition of claim 1, wherein the spacer sequence comprises an RNA sequence corresponding to any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.

20. A method for inhibiting the expression of a disease-related protein in a cell, the method comprising: The cell is contacted with the pharmaceutical composition according to any one of claims 1 to 19 and maintained for a period of time, thereby inhibiting the expression of disease-related proteins in the cell.

21. The method of claim 20, wherein the cell is in a subject; Preferably, the expression of the disease-associated protein in the cell is inhibited by at least about 50%.

22. Use of the pharmaceutical composition according to any one of claims 1 to 19 in the preparation of a medicament for treating a disease in a subject; Preferably, the drug mediates the degradation of mRNA of a disease-related protein. Also preferably, the disease-related protein is selected from PCSK9, APOC3, ANGPTL4, LPA, ATN1 protein, ataxia protein, huntingtin protein, BACE1, Also preferably, the medicament is for treating a subject suffering from a disorder mediated by PCSK9 expression.

23. The use of claim 22, wherein the disorder comprises hypercholesterolemia, atherosclerosis, hypertriglyceridemia, familial hypercholesterolemia, fatty liver disease, dyslipidemia, hyperlipoproteinemia, atherosclerosis, diabetes and its complications, metabolic syndrome, cardiovascular disease, or elevated cholesterol caused by genetic conditions.

24. The use of claim 22, wherein the subject comprises a mammal; Preferably, the mammal comprises a primate or a rodent; Preferably, the primate includes humans, orangutans or monkeys; Preferably, the rodent comprises a rat, a mouse, a guinea pig, a hamster or a vole.

25. The use according to claim 22, wherein the pharmaceutical composition has one or more of the following effects: 1) Reduce the expression level of PCSK9 gene; 2) mediate the degradation of PCSK9 protein mRNA; 3) Increase LDLR protein levels; 4) Lowering LDL-C levels; 5) reduce aortic plaque burden; 6) No obvious hepatotoxicity or renal toxicity; 7) Has low immunogenicity.

26. The use according to claim 22, wherein the administration of the drug comprises systemic administration and / or local administration.

Citation Information

Patent Citations

  • Polyethyleneimine modified with acrylamide monomers, preparation method and application in gene delivery

    CN101704949A

  • Covalent hydrophobically modified polyethyleneimine, preparation method and application thereof

    CN104109241A

  • siRNA for inhibiting expression of human PCSK9 gene and application thereof

    CN111154760A

  • Compositions comprising circular polyribonucleotides and uses thereof

    CN111819185A

  • Circular RNA for translation in eukaryotic cells

    CN112399860A

Cited By

  • Combinations of antisense agents, pharmaceutical compositions and methods of use

    WO2026133250A1

  • Combinations of antisense agents, pharmaceutical compositions and methods of use

    WO2026133251A1

  • Combinations of antisense agents, pharmaceutical compositions and methods of use

    WO2026133253A1