Genetically modified non-human animal with human or chimeric MMP-7

Genetically modified animals expressing human or chimeric MMP-7 provide a more accurate model for drug development, addressing the limitations of traditional animal models by enhancing drug screening and evaluation efficiency and reducing costs.

WO2025176195A1PCT designated stage Publication Date: 2025-08-28BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/078540
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-23
Filing Date
2025-02-21
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Traditional drug research and development methods using in vitro and in vivo animal models fail to replicate the complex biological environment of human diseases, leading to high failure rates and discrepancies between animal test results and clinical trials.

Method used

Development of genetically modified non-human animals expressing human or chimeric MMP-7, which can be used to create animal models that mimic human biological environments, enabling more accurate drug screening and evaluation.

Benefits of technology

These animal models enhance the efficiency and reduce the cost of drug development by providing a more reliable platform for studying MMP-7-related diseases and evaluating therapeutic agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025078540_28082025_PF_FP_ABST
    Figure CN2025078540_28082025_PF_FP_ABST
Patent Text Reader

Abstract

It relates to genetically modified non-human animals that express a human or chimeric (e.g., humanized)MMP-7, and methods of use thereof.
Need to check novelty before this filing date? Find Prior Art

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC MMP-7

[0001] CLAIM OF PRIORITY

[0002] This application claims the benefit of Chinese Patent Application App. No. 202410202235.2, filed on February 23, 2024. The entire contents of the foregoing applications are incorporated herein by reference.TECHNICAL FIELD

[0003] This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) matrix metalloproteinase-7 (MMP-7) and methods of use thereof.BACKGROUND

[0004] The traditional drug research and development typically use in vitro screening approaches. However, these screening approaches cannot provide the complex biological environment (such as tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interaction, etc. ) , resulting in a higher rate of failure in drug development. In addition, in view of the differences between humans and animals, the test results obtained from the use of conventional experimental animals for in vivo pharmacological test may not reflect the real disease state and the interaction at the targeting sites, resulting in that the results in many clinical trials are significantly different from the animal experimental results.

[0005] Therefore, the development of humanized animal models that are suitable for human antibody and / or drug screening and evaluation will significantly improve the efficiency of new drug development and reduce the cost for drug research and development.SUMMARY

[0006] This disclosure is related to an animal model with human matrix metalloproteinase-7 (MMP-7) or chimeric MMP-7. The animal model can express human MMP-7 or chimeric MMP-7 (e.g., humanized MMP-7) protein in its body. It can be used in the studies on the function of MMP-7 gene, and can be used in the screening and evaluation of anti-human MMP-7 antibodies or drugs targeting MMP-7. In addition, the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamic studies, treatment of immune-related diseases, and treatment of diseases targeting human MMP-7. These disclosed animal models can also be used to facilitate the development and design of new drugs, and save time and cost. In summary, this disclosure provides a powerful tool for studying the function of MMP-7 protein and a platform for screening drugs, e.g., anti-cancer drugs, anti-inflammation drugs, or anti-immune disorder (e.g., autoimmune disease) drugs.

[0007] In one aspect, the disclosure is related to genetically-modified, non-human animals whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric matrix metalloproteinase-7 (MMP-7) . In some embodiments, the sequence encoding the human or chimeric MMP-7 is operably linked to an endogenous regulatory element (e.g., endogenous promoter and / or endogenous 5’ -UTR) at an endogenous MMP-7 gene locus in the at least one chromosome. In some embodiments, the sequence encoding the human or chimeric MMP-7 is operably linked to a human or chimeric regulatory element at an endogenous MMP-7 gene locus in the at least one chromosome. In some embodiments, the sequence encoding the human or chimeric MMP-7 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) . In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous MMP-7 or expresses a decreased level of endogenous MMP-7 as compared to MMP-7 expression level in a wild-type animal. In some embodiments, the animal has one or more cells expressing human or chimeric MMP-7.

[0008] In one aspect, the disclosure is related to genetically-modified, non-human animals, wherein the genome of the animal includes a replacement of a sequence encoding a region of an endogenous MMP-7 with a sequence encoding a corresponding region of a human MMP-7 at an endogenous MMP-7 gene locus. In some embodiments, the sequence encoding a corresponding region of the human MMP-7 is operably linked to an endogenous, a human, or a chimeric regulatory element at the endogenous MMP-7 locus, and one or more cells of the animal expresses a human or chimeric MMP-7. In some embodiments, the animal does not express the endogenous MMP-7 or expresses a decreased level of the endogenous MMP-7 as compared to the MMP-7 expression level in a wild-type animal. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4,exon 5, exon 6, or a portion thereof, of a human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5. In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a portion thereof, of the endogenous MMP-7 gene. In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide. In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide. In some embodiments, the animal is a mouse. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous MMP-7 gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous MMP-7 gene locus.

[0009] In one aspect, the disclosure is also related to non-human animals including one or more cells containing a nucleotide sequence encoding a human or chimeric MMP-7 polypeptide, wherein the human or chimeric MMP-7 polypeptide comprises at least 50, 100, 150, 200, 250, 260, or 267 contiguous amino acid residues that are identical to a corresponding contiguous amino acid sequence of a human MMP-7 polypeptide, wherein the animal expresses the human or chimeric MMP-7 polypeptide. In some embodiments, the nucleotide sequence encoding the human or chimeric MMP-7 polypeptide is operably linked to an endogenous regulatory element of the animal, a human regulatory element, or a chimeric regulatory element. In some embodiments, the nucleotide sequence encoding the human or chimeric MMP-7 polypeptide is integrated to an endogenous MMP-7 gene locus of the animal. In some embodiments, the animal is a mouse, wherein the human or chimeric MMP-7 polypeptide has at least one mouse MMP-7 activity and / or at least one human MMP-7 activity.

[0010] The disclosure further relates to methods for making a genetically-modified, non-human animal, including replacing a sequence encoding a region of an endogenous MMP-7 with a sequence encoding a corresponding region of a human MMP-7, at an endogenous MMP-7 gene locus, in at least one cell of the animal. In some embodiments, the animal does not express the endogenous MMP-7 or expresses a decreased level of endogenous MMP-7 as compared to MMP-7 expression level in a wild-type animal. In some embodiments, the sequence encoding a corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of a human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) . In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the region of endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide. In some embodiments, the sequence encoding the corresponding region of human MMP-7 is operably linked to an endogenous regulatory element, e.g., a promoter and / or 5’ -UTR. In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. In some embodiments, the animal is heterozygous or homozygous with respect to the replacement at the endogenous MMP-7 gene locus.

[0011] The disclosure further relates to methods of making a genetically-modified animal cell that expresses a human or chimeric MMP-7, the method including replacing a nucleotide sequence encoding a region of an endogenous MMP-7, at an endogenous MMP-7 gene locus, with a nucleotide sequence encoding a corresponding region of a human MMP-7, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the human or chimeric MMP-7, wherein the animal cell expresses the human or chimeric MMP-7. In some embodiments, the sequence encoding a corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of a human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5. In some embodiments, the sequence encoding the corresponding region of the human MMP-7 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to the human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) . In some embodiments, the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene. In some embodiments, the sequence encoding the region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide. In some embodiments, the sequence encoding the human or chimeric MMP-7 polypeptide is operably linked to an endogenous regulatory element, e.g., a promoter and / or 5’ -UTR. In some embodiments, the animal is a mouse. In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is one or more selected from the group consisting of inducible T-cell costimulator (ICOS) , Natural Killer Cell Protein 46 (NKP46) , Transferrin Receptor 1 (TFR1) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3(B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) . In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is one or more selected from the group consisting of ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0012] The disclosure further relates to methods of determining effectiveness of a therapeutic agent for the treatment of cancer, including a) administering the therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects of the therapeutic agent to the tumor. In some embodiments, the therapeutic agent is an anti-MMP-7 antibody (e.g., an anti-human MMP-7 antibody) . In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, determining inhibitory effects of the anti-MMP-7 antibody to the tumor involves measuring the tumor volume in the animal. In some embodiments, the cancer is colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.

[0013] The disclosure further relates to methods of determining effectiveness of an anti-MMP-7 antibody and an additional therapeutic agent for the treatment of cancer, including a) administering the anti-MMP-7 antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has a tumor; and b) determining inhibitory effects on the tumor. In some embodiments, the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express PD-L1. In some embodiments, the tumor comprises one or more tumor cells that are injected into the animal. In some embodiments, determining inhibitory effects of the treatment involves measuring the tumor volume in the animal. In some embodiments, the animal has colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.

[0014] The disclosure further relates to methods of determining effectiveness of a therapeutic agent for treatment an immune disorder (e.g., an autoimmune disease) , including a) administering the therapeutic agent to the animal as described herein, wherein the animal has the immune disorder; and b) determining effects of the therapeutic agent to the immune disorder. In some embodiments, the immune disorder (e.g., an autoimmune disease) comprises idiopathic pulmonary fibrosis (IPF) , asthma, rheumatoid arthritis (RA) , or multiple sclerosis (MS) .

[0015] The disclosure further relates to methods of determining effectiveness of a therapeutic agent for reducing an inflammation, including a) administering the therapeutic agent to the animal as described herein, wherein the animal has the inflammation; and b) determining effects of the therapeutic agent to the inflammation. In some embodiments, the inflammation comprises arthritis or inflammatory bowel disease (IBD) .

[0016] The disclosure further relates to methods of determining toxicity of a therapeutic agent including (a) administering the therapeutic agent as described herein; and (b) determining effects of the therapeutic agent to the animal. In some embodiments, the therapeutic agent is an anti-MMP-7 antibody. In some embodiments, determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.

[0017] The disclosure further relates to proteins comprising an amino acid sequence, wherein the amino acid sequence is one of the following: (a) an amino acid sequence set forth in SEQ ID NO: 1 or 2; (b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1 or 2; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1 or 2; (d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1 or 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or (e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1 or 2.

[0018] The disclosure further relates to nucleic acids including a nucleotide sequence, wherein the nucleotide sequence is one of the following: (a) a sequence that encodes the protein as described herein; (b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19; (c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19; or (d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19.

[0019] The disclosure further relates to cells including the protein as described herein and / or the nucleic acid as described herein.

[0020] The disclosure further relates to animals including the protein as described herein and / or the nucleic acid as described herein.

[0021] The disclosure further relates to method of determining effectiveness of a therapeutic agent for the treatment of an MMP-7-related disorder, including (a) administering the therapeutic agent to the animal as described herein, wherein the animal has the MMP-7-related disorder; and (b)determining therapeutic effects of the therapeutic agent to the MMP-7-related disorder, wherein the MMP-7-related disorder is a cancer (e.g., colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., idiopathic pulmonary fibrosis, asthma, rheumatoid arthritis, or multiple sclerosis) , an inflammation (e.g., arthritis or inflammatory bowel disease) , or a kidney disease (e.g., acute kidney injury (AKI) and chronic kidney disease (CKD) ) . In some embodiments, the therapeutic agent is an MMP-7-targeting agent. In some embodiments, the MMP-7-targeting agent is an anti-MMP-7 antibody (e.g., an anti-human MMP-7 antibody) . In some embodiments, the MMP-7-targeting agent is an MMP-7-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) .

[0022] The disclosure further relates to methods of determining effectiveness of an anti-MMP-7 antibody and an additional therapeutic agent for the treatment of an MMP-7-related disorder, including (a) administering the anti-MMP-7 antibody and the additional therapeutic agent to the animal as described herein, wherein the animal has the MMP-7-related disorder; and (b) determining inhibitory effects on the MMP-7-related disorder, wherein the MMP-7-related disorder is a cancer (e.g., colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., idiopathic pulmonary fibrosis, asthma, rheumatoid arthritis, or multiple sclerosis) , an inflammation (e.g., arthritis or inflammatory bowel disease) , or a kidney disease (e.g., acute kidney injury (AKI) and chronic kidney disease (CKD) ) . In some embodiments, the animal further comprises a sequence encoding inducible T-cell costimulator (ICOS) , Natural Killer Cell Protein 46 (NKP46) , Transferrin Receptor 1 (TFR1) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , or any combination thereof. In some embodiments, the additional therapeutic agent is an antibody (e.g., an anti-human antibody) that binds to ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4, or any combination thereof. In some embodiments, the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4, or any combination thereof.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0024] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.DESCRIPTION OF DRAWINGS

[0025] FIG. 1 is a schematic diagram showing mouse and human MMP-7 gene loci (not to scale) .

[0026] FIG. 2 is a schematic diagram showing an exemplary MMP-7 gene targeting strategy with an exemplary targeting vector V1 design (not to scale) .

[0027] FIG. 3 is a schematic diagram showing an exemplary MMP-7 gene targeting strategy with an exemplary targeting vector V2 design (not to scale) .

[0028] FIG. 4 shows the Southern blot identification results of F1 generation MMP-7 gene humanized mice. WT is the wild-type control.

[0029] FIGs. 5A-5B show ELISA detection results of mouse MMP-7 (FIG. 5A) and human MMP-7 (FIG. 5B) expression levels. + / +represents wild-type C57BL / 6 mice, while H / +represents MMP-7 gene humanized heterozygous mice.

[0030] FIGs. 6A-6B show ELISA detection results of mouse MMP-7 (FIG. 6A) and human MMP-7 (FIG. 6B) expression levels. + / +represents wild-type C57BL / 6 mice, while H / H represents MMP-7 gene humanized homozygous mice.

[0031] FIG. 7A shows the alignment between human MMP-7 amino acid sequence (NP_002414.1; SEQ ID NO: 2) and mouse MMP-7 amino acid sequence (NP_034940.3; SEQ ID NO: 1) .

[0032] FIG. 7B shows the alignment between human MMP-7 amino acid sequence (NP_002414.1; SEQ ID NO: 2) and rat MMP-7 amino acid sequence (NP_036996.1; SEQ ID NO: 28) .DETAILED DESCRIPTION

[0033] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) matrix metalloproteinase-7 (MMP-7) , and methods of use thereof. The described transgenic non-human animal can express human or chimeric MMP-7 (e.g., humanized MMP-7) protein. It can be used for studying the function of the MMP-7 gene and for screening and evaluating MMP-7 pathway modulators (e.g., anti-human MMP-7 antibodies, oligonucleotide drugs, and / or peptide drugs) . Additionally, the animal model prepared by the methods described herein can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and treatment of diseases targeting human MMP-7 sites. The model described herein can also be used to promote new drug development and design, saving time and costs.

[0034] Experimental animal models are an indispensable research tool for studying the effects of therapeutic agents targeting MMP-7 (e.g., anti-MMP-7 antibodies) . With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening using animal models.

[0035] Matrix Metalloproteinase-7 (MMP-7)

[0036] Matrix metalloproteinase (MMP) family includes more than 20 zinc-dependent endopeptidases that can degrade almost all extracellular matrix (ECM) macromolecules in tissues, connective tissues, basement membrane, and matrix, and contribute to their turnover and remodeling. Furthermore, MMPs can also cleave many non-ECM substrates and are overexpressed in many cancer tissues, making them a critical player in a wide variety of physiologic and pathologic processes, such as cell proliferation and apoptosis, endothelial cell function, inflammation, and tumor metastasis, and invasion. Typically, MMPs have a common core structure containing a propeptide of about 80 amino acids, a catalytic metalloproteinase domain of about 170 amino acids, a linker peptide (hinge region) of variable length, and a hemopexin domain of about 200 amino acids. The C-terminal hemopexin domain is involved in substrate specificity and interaction with tissue inhibitors of metalloproteinases (TIMPs) .

[0037] Matrix metalloproteinase-7 (MMP-7) , also known as matrilysin, matrilysin-1, pump-1 protease (PUMP-1) , or uterine metalloproteinase, is one of the smallest secreted proteases of the MMP family, with a molecular weight about 30 KDa. The structure of MMP-7 is quite distinctive among MMP family. MMP-7 is a zinc-and calcium-dependent endopeptidase, which is bounded by four metal ions including a catalytic zinc ion, a structural zinc ion, and two calcium ions. The catalytic zinc ion binds to three His residues in tetracoordination. The calcium ion binding plays an important role in stabilizing the secondary structure. MMP-7 structurally differs from other MMPs in that it lacks a C-terminal hemopexin domain, or it does not have a well-defined hinge region.

[0038] MMP-7 protein consists primarily of, from N-terminus to C-terminus, a signal peptide, apropeptide region, and a chain region. The signal peptide, at the N-terminus (beginning) of the protein, directs the newly synthesized protein to extracellular space where it can perform its function. The signal peptide can be cleaved off once the protein reaches its destination. Following the signal peptide, but before the mature protein sequence, there is propeptide region that is an inhibitory segment that keeps the enzyme in an inactive form. The propeptide of MMP-7 contains a conserved cysteine residue that binds to the catalytic zinc ion, inhibiting the enzyme until it is cleaved. The chain region is the main body of the protein after the signal peptide and propeptide regions have been removed. The chain region includes the catalytic domain and any other functional domains.

[0039] The expression of MMP-7 is regulated by the Wnt / βcatenin signaling pathway, and mediated by transformation growth factorβ (TGF-β) . MMP-7 are commonly expressed in epithelial cells including ductal epithelium of exocrine glands in skin, salivary glands, pancreas, glandular epithelium of intestine and reproductive organ, liver, and breast. In addition, MMP-7 is highly expressed in the luminal surface of dysplastic glands in human colorectal cancers. MMP-7is initially synthesized as an inactive proenzyme called proMMP-7.

[0040] MMP-7 degrades various ECM substrates and cleaves non-ECM proteins, such as nephrin, E-cadherin, Fas ligand (FasL) , pro-MMP-2, and pro-MMP-9. Thus, MMP-7 plays important roles in regulating a diverse array of biological processes including aging, wound healing, bone growth and remodeling, and signaling pathways that control cell growth, apoptosis, epithelial to mesenchymal transition (EMT) , inflammation, and angiogenesis. In addition, MMP-7 plays a crucial role in various diseases due to its ability to degrade extracellular matrix components and influence cellular processes. MMP-7 is specifically expressed in human multisystem tumors such as digestive, urinary, and reproductive system tumors. In cancer, MMP-7 facilitates tumor invasion and metastasis by breaking down the extracellular matrix and cleaving cell surface proteins, promoting the adhesion of cancer cells. MMP-7 expression is increased in several inflammatory conditions, such as idiopathic pulmonary fibrosis (IPF) and inflammatory bowel diseases (IBD) (e.g., Crohn's disease or ulcerative colitis (UC) ) , contributing to disease progression by promoting fibrosis and intestinal barrier dysfunction. Inflammatory cytokines such as IL-1β, IL-4, IL-13, and TNFαcan enhance MMP-7 expression in various cell types, including colonic epithelial cells and macrophages. Inflammation is exacerbated by MMP-7 through its pro-inflammatory effects and degradation of tight junction proteins, increasing tissue permeability. MMP-7 is barely expressed in normal adult kidney but upregulated in acute kidney injury (AKI) and chronic kidney disease (CKD) , where it plays roles in fibrosis and tissue regeneration. These diverse roles make MMP-7 a significant target for therapeutic interventions across various pathological conditions.

[0041] A detailed description of MMP-7 and its function can be found, e.g., in Liu Z., et al. “The Many Faces of Matrix Metalloproteinase-7 in Kidney Diseases. ” Biomolecules. 2020 Jun 25.10 (6) : 960; Liao H., et al. “Roles of matrix metalloproteinase-7 (MMP-7) in cancer. ” Clinical Biochemistry. 2021.92: 9-18; Xiao Y., et al. “Matrix metalloproteinase 7 contributes to intestinal barrier dysfunction by degrading tight junction protein Claudin-7. ” Front Immunol. 2022 Oct 4. 13; Vandenbroucke., et al. “Pro-inflammatory effects of matrix metalloproteinase 7 in acute inflammation. ” Mucosal Immunology. 2014.7 (3) : 579-588; and Khan F. A., et al. “A systematic review of blood biomarkers with individual participant data meta-analysis of matrix metalloproteinase-7 in idiopathic pulmonary fibrosis. ” European Respiratory Journal. 2022 59(4) : 2101612; each of which is incorporated by reference in its entirety.

[0042] In human genome, human MMP-7 gene (NCBI Gene ID: 4316, UniPro ID: P09237) is in Chromosome 11 of the human genome, which is located at NC_000011.10 from the position 102520508 to the position 102530747 (GRCh38. p14 (GCF_000001405.40) ) . Human MMP-7 gene (Gene ID: 4316) locus has six exons, exon 1, exon 2, exon 3, exon 4, exon 5, and exon 6. The human MMP-7 protein also has, from N-terminus to C-terminus, a signal peptide, a propeptide region, and a chain region. The nucleotide sequence for human MMP-7 mRNA is NM_002423.5, and the amino acid sequence for human MMP-7 is NP_002414.1 (SEQ ID NO: 2) .The location for each exon and each region in human MMP-7 nucleotide sequence and amino acid sequence is listed below:

[0043] Table 1

[0044] Based on transcript NM_002423.5 and its encoding protein NP_002414.1 (SEQ ID NO: 2) ,the 5’ -UTR is at positions from 102530701 to 102530747, exon 1 is at positions from 102530593 to 102530747, intron 1 is at positions from 102527984 to102530592, exon 2 is at positions from 102527757 to 102527983, intron 2 is at positions from 102527673 to 102527756, exon 3 is at positions from 102527524 to 102527672, intron 3 is at positions from 102525065 to 102527523; exon 4 is at positions from 102524936 to 102525064, intron 4 is at positions from 102523402 to 102524935, exon 5 is at positions from 102523240 to 102523401, intron 5 is at positions from 102520805 to 102523239, exon 6 is at positions from 102520508 to 102520804, and the 3’ -UTR is at positions from 102520508 to 102520775. All relevant information for human MMP-7 locus can be found in the NCBI website with Gene ID: 4316, which is incorporated by reference herein in its entirety.

[0045] In mouse genome, mouse MMP-7 gene (NCBI Gene ID: 17393, UniProt ID: Q10738) is in Chromosome 9 of the mouse genome, which is located at NC_000075.7 from the position 7692095 to the position 7699587 (GRCm39 (GCF_000001635.27) ) . Mouse MMP-7 gene (Gene ID: 17393) locus has 6 exons, exon 1, exon 2, exon 3, exon 4, exon 5, and exon 6. The mouse MMP-7 protein also has, from N-terminus to C-terminus, a signal peptide, a propeptide region, and a chain region. The nucleotide sequence for mouse MMP-7 mRNA is NM_010810.6, and the amino acid sequence for mouse MMP-7 is NP_034940.3 (SEQ ID NO: 1) . The location for each exon and each region in mouse MMP-7 nucleotide sequence and amino acid sequence is listed below:

[0046] Table 2

[0047] Based on transcript NM_010810.6 and its encoding protein NP_034940.3 (SEQ ID NO: 1) ,the 5’ -UTR is at positions from 7692095 to 7692135, exon 1 is at positions from 7692136 to 7692243, intron 1 is at positions from 7692244 to 7695156, exon 2 is at positions from 7695157 to 7695383, intron 2 is at positions from 7695384 to 7695468, exon 3 is at positions from 7695469 to 7695617, intron 3 is at positions from 7695618 to 7696047; exon 4 is at positions from 7696048 to 7696176, intron 4 is at positions from 7696177 to 7697588, exon 5 is at positions from 7697589 to 7697750, intron 5 is at positions from 7697751 to 7699338, exon 6 is at positions from 7699339 to 7699358, and the 3’ -UTR is at positions from 7699359 to 7699587. All relevant information for human MMP-7 locus can be found in the NCBI website with Gene ID: 17393, which is incorporated by reference herein in its entirety.

[0048] FIG. 7A shows the alignment between human MMP-7 amino acid sequence (NP_002414.1; SEQ ID NO: 2) and mouse MMP-7 amino acid sequence (NP_034940.3; SEQ ID NO: 1) . Thus, the corresponding amino acid residue or region between human and mouse MMP-7 can be found in FIG. 7A.

[0049] MMP-7 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for MMP-7 in Rattus norvegicus (rat) is 25335, the gene ID for MMP-7 in Macaca mulatta (Rhesus monkey) is 703072, the gene ID for MMP-7 in Canis lupusfamiliaris (dog) is 489432, and the gene ID for MMP-7 in Sus scrofa (pig) is 397411. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety. FIG. 7B shows the alignment between human MMP-7 amino acid sequence (NP_002414.1; SEQ ID NO: 2) and rat MMP-7 amino acid sequence (NP_036996.1; SEQ ID NO: 28) . Thus, the corresponding amino acid residue or region between human and rat MMP-7 can be found in FIG. 7B.

[0050] The present disclosure provides human or chimeric (e.g., humanized) MMP-7 nucleotide sequence and / or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, the coding sequence of signal peptide, the coding sequence of propeptide region, and / or the coding sequence of chain region are replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, the coding sequence of signal peptide, the coding sequence of propeptide region, and / or the coding sequence of chain region are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1055, 1060, or 1065 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 261, 262, 263, or 264 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, the coding sequence of signal peptide, the coding sequence of propeptide region, and / or the coding sequence of chain region. In some embodiments, a region, aportion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 (e.g., a portion of exon 1 and the entire exons 2~6) are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2 exon 3, exon 4, exon 5, and / or exon 6 (e.g., aportion of exon 1 and the entire exons 2~6) .

[0051] In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, the coding sequence of signal peptide, the coding sequence of propeptide region, and / or the coding sequence of chain region is deleted.

[0052] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) MMP-7 nucleotide sequence. In some embodiments, the chimeric MMP-7 nucleotide sequence encodes a human or chimeric MMP-7 protein. In some embodiments, the chimeric MMP-7 protein has a human or humanized signal peptide, a human or humanized propeptide region, and / or a human or humanized chain region.

[0053] In some embodiments, the chimeric (e.g., humanized) MMP-7 nucleotide sequence encodes a MMP-7 protein comprising a signal peptide, a propeptide region, and / or a chain region. In some embodiments, the signal peptide comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1~17 of SEQ ID NO: 2. In some embodiments, the signal peptide comprises all or part of human MMP-7 signal peptide. In some embodiments, the propeptide region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 18~94 of SEQ ID NO: 2. In some embodiments, the propeptide region comprises all or part of human MMP-7 propeptide region. In some embodiments, the chain region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 95~267 of SEQ ID NO: 2. In some embodiments, the chain region comprises all or part of human MMP-7 chain region. In some embodiments, the human or chimeric MMP-7 protein has a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100%identical to amino acids 1~350 of SEQ ID NO: 2.

[0054] In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized MMP-7 protein. In some embodiments, the MMP-7 protein comprises, from N-terminus to C-terminus, a signal peptide, a propeptide region, and a chain region. In some embodiments, the humanized MMP-7 protein comprises a human or humanized signal peptide. In some embodiments, the humanized MMP-7 protein comprises an endogenous signal peptide. In some embodiments, the humanized MMP-7 protein comprises a human or humanized propeptide region. In some embodiments, the humanized MMP-7 protein comprises an endogenous propeptide region. In some embodiments, the humanized MMP-7 protein comprises a human or humanized chain region. In some embodiments, the humanized MMP-7 protein comprises an endogenous chain region. In some embodiments, the humanized MMP-7 protein comprises a human or humanized signal peptide, ahuman or humanized propeptide region, and a human or humanized chain region.

[0055] UTRs are untranslated regions are crucial segments of mRNA that do not code for proteins but play significant roles in regulating gene expression. UTRs includes 5’ -UTR located upstream of the coding sequence and 3’ -UTR located downstream of the coding sequence. 5’ -UTR contains regulatory elements that influence the initiation of translation and helps in the binding of ribosomes to the mRNA. 3’ -UTR contains regulatory regions that affect mRNA stability, localization, and translation efficiency, and often includes binding sites for microRNAs (miRNAs) and proteins that can either enhance or repress translation.

[0056] In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized MMP-7 gene. In some embodiments, the humanized MMP-7 gene comprises 6 exons. In some embodiments, the humanized MMP-7 gene comprises humanized exon 1, human exon 2, human exon 3, human exon 4, human exon 5, and / or human exon 6. In some embodiments, the humanized MMP-7 gene comprises human or humanized 5’ -UTR. In some embodiments, the humanized MMP-7 gene comprises human or humanized 3’ -UTR. In some embodiments, the humanized MMP-7 gene comprises endogenous 5’ -UTR. In some embodiments, the humanized MMP-7 gene comprises endogenous 3’ -UTR.

[0057] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) MMP-7 nucleotide sequence and / or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the sequence are identical to or derived from mouse MMP-7 mRNA sequence (e.g., NM_010810.6) , mouse MMP-7 amino acid sequence (e.g., SEQ ID NO: 1) , or a portion thereof (e.g., 5’ -UTR and / or a portion of exon 1) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the sequence are identical to or derived from human MMP-7 mRNA sequence (e.g., NM_002423.5) , human MMP-7 amino acid sequence (e.g., SEQ ID NO: 2) , or a portion thereof (e.g., a portion of exon 1, exon 2, exon 3, exon 4, exon 5 and / or exon 6) .

[0058] In some embodiments, the sequence encoding amino acids 1~264 of mouse MMP-7 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human MMP-7 (e.g., amino acids 1~267 of human MMP-7 (SEQ ID NO: 2) ) .

[0059] In some embodiments, the sequence encoding amino acids 1~17, 18~264, or 1~264 of mouse MMP-7 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human MMP-7 (e.g., amino acids 1~17, 18~267, or 1~267 of human MMP-7 (SEQ ID NO: 2) ) .

[0060] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse MMP-7 promotor, an inducible promoter, an enhancer, and / or any mouse or human regulatory elements.

[0061] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1105, 1110, 1115, or 1119 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from part of or the entire mouse MMP-7 nucleotide sequence (e.g., a portion of exon 1 and the entire exons 2~6 of NM_010810.6) .

[0062] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1055, 1060, or 1065 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are the same as part of or the entire mouse MMP-7 nucleotide sequence (e.g., 5’ -UTR, a portion of exon 1 of NM_010810.6) .

[0063] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1055, 1060, or 1065 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from part of or the entire human MMP-7 nucleotide sequence (e.g., 5’ -UTR and a portion of exon 1 of NM_002423.5) .

[0064] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1105, 1110, 1115, or 1119 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are the same as part of or the entire human MMP-7 nucleotide sequence (e.g., a portion of exon 1 and the entire exons 2~6 of NM_002423.5) .

[0065] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 261, 262, 263, 264, 265, 266, or 267 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that are different from part of or the entire mouse MMP-7 amino acid sequence (e.g., amino acids 1~17, 18~94, 95~264, or 1~264 of NP_034940.3 (SEQ ID NO: 1) ) .

[0066] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 261, 262, 263, or 264 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that are the same as part of or the entire mouse MMP-7 amino acid sequence (e.g., amino acids 1~17, 18~94, 95~264, or 1~264 of NP_034940.3 (SEQ ID NO: 1) ) . In some embodiments, the amino acid sequence has no more than a portion (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, or 240 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that are the same as part of or the entire mouse MMP-7 amino acid sequence. In some embodiments, no amino acids are identical to mouse MMP-7 amino acid sequence (NP_034940.3 (SEQ ID NO: 1) .

[0067] In some embodiments, the amino acid sequence has no more than a portion (e.g., no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 261, 262, 263, or 264 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire human MMP-7 amino acid sequence (e.g., amino acids 1~17, 18~94, or 95~267 of NP_002414.1 (SEQ ID NO: 2) ) . In some embodiments, no amino acids are different from human MMP-7 amino acid sequence (NP_002414.1 (SEQ ID NO: 2) )

[0068] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 261, 262, 263, 264, 265, 266, or 267 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire human MMP-7 amino acid sequence (e.g., amino acids 1~17, 18~94, or 95~267 of NP_002414.1 (SEQ ID NO: 2) ) .

[0069] The present disclosure also provides a humanized MMP-7 mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0070] a) an amino acid sequence shown in SEQ ID NO: 1, or 2;

[0071] b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1 or 2;

[0072] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, or 2 under a low stringency condition or a strict stringency condition;

[0073] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1 or 2;

[0074] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1 or 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

[0075] f) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1 or 2.

[0076] The present disclosure also provides a humanized MMP-7 amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0077] a) all or part of amino acids 1~267, 18~267, or 95~267 of SEQ ID NO: 2;

[0078] b) an amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 1~267, 18~267, or 95~267 of SEQ ID NO: 2;

[0079] c) an amino acid sequence that is different from amino acids 1~267, 18~267, or 95~267 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and

[0080] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1~267, 18~267, or 95~267 of SEQ ID NO: 2.

[0081] The present disclosure also provides a humanized MMP-7 amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0082] a) all or part of amino acids 1~17, 18~94, 1~94, or 95~264 of SEQ ID NO: 1;

[0083] b) an amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 1~17, 18~94, 1~94, or 95~264 of SEQ ID NO: 1;

[0084] c) an amino acid sequence that is different from amino acids 1~17, 18~94, 1~94, or 95~264 of SEQ ID NO: 1 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and

[0085] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1~17, 18~94, 1~94, or 95~264 of SEQ ID NO: 1.

[0086] The present disclosure also relates to a MMP-7 nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

[0087] a) a nucleic acid sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19, or a nucleic acid sequence encoding a homologous MMP-7 amino acid sequence of a humanized mouse MMP-7;

[0088] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19 under a low stringency condition or a strict stringency condition;

[0089] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19;

[0090] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1 or 2;

[0091] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1 or 2;

[0092] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1 or 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and / or

[0093] g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1 or 2.

[0094] The present disclosure further relates to a MMP-7 genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 5 or 6.

[0095] The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1 or 2 and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1 or 2 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0096] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 1 or 2 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0097] The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 5 or 6, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 5 or 6 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0098] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0099] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 106, 110, 112, 120, 130, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1108, 1200, 1300, 1400, 1451, 1500, 1504, 2000, 2500, 3000, 3500, 3885, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or 10751 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 245, 250, 251, 252, 260, 261, 262, 263, 264, 265, 266, or 267 amino acid residues.

[0100] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

[0101] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

[0102] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0103] The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g., leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

[0104] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) MMP-7 from an endogenous non-human MMP-7 locus.

[0105] Genetically modified animals

[0106] As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, amacrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous MMP-7 locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

[0107] As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

[0108] As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

[0109] As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

[0110] As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be, e.g., a human exon or a chimeric exon.

[0111] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized MMP-7 gene or a humanized MMP-7 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human MMP-7 gene, at least one or more portions of the gene or the nucleic acid is from a non-human MMP-7 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an MMP-7 protein. The encoded MMP-7 protein is functional or has at least one activity of the human MMP-7 protein or the non-human MMP-7 protein, e.g., modulating cell growth or immune responses.

[0112] In some embodiments, the humanized MMP-7 gene includes a nucleotide sequence of 20 bp~10751bp (contiguous or non-contiguous) that is identical to the sequence at human MMP-7 gene locus. In some embodiments, the nucleotide sequence is 20~10751 bp, or 48~1119 bp, e.g., 20,30, 40, 50, 60, 70, 80, 90, 100, 106, 110, 112, 120, 130, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1071, 1108, 1200, 1300, 1400, 1451, 1500, 1504, 2000, 2500, 3000, 3500, 3885, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 10731, or 10751 bp.

[0113] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized MMP-7 protein or a humanized MMP-7 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human MMP-7 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human MMP-7 protein. The humanized MMP-7 protein or the humanized MMP-7 polypeptide is functional or has at least one activity of the human MMP-7 protein or the non-human MMP-7 protein.

[0114] In some embodiments, the humanized MMP-7 protein includes a polypeptide sequence of 5~267 amino acids (contiguous or non-contiguous) that is identical to human MMP-7 protein. In some embodiments, the polypeptide sequence is 5~267 or 18~267 amino acids in length, e.g., 5, 10,18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 252, 253, 260, 261, 262, 263, 264, 265, or 267 amino acids.

[0115] In some embodiments, the signal peptide is human or humanized. In some embodiments, the propeptide region is human or humanized. In some embodiments, the chain region is human or humanized. In some embodiments, all the signal peptide, the propeptide region, and the chain region are human or humanized.

[0116] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

[0117] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat(family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

[0118] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm) , 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL / 6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB / c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB / c-50%12954 / Sv; or 50%C57BL / 6-50%129) . In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola) , C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H background. In some embodiments, the non-human animal is a mouse having NOD, NOD / SCID, or NOD-Prkdcscid IL-2rgnull background.

[0119] In one aspect, the non-human animal is a mammal. In one aspect, the non-human animal is a small mammal, e.g., a jerboa. In one embodiment, the genetically humanized non-human animal is a rodent. In one embodiment, the rodent is selected from the group consisting of mice, rats and hamsters. In one embodiment, the rodent is selected from the murine family. In one embodiment, the genetically modified animal is selected from a group consisting of hamsteridae (e.g., mouse-like hamsters) , hamsteridae (e.g., hamsters, New World rats and mice, voles) , murine superfamily (e.g., true mouse and rats, gerbils, spiny rats, and crested rats) , Falkomuridae (e.g., climbing mice, rock mice, tailed rats, Madagascar rats and mice) , Dormocidae (e.g., spiny dormouse) and Moleidae (e.g., mole rats, bamboo rats, and zokors) families. In a specific embodiment, the genetically modified rodent is selected from the group consisting of true mice or rats (Muridae) , gerbils, spiny rats and crested rats. In one embodiment, the genetically modified mouse is from a member of the family Muridae. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0120] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0121] The animal can have one or more other genetic modifications, and / or other modifications, that are suitable for the particular purpose for which the humanized MMP-7 animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and / or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and / or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD / SCID mice, IL2Rγknockout mice, NOD / SCID / γcnull mice (Ito, M. et al., NOD / SCID / γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Rag1 and / or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, agenetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human MMP-7 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD / SCID mice, IL-2Rγknockout mice, NOD / SCID / γcnull mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD-Prkdcscid IL-2rγnull mice, NOD-Rag 1- / --IL2rg- / - (NRG) mice, Rag 2- / --IL2rg- / - (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature MMP-7 coding sequence with human mature MMP-7 coding sequence.

[0122] Genetically modified non-human animals can comprise a modification at an endogenous non-human MMP-7 locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature MMP-7 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature MMP-7 protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous MMP-7 locus in the germline of the animal.

[0123] Genetically modified animals can express a human MMP-7 and / or a chimeric (e.g., humanized) MMP-7 from endogenous mouse loci, wherein the endogenous mouse MMP-7 gene has been replaced with a human MMP-7 gene and / or a nucleotide sequence that encodes a region of human MMP-7 sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human MMP-7 sequence. In various embodiments, an endogenous non-human MMP-7 locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature MMP-7 protein.

[0124] In some embodiments, the genetically modified mice can express the human MMP-7 and / or chimeric MMP-7 (e.g., humanized MMP-7) from endogenous loci that are under control of mouse promoters and / or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human MMP-7 or chimeric MMP-7 (e.g., humanized MMP-7) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human MMP-7 or the chimeric MMP-7 (e.g., humanized MMP-7) expressed in animal can maintain one or more functions of the wild-type mouse or human MMP-7 in the animal. For example, the expressed MMP-7 can modulate cell growth, immune responses, and / or inflammation. Furthermore, in some embodiments, the animal does not express endogenous MMP-7. In some embodiments, the animal expresses a decreased level of endogenous MMP-7 as compared to MMP-7 expression level in a wild-type animal. As used herein, the term “endogenous MMP-7” refers to MMP-7 protein that is expressed from an endogenous MMP-7 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

[0125] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human MMP-7 (NP_002414.1; SEQ ID NO: 2) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5 or 6.

[0126] The genome of the genetically modified animal can comprise a replacement at an endogenous MMP-7 gene locus of a sequence encoding a region of endogenous MMP-7 with a sequence encoding a corresponding region of human MMP-7. In some embodiments, the sequence that is replaced is any sequence within the endogenous MMP-7 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon5, exon 6, 5’ -UTR, 3’ -UTR, intron 1, or any combination thereof. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous MMP-7 gene. In some embodiments, the sequence that is replaced is a portion of exon 1 and the entire exons 2~6 of an endogenous mouse MMP-7 gene locus.

[0127] The genetically modified animal can have one or more cells expressing a human or chimeric MMP-7 (e.g., humanized MMP-7) having, from N-terminus to C-terminus, a signal peptide, a propeptide region, and a chain region. In some embodiments, the signal peptide comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the signal peptide of human MMP-7. In some embodiments, the signal peptide of the humanized MMP-7 has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 amino acids (e.g., contiguously or non-contiguously) that are identical to the signal peptide of human MMP-7. In some embodiments, the propeptide region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the propeptide region of human MMP-7. In some embodiments, the propeptide region of the humanized MMP-7 has a sequence that has at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 71, 72, 73, 74, 75, or 76 amino acids (e.g., contiguously or non-contiguously) that are identical to the propeptide region of human MMP-7. In some embodiments, the chain region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the chain region of human MMP-7. In some embodiments, the chain region of the humanized MMP-7 has a sequence that has at least 5, 10, 20,30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 172 amino acids (contiguously or non-contiguously) that are identical to the chain region of human MMP-7.

[0128] Because human MMP-7 and non-human MMP-7 (e.g., mouse MMP-7) sequences, in many cases, are different, antibodies that bind to human MMP-7 will not necessarily have the same binding affinity with non-human MMP-7 or have the same effects to non-human MMP-7. Therefore, the genetically modified animal having a human, or a humanized MMP-7 can be used to better evaluate the effects of anti-human MMP-7 antibodies in an animal model.

[0129] In some embodiments, the entire humanized MMP-7 described herein are derived from human MMP-7 sequence.

[0130] In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 of human MMP-7; a portion or the entire coding sequence of the signal peptide region, a portion or the entire coding sequence of the propeptide region, and / or a portion or the entire coding sequence of the chain region of human MMP-7; or a portion or the entire sequence of amino acids 1~267, 18~267, or 95~267 of SEQ ID NO: 2.

[0131] In some embodiments, the genome of the genetically modified animal comprises a portion of exon 1 and the entire exons 2~6 of human MMP-7 gene. In some embodiments, the portion of exon 1 includes at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or 155 nucleotides. In some embodiments, the portion of exon 1 includes 107 nucleotides. In some embodiments, the portion of exon 1 includes a nucleotide of at least 20 bp.

[0132] In some embodiments, the non-human animal can have, at an endogenous MMP-7 gene locus, a nucleotide sequence encoding a chimeric human / non-human MMP-7 polypeptide, wherein a human portion of the chimeric human / non-human MMP-7 polypeptide comprises all or a portion of the human MMP-7 signal peptide, all or a portion of the human MMP-7 propeptide region, and all or a portion of the human MMP-7 chain region, wherein the animal expresses a functional MMP-7 in the animal. The human portion of the chimeric human / non-human MMP-7 polypeptide can comprise an amino acid sequence encoded by a portion of exon 1,the entire exon 2, exon 3, exon 4, exon 5, and / or exon 6 of human MMP-7. In some embodiments, the human portion of the chimeric human / non-human MMP-7 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to amino acids 1~267 of SEQ ID NO: 2. In some embodiments, the signal peptide includes a sequence corresponding to the entire or part of amino acids 1~17 of SEQ ID NO: 2. In some embodiments, the propeptide region includes a sequence corresponding to the entire or part of amino acids 18~94 of SEQ ID NO: 2. In some embodiments, the chimeric human / non-human MMP-7 polypeptide comprises a chain region, which includes a sequence corresponding to the entire or part of amino acids 95~267 of SEQ ID NO: 2. In some embodiments, the signal peptide includes a sequence corresponding to the entire or part of amino acids 1~17 of SEQ ID NO: 1. In some embodiments, the propeptide region includes a sequence corresponding to the entire or part of amino acids 18~94 of SEQ ID NO: 1. In some embodiments, the chimeric human / non-human MMP-7 polypeptide comprises a chain region, which includes a sequence corresponding to the entire or part of amino acids 95~264 of SEQ ID NO: 1.

[0133] Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous MMP-7 locus, or homozygous with respect to the replacement at the endogenous MMP-7 locus.

[0134] In some embodiments, the humanized MMP-7 locus comprises a portion of or an entire human MMP-7 gene 5’ -UTR. In some embodiments, the humanized MMP-7 locus lacks a human MMP-7 gene 5’ -UTR. In some embodiment, the humanized MMP-7 locus comprises a portion of or an entire endogenous (e.g., mouse) 5’ -UTR. In some embodiments, the humanized MMP-7 locus comprises a portion of or an entire endogenous (e.g., mouse) 3’ -UTR. In some embodiments, the humanized MMP-7 locus comprises at least 50 nucleotides (e.g., contiguous or non-contiguous) downstream of the endogenous (e.g., mouse) 3’ -UTR (downstream of endogenous MMP-7 exon 6) . In some embodiments, the humanized MMP-7 locus comprises at least 395 nucleotides (e.g., contiguous or non-contiguous) downstream of the endogenous (e.g., mouse) 3’ -UTR. In some embodiments, the humanized MMP-7 locus comprises a portion of or an entire downstream of the 3’ -UTR of human MMP-7 gene. In some embodiments, the humanized MMP-7 locus comprises at least 50 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human MMP-7 gene (downstream of the human MMP-7 exon 6) . In some embodiments, the humanized MMP-7 locus comprises at least 558 nucleotides (e.g., contiguous or non-contiguous) downstream of the 3’ -UTR of human MMP-7 gene. In appropriate cases, it may be reasonable to presume that the mouse and human MMP-7 genes appear to be similarly regulated based on the similarity of their 5’ -flanking sequence. As shown in the present disclosure, humanized MMP-7 mice that comprise a replacement at an endogenous mouse MMP-7 locus, which retain mouse regulatory elements but comprise a humanization of MMP-7 encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized MMP-7 are grossly normal.

[0135] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .

[0136] In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

[0137] In some embodiments, the non-human mammal expresses a protein encoded by a humanized MMP-7 gene.

[0138] In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

[0139] The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

[0140] The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized MMP-7 in the genome of the animal.

[0141] In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized MMP-7 is provided. In some embodiments, the tissue-specific expression of human or humanized MMP-7 protein is provided.

[0142] In some embodiments, the expression of human or humanized MMP-7 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System / Tet-On System, or Tamoxifen System.

[0143] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.

[0144] Genetic, molecular, and behavioral analyses for the non-human mammals described above can be performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

[0145] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human MMP-7 protein can be detected by a variety of methods.

[0146] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized MMP-7 protein.

[0147] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous MMP-7 gene, wherein the disruption of the endogenous MMP-7 gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or part thereof of the endogenous MMP-7 gene.

[0148] In some embodiments, the disruption of the endogenous MMP-7 gene comprises deletion of one or more exons or part of exons of exon 1, exon 2, exon 3, exon 4, exon 5, and exon 6 of the endogenous MMP-7 gene.

[0149] In some embodiments, the disruption of the endogenous MMP-7 gene further comprises deletion of the entire or part of intron 1 of the endogenous MMP-7 gene.

[0150] In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 1907, 2000, 2211, 2500, 3000, 4000, 5000, 6000, 7000, or more nucleotides.

[0151] In some embodiments, the disruption of the endogenous MMP-7 gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 298, 300, 350, 400, 450, 500, 550, 600, 601, 650, 700, 750, 800, 850, 900, 950, 1000, 1023, 1050, or 1065 nucleotides of exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 (e.g., deletion of 264 nucleotides from exon 1 and the entire exons 2~6) .

[0152] Vectors

[0153] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the MMP-7 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired / donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the MMP-7 gene genomic DNAs in the length of 100 to 10,000 nucleotides.

[0154] In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000075.7; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000075.7.

[0155] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 7688242 to the position 7692126 of the NCBI accession number NC_000075.7; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 7699983 to the position 7704431 of the NCBI accession number NC_000075.7.

[0156] In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 7690623 to the position 7692126 of the NCBI accession number NC_000075.7; b) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 7699983 to the position 7701433 of the NCBI accession number NC_000075.7.

[0157] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, about 5 kb, about 5.5 kb, about 6 kb, about 6.5 kb, about 7 kb, about 7.5 kb, or about 8 kb.

[0158] In some embodiments, the region to be altered is exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 of MMP-7 gene (e.g., a portion of exon 1 and the entire exons 2~6 of mouse MMP-7 gene) .

[0159] The targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers. In some embodiments, the positive selectable marker is a Neo gene or Neo cassette. In some embodiments, the negative selectable marker is a DTA gene.

[0160] In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4. In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 18; and the sequence of the 3’ arm is shown in SEQ ID NO: 19.

[0161] In some embodiments, the sequence is derived from human (e.g., positions 102519950 to 102530700 of NC_000011.10 (e.g., SEQ ID NO: 5) ; or 48~1119 of NM_002423.5) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human MMP-7 gene, preferably exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 of the human MMP-7 gene. In some embodiments, the nucleotide sequence of the humanized MMP-7 gene encodes the entire or the part of human MMP-7 protein with the NCBI accession number NP_002414.1 (SEQ ID NO: 2) .

[0162] The disclosure also provides vectors for constructing a humanized animal model or a knock-out model. In some embodiments, the vectors comprise a sgRNA sequence, wherein the sgRNA sequence targets MMP-7 gene, and the sgRNA is unique on the target sequence of the gene to be altered, and meets the sequence arrangement rule of 5’ -NNN (20) -NGG3’ or 5’ -CCN-N (20) -3’ ; and in some embodiments, the targeting site of the sgRNA in the mouse MMP-7 gene is located on the exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, intron 1, intron 2, intron 3, intron 3, intron 4, intron 5, upstream of exon 1, or downstream of exon 6 of the mouse MMP-7 gene.

[0163] In some embodiments, the targeting sequences are shown as SEQ ID NOs: 21 and 22. Thus, the disclosure provides sgRNA sequences for constructing a genetic modified animal model. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 27 and 15. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 16 and 17. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 23 and 24. In some embodiments, the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 25 and 26.

[0164] In some embodiments, the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and / or a cell including the construct.

[0165] The disclosure also relates to a cell comprising the targeting vectors as described above.

[0166] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

[0167] In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

[0168] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0169] Methods of making genetically modified animals

[0170] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

[0171] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous MMP-7 gene locus, a sequence encoding a region of an endogenous MMP-7 with a sequence encoding a corresponding region of human or chimeric MMP-7. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

[0172] The targeting strategies involve a vector comprising a 5’ homologous arm, a human MMP-7 gene fragment (e.g., a human MMP-7 donor sequence) , and a 3’ homologous arm. The process can involve replacing endogenous MMP-7 sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous MMP-7 sequence with human MMP-7 sequence.

[0173] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous MMP-7 locus (or site) , a nucleic acid sequence encoding a region of endogenous MMP-7 with a sequence encoding a corresponding region of human MMP-7. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, and / or exon 6 of a human MMP-7 gene. In some embodiments, the sequence includes a portion of exon 1 and the entire exons 2~6 of a human MMP-7 gene (e.g., nucleic acids 48~1119 of NM_002423.5) . In some embodiments, the region includes the signal peptide of human MMP-7 (e.g., amino acids 1~17 of SEQ ID NO: 2) , and / or the propeptide region of human MMP-7 (e.g., amino acids 18~94 of SEQ ID NO: 2) . In some embodiments, the sequence can include a region (e.g., a part or the entire region) of exon 1 exon 2, exon 3, exon 4, exon 5, and / or exon 6 of mouse MMP-7. In some embodiments, the sequence includes a portion of exon 1 of mouse MMP-7 gene (e.g., nucleic acids 1~41 of NM_010810.6) .

[0174] In some embodiments, the methods of modifying a MMP-7 locus of a mouse to express a chimeric human / mouse MMP-7 peptide can include the steps of replacing at the endogenous mouse MMP-7 locus a nucleotide sequence encoding a mouse MMP-7 with a nucleotide sequence encoding a human MMP-7, thereby generating a sequence encoding a chimeric human / mouse MMP-7.

[0175] In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, the second nucleotide sequence, and / or the third nucleotide sequence do not overlap) . In some embodiments, the amino acid sequences as described herein do not overlap with each other.

[0176] The present disclosure further provides a method for establishing a MMP-7 gene humanized animal model, involving the following steps:

[0177] (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;

[0178] (b) culturing the cell in a liquid culture medium;

[0179] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

[0180] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

[0181] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL / 6 mouse) .

[0182] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .

[0183] In some embodiments, the fertilized eggs for the methods described above are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs and DBA / 2 fertilized eggs.

[0184] Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.

[0185] In some embodiments, methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal’s MMP-7 gene, e.g., by inserting a nucleotide sequence (e.g., DNA or cDNA sequence) encoding human or humanized MMP-7 protein, e.g., immediately after the endogenous regulatory element of the non-human animal’s MMP-7 gene. For example, one or more functional region sequences of the non-human animal’s MMP-7 gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous MMP-7 protein. In some embodiments, the coding frame of the modified non-human animal’s MMP-7 gene can be all or part of the nucleotide sequence from exon 1 to exon 6 of the non-human animal’s MMP-7 gene.

[0186] In some embodiments, methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized MMP-7 protein and / or an auxiliary sequence after the endogenous regulatory element of the non-human animal’s MMP-7 gene. In some embodiments, the auxiliary sequence can be a stop codon, such that the MMP-7 gene humanized animal model can express human or humanized MMP-7 protein in vivo, but does not express non-human animal’s MMP-7 protein. In some embodiments, the auxiliary sequence includes WPRE (WHP Posttranscriptional Response Element) , loxP, and / or polyA.

[0187] In some embodiments, the insertion refers to placing a target fragment directly between two adjacent bases without deleting nucleotides. For example, the target fragment can be a human MMP-7 gene, a humanized MMP-7 gene, a nucleotide sequence encoding a human or humanized MMP-7 protein, or a nucleotide sequence obtained by splicing human MMP-7 and non-human MMP-7 genes. In some embodiments, the target fragment can also be a partial nucleotide sequence of the human MMP-7 gene. Preferably, exon x+1 to exon 6 of the human MMP-7 gene can be inserted adjacent to exon x of the MMP-7 gene of non-human animals. For example, exon 2 to exon 6 of the human MMP-7 gene can be inserted adjacent to exon 1 of the MMP-7 gene of non-human animals; exon 3 to exon 6 of the human MMP-7 gene can be inserted adjacent to exon 2 of the MMP-7 gene of non-human animals; exon 4 to exon 6 of the human MMP-7 gene can be inserted adjacent to exon 3 of the MMP-7 gene of non-human animals; or exon 5 to exon 6 of human MMP-7 gene can be inserted adjacent to exon 4 of the MMP-7 gene of non-human animals.

[0188] In some embodiments, the method for making the genetically modified animal comprises:

[0189] (1) providing a plasmid comprising a human MMP-7 gene fragment (e.g., a human MMP-7 donor sequence) , flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous MMP-7 gene;

[0190] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous MMP-7 gene;

[0191] (3) modifying genome of a fertilized egg or an embryonic stem cell by using the plasmid of step (1) , the sgRNAs of step (2) , and Cas9;

[0192] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudopregnant female mouse or transplanting the embryonic stem cell obtained in step (3) into a blastocyst which is then transplanted into the oviduct of a pseudopregnant female mouse to produce a child mouse that functionally expresses a humanized MMP-7 protein; and

[0193] (5) mating the child mouse obtained in step (2) to obtain a homozygote mouse,

[0194] In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs that target a 5’ -terminal targeting site and a 3’ -terminal targeting site.

[0195] In some embodiments, the sequence encoding the humanized MMP-7 protein is operably linked to an endogenous regulatory element at the endogenous MMP-7 gene locus.

[0196] In some embodiments, the genetically-modified animal does not express an endogenous MMP-7 protein.

[0197] In some embodiments, the method for making the genetically modified animal comprises:

[0198] (1) providing a plasmid comprising a human or chimeric MMP-7 gene fragment (e.g., a human MMP-7 donor sequence) , flanked by a 5’ homologous arm and a 3’ homologous arm, wherein the 5’ and 3’ homologous arms target an endogenous MMP-7 gene;

[0199] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous MMP-7 gene; and

[0200] (3) modifying genome of a fertilized egg or an embryonic stem cell by inserting the human or chimeric MMP-7 gene fragment (e.g., a human MMP-7 donor sequence) into the genome.

[0201] Methods of using genetically modified animals

[0202] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters, 5’ -UTR, and / or any other regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assay and / or functional assay. Inclusion in the human transgene of upstream and / or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and / or regulation of the transgene.

[0203] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

[0204] Genetically modified animals that express human or humanized MMP-7 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and / or the efficacy of these human therapeutics in the animal models.

[0205] In various aspects, genetically modified animals are provided that express human or humanized MMP-7, which are useful for testing therapeutic agents that can decrease or block the interaction between the interaction between MMP-7 and anti-human MMP-7 antibodies, testing whether a therapeutic agent can increase or decrease the immune response, and / or determining whether an agent is an MMP-7 agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor (e.g., breast cancer, colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) or a blood cell tumor (e.g., a lymphocyte tumor, aB cell tumor, or a T cell tumor) .

[0206] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent for the treatment of an MMP-7-related disorder, wherein the MMP-7-related disorder is a cancer (e.g., solid tumor, blood tumor, colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., an autoimmune disease, idiopathic pulmonary fibrosis (IPF) , asthma, rheumatoid arthritis (RA) , or multiple sclerosis (MS) ) , an inflammation including arthritis or inflammatory bowel disease (IBD) , or a kidney disease (e.g., acute kidney injury (AKI) and chronic kidney disease (CKD) ) . In some embodiments, the method includes administering the therapeutic agent to the animal as described herein, wherein the therapeutic agent is an MMP-7-targeting agent, e.g., an anti-MMP-7 antibody, or an MMP-7-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) , and determining therapeutic effects of the therapeutic agent to the MMP-7-related disorder.

[0207] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent (e.g., an anti-MMP-7 antibody or an MMP-7-targeting drug (e.g., an MMP-7-inhibitory nucleic acid) ) for the treatment of cancer. In some embodiments, the methods involve administering the therapeutic agent (e.g., an anti-human MMP-7 antibody or an MMP-7-targeting drug (e.g., an MMP-7-inhibitory nucleic acid) ) to the animal as described herein, wherein the animal has a cancer or tumor; and determining inhibitory effects of the therapeutic agent to the cancer or tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT. In some embodiments, the detection methods include caliper measurement, flow cytometry detection, and / or in vivo animal imaging detection. In some embodiments, the detection includes evaluating individual body weight, fat mass, activation pathways, neuroprotective activity, or metabolic changes, including changes in food consumption or water consumption.

[0208] In some embodiments, the tumor comprises one or more cancer cells (e.g., cancer cells derived from humans or non-human animals) that are injected into the animal. In some embodiments, the anti-MMP-7 antibody activates MMP-7 signaling pathways. In some embodiments, the anti-MMP-7 antibody does not activate MMP-7 signaling pathways. In some embodiments, the anti-MMP-7 antibody inhibits MMP-7 signaling pathways. In some embodiments, the therapeutic agent does not inhibit the MMP-7 signaling pathways. In some embodiments, the anti-MMP-7 antibody block the interaction between MMP-7 complexes thereby inhibiting MMP-7 signaling pathways.

[0209] In some embodiments, the genetically modified animals can be used for determining whether an anti-MMP-7 antibody is a MMP-7 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the therapeutic agent (e.g., anti-MMP-7 antibodies) on MMP-7, whether the agent can upregulate the immune response or downregulate immune response, and / or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytotoxicity (ADCC) . In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer.

[0210] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and / or determining tumor (volume) inhibition rate (TGITV) . The tumor growth inhibition rate can be calculated using the formula TGITV (%) = (1–TVt / TVc) ×100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

[0211] In some embodiments, the therapeutic agent (e.g., an anti-MMP-7 antibody or an MMP-7-targeting drug) is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.

[0212] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In a specific embodiment, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelioma, oropharyngeal tumor, female reproductive system cancer, or meningioma. In some embodiments, the cancer described herein is a solid tumor, blood tumor, head and neck cancer, liver cancer, lung cancer, leukemia, colorectal cancer, kidney cancer, pancreatic cancer, or gastric cancer.

[0213] In some embodiments, the therapeutic agent (e.g., an anti-MMP-7 antibody or an MMP-7-targeting drug) is designed for treating various autoimmune diseases, including rheumatoid arthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, or scleroderma. In some embodiments, the therapeutic agent is designed for treating various immune disorders, e.g., idiopathic pulmonary fibrosis, asthma, rheumatoid arthritis, or multiple sclerosis. Thus, the methods as described herein can be used to determine the effectiveness of a therapeutic agent (e.g., an anti-MMP-7 antibody or an MMP-7-targeting drug) in inhibiting immune response. In some embodiments, the immune disorders described herein is graft versus host disease (GVHD) , psoriasis, allergy, asthma, myocarditis, nephritis, hepatitis (e.g., non-alcoholic steatohepatitis) , systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, or neurological disorders.

[0214] In some embodiments, the therapeutic agent (e.g., an anti-MMP-7 antibody or an MMP-7-targeting drug) is designed for treating various inflammations, e.g., hepatitis, arthritis, or inflammatory bowel disease (IBD) . In some embodiments, the inflammation described herein includes both acute inflammation and chronic inflammation. Specifically, the inflammation includes but not limited to degenerative inflammation, exudative inflammation (e.g., serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotic inflammation, catarrhal inflammation) , proliferative inflammation, specific inflammation (e.g., tuberculosis, syphilis, leprosy, or lymphogranuloma) .

[0215] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-MMP-7 antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40%smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .

[0216] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

[0217] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and / or a therapeutic strategy.

[0218] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the MMP-7 gene function, human MMP-7 antibodies, drugs for human MMP-7 targeting sites, the drugs or efficacies for human MMP-7 targeting sites, the drugs for immune-related diseases and antitumor drugs.

[0219] In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the MMP-7 gene humanized non-human animal prepared by the methods described herein, the MMP-7 gene humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized MMP-7 protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and / or other immunotherapies can treat the MMP-7-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and / or other immunotherapies provides an evaluation method for treating the MMP-7-associated diseases described herein.

[0220] Genetically modified animal model with two or more human or chimeric genes

[0221] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric MMP-7 gene and a sequence encoding an additional human or chimeric protein.

[0222] In some embodiments, the additional human or chimeric protein can be inducible T-cell costimulator (ICOS) , Natural Killer Cell Protein 46 (NKP46) , Transferrin Receptor 1 (TFR1) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and / or Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) .

[0223] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

[0224] (a) using the methods of introducing human MMP-7 gene or chimeric MMP-7 gene as described herein to obtain a genetically modified non-human animal;

[0225] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

[0226] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4 gene. Some of these genetically modified non-human animals are described, e.g., in PCT / CN2017 / 090320, PCT / CN2017 / 099574, PCT / CN2017 / 099576, PCT / CN2022 / 113594, PCT / CN2021 / 095273, PCT / CN2022 / 096667, PCT / CN2020 / 113618, PCT / CN2019 / 128358, PCT / CN2020 / 128201, PCT / CN2022 / 131092, and PCT / CN2021 / 085053; each of which is incorporated herein by reference in its entirety.

[0227] In some embodiments, the MMP-7 humanization is directly performed on a genetically modified animal having a human or chimeric ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4.

[0228] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-MMP-7 antibody and an additional therapeutic agent for the treatment of cancer. The methods include administering the anti-MMP-7 antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody (e.g., nivolumab) , or an anti-PD-L1 antibody. In some embodiments, the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, CTLA4, or any combination thereof.

[0229] In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab) , an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and / or PD-L2.

[0230] In some embodiments, the combination treatment is designed for treating various cancers as described herein, e.g., a solid tumor, gynecologic cancer, breast cancer, colorectal cancer, gastric adenocarcinoma, lung adenocarcinoma, pancreatic cancer, or head and neck cancer.

[0231] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and / or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the patient.

[0232] EXAMPLES

[0233] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0234] Materials and Methods

[0235] The following equipment and materials used in the following examples were obtained from several companies identified below:

[0236] C57BL / 6 mice and Flp recombinase transgenic mice were purchased from the National Institutes for Food and Drug Control, National Rodent Laboratory Animal Resources Center.

[0237] AseI restriction enzyme was purchased from NEB (Catalog number: R0526S) .

[0238] BspHI restriction enzyme was purchased from NEB (Catalog number: R0517S) .

[0239] Human Total MMP-7 ELISA Kit-Quantikine was purchased from R&D systems (Catalog number: DMP700) .

[0240] Mouse MMP-7 ELISA Kit (Colorimetric) was purchased from Novus Biologicals (Catalog number: NBP3-06895)

[0241] EXAMPLE 1: Mice with humanized matrix metalloproteinase-7 (MMP-7) gene

[0242] In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human or humanized MMP-7 protein, and the obtained genetically-modified non-human animal can express a human or humanized MMP-7 protein in vivo. The mouse MMP-7 gene (NCBI Gene ID: 17393) is located at 7692095 to 7699587 of chromosome 9 (NC_000075.7) , and the human MMP-7 gene (NCBI Gene ID: 4316) is located at 102520508 to 102530747 of chromosome 11 (NC_000011.10) . The mouse MMP-7 transcript is NM_010810.6, and the corresponding protein sequence NP_034940.3 is set forth in SEQ ID NO: 1. The human MMP-7 transcript is NM_002423.5, and the corresponding protein sequence NP_002414.1 is set forth in SEQ ID NO: 2. Mouse and human MMP-7 gene loci are shown in FIG. 1.

[0243] Specifically, using gene-editing techniques, under control of mouse MMP-7 gene regulatory elements, a sequence (about 7.9 kb, e.g., from start codon ATG to the downstream of 3’-UTR) starting from part of the sequence of exon 1 and ending with the entire sequence of exon 6 of the mouse MMP-7 gene was replaced with a corresponding sequence (about 10.8 kb, e.g., from start codon ATG to the downstream of 3’ -UTR) starting from within part of the sequence of exon 1 and ending with the entire exon 6 sequence of the human MMP-7 gene, resulting in a humanized MMP-7 gene locus.

[0244] To implement the targeting strategy, a targeting vector V1 was constructed. The targeting vector V1 (FIG. 2) contains homologous arm sequences upstream and downstream of the mouse MMP-7 gene, and an “A Fragment” containing DNA sequences of human MMP-7 gene. Specifically, sequence of the upstream 5’ homologous arm (5’ homologous arm, SEQ ID NO: 3) is identical to nucleotide sequence at positions 7688242 to 7692126 of NCBI accession number NC_000075.7, and sequence of the downstream 3’ homologous arm (3’ homologous arm, SEQ ID NO: 4) is identical to nucleotide sequence at positions 7699983 to 7704431 of NCBI accession number NC_000075.7. The nucleotide sequence of the human MMP-7 gene fragment (SEQ ID NO: 5) is identical to nucleotide sequence at positions 102519950 to 102530700 of NCBI accession number NC_000011.10. The connection between the upstream of the human MMP-7 gene fragment and the mouse sequence was designed as: 5’ -TTCTCCAGCCCCTGTCAGGAAACATCAAAGTAGCTCTGAGAACAATCGCCTGTTG ACTCACCGTGCTGTGTGCTGTGTGCCTGCTGCCTGGCAGCCTGGCCCTGCCG-3’ (SEQ ID NO: 7) , wherein the last “G” in sequence “TGTTG” is the last nucleotide of the mouse sequence, and the first “A” in sequence is the first nucleotide of the human sequence.

[0245] The targeting vector also includes a resistance gene for positive clone selection, namely the neomycin phosphotransferase coding sequence (Neo) , flanked by two site-specific recombination system Frt recombination sites arranged in the same direction, forming a Neo cassette. The connection between the 5’ end of the Neo cassette and the human sequence was designed as: 5’ -TTCTACTGTGCAAGGGTCATGAAATTGAACAAAACTAAAATTGGATATTATGGA TCCTATTCTCTAGAAAGTATAGGAACTTCAGGTCTGAAGAGGAGTTTACGTC-3’ (SEQ ID NO: 9) , wherein the last “A” in sequence “ATGGA” is the last nucleotide of the human sequence, and the first “G” in sequence is the first nucleotide of the Neo cassette. The connection between the 3’ end of the Neo cassette and the mouse sequence was designed as: 5’ -TTGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC CTGT AGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTTGTT-3’ (SEQ ID NO: 10) , wherein the last “C” in sequence “ACTTC” is the last nucleotide of the Neo cassette, and the first “G” in sequence is the first nucleotide of the mouse sequence. The mRNA sequence of the engineered humanized mouse MMP-7 is set forth in SEQ ID NO: 6, and its encoded protein sequence is set forth in SEQ ID NO: 2.

[0246] The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Embryonic stem cells of C57BL / 6 mice were transfected by electroporation with the targeting vector that had been verified as correct. The obtained cells were screened using a positive clone selection marker gene to identify the correct positive clone cells. The correct positive clone cells (black mice) were introduced into isolated blastocysts (white mice) using techniques known in the art. The resulting chimeric blastocysts were briefly cultured in a medium and then transplanted into the fallopian tubes of recipient female mice (white mice) , producing F0 generation chimeric mice (black and white) . The F0 chimeric mice were backcrossed with wild-type mice to obtain F1 generation mice. The F1 heterozygous mice were then interbred to produce F2 generation homozygous mice. Additionally, positive (e.g., heterozygous) mice were mated with Flp tool mice to remove the positive clone selection marker gene, and subsequent interbreeding produced MMP-7 gene humanized homozygous mice.

[0247] Additionally, CRISPR / Cas9 technology was also used for gene editing to further design the targeting vector V2. The targeting vector V2 (FIG. 3) contains homologous arm sequences upstream and downstream of the mouse MMP-7 gene, as well as the human MMP-7 fragment. Specifically, the upstream 5’ homologous arm sequence (SEQ ID NO: 18) is identical to the nucleotide sequence at positions 7690623 to 7692126 of NCBI accession number NC_000075.7, and the downstream 3’ homologous arm sequence (SEQ ID NO: 19) is identical to the nucleotide sequence at positions 7699983 to 7701433 of NCBI accession number NC_000075.7. The nucleotide sequence of the human MMP-7 fragment (SEQ ID NO: 5) is identical to the nucleotide sequence at positions 102519950 to 102530700 of NCBI accession number NC_000011.10. The connection between the upstream of the human MMP-7 gene fragment and the mouse sequence was designed as: 5’ -TTCTCCAGCCCCTGTCAGGAAACATCAAAGTAGCTCTGAGAACAATCGCCTGTTG ACTCACCGTGCTGTGTGCTGTGTGCCTGCTGCCTGGCAGCCTGGCCCTGCCG-3’ (SEQ ID NO: 7) , wherein the last “G” in sequence “TGTTG” is the last nucleotide of the mouse sequence, and the first “A” in sequence is the first nucleotide of the human sequence. The connection between the downstream of the human MMP-7 gene fragment and the mouse sequence was designed as (without the Neo cassette) : 5’ -ACTGTGCAAGGGTCATGAAATTGAACAAAACTAAAATTGGATATTATGGA CTG TAGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTTGTTACAGA-3’ (SEQ ID NO:8) , wherein the last “A” in sequence “ATGGA” is the last nucleotide of the human sequence, and the first “G” in sequence is the first nucleotide of the mouse sequence. The mRNA sequence of the engineered humanized mouse MMP-7 was set forth in SEQ ID NO: 6, and the expressed protein sequence is set forth in SEQ ID NO: 2.

[0248] The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation, or direct synthesis. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Targeting vectors with verified sequences were used for subsequent experiments.

[0249] The target sequence determines the targeting specificity of the sgRNA and the efficiency of Cas9-induced cleavage of the target gene. Therefore, the selection and design of highly efficient and specific target sequences are prerequisites for constructing sgRNA expression vectors. The sgRNA sequences designed and synthesized to recognize the target sites are as follows:

[0250] sgRNA1 target site (SEQ ID NO: 21) : 5’ -TTTGTCCTTCGGTGCTTGCGTGG-3’ ; and

[0251] sgRNA2 target site (SEQ ID NO: 22) : 5’ -CCTCCATTGCATCCCTCAGCTGG-3’ .

[0252] A universal CRISPR activity (UCA) kit was used to detect the activity of the sgRNAs. After confirming that the sgRNAs was able to mediate high-efficiency cleavage by Cas9, restriction enzyme cleavage sites were added to the 5’ end and a complementary strand of the sgRNAs, to obtain forward and reverse oligonucleotide sequences, as shown in the table below. After annealing, the annealed products were ligated into the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) , resulting in the expression vectors pT7-MMP-7-1 and pT7-MMP-7-2.

[0253] Table 3. sgRNA1 and sgRNA2 sequence list

[0254] The pT7-sgRNA vector was synthesized, which included a DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 20) , and was ligated to the backbone vector (Takara, Catalog number: 3299) after restriction enzyme digestion (EcoRI and BamHI) . The resulting plasmid was confirmed by sequencing. The pre-mixed Cas9 mRNA, the targeting vector, and in vitro transcription products of the pT7-MMP-7-1 and pT7-MMP-7-2 plasmids (using AmbionTMin vitro transcription kit to carry out the transcription according to the method provided in the product instruction) were injected into the cytoplasm or nucleus of mouse fertilized eggs (e.g., C57BL / 6 mice) with a microinjection instrument. The microinjection of fertilized eggs was carried out according to the method described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Chemistry Industry Press, 2006. The injected fertilized eggs were briefly cultured in a medium and then transplanted into the fallopian tubes of the recipient female mice for development. The resulting mice (F0 generation) were bred through cross-breeding and self-breeding to expand the population and establish a stable MMP-7 gene humanized mouse line.

[0255] The genotype of the F1 generation mice somatic cells was identified using PCR analysis. The F1 generation mice identified as positive by PCR were then subjected to Southern Blot analysis to confirm the absence of random insertions. Specifically, genomic DNA from mouse tail snips was extracted, digested with either AseI or BspHI restriction enzymes, transferred to a membrane, and hybridized with respective probes. The 5’ probe and the A probe are located on the upstream of the 5’ homologous arm and human MMP-7 fragment sequence, respectively. The specific lengths of the probes and target fragments are shown in the table below. An example of the results is shown in FIG. 4. Based on the PCR and sequencing results, 4 mice, numbered F1-01 to F1-04, were identified as positive (heterozygous) . This indicates that this method can construct MMP-7 gene humanized mice that are stably transmissible between generations and free of random insertions.

[0256] Table 4. Specific size of the probes and target fragments

[0257] The following primers were used to synthesize the probes for Southern Blot assays:

[0258] 5’ Probe-F (SEQ ID NO: 11) : 5’ -GATGTGGGACATTTCTAGAC-3’ ,

[0259] 5’ Probe-R (SEQ ID NO: 12) : 5’ -GTGTGGAAATATGACAAATATAG-3’ ; and

[0260] A Probe-F (SEQ ID NO: 13) : 5’ -CACCACACTATTTTGAGGTCTTCCGCA-3’ ,

[0261] A Probe-R (SEQ ID NO: 14) : 5’ -AACCTAGAGAGTGGCTGCAGCAGGA-3’ .

[0262] The expression of human or humanized MMP-7 mRNA in MMP-7 gene humanized mice was detected using ELISA. Specifically, three 8-week-old male wild-type C57BL / 6 mice (+ / +) and three 8-week-old male MMP-7 gene humanized heterozygous mice (H / +) prepared in this study were selected. Serum was collected and tested using the Human Total MMP-7 ELISA Kit-Quantikine and the Mouse MMP-7 ELISA Kit (Colorimetric) . The test results are shown in FIGs. 5A-5B.

[0263] As shown in FIGs. 5A-5B, when using the mouse-specific MMP-7 ELISA kit, mouse MMP-7 protein was detected in both MMP-7 humanized heterozygous mice and C57BL / 6 mice. When using the human-specific MMP-7 ELISA kit, human MMP-7 protein was detected only in MMP-7 humanized heterozygous mice.

[0264] In another similar experiment, three 8-week-old male wild-type C57BL / 6 mice (+ / +) and three 8-week-old male MMP-7 gene humanized homozygous mice (H / H) prepared in this study were selected to collect serum. The test results are shown in FIGs. 6A-6B. Mouse MMP-7 protein was detected only in C57BL / 6 mice. Human MMP-7 protein was detected only in MMP-7 humanized homozygous mice. These results demonstrate that the human MMP-7 protein can be successfully expressed in MMP-7 humanized heterozygous and homozygous mice.

[0265] EXAMPLE 2: In vivo efficacy verification

[0266] The humanized mice disclosed in this disclosure can be used to induce various human disease models, including models of idiopathic pulmonary fibrosis (IPF) and cancer, and can be used to test the in vivo efficacy of human-specific antibodies. For example, several MMP-7 humanized homozygous mice will be used to induce IPF models. After successful establishment of IPF, the mice will be divided into a control group and a treatment group. The treatment group is randomly administered a drug targeting human MMP-7, while the control group is injected with an equivalent volume of saline. The mice's body weight was regularly recorded, cytokine levels were measured, and lung HE staining was performed. By comparing changes in body weight and cytokine levels, the in vivo safety and efficacy of the compound can be effectively evaluated.

[0267] EXAMPLE 3: Generation of double-or multi-gene humanized mice

[0268] The methods described herein or the MMP-7 gene humanized mice produced by the disclosed methods can also be used to create multi-humanized mouse models. For example, in Example 1, the embryonic stem cells used for microinjection can be obtained from mice containing at least one gene modification such as modified (e.g., human or humanized) ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. Alternatively, based on the humanized MMP-7 mice, double or multi-humanized mouse models can be obtained using isolated mouse embryonic stem cells and gene recombination targeting techniques. MMP-7 homozygous or heterozygous mice obtained by the methods described herein can also be crossed with other gene-modified mice. Their offspring can be screened, and according to Mendelian inheritance, there is a certain probability of obtaining multi-gene modified mice with humanized MMP-7 gene and other gene modifications. Interbreeding these heterozygous mice can produce homozygous mice with double or multiple gene modifications.

[0269] OTHER EMBODIMENTS

[0270] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages,and modifications are within the scope of the following claims.

Claims

1.A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric matrix metalloproteinase-7 (MMP-7) .2.The animal of claim 1, wherein the sequence encoding the human or chimeric MMP-7 is operably linked to an endogenous regulatory element (e.g., endogenous promoter and / or endogenous 5’-UTR) at an endogenous MMP-7 gene locus in the at least one chromosome.3.The animal of claim 1 or 2, wherein the sequence encoding the human or chimeric MMP-7 is operably linked to a human or chimeric regulatory element at an endogenous MMP-7 gene locus in the at least one chromosome.4.The animal of any one of claims 1-3, wherein the sequence encoding the human or chimeric MMP-7 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) .5.The animal of any one of claims 1-4, wherein the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat.6.The animal of any one of claims 1-5, wherein the animal is a mouse.7.The animal of any one of claims 1-6, wherein the animal does not express endogenous MMP-7 or expresses a decreased level of endogenous MMP-7 as compared to MMP-7 expression level in a wild-type animal.8.The animal of any one of claims 1-7, wherein the animal has one or more cells expressing human or chimeric MMP-7.9.A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of an endogenous MMP-7 with a sequence encoding a corresponding region of a human MMP-7 at an endogenous MMP-7 gene locus.10.The animal of claim 9, wherein the sequence encoding a corresponding region of the human MMP-7 is operably linked to an endogenous, a human, or a chimeric regulatory element at the endogenous MMP-7 locus, and one or more cells of the animal expresses a human or chimeric MMP-7.11.The animal of claim 9 or 10, wherein the animal does not express the endogenous MMP-7 or expresses a decreased level of the endogenous MMP-7 as compared to the MMP-7 expression level in a wild-type animal.12.The animal of any one of claims 9-11, wherein the sequence encoding the corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a portion thereof, of a human MMP-7 gene.13.The animal of any one of claims 9-12, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.14.The animal of any one of claims 9-13, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.15.The animal of any one of claims 9-14, wherein the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5.16.The animal of any one of claims 9-15, wherein the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a portion thereof, of the endogenous MMP-7 gene.17.The animal of any one of claims 9-16, wherein the sequence encoding a region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.18.The animal of any one of claims 9-17, wherein the sequence encoding a region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.19.The animal of any one of claims 9-18, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide.20.The animal of any one of claims 9-19, wherein the sequence encoding a region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide.21.The animal of any one of claims 9-20, wherein the animal is a mouse.22.The animal of any one of claims 9-21, wherein the animal is heterozygous with respect to the replacement at the endogenous MMP-7 gene locus.23.The animal of any one of claims 9-22, wherein the animal is homozygous with respect to the replacement at the endogenous MMP-7 gene locus.24.A non-human animal comprising one or more cells comprising a nucleotide sequence encoding a human or chimeric MMP-7 polypeptide, wherein the human or chimeric MMP-7 polypeptide comprises at least 50, 100, 150, 200, 250, 260, or 267 contiguous amino acid residues that are identical to a corresponding contiguous amino acid sequence of a human MMP-7 polypeptide, wherein the animal expresses the human or chimeric MMP-7 polypeptide.25.The animal of claim 24, wherein the nucleotide sequence encoding the human or chimeric MMP-7 polypeptide is operably linked to an endogenous regulatory element of the animal, a human regulatory element, or a chimeric regulatory element.26.The animal of claim 24 or 25, wherein the nucleotide sequence encoding the human or chimeric MMP-7 polypeptide is integrated to an endogenous MMP-7 gene locus of the animal.27.The animal of any one of claims 24-26, wherein the animal is a mouse, wherein the human or chimeric MMP-7 polypeptide has at least one mouse MMP-7 activity and / or at least one human MMP-7 activity.28.A method for making a genetically-modified, non-human animal, comprising:replacing a sequence encoding a region of an endogenous MMP-7 with a sequence encoding a corresponding region of a human MMP-7, at an endogenous MMP-7 gene locus, in at least one cell of the animal.29.The method of claim 28, wherein the animal does not express the endogenous MMP-7 or expresses a decreased level of endogenous MMP-7 as compared to MMP-7 expression level in a wild-type animal.30.The method of claim 28 or 29, wherein the sequence encoding a corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of a human MMP-7 gene.31.The method of any one of claims 28-30, wherein the sequence encoding the corresponding region of human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.32.The method of any one of claims 28-31, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.33.The method of any one of claims 28-32, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide.34.The method of any one of claims 28-33, wherein the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5.35.The method of any one of claims 28-34, wherein the sequence encoding the corresponding region of the human MMP-7 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) .36.The method of any one of claims 28-35, wherein the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of the endogenous MMP-7 gene.37.The method of any one of claims 28-36, wherein the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.38.The method of any one of claims 28-37, wherein the sequence encoding the region of endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7 gene, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.39.The method of any one of claims 28-38, wherein the sequence encoding a region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide.40.The method of any one of claims 28-39, wherein the sequence encoding the corresponding region of human MMP-7 is operably linked to an endogenous regulatory element, e.g., a promoter and / or 5’-UTR.41.The method of any one of claims 28-40, wherein the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat.42.The method of any one of claims 28-41, wherein the animal is a mouse.43.The method of any one of claims 28-42, wherein the animal is heterozygous or homozygous with respect to the replacement at the endogenous MMP-7 gene locus.44.A method of making a genetically-modified animal cell that expresses a human or chimeric MMP-7, the method comprising:replacing a nucleotide sequence encoding a region of an endogenous MMP-7, at an endogenous MMP-7 gene locus, with a nucleotide sequence encoding a corresponding region of a human MMP-7, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the human or chimeric MMP-7, wherein the animal cell expresses the human or chimeric MMP-7.45.The method of claim 44, wherein the sequence encoding a corresponding region of the human MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of a human MMP-7 gene.46.The method of claim 44 or 45, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.47.The method of any one of claims 44-46, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the human MMP-7 gene, optionally including at least 558 contiguous nucleotides downstream of exon 6 of the human MMP-7 gene.48.The method of any one of claims 44-47, wherein the sequence encoding the corresponding region of the human MMP-7 comprises a sequence encoding a human signal peptide.49.The method of any one of claims 44-48, wherein the sequence encoding the corresponding region of the human MMP-7 is at least 70%, 75, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 5.50.The method of any one of claims 44-49, wherein the sequence encoding the corresponding region of the human MMP-7 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to the human MMP-7 (NP_002414.1 (SEQ ID NO: 2) ) .51.The method of any one of claims 44-50, wherein the sequence encoding a region of the endogenous MMP-7 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a part thereof, of the endogenous MMP-7 gene.52.The method of any one of claims 44-51, wherein the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7, optionally including at least 50 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.53.The method of any one of claims 44-52, wherein the sequence encoding the region of the endogenous MMP-7 comprises a portion of exon 1 and the entire exons 2~6 of the endogenous MMP-7, optionally including at least 395 contiguous nucleotides downstream of exon 6 of the endogenous MMP-7 gene.54.The method of any one of claims 44-53, wherein the sequence encoding the region of the endogenous MMP-7 comprises a sequence encoding an endogenous signal peptide.55.The method of any one of claims 44-54, wherein the sequence encoding the human or chimeric MMP-7 polypeptide is operably linked to an endogenous regulatory element, e.g., a promoter and / or 5’-UTR.56.The method of any one of claims 44-55, wherein the animal is a mouse.57.The animal of any one of claims 1-27, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.58.The animal of claim 57, wherein the additional human or chimeric protein is one or more selected from the group consisting of inducible T-cell costimulator (ICOS) , Natural Killer Cell Protein 46 (NKP46) , Transferrin Receptor 1 (TFR1) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) .59.The method of any one of claims 28-56, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.60.The method of claim 59, wherein the additional human or chimeric protein is one or more selected from the group consisting of ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.61.A method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-27, 57, and 58, wherein the animal has a tumor; andb) determining inhibitory effects of the therapeutic agent to the tumor.62.The method of claim 61, wherein the therapeutic agent is an anti-MMP-7 antibody (e.g., an anti-human MMP-7 antibody) .63.The method of claim 61 or 62, wherein the tumor comprises one or more cancer cells that are injected into the animal.64.The method of any one of claims 61-63, wherein determining inhibitory effects of the anti-MMP-7 antibody to the tumor involves measuring the tumor volume in the animal.65.The method of any one of claims 61-64, wherein the cancer is colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.66.A method of determining effectiveness of an anti-MMP-7 antibody and an additional therapeutic agent for the treatment of cancer, comprisinga) administering the anti-MMP-7 antibody and the additional therapeutic agent to the animal of any one of claims 1-27, 57, and 58, wherein the animal has a tumor; andb) determining inhibitory effects on the tumor.67.The method of claim 66, wherein the animal further comprises a sequence encoding a human or chimeric PD-1, a human or chimeric PD-L1, and / or a human or chimeric CTLA4.68.The method of claim 66 or 67, wherein the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody.69.The method of any one of claims 66-68, wherein the tumor comprises one or more tumor cells that express PD-L1.70.The method of any one of claims 66-69, wherein the tumor comprises one or more tumor cells that are injected into the animal.71.The method of any one of claims 66-70, wherein determining inhibitory effects of the treatment involves measuring the tumor volume in the animal.72.The method of any one of claims 66-71, wherein the animal has colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer.73.A method of determining effectiveness of a therapeutic agent for treatment an immune disorder (e.g., an autoimmune disease) , comprising:a) administering the therapeutic agent to the animal of any one of claims 1-27, 57, and 58, wherein the animal has the immune disorder; andb) determining effects of the therapeutic agent to the immune disorder.74.The method of claim 73, wherein the immune disorder (e.g., an autoimmune disease) comprises idiopathic pulmonary fibrosis (IPF) , asthma, rheumatoid arthritis (RA) , or multiple sclerosis (MS) .75.A method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-27, 57, and 58, wherein the animal has the inflammation; andb) determining effects of the therapeutic agent to the inflammation.76.The method of claim 75, wherein the inflammation comprises arthritis or inflammatory bowel disease (IBD) .77.A method of determining toxicity of a therapeutic agent comprising:(a) administering the therapeutic agent to the animal of any one of claims 1-27, 57, and 58; and(b) determining effects of the therapeutic agent to the animal.78.The method of claim 77, wherein the therapeutic agent is an anti-MMP-7 antibody.79.The method of claim 77 or 78, wherein determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.80.A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:(a) an amino acid sequence set forth in SEQ ID NO: 1 or 2;(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1 or 2;(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1 or 2;(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1 or 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or(e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1 or 2.81.A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:(a) a sequence that encodes the protein of claim 80;(b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19;(c) a sequence that is at least 90%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19; or(d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 18, or 19.82.A cell comprising the protein of claim 80 and / or the nucleic acid of claim 81.83.An animal comprising the protein of claim 80 and / or the nucleic acid of claim 81.84.A method of determining effectiveness of a therapeutic agent for the treatment of an MMP-7-related disorder, comprising:(a) administering the therapeutic agent to the animal of any one of claims 1-27, 57, and 58, wherein the animal has the MMP-7-related disorder; and(b) determining therapeutic effects of the therapeutic agent to the MMP-7-related disorder, wherein the MMP-7-related disorder is a cancer (e.g., colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., idiopathic pulmonary fibrosis, asthma, rheumatoid arthritis, or multiple sclerosis) , an inflammation (e.g., arthritis or inflammatory bowel disease) , or a kidney disease (e.g., acute kidney injury (AKI) and chronic kidney disease (CKD) ) .85.The method of claim 84, wherein the therapeutic agent is an MMP-7-targeting agent.86.The method of claim 84 or 85, wherein the MMP-7-targeting agent is an anti-MMP-7 antibody (e.g., an anti-human MMP-7 antibody) .87.The method of any one of claims 84-86, wherein the MMP-7-targeting agent is an MMP-7-inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) .88.A method of determining effectiveness of an anti-MMP-7 antibody and an additional therapeutic agent for the treatment of an MMP-7-related disorder, comprising(a) administering the anti-MMP-7 antibody and the additional therapeutic agent to the animal of any one of claims 1-27, 57, and 58 wherein the animal has the MMP-7-related disorder; and(b) determining inhibitory effects on the MMP-7-related disorder,wherein the MMP-7-related disorder is a cancer (e.g., colon cancer, gastrointestinal cancer, endocrine cancer, pancreatic cancer, a solid tumor, a blood tumor, head and neck cancer, liver cancer, or lung cancer) , an immune disorder (e.g., idiopathic pulmonary fibrosis, asthma, rheumatoid arthritis, or multiple sclerosis) , an inflammation (e.g., arthritis or inflammatory bowel disease) , or a kidney disease (e.g., acute kidney injury (AKI) and chronic kidney disease (CKD) ) .89.The method of claim 88, wherein the animal further comprises a sequence encoding inducible T-cell costimulator (ICOS) , Natural Killer Cell Protein 46 (NKP46) , Transferrin Receptor 1 (TFR1) , Lymphocyte-activation gene 3 (LAG3) , 4-1BB, Cluster of Differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , CD27, CD28, B7 Homolog 3 (B7H3) , OX40, programmed cell death protein 1 (PD-1) , programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) , or any combination thereof.90.The method of claim 88 or 89, wherein the additional therapeutic agent is an antibody (e.g., an anti-human antibody) that binds to ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4, or any combination thereof.91.The method of any one of claims 88-90, wherein the additional therapeutic agent is an inhibitory nucleic acid (e.g., antisense, shRNA, siRNA, or double-stranded RNA) that targets ICOS, NKP46, TFR1, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4, or any combination thereof.

Citation Information

Patent Citations

  • Expression method and application of recombinant human MMP-7 protein

    CN114032252A

  • Non-human animal modified by MMP7 gene

    CN120041503A

  • Transgenic non-human mammal that expresses human MMP2

    US20160374319A1

  • Transgenic animal model for degenerative diseases of cartilage

    WO1999031969A2

  • MMP activation peptide detection in biological samples

    WO2010047938A2