Methods and compositions for assessing tissue and organ damage

Abstract

The present disclosure relates to certain compositions, kits, devices, systems and methods, e.g., compositions, kits, devices, systems and methods for assessing methylation status, and / or assessing tissue and / or organ damage or toxicity in a subject. In particular aspects, provided herein are compositions, kits, devices, systems and methods for assessing tissue and / or organ damage or toxicity in a subject based on assessing methylation status of selected one or more tissue-specific or organ-specific target polynucleotide(s), e.g., one or more tissue-specific or organ-specific target genomic DNA sequence(s), from the subject.

Description

P A T E N T Attorney Docket No.: 4552-2000740 METHODS AND COMPOSITIONS FOR ASSESSING TISSUE AND ORGAN DAMAGE RELATED APPLICATION

[0001] The present application claims priority to U.S. provisional patent application No. 63 / 555,516, filed on February 20, 2024, the content of which is incorporated herein by reference in its entirety for all purposes. REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0002] The present application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on February 17, 2025, is named “4552-2000740.xml” and is 646,668 bytes in size. The sequence listing contained in this .XML file is part of the present specification and is hereby incorporated by reference herein in its entirety. TECHNICAL FIELD

[0003] The present disclosure relates to certain compositions, kits, devices, systems and methods, e.g., compositions, kits, devices, systems and methods for assessing methylation status, and / or assessing tissue and / or organ damage or toxicity in a subject. In particular aspects, provided herein are compositions, kits, devices, systems and methods for assessing tissue and / or organ damage or toxicity in a subject based on assessing methylation status of selected one or more tissue-specific or organ-specific target polynucleotide(s), e.g., one or more tissue-specific or organ-specific target genomic DNA sequence(s), from the subject. BACKGROUND

[0004] In drug development, it is necessary to evaluate the toxicity of candidate compounds. It is necessary to consider the various effects on organs exerted by the administered drug candidate compounds. In addition to histopathology, which is a direct examination of tissues, biomarkers that are representative of the state of each organ are used to evaluate toxicity. In general, proteins specific to each organ are often used as biomarkers. Alternatively, indicators representative of the components and functions contained in cells are sometimes used as biomarkers. Regarding the liver, the activity of the liver enzymes alanine transaminase and aspartate transaminase in blood is widely used as an indicator of liver injury. It has beenP A T E N T Attorney Docket No.: 4552-2000740 reported that miR-122, which is predominantly expressed in the liver, can be used as a hepatotoxicity biomarker(1, 2). For the kidney, blood urea nitrogen and creatinine are routinely measured to detect nephrotoxicity. Kidney Injury Molecule-1, which is specifically expressed in kidney injury, has recently been reported to be a useful biomarker (3). For the heart, cardiac troponin, which is abundantly expressed in the heart, is often used as an indicator of myocardial damage (4). Some of these biomarkers can be measured by automated clinical laboratory analysis, but many emerging biomarkers also need to be measured one by one by ELISA or other methods, and also may not be sufficient in terms of sensitivity and specificity because the methods for measuring such biomarkers are not sophisticated. In addition, there may be no biomarkers to detect organ toxicity, or emerging biomarkers may not be clinically ready for use. For example, there are no clinically useful biomarkers for testicular toxicity, which is often seen in drug development. Although there are reports of hormones (5, 6) and circulating microRNAs, their clinical usefulness has not yet been confirmed. Therefore, in order to develop promising safer drugs, biomarkers that can accurately monitor their effects on various organs are required. To that end, the performance of biomarkers and the sophistication of measurement methods are essential issues.

[0005] Cell-free DNA is thought to be released from cells mostly through apoptosis and necrosis, and possibly also active secretion. Outside the blood circulation, cell-free DNA has been detected in various body fluids, including urine, cerebrospinal fluid, pleural fluid and saliva (7). Bronkhorst et al., reported that occurrence of cell-free DNA could be a result of actively secreted DNA, perhaps in association with a protein complex (8). Exercise has also been reported to increase DNA levels in the blood. Enhanced cardiorespiratory function during exercise might lead to the accumulation of cell-free DNA via the release of stress hormones that already increase at intensities below the anaerobic threshold (9). High cell-free DNA concentration was a predictor of short-term mortality after severe traumatic brain injury (10). The fraction of donor DNA is naturally elevated 1 day after transplant (because organ transplants are essentially genome transplants), and these levels decline exponentially over the course of the week, if the organ is accepted (11). Thus, cell-free DNA in the blood could be an indicator that a cell somewhere in the body has broken down.

[0006] Cell-free DNA is loaded with a variety of information. Multiple classes of genetic and epigenetic alterations such as point mutations, copy number alterations, rearrangements andP A T E N T Attorney Docket No.: 4552-2000740 methylation changes can be found in cell-free DNA(7). Cell-free DNA is now widely used for cancer diagnosis and prenatal diagnosis of fetuses. Its usefulness in the evaluation of disease states has been confirmed. Though NGS of tumor tissue is generally preferred, often a tissue biopsy is unobtainable or of insufficient quantity or quality, and therefore circulating tumor DNA (ctDNA) analysis using blood is the only available option. Liquid biopsies allow for a fast and easy method of serial analysis over multiple time points that can help guide treatment decisions by identifying the emergence of mutations and other genetic alterations that predict for resistance or response to the next line of therapy. Therapeutic intervention can also lead to changes in the levels of ctDNA in the blood(12). Non-invasive prenatal testing (NIPT) has been applied to the determination of fetal sex, fetal rhesus D (RhD) genotyping, and identification of some pregnancy-associated conditions (such as pre-eclampsia), aneuploidies, and paternally inherited monogenic disorders (13).

[0007] Accordingly, there is a need for improved compositions, kits, devices, systems and methods for assessing tissue and / or organ damage or toxicity in a subject. The present disclosure addresses this and other related needs. BRIEF SUMMARY

[0008] The summary is not intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the detailed description including those aspects disclosed in the accompanying drawings and in the appended claims.

[0009] A method for detecting cancer-derived cell-free DNA, which is present in trace amounts in blood, has been developed (14), and it is actually used clinically. Since this method is based on specific DNA methylation patterns of cells in each organ, we selected this method for this study to investigate the feasibility of using cell-free DNA as a biomarker to identify damaged tissue in animal toxicity study and to confirm its usefulness. First, we confirmed if it was possible to create a DNA methylation database for each organ of rats and identified liver- specific methylation patterns. Thioacetamide (TAA), a typical hepatotoxicant, was administered to rats, and cell-free DNA at the time of hepatotoxicity was analyzed to determine the extent to which liver-specific methylation patterns were included. We also compared numericalP A T E N T Attorney Docket No.: 4552-2000740 indicators of liver-specific methylation patterns with existing liver biomarkers, such as AST and ALT, to determine their detection sensitivity.

[0010] In one aspect, provided herein is a panel of isolated polynucleotides comprising, consisting of, or consisting essentially of, one or more isolated tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof.

[0011] In another aspect, a kit, device, system or an article of manufacture that is configured for assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s). In some embodiments, the present kit, device, system or an article of manufacture is configured for assessing tissue and / or organ damage or toxicity in a subject.

[0012] In still another aspect, provided herein is an in vitro method for classifying a sample, which method comprises: a) in vitro assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from said subject; and b) classifying said sample into a category based on said methylation status of said one or more tissue-specific or organ-specific target polynucleotide(s) in said sample obtained in a). In some embodiments, the present methods are used for assessing tissue and / or organ damage or toxicity in a subject. In some embodiments, the present methods are used for diagnosis, prognosis, stratification, risk assessment, or treatment monitoring of tissue and / or organ damage or toxicity in a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 illustrates an exemplary support vector machines analysis. Image of Figure 1 is taken from Wikipedia: https: / / en.wikipedia.org / wiki / Support_vector_machine), and does not represent any DNA methylation status analysis or cancer assessment.

[0014] Figure 2 illustrates steps for constructing a single-stranded polynucleotide library and performing sequencing analysis using the library, according to one aspect of the present disclosure.

[0015] Figure 3 illustrates a construct comprising a target molecule for sequencing, according to one aspect of the present disclosure.

[0016] Figures 4A-24C illustrate exemplary analyses of cfDNA and other liver biomarkers. The horizontal axis shows the measured values of AST and ALT, and the vertical axis shows the liver methylation score. (A) Detection of liver damage using cfDNA biomarkers. Each liverP A T E N T Attorney Docket No.: 4552-2000740 methylation score of cfDNA in plasma sample and liver genomic DNA obtained from rats were calculated. (B) Comparison to ALT / AST with liver methylation scores. ALT / AST values and liver methylation scores were scatter-plotted. (C) Spike-in Simulation. To simulate lower levels of hepatotoxicity, computational simulations were performed. Mixed sequencing reads from Plasma TAA 9h and Plasma No Treatment. 10%:90% mixture could be reliably detected.

[0017] Figure 5 illustrates exemplary detection of drug-induced testes damage in rats. (A) Detection of testes damage using cfDNA biomarkers. Each testes methylation score of cfDNA in plasma samples obtained from drug-treated rats were calculated. The horizontal axis shows the number of days of drug treatment prior to blood draw, the vertical axis shows the testes methylation score, and the legend indicates the drug dosage. (B) Comparison to histopathological severity score with testes methylation scores. The pathology score obtained from testes biopsy was scatter-plotted against the testes methylation scores. The horizontal axis shows the pathology score, and the vertical axis shows the testes score.

[0018] Figure 6 illustrates exemplary generation of rat tissue-specific methylation database. Methylation haplotype metrics from samples comprising 9 tissue types (colon, gastrocnemius, heart, kidney, liver, lung, small intestine, stomach, and testes) were clustered using hierarchical clustering. The heatmap color indicates the correlation coefficient between each sample.

[0019] Figure 7 illustrates the Python Code used in Example 1.

[0020] Figure 8 illustrates the Python Code used in Example 2.

[0021] Figure 9 illustrates the Python Code used in Example 3. DETAILED DESCRIPTION

[0022] Numerous specific details are set forth in the following description in order to provide a thorough understanding of the present disclosure. These details are provided for the purpose of example and the claimed subject matter may be practiced according to the claims without some or all of these specific details. It is to be understood that other embodiments can be used and structural changes can be made without departing from the scope of the claimed subject matter. It should be understood that the various features and functionality described in one or more of the individual embodiments are not limited in their applicability to the particular embodiment with which they are described. They instead can, be applied, alone or in someP A T E N T Attorney Docket No.: 4552-2000740 combination, to one or more of the other embodiments of the disclosure, whether or not such embodiments are described, and whether or not such features are presented as being a part of a described embodiment. For the purpose of clarity, technical material that is known in the technical fields related to the claimed subject matter has not been described in detail so that the claimed subject matter is not unnecessarily obscured.

[0023] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entireties for all purposes to the same extent as if each individual publication were individually incorporated by reference. Citation of the publications or documents is not intended as an admission that any of them is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.

[0024] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0025] The practice of the provided embodiments will employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and sequencing technology, which are within the skill of those who practice in the art. Such conventional techniques include polypeptide and protein synthesis and modification, polynucleotide synthesis and modification, polymer array synthesis, hybridization and ligation of polynucleotides, detection of hybridization, and nucleotide sequencing. Specific illustrations of suitable techniques can be had by reference to the examples herein. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Green, et al., Eds., Genome Analysis: A Laboratory Manual Series (Vols. I-IV) (1999); Weiner, Gabriel, Stephens, Eds., Genetic Variation: A Laboratory Manual (2007); Dieffenbach, Dveksler, Eds., PCR Primer: A Laboratory Manual (2003); Bowtell and Sambrook, DNA Microarrays: A Molecular Cloning Manual (2003); Mount, Bioinformatics: Sequence and Genome Analysis (2004); Sambrook and Russell, Condensed Protocols from Molecular Cloning: A Laboratory Manual (2006); and Sambrook and Russell, Molecular Cloning: A Laboratory Manual (2002) (all from Cold Spring Harbor Laboratory Press); Ausubel et al. eds., Current Protocols in Molecular Biology (1987); T. Brown ed., Essential Molecular Biology (1991), IRL Press; Goeddel ed., Gene ExpressionP A T E N T Attorney Docket No.: 4552-2000740 Technology (1991), Academic Press; A. Bothwell et al. eds., Methods for Cloning and Analysis of Eukaryotic Genes (1990), Bartlett Publ.; M. Kriegler, Gene Transfer and Expression (1990), Stockton Press; R. Wu et al. eds., Recombinant DNA Methodology (1989), Academic Press; M. McPherson et al., PCR: A Practical Approach (1991), IRL Press at Oxford University Press; Stryer, Biochemistry (4th Ed.) (1995), W. H. Freeman, New York N.Y.; Gait, Oligonucleotide Synthesis: A Practical Approach (2002), IRL Press, London; Nelson and Cox, Lehninger, Principles of Biochemistry (2000) 3rd Ed., W. H. Freeman Pub., New York, N.Y.; Berg, et al., Biochemistry (2002) 5th Ed., W. H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entireties by reference for all purposes. A. Definitions

[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which the present disclosure belongs. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth in this section prevails over the definition that is incorporated herein by reference.

[0027] As used herein, “a” or “an” means “at least one” or “one or more.” As used herein, the singular forms “a,” “an,” and “the” include the plural reference unless the context clearly dictates otherwise.

[0028] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both ofP A T E N T Attorney Docket No.: 4552-2000740 the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range.

[0029] Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”. Additionally, use of “about” preceding any series of numbers includes “about” each of the recited numbers in that series. For example, description referring to “about X, Y, or Z” is intended to describe “about X, about Y, or about Z.”

[0030] The term “average” as used herein refers to either a mean or a median, or any value used to approximate the mean or the median, unless the context clearly indicates otherwise.

[0031] A “subject” as used herein refers to an organism, or a part or component of the organism, to which the provided compositions, methods, kits, devices, and systems can be administered or applied. For example, the subject can be a mammal or a cell, a tissue, an organ, or a part of the mammal. As used herein, “mammal” refers to any of the mammalian class of species, preferably human (including humans, human subjects, or human patients). Subjects and mammals include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, and rodents such as mice and rats.

[0032] As used herein the term “sample” refers to anything which may contain a target molecule for which analysis is desired, including a biological sample. As used herein, a “biological sample” can refer to any sample obtained from a living or viral (or prion) source or other source of macromolecules and biomolecules, and includes any cell type or tissue of a subject from which nucleic acid, protein and / or other macromolecule can be obtained. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. For example, isolated nucleic acids that are amplified constitute a biological sample. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, tears, mucus, amniotic fluid or the like, an effusion, a bone marrow sample, ascitic fluid, pelvic wash fluid, pleural fluid, spinal fluid, lymph, ocular fluid, extract of nasal, throat or genital swab, cell suspension from digested tissue, or extract of fecal material, and tissue and organ samples from humans, animals, e.g., non-human mammals, and plants and processed samples derived therefrom.

[0033] The terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” are used interchangeably herein to refer to a polymeric form of nucleotides of anyP A T E N T Attorney Docket No.: 4552-2000740 length, and comprise ribonucleotides, deoxyribonucleotides, and analogs or mixtures thereof. The terms include triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and / or by capping, and unmodified forms of the polynucleotide. More particularly, the terms “polynucleotide,” “oligonucleotide,” “nucleic acid,” and “nucleic acid molecule” include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (“PNAs”)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, OR, as Neugene) polymers, and other synthetic sequence- specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. Thus, these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' to P5' phosphoramidates, 2'-O-alkyl-substituted RNA, hybrids between DNA and RNA or between PNAs and DNA or RNA, and also include known types of modifications, for example, labels, alkylation, “caps,” substitution of one or more of the nucleotides with an analog, inter- nucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalkylphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including enzymes (e.g. nucleases), toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelates (of, e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide. A nucleic acid generally will contain phosphodiester bonds, although in some cases nucleic acid analogs may be included that have alternative backbones such as phosphoramidite, phosphorodithioate, or methylphophoroamidite linkages; or peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with bicyclic structures including locked nucleic acids, positive backbones, non-ionic backbones and non-ribose backbones. Modifications of theP A T E N T Attorney Docket No.: 4552-2000740 ribose-phosphate backbone may be done to increase the stability of the molecules; for example, PNA:DNA hybrids can exhibit higher stability in some environments. The terms “polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” can comprise any suitable length, such as at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, or more nucleotides.

[0034] It will be appreciated that, as used herein, the terms “nucleoside” and “nucleotide” include those moieties which contain not only the known purine and pyrimidine bases, but also other heterocyclic bases which have been modified. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, or other heterocycles. Modified nucleosides or nucleotides can also include modifications on the sugar moiety, e.g., wherein one or more of the hydroxyl groups are replaced with halogen, aliphatic groups, or are functionalized as ethers, amines, or the like. The term “nucleotidic unit” is intended to encompass nucleosides and nucleotides.

[0035] The terms “complementary” and “substantially complementary” include the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, for instance, between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single- stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the other strand, usually at least about 90% to about 95%, and even about 98% to about 100%. In one aspect, two complementary sequences of nucleotides are capable of hybridizing, preferably with less than 25%, more preferably with less than 15%, even more preferably with less than 5%, most preferably with no mismatches between opposed nucleotides. Preferably the two molecules will hybridize under conditions of high stringency.

[0036] As used herein, for a reference sequence, the reverse complementary sequence is the complementary sequence of the reference sequence in the reverse order. For example, for 5’- ATCG-3’, the complementary sequence is 3’-TAGC-5’, and the reverse-complementary sequence is 5’-CGAT-3’.P A T E N T Attorney Docket No.: 4552-2000740

[0037] “Hybridization” as used herein may refer to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide. In one aspect, the resulting double-stranded polynucleotide can be a “hybrid” or “duplex.” “Hybridization conditions” typically include salt concentrations of approximately less than 1 M, often less than about 500 mM and may be less than about 200 mM. A “hybridization buffer” includes a buffered salt solution such as 5% SSPE, or other such buffers known in the art. Hybridization temperatures can be as low as 5°C, but are typically greater than 22°C, and more typically greater than about 30°C, and typically in excess of 37°C. Hybridizations are often performed under stringent conditions, i.e., conditions under which a sequence will hybridize to its target sequence but will not hybridize to other, non-complementary sequences. Stringent conditions are sequence-dependent and are different in different circumstances. For example, longer fragments may require higher hybridization temperatures for specific hybridization than short fragments. As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents, and the extent of base mismatching, the combination of parameters is more important than the absolute measure of any one parameter alone. Generally stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence at a defined ionic strength and pH. The melting temperature Tmcan be the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation, Tm =81.5 + 0.41 (% G + C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson, M.L.M. and Young, B.D. 1985, Quantitative filter hybridization. In: Nucleic acid hybridization: a practical approach, 73– 111. B. D. Hames and S. J. Higgins (eds.). IRL Press Limited, Oxford.). Other references (e.g., Allawi and SantaLucia, Jr., Biochemistry, 36:10581-94 (1997)) include alternative methods of computation which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.

[0038] In general, the stability of a hybrid is a function of the ion concentration and temperature. Typically, a hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Exemplary stringent conditions include a salt concentration of at least 0.01 M to no more than 1 M sodium ionP A T E N T Attorney Docket No.: 4552-2000740 concentration (or other salt) at a pH of about 7.0 to about 8.3 and a temperature of at least 25°C. For example, conditions of 5 × SSPE (750 mM NaCl, 50 mM sodium phosphate, 5 mM EDTA at pH 7.4) and a temperature of approximately 30°C are suitable for allele-specific hybridizations, though a suitable temperature depends on the length and / or GC content of the region hybridized. In one aspect, “stringency of hybridization” in determining percentage mismatch can be as follows: 1) high stringency: 0.1 × SSPE, 0.1% SDS, 65°C; 2) medium stringency: 0.2 × SSPE, 0.1% SDS, 50°C (also referred to as moderate stringency); and 3) low stringency: 1.0 × SSPE, 0.1% SDS, 50°C. It is understood that equivalent stringencies may be achieved using alternative buffers, salts and temperatures. For example, moderately stringent hybridization can refer to conditions that permit a nucleic acid molecule such as a probe to bind a complementary nucleic acid molecule. The hybridized nucleic acid molecules generally have at least 60% identity, including for example at least any of 70%, 75%, 80%, 85%, 90%, or 95% identity. Moderately stringent conditions can be conditions equivalent to hybridization in 50% formamide, 5 × Denhardt’s solution, 5x SSPE, 0.2% SDS at 42ºC, followed by washing in 0.2 × SSPE, 0.2% SDS, at 42ºC. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5 × Denhardt’s solution, 5 × SSPE, 0.2% SDS at 42ºC, followed by washing in 0.1 × SSPE, and 0.1% SDS at 65ºC. Low stringency hybridization can refer to conditions equivalent to hybridization in 10% formamide, 5 × Denhardt’s solution, 6 × SSPE, 0.2% SDS at 22ºC, followed by washing in 1x SSPE, 0.2% SDS, at 37ºC. Denhardt’s solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20 × SSPE (sodium chloride, sodium phosphate, EDTA) contains 3 M sodium chloride, 0.2 M sodium phosphate, and 0.025 M EDTA. Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, N.Y. (1989); and Ausubel et al., Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons (1999).

[0039] Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementary. See M. Kanehisa, Nucleic Acids Res.12:203 (1984).P A T E N T Attorney Docket No.: 4552-2000740

[0040] A “primer” used herein can be an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed. The sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide. Primers usually are extended by a polymerase, for example, a DNA polymerase.

[0041] “Ligation” may refer to the formation of a covalent bond or linkage between the termini of two or more nucleic acids, e.g., oligonucleotides and / or polynucleotides, in a template-driven reaction. The nature of the bond or linkage may vary widely and the ligation may be carried out enzymatically. As used herein, ligations are usually carried out enzymatically to form a phosphodiester linkage between a 5' carbon terminal nucleotide of one oligonucleotide with a 3' carbon of another nucleotide.

[0042] “Amplification,” as used herein, generally refers to the process of producing multiple copies of a desired sequence. “Multiple copies” means at least 2 copies. A “copy” does not necessarily mean perfect sequence complementarity or identity to the template sequence. For example, copies can include nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations introduced through a primer comprising a sequence that is hybridizable, but not complementary, to the template), and / or sequence errors that occur during amplification.

[0043] “Sequence determination” and the like include determination of information relating to the nucleotide base sequence of a nucleic acid. Such information may include the identification or determination of partial as well as full sequence information of the nucleic acid. Sequence information may be determined with varying degrees of statistical reliability or confidence. In one aspect, the term includes the determination of the identity and ordering of a plurality of contiguous nucleotides in a nucleic acid.

[0044] The term “Sequencing,” “High throughput sequencing,” or “next generation sequencing” includes sequence determination using methods that determine many (typically thousands to billions) of nucleic acid sequences in an intrinsically parallel manner, i.e. where DNA templates are prepared for sequencing not one at a time, but in a bulk process, and where many sequences are read out preferably in parallel, or alternatively using an ultra-high throughput serial process that itself may be parallelized. Such methods include but are notP A T E N T Attorney Docket No.: 4552-2000740 limited to pyrosequencing (for example, as commercialized by 454 Life Sciences, Inc., Branford, CT); sequencing by ligation (for example, as commercialized in the SOLiD™ technology, Life Technologies, Inc., Carlsbad, CA); sequencing by synthesis using modified nucleotides (such as commercialized in TruSeq™ and HiSeq™ technology by Illumina, Inc., San Diego, CA; HeliScope™ by Helicos Biosciences Corporation, Cambridge, MA; and PacBio RS by Pacific Biosciences of California, Inc., Menlo Park, CA), sequencing by ion detection technologies (such as Ion Torrent™ technology, Life Technologies, Carlsbad, CA); sequencing of DNA nanoballs (Complete Genomics, Inc., Mountain View, CA); nanopore-based sequencing technologies (for example, as developed by Oxford Nanopore Technologies, LTD, Oxford, UK), and like highly parallelized sequencing methods.

[0045] “SNP” or “single nucleotide polymorphism” may include a genetic variation between individuals; e.g., a single nitrogenous base position in the DNA of organisms that is variable. SNPs are found across the genome; much of the genetic variation between individuals is due to variation at SNP loci, and often this genetic variation results in phenotypic variation between individuals. SNPs for use in the present disclosure and their respective alleles may be derived from any number of sources, such as public databases (U.C. Santa Cruz Human Genome Browser Gateway (genome.ucsc.edu / cgi-bin / hgGateway) or the NCBI dbSNP website (ncbi.nlm.nih gov / SNP / ), or may be experimentally determined as described in U.S. Pat. No. 6,969,589; and US Pub. No.2006 / 0188875 entitled “Human Genomic Polymorphisms.” Although the use of SNPs is described in some of the embodiments presented herein, it will be understood that other biallelic or multi-allelic genetic markers may also be used. A biallelic genetic marker is one that has two polymorphic forms, or alleles. As mentioned above, for a biallelic genetic marker that is associated with a trait, the allele that is more abundant in the genetic composition of a case group as compared to a control group is termed the “associated allele,” and the other allele may be referred to as the “unassociated allele.” Thus, for each biallelic polymorphism that is associated with a given trait (e.g., a disease or drug response), there is a corresponding associated allele. Other biallelic polymorphisms that may be used with the methods presented herein include, but are not limited to multinucleotide changes, insertions, deletions, and translocations.

[0046] It will be further appreciated that references to DNA herein may include genomic DNA, mitochondrial DNA, episomal DNA, and / or derivatives of DNA such as amplicons, RNAP A T E N T Attorney Docket No.: 4552-2000740 transcripts, cDNA, DNA analogs, etc. The polymorphic loci that are screened in an association study may be in a diploid or a haploid state and, ideally, would be from sites across the genome. Sequencing technologies are available for SNP sequencing, such as the BeadArray platform (GOLDENGATETMassay) (Illumina, Inc., San Diego, CA) (see Fan, et al., Cold Spring Symp. Quant. Biol., 68:69-78 (2003)), may be employed.

[0047] In some embodiments, the term “methylation state” or “methylation status” refers to the presence or absence of 5-methylcytosine (“5-mC” or “5-mCyt”) at one or a plurality of CpG dinucleotides within a DNA sequence. Methylation states at one or more particular CpG methylation sites (each having two CpG dinucleotide sequences) within a DNA sequence include “unmethylated,” “fully-methylated,” and “hemi-methylated.” The term “hemi- methylation” or “hemimethylation” refers to the methylation state of a double stranded DNA wherein only one strand thereof is methylated. The term “hypermethylation” refers to the average methylation state corresponding to an increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5- mCyt found at corresponding CpG dinucleotides within a normal control DNA sample. The term “hypomethylation” refers to the average methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.

[0048] “Multiplexing” or “multiplex assay” herein may refer to an assay or other analytical method in which the presence, amount and / or methylation state (or methylation status) of multiple targets, e.g., multiple nucleic acid sequences, can be assayed simultaneously by using more than one markers, each of which has at least one different detection characteristic, e.g., fluorescence characteristic (for example excitation wavelength, emission wavelength, emission intensity, FWHM (full width at half maximum peak height), or fluorescence lifetime) or a unique nucleic acid or protein sequence characteristic.

[0049] As used herein, “disease or disorder” refers to a pathological condition in an organism resulting from, e.g., infection or genetic defect, and characterized by identifiable symptoms.P A T E N T Attorney Docket No.: 4552-2000740 B. Panels of isolated polynucleotides and related compositions

[0050] In one aspect, provided herein is a panel of isolated polynucleotides comprising, consisting of, or consisting essentially of, one or more isolated tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof.

[0051] In some embodiments, the present panel can comprise one or more isolated liver- specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof. For example, one, more or each of the isolated tissue-specific or organ-specific target polynucleotide(s) in the present panel: a) can be located in one or more gene(s) that is or are specific for liver as listed in Table 1; or b) can comprise, consist essentially of, or consist of, one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof.

[0052] In some embodiments, the present panel can comprise one or more isolated testes- specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof. For example, one, more or each of the isolated tissue-specific or organ-specific target polynucleotide(s) in the present panel: a) can be located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) can be located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 1; or c) can comprise, consist essentially of, or consist of, one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof.

[0053] The present panel can comprise, consist of, or consist essentially of, any suitable number of the above isolated polynucleotides. For example, the present panel can comprise, consist of, or consist essentially of, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more isolated tissue-specific or organ- specific target polynucleotides, e.g., isolated tissue-specific or organ-specific target polynucleotides for one or more tissue(s) or organ(s) of whole genome of a subject, or a complementary or substantially complementary sequence thereof.

[0054] The isolated polynucleotides in the present panel can be any suitable type(s) of polynucleotides. For example, the isolated tissue-specific or organ-specific targetP A T E N T Attorney Docket No.: 4552-2000740 polynucleotide(s) in the present panel are DNA molecules, RNA molecules, or a combination thereof.

[0055] The isolated polynucleotides can be immobilized on a substrate. The isolated polynucleotides can be immobilized on any suitable substrate. For example, the substrate can comprise a solid surface, a porous surface, or a combination thereof. In some embodiments, the substrate can be a part of a bead, a tube, a microtiter plate, a membrane, a gel, or a glass slide. In other embodiments, the isolated polynucleotide molecules can be immobilized spatially apart from each other on a substrate so that each of the isolated polynucleotide molecules can be assessed or analyzed individually.

[0056] Kits, devices, systems or articles of manufacture that comprise any of the above panel(s) are also provided.

[0057] The present kits, devices, systems or articles of manufacture can be configured for any suitable use or purpose. For example, the present kits, devices, systems or articles of manufacture can be configured for assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, e.g., configured for in vitro assessing of methylation status of the one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, in one or more sample that comprises cell-free target polynucleotide(s) from a subject. In some embodiments, the present kits, devices, systems or articles of manufacture can be configured for assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more isolated tissue-specific or organ-specific target polynucleotides, e.g., isolated tissue- specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof. In other embodiments, the isolated polynucleotides in the present kits, devices, systems or articles of manufacture can be configured as control polynucleotides.

[0058] The isolated polynucleotides in the present kits, devices, systems or articles of manufacture can have any suitable level of concentration. For example, the isolated polynucleotides can have a level of concentration from about 1 femtomolar to about 100 millimolar, e.g., at about 1 femtomolar (fM), 10 fM, 100 fM, 1 picomolar (pM), 10 pM, 100 pM,P A T E N T Attorney Docket No.: 4552-2000740 1 nanomolar (nM), 10 nM, 100 nM, 1 micromolar (μM), 10 μM, 100 μM, 1 millimolar (mM), 10 mM, 100 mM, or a subrange thereof.

[0059] The present kits, devices, systems or articles of manufacture can be configured for any suitable use or purpose. For example, the kits, devices, systems or articles of manufacture can be configured for assessing tissue and / or organ damage or toxicity in the subject.

[0060] The one or more tissue-specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2 consecutive polynucleotides of a tissue- specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue- specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject.

[0061] In some embodiments, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject. For example, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more tissues or organs of the subject. In some embodiments, the tissue-specific or organ-specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject.

[0062] In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes an RNA that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes a polypeptide that is specific for the tissue or organ in the subject.

[0063] In some embodiments, the one or more tissue-specific or organ-specific target polynucleotide(s) / gene(s) is or are listed in Table 1 below, or is or are a subgroup of the tissue- specific or organ-specific target polynucleotide(s) / gene(s) that is or are listed in Table 1. For example, the tissue-specific or organ-specific target polynucleotide(s) / gene(s) can be a single,P A T E N T Attorney Docket No.: 4552-2000740 multiple or all tissue-specific or organ-specific target polynucleotide(s) / gene(s) for a particular tissue or organ or for selective groups of tissues or organs listed in Table 1. C. Kits, systems and related compositions for assessing methylation

[0064] In another aspect, a kit, device, system or an article of manufacture which comprises reagents for assessing methylation status of one or more of isolated tissue-specific or organ- specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, is provided. In some embodiments, the present kits, devices, systems or articles of manufacture are configured for in vitro assessing of methylation status of one or more of isolated tissue-specific or organ-specific target polynucleotide(s) in one or more sample(s) that comprises cell-free target polynucleotide(s) from one or more subject(s), e.g., one or more blood or plasma sample(s) obtained from one or more subject(s).

[0065] The present kits, devices, systems or articles of manufacture can comprise reagents for assessing methylation status of any suitable number of tissue-specific or organ-specific target polynucleotide(s). For example, the present kits, devices, systems or articles of manufacture can comprise reagents for assessing methylation status of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides, e.g., tissue-specific or organ-specific target polynucleotides for one or more tissue(s) or organ(s) of whole genome of a subject, or a complementary or substantially complementary sequence thereof. In some embodiments, the present kits, devices, systems or articles of manufacture can comprise reagents for assessing methylation status of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides located in one or more genes listed in Table 1 below. In some embodiments, the present kits, devices, systems or articles of manufacture can comprise reagents for assessing methylation status of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides located in one or more genes for one organ for multiple organs listed in Table 1 below.P A T E N T Attorney Docket No.: 4552-2000740 Table 1. Exemplary tissue-specific or organ-specific target polynucleotides / genes ORGAN GENOMIC REGION ASSOCIATED GENE(S) Colon chr13:79651128-79651130 Fasl, Tnfsf18 chr5:58982899-58982901 Cd72, Sit1chr17:6925491-6925493 Klhl3, Hnrnpa0Colon chr5:118238047- Foxd3, Gm12689 118238049 Colon chr5:169269363- Plekhg5 169269365 Colon chr8:97244866-97244868 Ankrd34c, Rasgrf1 Colon chr1:222671352- 2700081O15Rik, Rtn3 222671354 Colon chr13:79651200-79651202 Fasl, Tnfsf18 Colon chr5:102806778- Bnc2 102806780 Colon chr10:106241732- Gm11733, Sept9 106241734 Colon chr9:66264094-66264096 Fzd7, Cdk15 Colon chr4:118299362- None 118299364 Colon chr6:33911362-33911364 Laptm4a, Sdc1 Colon chr15:41826863-41826865 Kpna3, Spryd7 Colon chr2:187995384- Arhgef2, Rxfp4 187995386 Colon chr7:53333359-53333361 Csrp2, E2f7 Colon chr1:100653139- Myh14, Kcnc3 100653141 Colon chr17:12669223-12669225 Syk, Auh Colon chr2:120897710- Dnajc19, Sox2 120897712 Colon chr1:32641314-32641316 Irx4, Ndufs6 Colon chr1:93691393-93691395 Zfp536, Tshz3 Colon chr1:80128491-80128493 Opa3, Gpr4 Colon chr1:224867432- Chrm1 224867434 Colon chr10:98744072-98744074 Kcnj16, Map2k6 Colon chr1:184764972- Insc, Sox6 184764974 Colon chr2:5576412-5576414 Nr2f1, Pou5f2 Colon chr6:26193088-26193090 Mrpl33, Slc4a1apP A T E N T Attorney Docket No.: 4552-2000740 Colon chr17:15749708-15749710 Fgd3 Colon chr19:26236259-26236261 Zfp791, Man2b1 Colon chr10:82802355-82802357 Samd14, Ppp1r9b Colon chr10:106241781- Gm11733, Sept9 106241783 Colon chr9:43045134-43045136 Cnnm4 Colon chr10:11810831-11810833 Nlrc3 Colon chr15:108463901- Tm9sf2, Timm8a2 108463903 Colon chr7:120140928- Lgals1, Sh3bp1 120140930 Colon chr4:7338902-7338904 Nos3, Atg9b Colon chr13:48446623-48446625 Rab7b, Ctse Colon chr3:62421437-62421439 Hnrnpa3, Mtx2 Colon chr18:48432211-48432213 Prdm6 Colon chr17:70337279-70337281 Gdi2 Colon chr5:101360470- Frem1, Ttc39b 101360472 Colon chr5:118238038- Foxd3, Gm12689 118238040 Colon chr14:103312874- Meis1 103312876 Colon chr8:48861672-48861674 Cxcr5, Bcl9l Colon chr3:61609403-61609405 Hoxd10, Hoxd13 Colon chr17:42549173-42549175 Ripor2, Cmah Colon chr2:181975105- Lrat, Fgg 181975107 Colon chr4:120755763- Abtb1, Mgll 120755765 Colon chr1:260291271- Dntt, Opalin 260291273 Colon chr17:4982912-4982914 None Colon chr10:106241801- Gm11733, Sept9 106241803 Colon chr20:31927938-31927940 Tacr2, Hk1 Colon chr2:20857798-20857800 Acot12 Colon chr3:61040240-61040242 Atp5g3, Lnpk Colon chr8:12101148-12101150 Maml2, Ccdc82 Colon chr5:167056608- Gpr157, H6pd 167056610 Colon chr5:169707340- Nphp4, Ajap1 169707342P A T E N T Attorney Docket No.: 4552-2000740 Colon chr20:4407466-4407468 Atf6b, Prrt1 Colon chr14:60713359-60713361 Lgi2, Sepsecs Colon chr1:80128423-80128425 Opa3, Gpr4 Colon chr10:104556878- Galk1, Itgb4 104556880 Colon chr8:12101144-12101146 Maml2, Ccdc82 Colon chr1:260582347- Tm9sf3, Pik3ap1 260582349 Colon chr15:41826913-41826915 Kpna3, Spryd7 Colon chr2:94106725-94106727 Fabp5, Pag1 Colon chr10:46548658-46548660 Srebf1, Rai1 Colon chr2:5576190-5576192 Nr2f1, Pou5f2 Colon chr17:4982886-4982888 None Colon chr10:82802466-82802468 Samd14, Ppp1r9b Colon chr18:59835584-59835586 Onecut2, Fech Colon chr10:18052482-18052484 Smim23, Fgf18 Colon chr19:52242512-52242514 Taf1c, Dnaaf1 Colon chr11:70672500-70672502 Zfp148, Snx4 Colon chr10:11810784-11810786 Nlrc3 Colon chr5:101360582- Frem1, Ttc39b 101360584 Colon chr8:114897470- Ppm1m, Twf2 114897472 Colon chr2:5576240-5576242 Nr2f1, Pou5f2 Colon chr5:157165180- Pla2g2c 157165182 Colon chr2:199095045- Gja5, Gja8 199095047 Colon chr10:63738259-63738261 Inpp5k, Pitpna Colon chr6:104408553- Ccdc177, Plekhd1 104408555 Colon chr5:101360527- Frem1, Ttc39b 101360529 Colon chr1:219320692- Cabp2, Gstp3 219320694 Colon chr10:38823928-38823930 Gm9837, Shroom1 Colon chr11:35729354-35729356 Erg, Kcnj15 Colon chr5:118238017- Foxd3, Gm12689 118238019 Colon chr2:5576220-5576222 Nr2f1, Pou5f2P A T E N T Attorney Docket No.: 4552-2000740 Colon chr13:106063826- Esrrg, Gpatch2 106063828 Colon chr17:27634423-27634425 Rreb1, Ssr1 Colon chr3:61597438-61597440 Hoxd10, Hoxd13 Colon chr20:4407398-4407400 Atf6b, Prrt1 Colon chr5:169269327- Plekhg5 169269329 Colon chr15:90194719-90194721 Spry2, Gm4775 Colon chr4:118299377- Pcbp1, C87436 118299379 Colon chr1:226265504- Fen1, Myrf 226265506 Colon chr6:104408542- Ccdc177, Plekhd1 104408544 Gastrocnemius chr10:45279275-45279277 Rnf187 Gastrocnemius chr4:149957599- Hnrnpf 149957601 Gastrocnemius chr5:137264650- Cdc20 137264652 Gastrocnemius chr12:9360840-9360842 Flt3 Gastrocnemius chr7:36000991-36000993 Plxnc1 Gastrocnemius chr10:16638173-16638175 Nkx2-5, Bnip1 Gastrocnemius chr10:86711724-86711726 Msl1 Gastrocnemius chr7:99954926-99954928 Trib1 Gastrocnemius chr1:226501381- Lrrc10b 226501383 Gastrocnemius chr14:76856978-76856980 Zfp518b Gastrocnemius chr7:131331271- Alg10b 131331273 Gastrocnemius chr6:10533551-10533553 Rhoq Gastrocnemius chr1:94404044-94404046 Uri1 Gastrocnemius chr6:26680177-26680179 Cad Gastrocnemius chr15:56969723-56969725 Lrch1 Gastrocnemius chr19:10898747-10898749 Cpne2 Gastrocnemius chr6:11274924-11274926 Msh2 Gastrocnemius chr12:40114891-40114893 Fam109a, Cux2 Gastrocnemius chr6:8955699-8955701 Six2 Gastrocnemius chr10:35725862-35725864 Mgat4b Gastrocnemius chr20:7921392-7921394 Tead3, Rpl10a Gastrocnemius chr1:7065131-7065133 Stx11 Gastrocnemius chr2:44858163-44858165 CcnoP A T E N T Attorney Docket No.: 4552-2000740 Gastrocnemius chr2:188562348- Trim46, Krtcap2 188562350 Gastrocnemius chr9:93377390-93377392 Ncl Gastrocnemius chr17:68573018-68573020 Pfkp, Pitrm1 Gastrocnemius chr2:142885046- Frem2 142885048 Gastrocnemius chr18:57031482-57031484 Pcyox1l Gastrocnemius chr14:17283189-17283191 Naaa Gastrocnemius chr1:211732804- Inpp5a 211732806 Gastrocnemius chr17:51909571-51909573 Inhba Gastrocnemius chr1:57327519-57327521 Dll1 Gastrocnemius chr7:24313853-24313855 Btbd11 Gastrocnemius chr4:79846693-79846695 Mpp6 Gastrocnemius chr14:115166554- Psme4 115166556 Gastrocnemius chr2:550466-550468 Alkbh8, Gm10715 Gastrocnemius chr12:41663544-41663546 Lhx5, Sdsl Gastrocnemius chr1:225185091- Ahnak 225185093 Gastrocnemius chr1:274031161- Mxi1 274031163 Gastrocnemius chr1:282169628- Eif3a 282169630 Gastrocnemius chr3:177202104- Rgs19 177202106 Gastrocnemius chr10:45279185-45279187 Rnf187 Gastrocnemius chr2:244057774- Tspan5 244057776 Gastrocnemius chr2:210087987- Rbm15, Slc16a4 210087989 Gastrocnemius chr10:15196049-15196051 Jmjd8 Gastrocnemius chr7:23843337-23843339 Fbxo7 Gastrocnemius chr7:122924561- Chadl, L3mbtl2 122924563 Gastrocnemius chr1:20332214-20332216 Tmem200a Gastrocnemius chr1:53014342-53014344 Sft2d1 Gastrocnemius chr19:44231663-44231665 Kars, Terf2ip Gastrocnemius chr14:5166953-5166955 Zfp326, Lrrc8d Gastrocnemius chr1:140860687- Mfge8 140860689 Gastrocnemius chr10:37707258-37707260 Tcf7, Vdac1P A T E N T Attorney Docket No.: 4552-2000740 Gastrocnemius chr3:92290605-92290607 Trim44, Fjx1 Gastrocnemius chr8:21890408-21890410 A230050P20Rik Gastrocnemius chr6:95998527-95998529 Six4 Gastrocnemius chr13:90466949-90466951 Copa, Ncstn Gastrocnemius chr10:89916269-89916271 1700006E09Rik, Dusp3 Gastrocnemius chr8:32360541-32360543 Aplp2 Gastrocnemius chr17:21577425-21577427 Tmem14c Gastrocnemius chr3:122813390- Idh3b 122813392 Gastrocnemius chr14:82196979-82196981 Nsd2 Gastrocnemius chr2:127627197- Hspa4l 127627199 Gastrocnemius chr3:2410284-2410286 Tor4a, Nrarp Gastrocnemius chr15:41084488-41084490 Mipep Gastrocnemius chr19:24329434-24329436 Tbc1d9 Gastrocnemius chr10:109520770- Actg1 109520772 Gastrocnemius chr11:31847258-31847260 Donson Gastrocnemius chr20:32509771-32509773 None Gastrocnemius chr1:222168007- Prdx5, Trmt112 222168009 Gastrocnemius chr8:82257874-82257876 Bcl2l10, Gnb5 Gastrocnemius chr9:44126883-44126885 Mgat4a Gastrocnemius chr17:37616212-37616214 Sox4, Prl5a1 Gastrocnemius chr12:39768709-39768711 Pptc7 Gastrocnemius chr20:10680179-10680181 Sik1 Gastrocnemius chr7:132757115- Slc2a13 132757117 Gastrocnemius chr8:22051411-22051413 Icam5, Zglp1 Gastrocnemius chr20:10680123-10680125 Sik1 Gastrocnemius chr5:60900958-60900960 Dcaf10 Gastrocnemius chr6:109939530- Tgfb3, Ift43 109939532 Gastrocnemius chr13:109789291- Atf3 109789293 Gastrocnemius chr20:2103459-2103461 Rnf39 Gastrocnemius chr3:139001860- Insm1, Ralgapa2 139001862 Gastrocnemius chr1:264767888- Lzts2, Pdzd7 264767890P A T E N T Attorney Docket No.: 4552-2000740 Gastrocnemius chr19:19323605-19323607 Cyld Gastrocnemius chr11:47113599-47113601 Zbtb11 Gastrocnemius chr9:86571646-86571648 Dock10 Gastrocnemius chr1:72895263-72895265 Ppp1r12c, Tnnt1 Gastrocnemius chr13:91162477-91162479 Cfap126, Fcgr3 Gastrocnemius chr16:20297620-20297622 Slc5a5 Gastrocnemius chr17:70010916-70010918 Net1, Calm5 Gastrocnemius chr9:71313895-71313897 Mettl21a Gastrocnemius chr20:29655703-29655705 Spock2 Gastrocnemius chr12:52186861-52186863 Galnt9 Gastrocnemius chr1:226459640- Syt7, Lrrc10b 226459642 Gastrocnemius chr2:113652320- Pld1 113652322 Heart chr13:79651128-79651130 Fasl, Tnfsf18 Heart chr5:118238047- Foxd3, Gm12689 118238049 Heart chr20:11737385-11737387 Sumo3 Heart chr4:153778254- Usp18, Tuba8 153778256 Heart chr1:222671352- 2700081O15Rik, Rtn3 222671354 Heart chr6:129216660- None 129216662 Heart chr2:5592842-5592844 Nr2f1 Heart chr16:20150682-20150684 Fcho1 Heart chr19:54000587-54000589 Fam92b, Gse1 Heart chr18:55891197-55891199 Synpo Heart chr10:63738259-63738261 Inpp5k, Pitpna Heart chr17:12669223-12669225 Syk, Auh Heart chr2:120897710- Dnajc19, Sox2 120897712 Heart chr18:49940663-49940665 Zfp608 Heart chr8:97244866-97244868 Ankrd34c, Rasgrf1 Heart chr10:98744072-98744074 Kcnj16, Map2k6 Heart chr3:170398872- Cass4 170398874 Heart chr1:184764972- Insc, Sox6 184764974 Heart chr13:79270248-79270250 Tnfsf4 Heart chr9:43045134-43045136 Cnnm4P A T E N T Attorney Docket No.: 4552-2000740 Heart chr10:11810831-11810833 Nlrc3 Heart chr14:35434622-35434624 Kit, Pdgfra Heart chr4:7338902-7338904 Nos3, Atg9b Heart chr13:48446623-48446625 Rab7b, Ctse Heart chr14:107615218- None 107615220 Heart chr17:70337279-70337281 Gdi2 Heart chr8:73064453-73064455 Tpm1, Tln2 Heart chr5:118238038- Foxd3, Gm12689 118238040 Heart chr4:170931773- Arhgdib 170931775 Heart chr2:5592827-5592829 Nr2f1 Heart chr8:48861672-48861674 Cxcr5, Bcl9l Heart chr18:79606630-79606632 Zfp516, Zfp236 Heart chr5:157981929- Iffo2, Ubr4 157981931 Heart chr10:106150193- Sept9, Sec14l1 106150195 Heart chr5:147148068- Azin2 147148070 Heart chr19:37246462-37246464 4931428F04Rik Heart chr12:10254442-10254444 Gpr12 Heart chr1:260291271- Dntt, Opalin 260291273 Heart chr17:4982912-4982914 None Heart chr19:19745130-19745132 Adcy7 Heart chr18:79385037-79385039 Mbp, Zfp236 Heart chr9:47185325-47185327 Il18r1 Heart chr3:167047877- Zfp217, Bcas1 167047879 Heart chr2:198545536- Fcgr1, BC107364 198545538 Heart chr17:5087765-5087767 Zcchc6, Gas1 Heart chr1:260582347- Tm9sf3, Pik3ap1 260582349 Heart chr9:18645002-18645004 Supt3, Clic5 Heart chr18:74504601-74504603 Slc14a1, Slc14a2 Heart chr10:18052482-18052484 Smim23, Fgf18 Heart chr6:33911362-33911364 Laptm4a, Sdc1 Heart chr19:19745113-19745115 Adcy7P A T E N T Attorney Docket No.: 4552-2000740 Heart chr11:70672500-70672502 Zfp148, Snx4 Heart chr10:11810784-11810786 Nlrc3 Heart chr16:54444443-54444445 Pdgfrl, Mtus1 Heart chr14:103318842- Meis1 103318844 Heart chr1:142183744- Fes 142183746 Heart chr3:170398848- Cass4 170398850 Heart chr5:157165180- Pla2g2c 157165182 Heart chr2:199095045- Gja5, Gja8 199095047 Heart chr12:17174919-17174921 Uncx, Micall2 Heart chr10:39179667-39179669 None Heart chr1:219320692- Cabp2, Gstp3 219320694 Heart chr12:45181620-45181622 Taok3, Pebp1 Heart chr5:118238017- Foxd3, Gm12689 118238019 Heart chr11:87728385-87728387 Scarf2, Car15 Heart chr15:12831263-12831265 Fezf2, 3830406C13Rik Heart chr9:119156530- Tgif1, Dlgap1 119156532 Heart chr2:5576220-5576222 Nr2f1, Pou5f2 Heart chr1:82182712-82182714 Megf8 Heart chr4:61810544-61810546 Akr1b8 Heart chr18:74504534-74504536 Slc14a1, Slc14a2 Heart chr13:102644199- Hlx 102644201 Heart chr15:90194719-90194721 Spry2, Gm4775 Heart chr12:13213820-13213822 Kdelr2 Heart chr14:33174184-33174186 Spink2, Rest Heart chr1:226265504- Fen1, Myrf 226265506 Heart chr20:48245897-48245899 Gm9803, Bend3 Heart chr7:11446575-11446577 Zbtb7a Heart chr2:199095095- Gja5, Gja8 199095097 Heart chr7:70521760-70521762 Pip4k2c, Kif5a Heart chr2:185851563- Mab21l2 185851565P A T E N T Attorney Docket No.: 4552-2000740 Heart chr7:53333395-53333397 Csrp2, E2f7 Heart chr7:12381817-12381819 Mum1, Efna2 Heart chr8:48861770-48861772 Cxcr5, Bcl9l Heart chr17:9791421-9791423 Rgs14 Heart chr5:166513986- Clstn1, Ctnnbip1 166513988 Heart chr13:110784621- Traf5, Rd3 110784623 Heart chr4:179198004- None 179198006 Heart chr9:95592768-95592770 Glrp1, Arl4c Heart chr5:5874564-5874566 Slco5a1, Sulf1 Heart chr20:5446286-5446288 Vps52, B3galt4 Heart chr20:31927938-31927940 Tacr2, Hk1 Heart chr5:169269327- Plekhg5 169269329 Heart chr10:18052491-18052493 Smim23, Fgf18 Heart chr10:39373217-39373219 Slc22a4 Heart chr10:59529414-59529416 Atp2a3 Kidney chr13:79651128-79651130 Fasl, Tnfsf18 Kidney chr5:58982899-58982901 Cd72, Sit1 Kidney chr17:6925491-6925493 Klhl3, Hnrnpa0 Kidney chr5:118238047- Foxd3, Gm12689 118238049 Kidney chr18:30956230-30956232 Pcdhgc5, Pcdhgc3 Kidney chr1:222671352- 2700081O15Rik, Rtn3 222671354 Kidney chr10:46548639-46548641 Srebf1, Rai1 Kidney chr16:20150682-20150684 Fcho1 Kidney chr9:82540719-82540721 Dnpep, Des Kidney chr19:54000587-54000589 Fam92b, Gse1 Kidney chr6:33911362-33911364 Laptm4a, Sdc1 Kidney chr7:117254714- BC024139, Plec 117254716 Kidney chr15:41826863-41826865 Kpna3, Spryd7 Kidney chr2:187995384- Arhgef2, Rxfp4 187995386 Kidney chr9:98085198-98085200 Prlh, Mlph Kidney chr4:151384953- Lrtm2, Cacna2d4 151384955 Kidney chr7:53333359-53333361 Csrp2, E2f7P A T E N T Attorney Docket No.: 4552-2000740 Kidney chr3:167021754- Zfp217, Bcas1 167021756 Kidney chr17:12669223-12669225 Syk, Auh Kidney chr10:56638056-56638058 Asgr1, Dlg4 Kidney chr1:84213163-84213165 Shkbp1, Sptbn4 Kidney chr8:97244866-97244868 Ankrd34c, Rasgrf1 Kidney chr10:98744072-98744074 Kcnj16, Map2k6 Kidney chr3:170398872- Cass4 170398874 Kidney chr1:184764972- Insc, Sox6 184764974 Kidney chr2:5576412-5576414 Nr2f1, Pou5f2 Kidney chr20:20104680-20104682 Ccdc6, Ank3 Kidney chr17:15749708-15749710 Fgd3 Kidney chr19:26236259-26236261 Zfp791, Man2b1 Kidney chr9:43045134-43045136 Cnnm4 Kidney chr15:108463901- Tm9sf2, Timm8a2 108463903 Kidney chr18:72425919-72425921 Smad2, Zbtb7c Kidney chr4:7338902-7338904 Nos3, Atg9b Kidney chr13:48446623-48446625 Rab7b, Ctse Kidney chr12:16123081-16123083 Lfng, Ttyh3 Kidney chr9:61428815-61428817 Pgap1, Ankrd44 Kidney chr12:23605127-23605129 Polr2j, Rasa4 Kidney chr5:158083296- Aldh4a1, Gm21969 158083298 Kidney chr17:70337279-70337281 Gdi2 Kidney chr1:264416491- Pax2, Hif1an 264416493 Kidney chr5:118238038- Foxd3, Gm12689 118238040 Kidney chr14:103312874- Meis1 103312876 Kidney chr8:48861672-48861674 Cxcr5, Bcl9l Kidney chr18:79606630-79606632 Zfp516, Zfp236 Kidney chr17:42549173-42549175 Ripor2, Cmah Kidney chr1:57818447-57818449 Rgmb Kidney chr16:81242512-81242514 Gas6, Tmem255b Kidney chr16:71630150-71630152 Tacc1 Kidney chr17:4982912-4982914 None Kidney chr19:19745130-19745132 Adcy7P A T E N T Attorney Docket No.: 4552-2000740 Kidney chr18:79385037-79385039 Mbp, Zfp236 Kidney chr1:80428006-80428008 Nkpd1, Ppp1r37 Kidney chr11:72614753-72614755 Bdh1 Kidney chr8:39622119-39622121 Pknox2, Fez1 Kidney chr2:198545536- Fcgr1, BC107364 198545538 Kidney chr14:60713359-60713361 Lgi2, Sepsecs Kidney chr1:80128423-80128425 Opa3, Gpr4 Kidney chr16:1894317-1894319 Ppif, Zmiz1 Kidney chr13:101252035- Tlr5, Susd4 101252037 Kidney chr9:66264094-66264096 Fzd7, Cdk15 Kidney chr1:260582347- Tm9sf3, Pik3ap1 260582349 Kidney chr15:41826913-41826915 Kpna3, Spryd7 Kidney chr2:94106725-94106727 Fabp5, Pag1 Kidney chr10:105492853- Prpsap1, Sphk1 105492855 Kidney chr3:170398929- None 170398931 Kidney chr18:74504601-74504603 Slc14a1, Slc14a2 Kidney chr3:11750170-11750172 Cdk9 Kidney chr19:52242512-52242514 Taf1c, Dnaaf1 Kidney chr20:10118758-10118760 Pde9a Kidney chr8:67568115-67568117 Itga11 Kidney chr11:70672500-70672502 Zfp148, Snx4 Kidney chr10:11810784-11810786 Nlrc3 Kidney chr5:101360582- Frem1, Ttc39b 101360584 Kidney chr16:54444443-54444445 Pdgfrl, Mtus1 Kidney chr1:165901450- Relt 165901452 Kidney chr8:114897470- Ppm1m, Twf2 114897472 Kidney chr3:170398848- Cass4 170398850 Kidney chr5:157165180- Pla2g2c 157165182 Kidney chr2:199095045- Gja5, Gja8 199095047 Kidney chr10:63738259-63738261 Inpp5k, PitpnaP A T E N T Attorney Docket No.: 4552-2000740 Kidney chr10:39179667-39179669 None Kidney chr5:101360527- Frem1, Ttc39b 101360529 Kidney chr1:219320692- Cabp2, Gstp3 219320694 Kidney chr18:79385100-79385102 Mbp, Zfp236 Kidney chr10:38823928-38823930 Gm9837, Shroom1 Kidney chr12:45181620-45181622 Taok3, Pebp1 Kidney chr19:25307861-25307863 Nanos3, Zswim4 Kidney chr5:118238017- Foxd3, Gm12689 118238019 Kidney chr15:12831263-12831265 Fezf2, 3830406C13Rik Kidney chr2:5576220-5576222 Nr2f1, Pou5f2 Kidney chr5:60089748-60089750 Pax5, Melk Kidney chr12:23605086-23605088 Polr2j, Rasa4 Kidney chr10:71844994-71844996 Aatf, Lhx1 Kidney chr1:280883878- Rab11fip2, Emx2 280883880 Kidney chr4:61810544-61810546 Akr1b8 Kidney chr5:169707340- Nphp4, Ajap1 169707342 Lung chr13:79651128-79651130 Fasl, Tnfsf18 Lung chr1:124653410- E030018B13Rik, 124653412 Otud7a Lung chr5:118238047- Foxd3, Gm12689 118238049 Lung chr8:97244866-97244868 Ankrd34c, Rasgrf1 Lung chr1:222671352- 2700081O15Rik, Rtn3 222671354 Lung chr13:79651200-79651202 Fasl, Tnfsf18 Lung chr1:124653104- E030018B13Rik, 124653106 Otud7a Lung chr2:5592842-5592844 Nr2f1 Lung chr7:18676563-18676565 Rps28, Kank3 Lung chr16:20150682-20150684 Fcho1 Lung chr1:124653405- E030018B13Rik, 124653407 Otud7a Lung chr19:54000587-54000589 Fam92b, Gse1 Lung chr6:33911362-33911364 Laptm4a, Sdc1 Lung chr10:63738259-63738261 Inpp5k, PitpnaP A T E N T Attorney Docket No.: 4552-2000740 Lung chr1:124653455- E030018B13Rik, 124653457 Otud7a Lung chr2:5592946-5592948 Nr2f1 Lung chr3:167021754- Zfp217, Bcas1 167021756 Lung chr17:12669223-12669225 Syk, Auh Lung chr2:120897710- Dnajc19, Sox2 120897712 Lung chr14:76853043-76853045 Zfp518b Lung chr1:124653539- E030018B13Rik, 124653541 Otud7a Lung chr3:170398872- Cass4 170398874 Lung chr1:184764972- Insc, Sox6 184764974 Lung chr2:5576412-5576414 Nr2f1, Pou5f2 Lung chr17:15749708-15749710 Fgd3 Lung chr12:16236822-16236824 Chst12, Gm4869 Lung chr7:18676534-18676536 Rps28, Kank3 Lung chr9:43045134-43045136 Cnnm4 Lung chr10:11810831-11810833 Nlrc3 Lung chr1:124653071- E030018B13Rik, 124653073 Otud7a Lung chr14:35434622-35434624 Kit, Pdgfra Lung chr4:7338902-7338904 Nos3, Atg9b Lung chr13:48446623-48446625 Rab7b, Ctse Lung chr5:158083296- Aldh4a1, Gm21969 158083298 Lung chr17:70337279-70337281 Gdi2 Lung chr8:73064453-73064455 Tpm1, Tln2 Lung chr5:118238038- Foxd3, Gm12689 118238040 Lung chr14:103312874- Meis1 103312876 Lung chr2:5592827-5592829 Nr2f1 Lung chr10:91448425-91448427 Arhgap27 Lung chr1:124653440- E030018B13Rik, 124653442 Otud7a Lung chr14:76853062-76853064 Zfp518b Lung chr15:108463922- Tm9sf2, Timm8a2 108463924 Lung chr9:29462567-29462569 Cd96, Gm4737P A T E N T Attorney Docket No.: 4552-2000740 Lung chr12:10254442-10254444 Gpr12 Lung chr5:129756258- Dmrta2, Elavl4 129756260 Lung chr1:260291271- Dntt, Opalin 260291273 Lung chr17:4982912-4982914 None Lung chr19:19745130-19745132 Adcy7 Lung chr18:79385037-79385039 Mbp, Zfp236 Lung chr8:12101148-12101150 Maml2, Ccdc82 Lung chr5:169707340- Nphp4, Ajap1 169707342 Lung chr14:60713359-60713361 Lgi2, Sepsecs Lung chr1:80128423-80128425 Opa3, Gpr4 Lung chr7:74052343-74052345 Vps13b, Osr2 Lung chr13:101252035- Tlr5, Susd4 101252037 Lung chr14:76853049-76853051 Zfp518b Lung chr1:260582347- Tm9sf3, Pik3ap1 260582349 Lung chr2:5592885-5592887 Nr2f1 Lung chr15:41826913-41826915 Kpna3, Spryd7 Lung chr2:94106725-94106727 Fabp5, Pag1 Lung chr2:5576190-5576192 Nr2f1, Pou5f2 Lung chr19:52242512-52242514 Taf1c, Dnaaf1 Lung chr20:10118758-10118760 Pde9a Lung chr11:70672500-70672502 Zfp148, Snx4 Lung chr10:11810784-11810786 Nlrc3 Lung chr1:52942697-52942699 T, Prr18 Lung chr3:170398848- Cass4 170398850 Lung chr5:157165180- Pla2g2c 157165182 Lung chr2:199095045- Gja5, Gja8 199095047 Lung chr5:129756248- Dmrta2, Elavl4 129756250 Lung chr18:79385100-79385102 Mbp, Zfp236 Lung chr5:118238017- Foxd3, Gm12689 118238019 Lung chr1:124653429- E030018B13Rik, 124653431 Otud7aP A T E N T Attorney Docket No.: 4552-2000740 Lung chr11:87728385-87728387 Scarf2, Car15 Lung chr7:18676545-18676547 Rps28, Kank3 Lung chr2:5576220-5576222 Nr2f1, Pou5f2 Lung chr5:60089748-60089750 Pax5, Melk Lung chr17:9192015-9192017 Tifab, Neurog1 Lung chr4:61810544-61810546 Akr1b8 Lung chr15:90194719-90194721 Spry2, Gm4775 Lung chr1:124653033- E030018B13Rik, 124653035 Otud7a Lung chr1:226265504- Fen1, Myrf 226265506 Lung chr20:48245897-48245899 Gm9803, Bend3 Lung chr10:56505810-56505812 Acap1 Lung chr12:13213820-13213822 Kdelr2 Lung chr18:63937698-63937700 Fam210a, Ldlrad4 Lung chr13:99061002-99061004 H3f3a, Acbd3 Lung chr2:5592888-5592890 Nr2f1 Lung chr15:41826893-41826895 Kpna3, Spryd7 Lung chr1:281755597- Prlhr 281755599 Lung chr2:185851563- Mab21l2 185851565 Lung chr18:73997208-73997210 Rnf165, Haus1 Lung chr7:137858118- Scaf11 137858120 Lung chr17:9791421-9791423 Rgs14 Lung chr1:124653499- E030018B13Rik, 124653501 Otud7a Small Intestine chr10:45279275-45279277 Rnf187 Small Intestine chr4:149957599- Hnrnpf 149957601 Small Intestine chr5:137264650- Cdc20 137264652 Small Intestine chr12:9360840-9360842 Flt3 Small Intestine chr7:36000991-36000993 Plxnc1 Small Intestine chr10:16638173-16638175 Nkx2-5, Bnip1 Small Intestine chr10:86711724-86711726 Msl1 Small Intestine chr7:99954926-99954928 Trib1 Small Intestine chr1:226501381- Lrrc10b 226501383 Small Intestine chr14:76856978-76856980 Zfp518bP A T E N T Attorney Docket No.: 4552-2000740 Small Intestine chr7:131331271- Alg10b 131331273 Small Intestine chr6:10533551-10533553 Rhoq Small Intestine chr1:94404044-94404046 Uri1 Small Intestine chr6:26680177-26680179 Cad Small Intestine chr15:56969723-56969725 Lrch1 Small Intestine chr19:10898747-10898749 Cpne2 Small Intestine chr6:11274924-11274926 Msh2 Small Intestine chr12:40114891-40114893 Fam109a, Cux2 Small Intestine chr6:8955699-8955701 Six2 Small Intestine chr10:35725862-35725864 Mgat4b Small Intestine chr20:7921392-7921394 Tead3, Rpl10a Small Intestine chr1:7065131-7065133 Stx11 Small Intestine chr2:44858163-44858165 Ccno Small Intestine chr2:188562348- Trim46, Krtcap2 188562350 Small Intestine chr9:93377390-93377392 Ncl Small Intestine chr17:68573018-68573020 Pfkp, Pitrm1 Small Intestine chr2:142885046- Frem2 142885048 Small Intestine chr18:57031482-57031484 Pcyox1l Small Intestine chr14:17283189-17283191 Naaa Small Intestine chr1:211732804- Inpp5a 211732806 Small Intestine chr17:51909571-51909573 Inhba Small Intestine chr1:57327519-57327521 Dll1 Small Intestine chr7:24313853-24313855 Btbd11 Small Intestine chr4:79846693-79846695 Mpp6 Small Intestine chr14:115166554- Psme4 115166556 Small Intestine chr2:550466-550468 Alkbh8, Gm10715 Small Intestine chr12:41663544-41663546 Lhx5, Sdsl Small Intestine chr1:225185091- Ahnak 225185093 Small Intestine chr1:274031161- Mxi1 274031163 Small Intestine chr1:282169628- Eif3a 282169630 Small Intestine chr3:177202104- Rgs19 177202106 Small Intestine chr10:45279185-45279187 Rnf187P A T E N T Attorney Docket No.: 4552-2000740 Small Intestine chr2:244057774- Tspan5 244057776 Small Intestine chr2:210087987- Rbm15, Slc16a4 210087989 Small Intestine chr10:15196049-15196051 Jmjd8 Small Intestine chr7:23843337-23843339 Fbxo7 Small Intestine chr7:122924561- Chadl, L3mbtl2 122924563 Small Intestine chr1:20332214-20332216 Tmem200a Small Intestine chr1:53014342-53014344 Sft2d1 Small Intestine chr19:44231663-44231665 Kars, Terf2ip Small Intestine chr14:5166953-5166955 Zfp326, Lrrc8d Small Intestine chr1:140860687- Mfge8 140860689 Small Intestine chr10:37707258-37707260 Tcf7, Vdac1 Small Intestine chr3:92290605-92290607 Trim44, Fjx1 Small Intestine chr8:21890408-21890410 A230050P20Rik Small Intestine chr6:95998527-95998529 Six4 Small Intestine chr13:90466949-90466951 Copa, Ncstn Small Intestine chr10:89916269-89916271 1700006E09Rik, Dusp3 Small Intestine chr8:32360541-32360543 Aplp2 Small Intestine chr17:21577425-21577427 Tmem14c Small Intestine chr3:122813390- Idh3b 122813392 Small Intestine chr14:82196979-82196981 Nsd2 Small Intestine chr2:127627197- Hspa4l 127627199 Small Intestine chr3:2410284-2410286 Tor4a, Nrarp Small Intestine chr15:41084488-41084490 Mipep Small Intestine chr19:24329434-24329436 Tbc1d9 Small Intestine chr10:109520770- Actg1 109520772 Small Intestine chr11:31847258-31847260 Donson Small Intestine chr20:32509771-32509773 None Small Intestine chr1:222168007- Prdx5, Trmt112 222168009 Small Intestine chr8:82257874-82257876 Bcl2l10, Gnb5 Small Intestine chr9:44126883-44126885 Mgat4a Small Intestine chr17:37616212-37616214 Sox4, Prl5a1 Small Intestine chr12:39768709-39768711 Pptc7P A T E N T Attorney Docket No.: 4552-2000740 Small Intestine chr20:10680179-10680181 Sik1 Small Intestine chr7:132757115- Slc2a13 132757117 Small Intestine chr8:22051411-22051413 Icam5, Zglp1 Small Intestine chr20:10680123-10680125 Sik1 Small Intestine chr5:60900958-60900960 Dcaf10 Small Intestine chr6:109939530- Tgfb3, Ift43 109939532 Small Intestine chr13:109789291- Atf3 109789293 Small Intestine chr20:2103459-2103461 Rnf39 Small Intestine chr3:139001860- Insm1, Ralgapa2 139001862 Small Intestine chr1:264767888- Lzts2, Pdzd7 264767890 Small Intestine chr19:19323605-19323607 Cyld Small Intestine chr11:47113599-47113601 Zbtb11 Small Intestine chr9:86571646-86571648 Dock10 Small Intestine chr1:72895263-72895265 Ppp1r12c, Tnnt1 Small Intestine chr13:91162477-91162479 Cfap126, Fcgr3 Small Intestine chr16:20297620-20297622 Slc5a5 Small Intestine chr17:70010916-70010918 Net1, Calm5 Small Intestine chr9:71313895-71313897 Mettl21a Small Intestine chr20:29655703-29655705 Spock2 Small Intestine chr12:52186861-52186863 Galnt9 Small Intestine chr1:226459640- Syt7, Lrrc10b 226459642 Small Intestine chr2:113652320- Pld1 113652322 Stomach chr13:79651128-79651130 Fasl, Tnfsf18 Stomach chr5:58982899-58982901 Cd72, Sit1 Stomach chr17:6925491-6925493 Klhl3, Hnrnpa0 Stomach chr5:118238047- Foxd3, Gm12689 118238049 Stomach chr20:11737385-11737387 Sumo3 Stomach chr8:97244866-97244868 Ankrd34c, Rasgrf1 Stomach chr1:222671352- 2700081O15Rik, Rtn3 222671354 Stomach chr13:79651200-79651202 Fasl, Tnfsf18 Stomach chr8:48861672-48861674 Cxcr5, Bcl9l Stomach chr9:82540719-82540721 Dnpep, DesP A T E N T Attorney Docket No.: 4552-2000740 Stomach chr19:54000587-54000589 Fam92b, Gse1 Stomach chr1:198128344- Coro1a 198128346 Stomach chr6:33911362-33911364 Laptm4a, Sdc1 Stomach chr19:57515662-57515664 Fam89a Stomach chr15:41826863-41826865 Kpna3, Spryd7 Stomach chr7:53333359-53333361 Csrp2, E2f7 Stomach chr1:100653139- Myh14, Kcnc3 100653141 Stomach chr19:59578694-59578696 Irf2bp2, Tomm20 Stomach chr17:12669223-12669225 Syk, Auh Stomach chr10:56638056-56638058 Asgr1, Dlg4 Stomach chr14:83813416-83813418 Morc2a, Smtn Stomach chr4:718615-718617 Shh, Rbm33 Stomach chr1:80128491-80128493 Opa3, Gpr4 Stomach chr10:98744072-98744074 Kcnj16, Map2k6 Stomach chr3:170398872- Cass4 170398874 Stomach chr1:11656262-11656264 Cited2 Stomach chr1:184764972- Insc, Sox6 184764974 Stomach chr1:220124938- Ctsf, Actn3 220124940 Stomach chr6:26193088-26193090 Mrpl33, Slc4a1ap Stomach chr17:15749708-15749710 Fgd3 Stomach chr20:31927938-31927940 Tacr2, Hk1 Stomach chr19:26236259-26236261 Zfp791, Man2b1 Stomach chr12:16236822-16236824 Chst12, Gm4869 Stomach chr19:19745113-19745115 Adcy7 Stomach chr9:43045134-43045136 Cnnm4 Stomach chr3:56768569-56768571 Erich2, Sp5 Stomach chr16:10860818-10860820 Bmpr1a, 9230112D13Rik Stomach chr14:35434622-35434624 Kit, Pdgfra Stomach chr8:60119390-60119392 Isl2, Scaper Stomach chr4:7338902-7338904 Nos3, Atg9b Stomach chr13:48446623-48446625 Rab7b, Ctse Stomach chr8:121894228- Pdcd6ip 121894230 Stomach chr12:46845690-46845692 Pxn Stomach chr17:70337279-70337281 Gdi2P A T E N T Attorney Docket No.: 4552-2000740 Stomach chr10:105492853- Prpsap1, Sphk1 105492855 Stomach chr5:118238038- Foxd3, Gm12689 118238040 Stomach chr14:103312874- Meis1 103312876 Stomach chr16:11127575-11127577 Grid1, Wapl Stomach chr18:79606630-79606632 Zfp516, Zfp236 Stomach chr14:14316463-14316465 Bmp2k, Anxa3 Stomach chr5:144760391- Tfap2e, Psmb2 144760393 Stomach chr17:42549173-42549175 Ripor2, Cmah Stomach chr9:37973059-37973061 Ccdc115, Dst Stomach chr3:56768605-56768607 Erich2, Sp5 Stomach chr12:16236861-16236863 Chst12, Gm4869 Stomach chr18:79606713-79606715 None Stomach chr12:10254442-10254444 Gpr12 Stomach chr4:120755763- Abtb1, Mgll 120755765 Stomach chr8:12101148-12101150 Maml2, Ccdc82 Stomach chr10:106241801- Gm11733, Sept9 106241803 Stomach chr19:19745130-19745132 Adcy7 Stomach chr18:79385037-79385039 Mbp, Zfp236 Stomach chr11:72614753-72614755 Bdh1 Stomach chr10:108197849- Cbx4 108197851 Stomach chr6:129216821- D430019H16Rik, 129216823 Tunar Stomach chr20:4407466-4407468 Atf6b, Prrt1 Stomach chr14:60713359-60713361 Lgi2, Sepsecs Stomach chr1:80128423-80128425 Opa3, Gpr4 Stomach chr10:17667435-17667437 Smim23, Fbxw11 Stomach chr7:138820180- Amigo2, Rpap3 138820182 Stomach chr8:12101144-12101146 Maml2, Ccdc82 Stomach chr7:12381838-12381840 Mum1, Efna2 Stomach chr9:66264094-66264096 Fzd7, Cdk15 Stomach chr7:11334461-11334463 Matk Stomach chr19:54000494-54000496 Fam92b, Gse1 Stomach chr2:94106725-94106727 Fabp5, Pag1P A T E N T Attorney Docket No.: 4552-2000740 Stomach chr8:12101212-12101214 Maml2, Ccdc82 Stomach chr3:170398929- None 170398931 Stomach chr10:11810831-11810833 Nlrc3 Stomach chr5:157623208- Minos1, Capzb 157623210 Stomach chr10:82802466-82802468 Samd14, Ppp1r9b Stomach chr18:74504601-74504603 Slc14a1, Slc14a2 Stomach chr9:46707496-46707498 None Stomach chr19:19745093-19745095 Adcy7 Stomach chr19:52242512-52242514 Taf1c, Dnaaf1 Stomach chr3:60206353-60206355 Gpr155, Wipf1 Stomach chr20:10118758-10118760 Pde9a Stomach chr11:70672500-70672502 Zfp148, Snx4 Stomach chr10:11810784-11810786 Nlrc3 Stomach chr16:54444443-54444445 Pdgfrl, Mtus1 Stomach chr1:52942697-52942699 T, Prr18 Stomach chr8:114897470- Ppm1m, Twf2 114897472 Stomach chr3:170398848- Cass4 170398850 Stomach chr17:8883359-8883361 Pitx1, Catsper3 Stomach chr5:157165180- Pla2g2c 157165182 Stomach chr2:199095045- Gja5, Gja8 199095047

[0066] The present kits, devices, systems or articles of manufacture can comprise any suitable reagents for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s). For example, the reagents can comprise, consist essentially of, or consist of a probe or primer configured for hybridizing with each of the tissue-specific or organ-specific target polynucleotide(s) whose methylation status is to be assessed. In some embodiments, the reagents comprise, consist essentially of, or consist of a single probe or primer configured for hybridizing with each of the tissue-specific or organ-specific target polynucleotides whose methylation status is to be assessed. In other embodiments, the reagents comprise, consist essentially of, or consist of multiple probes or primers configured for hybridizing with each of the tissue-specific or organ-specific target polynucleotides whose methylation status is to be assessed.P A T E N T Attorney Docket No.: 4552-2000740

[0067] In some embodiments, the one or more primers in the present kits, devices, systems or articles of manufacture comprise, consist essentially of, or consist of, a sequence set forth in SEQ ID NOs: 1-730 listed in Table 2, a complementary or substantially complementary sequence thereof, or any combination thereof. For each tissue-specific or organ-specific target polynucleotide listed in Table 2, the present kits, devices, systems or articles of manufacture can comprise, consist essentially of, or consist of, one or more corresponding primers for that Target. For example, the one or more primers may comprise, consist essentially of, or consist of, a sequence set forth in any of SEQ ID NOs:1 - SEQ ID NO:730, a complementary or substantially complementary sequence thereof, or any combination thereof. Table 2. Exemplary tissue-specific or organ-specific target polynucleotides Organ Genomic Region Associated Gene(s) Sequence Seq ID # Testes chr1:2342763-2342765 Tab2, Ust GCGGGGATGGGGAGTGAGTAATAGGGT SEQ ID NO:1 Testes chr1:11656262- Cited2 AGTTTGTAGTTTTTGGTTGTAAGGTTCGGTTTGT SEQ ID NO:2 11656264 Testes chr1:31506131- None AGGAAAAAGGAAACGGATTTTCGGGGGA SEQ ID NO:3 31506133 Testes chr1:64373298- Cacng8, Cacng7 TCGGGAAGGAAGTTTCGGTTTGGGAGT SEQ ID NO:4 64373300 Testes chr1:78874630- Pnmal2 GCGGTTTGCGTAGTGTTTGGTTGTTATGGG SEQ ID NO:5 78874632 Testes chr1:80428006- Nkpd1, Ppp1r37 GGGAGGGAAGGATGGGGGTTGTCGTTT SEQ ID NO:6 80428008 Testes chr1:82497542- Ccdc97, Tgfb1 AGCGGGTTGTGGTGGTTGTTGTGATGA SEQ ID NO:7 82497544 Testes chr1:82498036- Ccdc97, Tgfb1 GTGGTAGAGCGTTTTTTAGGAAGCGTAAGG SEQ ID NO:8 82498038 Testes chr1:82498057- Ccdc97, Tgfb1 AGGTTGTGGGAAGAAAGTTGTGATTAAGGATAGTT SEQ ID NO:9 82498059 Testes chr1:85381142- Plekhg2, Zfp36 GGGGTGGCGATTGGTTTGGCGTAGTTT SEQ ID NO:10 85381144 Testes chr1:91401970- Slc7a10, Cebpa AAGGGGGATTTACGTTTTGGGTTAGGGA SEQ ID NO:11 91401972 Testes chr1:184764972- Insc, Sox6 AGGAGGAAATGGTAAGGAAGGGTTAGCG SEQ ID NO:12 184764974 Testes chr1:204160312- Cpxm2 TAGGGGGTGGAGGGAGTTGAGAAGGGG SEQ ID NO:13 204160314 Testes chr1:217345188- Shank2 CGGCGAGTAGTGGTAGGCGTTTGGGC SEQ ID NO:14 217345190 Testes chr1:217345400- Shank2 CGGTGTTTTTTGGTCGTTAGTTCGCGCG SEQ ID NO:15 217345402 Testes chr1:218274316- Ccnd1, 1810010D01Rik GGGGTTAGAGGTTTGTTATTGTATATTGTTGGGCG SEQ ID NO:16 218274318 Testes chr1:218274325- Ccnd1, 1810010D01Rik TGAAATTTTAGTTGGGTTTTCGGTCGTTGGT SEQ ID NO:17 218274327 Testes chr1:218274391- Ccnd1, 1810010D01Rik TGAAATTTTAGTTGGGTTTTCGGTCGTTGGT SEQ ID NO:18 218274393 Testes chr1:220124927- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID NO:19 220124929P A T E N T Attorney Docket No.: 4552-2000740 Testes chr1:220124938- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID NO:20 220124940 Testes chr1:220124956- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID NO:21P A T E N T Attorney Docket No.: 4552-2000740 Testes chr3:167021754- Zfp217, Bcas1 TAGTGTGTGTGTGTGCGTGTGCGTGTG SEQ ID NO:53 167021756 Testes chr3:167047877- Zfp217, Bcas1 GGAATTTTTTAAGGGGGAAGGTTTGAGGAGGT SEQ ID NO:54P A T E N T Attorney Docket No.: 4552-2000740 Testes chr5:158287481- Pax7, Tas1r2 AGATAACGGTTTGTTAAAAGGAATTGCGAGTCG SEQ ID NO:85 158287483 Testes chr5:158287563- Pax7, Tas1r2 AGGAGGAGGAGGAGGAGGAGGAGGAGG SEQ ID NO:86 158287565 Testes chr5:161979197- None TCGGGGGGTGATTGTGGCGTGTTAATT SEQ ID NO:87 161979199 Testes chr5:165716415- Casz1, Pex14 TCGGAGGTAGGGAAAGGAAAGGAAGGT SEQ ID NO:88 165716417 Testes chr5:169269327- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID NO:89 169269329 Testes chr5:169269334- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID NO:90 169269336 Testes chr5:169269351- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID NO:91 169269353 Testes chr5:169269363- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID NO:92 169269365 Testes chr5:169269366- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID NO:93 169269368 Testes chr5:169707340- Nphp4, Ajap1 AAGGAGGGGGAGGGGAAGGTGATTGGA SEQ ID NO:94 169707342 Testes chr6:27440313- Drc1, Otof GGTTGTTGATATTCGGTTGTTTGGGGGT SEQ ID NO:95 27440315 Testes chr6:27440327- Drc1, Otof GGTTGTTGATATTCGGTTGTTTGGGGGT SEQ ID NO:96 27440329 Testes chr6:33911362- Laptm4a, Sdc1 AGGAGAGGTTATGGGAGGAGAGGGGGC SEQ ID NO:97 33911364 Testes chr6:132127010- Ccnk, Ccdc85c TCGGTGTTTTTCGGTAGATAGGTGGCG SEQ ID NO:98 132127012 Testes chr6:132127021- Ccnk, Ccdc85c CGGTGTTTTTCGGTAGATAGGTGGCGT SEQ ID NO:99 132127023 Testes chr6:132679880- Degs2, Yy1 AGGAAGTTTTTAGAAGGGCGGTTTCGGT SEQ ID 132679882 NO:100 Testes chr7:1676938-1676940 None GCGGGGTGGGTGTGTGAGTTTATTCGC SEQ ID NO:101 Testes chr7:12077539- Onecut3, Atp8b3 GGTGGTTTGGAAATTGTGGTTTTTTGGAGTGG SEQ ID 12077541 NO:102 Testes chr7:12282478- Apc2, Rps15 ACGGCGTTTGAATCGAGGTTTGCGGAG SEQ ID 12282480 NO:103 Testes chr7:12591458- Wdr18, Arid3a TGGGTGTCGGGGAGTTAGGGATTGGAG SEQ ID 12591460 NO:104 Testes chr7:12591463- Wdr18, Arid3a TGGGTGTCGGGGAGTTAGGGATTGGAG SEQ ID 12591465 NO:105 Testes chr7:12591468- Wdr18, Arid3a TGGGTGTCGGGGAGTTAGGGATTGGAG SEQ ID 12591470 NO:106 Testes chr7:12591470- Wdr18, Arid3a TGGGTGTCGGGGAGTTAGGGATTGGAG SEQ ID 12591472 NO:107 Testes chr7:12591485- Wdr18, Arid3a TGGGTGTCGGGGAGTTAGGGATTGGAG SEQ ID 12591487 NO:108 Testes chr7:12591528- Wdr18, Arid3a GCGAGTGGTGTGTCGGGTAGATCGAGG SEQ ID 12591530 NO:109 Testes chr7:12591543- Wdr18, Arid3a GCGAGTGGTGTGTCGGGTAGATCGAGG SEQ ID 12591545 NO:110 Testes chr7:53333359- Csrp2, E2f7 GAATTGGTATTGTTTGGATGTAATATTGTGGCGGT SEQ ID 53333361 NO:111 Testes chr7:59300824- 4933416C03Rik, Ptprb AGGGAGGTGGGGTGGATGTGGGGATAT SEQ ID 59300826 NO:112 Testes chr7:70521760- Pip4k2c, Kif5a AGGGTTCGGAAAGTTTTGGGTTGGAGT SEQ ID 70521762 NO:113 Testes chr7:99482710- None CGGAAGAGAGGGGTTAATTGCGAGGCG SEQ ID 99482712 NO:114 Testes chr7:99482761- None CGGAAGAGAGGGGTTAATTGCGAGGCG SEQ ID 99482763 NO:115P A T E N T Attorney Docket No.: 4552-2000740 Testes chr7:99522645- None TTGAGGTCGTGGTCGAGAGGGGAAGGA SEQ ID 99522647 NO:116 Testes chr7:114931942- Slc45a4, Gpr20 GGTCGGTGATTGGGGAGGAGGTTAGGT SEQ ID 114931944 NO:117 Testes chr7:117254714- BC024139, Plec AGGTTTTTAGGTTCGGGTATACGGAGTCG SEQ ID 117254716 NO:118 Testes chr7:117254799- BC024139, Plec GGGTGTGGTTATGGGGGAGGGGTTGTT SEQ ID 117254801 NO:119 Testes chr7:137858118- Scaf11 TGGGAGATGAATGGGGAGGAGGGGAGG SEQ ID 137858120 NO:120 Testes chr7:139404519- Tmem106c, Vdr TGAAGGAAGATAATAAGCGATTTCGGGAGGG SEQ ID 139404521 NO:121 Testes chr7:141135498- Nckap5l, Bcdin3d ACGGAGTTCGGGGATGGAGAGAATTTG SEQ ID 141135500 NO:122 Testes chr8:11933262- Maml2, Ccdc82 AGTTAGGAAGAAGTAGTGGGTCGGTTGGA SEQ ID 11933264 NO:123 Testes chr8:12101144- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101146 NO:124 Testes chr8:12101148- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101150 NO:125 Testes chr8:12101172- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101174 NO:126 Testes chr8:12101212- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101214 NO:127 Testes chr8:48861672- Cxcr5, Bcl9l AGGTGGGGGAGGGGGGTGATAGGTTAG SEQ ID 48861674 NO:128 Testes chr8:48861750- Cxcr5, Bcl9l GGGGTTTTGTGCGTGTGTGGGTTAGGT SEQ ID 48861752 NO:129 Testes chr8:48861770- Cxcr5, Bcl9l GGGGTTTTGTGCGTGTGTGGGTTAGGT SEQ ID 48861772 NO:130 Testes chr8:49184301- Ttc36, Kmt2a TTTGGAAGGGGGTGGAGGAAAGTCGGG SEQ ID 49184303 NO:131 Testes chr8:49184447- Ttc36, Kmt2a TTTGGAAGGGGGTGGAGGAAAGTCGGG SEQ ID 49184449 NO:132 Testes chr8:60122070- Isl2, Scaper ACGGTTTGTTTGTAGGGAATACGTCGGGT SEQ ID 60122072 NO:133 Testes chr8:97244866- Ankrd34c, Rasgrf1 TGAGGGGAAATGGAAATTATTGTTTCGGGTGA SEQ ID 97244868 NO:134 Testes chr8:115072282- Rpl29, Dusp7 AGTAAGCGGATGAGGTCGGGGAAGTTT SEQ ID 115072284 NO:135 Testes chr8:117826160- Plxnb1, Tma7 GAAGGGGTTTAGAATTCGGAGGAAGGGT SEQ ID 117826162 NO:136 Testes chr8:117826173- Plxnb1, Tma7 GAAGGGGTTTAGAATTCGGAGGAAGGGT SEQ ID 117826175 NO:137 Testes chr8:117826190- Plxnb1, Tma7 GAAGGGGTTTAGAATTCGGAGGAAGGGT SEQ ID 117826192 NO:138 Testes chr8:119326465- Ccrl2 ATTGGGTTTTCGAGGGTGGGGAAGGGT SEQ ID 119326467 NO:139 Testes chr8:119326490- Ccrl2 AGAAGTTAGGGGGTGGGGTTGTACGTT SEQ ID 119326492 NO:140 Testes chr8:121894228- Pdcd6ip AGTATGGCGCGTAGTTGTCGGAGTTAA SEQ ID 121894230 NO:141 Testes chr8:121894281- Pdcd6ip AGTATGGCGCGTAGTTGTCGGAGTTAA SEQ ID 121894283 NO:142 Testes chr8:124270118- Tgfbr2, Gadl1 CGTTCGGGGGAAGGTAGAAGAGTGCGT SEQ ID 124270120 NO:143 Testes chr9:12794195- Rftn1, Kif6 AGATGCGAAAATTGCGGGTATATAGGGGT SEQ ID 12794197 NO:144 Testes chr9:37972989- Ccdc115, Dst AGGAGGTATGGTGTTTGAGGTGTGGATAGT SEQ ID 37972991 NO:145 Testes chr9:37973059- Ccdc115, Dst TTTGGGTTTTTTGAAGCGGTTTATTTGTAGAGGA SEQ ID 37973061 NO:146P A T E N T Attorney Docket No.: 4552-2000740 Testes chr9:37973077- Ccdc115, Dst ACGAGTAAGTATGTTAACGGGTTGGGTGT SEQ ID 37973079 NO:147 Testes chr9:47017631- Il1rl2, Il1r1 ACGGGTTTTAGTTTTTATTGATCGGTAAATGGGG SEQ ID 47017633 NO:148 Testes chr9:61428815- Pgap1, Ankrd44 TGGGGAGAGTTAGTCGTTAGTTGCGTTGT SEQ ID 61428817 NO:149 Testes chr9:95592768- Glrp1, Arl4c AGCGATGGGAAAGAGTTAGGAGGGAGA SEQ ID 95592770 NO:150 Testes chr10:11810784- Nlrc3 AGAGATTTTGGTTTGTTCGGAGTCGAGGA SEQ ID 11810786 NO:151 Testes chr10:11810831- Nlrc3 CGAGGTAGAGATTTTGGTTTGTTCGGAGTCG SEQ ID 11810833 NO:152 Testes chr10:17426500- Fbxw11, Stk10 AGGGTATTTCGTAGAGGATGGTTTTGGGTTT SEQ ID 17426502 NO:153 Testes chr10:17667435- Smim23, Fbxw11 CGATAACGAGGTTATTAATTTAGGAAGGGCGGT SEQ ID 17667437 NO:154 Testes chr10:17667474- Smim23, Fbxw11 GGAAGTGTGGGTAGTGGTTGGGTTAGT SEQ ID 17667476 NO:155 Testes chr10:34522630- Olfr1393, Mgat1 CGGTAGTGTGAAAAGTTGGGAAATTGGTTTGT SEQ ID 34522632 NO:156 Testes chr10:39179667- None AGGAAGGTATATCGAAAACGGGTAAGTGGTG SEQ ID 39179669 NO:157 Testes chr10:56505810- Acap1 GGACGGATAGGGTCGTGGGTTTAGCGT SEQ ID 56505812 NO:158 Testes chr10:56638056- Asgr1, Dlg4 AGCGAGGCGTGTTTTGGTTTTTGACGT SEQ ID 56638058 NO:159 Testes chr10:63738259- Inpp5k, Pitpna AGGGGAGTGGAAGTTCGGGAAGTGTGC SEQ ID 63738261 NO:160 Testes chr10:81834504- Tob1, Spag9 AGGTTTGGTTTTTGGGTGGCGTTGTTG SEQ ID 81834506 NO:161 Testes chr10:85607877- Cisd3, Mllt6 GGGGGTTAGGTGGGGTGAGAATGGAGG SEQ ID 85607879 NO:162 Testes chr10:96020379- Cacng4 CGGGTGTGGGTTTATTCGTTTATTTGGGATT SEQ ID 96020381 NO:163 Testes chr10:98744072- Kcnj16, Map2k6 AAAAAATATGGGGACGTTTTTGTGATACGGTTGA SEQ ID 98744074 NO:164 Testes chr10:104557303- Galk1, Itgb4 ACGTAGAGTATTTGGTGAATGGTCGGATGG SEQ ID 104557305 NO:165 Testes chr10:105103653- Acox1, Evpl AGTTTGGTTGCGAGGACGGCGTTTTTT SEQ ID 105103655 NO:166 Testes chr10:105492866- Prpsap1, Sphk1 TGGGTTTGAAGTGGGTTGTGGTTTGGT SEQ ID 105492868 NO:167 Testes chr10:109747331- Ppp1r27, P4hb AGGATTTGGTTGGTTTTTCGGCGAGGA SEQ ID 109747333 NO:168 Testes chr11:35729354- Erg, Kcnj15 TGAAGGAAAGGGAAGTTTTGTCGGAAATGAGA SEQ ID 35729356 NO:169 Testes chr11:70672500- Zfp148, Snx4 AGGAGGGAGAAAGGGAGGGAAGGGAGG SEQ ID 70672502 NO:170 Testes chr11:76465523- Rtp1, BC106179 GGGATCGGTTGTGTGGTTTATGGTAGGT SEQ ID 76465525 NO:171 Testes chr12:6779245- Medag, Alox5ap CGGAATCGAATGATTTGTTTTGTTAACGGTAGTTGT SEQ ID 6779247 NO:172 Testes chr12:7764482- Ubl3, Katnal1 ACGGTGTGCGTTTATTGTTGGCGGAAG SEQ ID 7764484 NO:173 Testes chr12:13213820- Kdelr2 ACGGGGTTTATGTAGTTTGGGGATGGGGT SEQ ID 13213822 NO:174 Testes chr12:16236822- Chst12, Gm4869 GTGGAGTTATAGGGAGGTATTGAGGAAGGAGT SEQ ID 16236824 NO:175 Testes chr12:16236861- Chst12, Gm4869 GTGGAGTTATAGGGAGGTATTGAGGAAGGAGT SEQ ID 16236863 NO:176 Testes chr12:25048787- Eif4h, Limk1 TGAGTGGGTGGAGGTGGAGTTAGGGAGT SEQ ID 25048789 NO:177P A T E N T Attorney Docket No.: 4552-2000740 Testes chr12:38746984- Bcl7a, Wdr66 CGGTGTGAAGATAAAGGTGGAAGGGGA SEQ ID 38746986 NO:178 Testes chr12:38746994- Bcl7a, Wdr66 CGGTGTGAAGATAAAGGTGGAAGGGGA SEQ ID 38746996 NO:179 Testes chr12:46845675- Pxn 0 SEQ ID 46845677 NO:180 Testes chr12:46845690- Pxn 0 SEQ ID 46845692 NO:181 Testes chr12:47413511- None TGGAGAGGTAGAGGTTGTTGGTAGGATGT SEQ ID 47413513 NO:182 Testes chr12:47456392- Oasl1 AGACGAGGTGTGTGTTTTCGGAAGGTT SEQ ID 47456394 NO:183 Testes chr12:47456438- Oasl1 AGACGAGGTGTGTGTTTTCGGAAGGTT SEQ ID 47456440 NO:184 Testes chr12:47456471- Oasl1 AGACGAGGTGTGTGTTTTCGGAAGGTT SEQ ID 47456473 NO:185 Testes chr12:50251264- Gm6588, Asphd2 GGATTCGTTGCGTTGGGAGTTTGTGGT SEQ ID 50251266 NO:186 Testes chr12:50251296- Gm6588, Asphd2 GGGGGGCGAATTTGAGGAACGAATGTT SEQ ID 50251298 NO:187 Testes chr12:50251301- Gm6588, Asphd2 GGGGGGCGAATTTGAGGAACGAATGTT SEQ ID 50251303 NO:188 Testes chr13:36546753- En1, Insig2 AGGGGTTTTTAGGTGGTTGGAATGTGGA SEQ ID 36546755 NO:189 Testes chr13:48446623- Rab7b, Ctse AGGGCGGGGGATGGTAGAGGAGTAGTA SEQ ID 48446625 NO:190 Testes chr13:79651128- Fasl, Tnfsf18 TGAGGGCGAAGTGTGGAGAAATTTGGA SEQ ID 79651130 NO:191 Testes chr13:79651200- Fasl, Tnfsf18 TGAGGGCGAAGTGTGGAGAAATTTGGA SEQ ID 79651202 NO:192 Testes chr14:14316463- Bmp2k, Anxa3 AGCGGTTCGGTAGTTTTGATGCGTTTT SEQ ID 14316465 NO:193 Testes chr14:34961115- Kit, Kdr GAAGGGTTTGGAGGAGGTAGTCGTCGT SEQ ID 34961117 NO:194 Testes chr14:60713359- Lgi2, Sepsecs AGGGATAGTTTTAGGGATAGGATGGTCGGT SEQ ID 60713361 NO:195 Testes chr14:83813416- Morc2a, Smtn AGTGAAGTGGTTTTTCGGGAAGTGGGT SEQ ID 83813418 NO:196 Testes chr14:83813442- Morc2a, Smtn AGTGAAGTGGTTTTTCGGGAAGTGGGT SEQ ID 83813444 NO:197 Testes chr15:47362111- Rp1l1, Prss55 CGGAGTATTTGGAACGGTTTTATGGCGGT SEQ ID 47362113 NO:198 Testes chr15:108463901- Tm9sf2, Timm8a2 GGGATATTGGGAGTGGAATTTAGGGTTATGTGT SEQ ID 108463903 NO:199 Testes chr15:108463922- Tm9sf2, Timm8a2 GGGATATTGGGAGTGGAATTTAGGGTTATGTGT SEQ ID 108463924 NO:200 Testes chr16:10860796- Bmpr1a, 9230112D13Rik GCGGTTGTTTATATCGGCGGAGGAAGCG SEQ ID 10860798 NO:201 Testes chr16:10860818- Bmpr1a, 9230112D13Rik CGGCGGAGGAAGCGTTGAATGTTGGAT SEQ ID 10860820 NO:202 Testes chr16:10860836- Bmpr1a, 9230112D13Rik CGGCGGAGGAAGCGTTGAATGTTGGAT SEQ ID 10860838 NO:203 Testes chr16:20150682- Fcho1 TGGAGTTATAATTGTTCGTTTGGTTGTTCGGAATTT SEQ ID 20150684 NO:204 Testes chr16:81242512- Gas6, Tmem255b CGGAATAGTTTTTGTAGAGGTAGGTGTCGGT SEQ ID 81242514 NO:205 Testes chr16:81242581- Gas6, Tmem255b CGGAATAGTTTTTGTAGAGGTAGGTGTCGGT SEQ ID 81242583 NO:206 Testes chr16:83349448- Naxd, Rab20 AGGTTGTGTTTTTCGGTTTTGGTTATACGTGT SEQ ID 83349450 NO:207 Testes chr16:83349468- Naxd, Rab20 CGGAGGAGGGAATTTTGATAGGTTAGTAGGGT SEQ ID 83349470 NO:208P A T E N T Attorney Docket No.: 4552-2000740 Testes chr17:4982873- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982875 NO:209 Testes chr17:4982886- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982888 NO:210 Testes chr17:4982912- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982914 NO:211 Testes chr17:4982918- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982920 NO:212 Testes chr17:4982942- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982944 NO:213 Testes chr17:9254785- H2afy, Tifab GACGACGGTTATCGGGGTTGCGGAGAT SEQ ID 9254787 NO:214 Testes chr17:9836361- Rab24 AGGATGTTACGTTGGGTAGAGCGATTGT SEQ ID 9836363 NO:215 Testes chr17:15749658- Fgd3 GGAAGAGGCGGAATTTAGTTTTGTTGGGGT SEQ ID 15749660 NO:216 Testes chr17:15749669- Fgd3 GGAAGAGGCGGAATTTAGTTTTGTTGGGGT SEQ ID 15749671 NO:217 Testes chr17:15749708- Fgd3 GCGAGAGGAGGTTGGTTTGTCGTTGGT SEQ ID 15749710 NO:218 Testes chr17:23467084- Phactr1, Tbc1d7 AGTTTGAAAGGTTGTTGGGAAAGTGAAGTTTTGT SEQ ID 23467086 NO:219 Testes chr17:42549171- Ripor2, Cmah TGAGGTTGTGGGGAAGAGAGAGGAGGT SEQ ID 42549173 NO:220 Testes chr17:42549173- Ripor2, Cmah TGAGGTTGTGGGGAAGAGAGAGGAGGT SEQ ID 42549175 NO:221 Testes chr17:70337279- Gdi2 AGAGTGTCGGGAGTGTAATTGTAGATAAGGTAGATT SEQ ID 70337281 NO:222 Testes chr18:27166545- Pkd2l2, Reep5 GAGAGGTCGTTTTGGTAGATTCGGTAAGGT SEQ ID 27166547 NO:223 Testes chr18:72425919- Smad2, Zbtb7c CGGGTGATTTAGGTTGGGCGTTTGGTGG SEQ ID 72425921 NO:224 Testes chr18:73997208- Rnf165, Haus1 ACGGGTGTTTATTTTAGTTGCGGGGGG SEQ ID 73997210 NO:225 Testes chr18:74504601- Slc14a1, Slc14a2 GGGATATCGGGTATTAATAGGTAGGAGGAAGCG SEQ ID 74504603 NO:226 Testes chr18:79385037- Mbp, Zfp236 TTGTTGTATTTTGCGGGGGTGGGGTGG SEQ ID 79385039 NO:227 Testes chr18:79385100- Mbp, Zfp236 TTGTTGTATTTTGCGGGGGTGGGGTGG SEQ ID 79385102 NO:228 Testes chr19:25307800- Nanos3, Zswim4 CGTCGTGGCGATCGATTGTGTTGTGGA SEQ ID 25307802 NO:229 Testes chr19:26236259- Zfp791, Man2b1 AGTTAGTGGTTTAACGTTTTGAGTTAAGGGTTGAGT SEQ ID 26236261 NO:230 Testes chr19:40409711- Pmfbp1, Zfhx3 TGGAGTTTTGGTATTAAGGGAGGTTTTCGTGG SEQ ID 40409713 NO:231 Testes chr19:53002297- Foxf1, Irf8 GCGGGAGGGTGTTTGGTTGGTTTTCGT SEQ ID 53002299 NO:232 Testes chr19:53002333- Foxf1, Irf8 GCGGGAGGGTGTTTGGTTGGTTTTCGT SEQ ID 53002335 NO:233 Testes chr19:53002366- Foxf1, Irf8 AGTCGGGTCGGTTTTGGTCGGGTGATT SEQ ID 53002368 NO:234 Testes chr19:53002411- Foxf1, Irf8 AGTCGGGTCGGTTTTGGTCGGGTGATT SEQ ID 53002413 NO:235 Testes chr19:58461062- None AGGGGAGTTTGAGTTTGAAAGGATTAGGGTT SEQ ID 58461064 NO:236 Testes chr19:58461080- None AGGGGAGTTTGAGTTTGAAAGGATTAGGGTT SEQ ID 58461082 NO:237 Testes chr19:59578694- Irf2bp2, Tomm20 AGGTAGGTTGGGTATTTTGGGGGGCGG SEQ ID 59578696 NO:238 Testes chr20:5618190- Bak1 AAGATGGGGTTTGGCGTTGGTTGTCGG SEQ ID 5618192 NO:239P A T E N T Attorney Docket No.: 4552-2000740 Testes chr20:5618200- Bak1 AAGATGGGGTTTGGCGTTGGTTGTCGG SEQ ID 5618202 NO:240 Testes chr20:5618212- Bak1 AAGATGGGGTTTGGCGTTGGTTGTCGG SEQ ID 5618214 NO:241 Testes chr20:10118758- Pde9a GGAATAGGGTAGGAATTCGGAGGTAGGAGT SEQ ID 10118760 NO:242 Testes chr20:31927938- Tacr2, Hk1 AGAGAGTGGTAGCGGTAAGGGGGTCGT SEQ ID 31927940 NO:243 Testes chr20:48245897- Gm9803, Bend3 GGGGGGATAAGAAGTGATGGTGTAAGTGTT SEQ ID 48245899 NO:244 Testes chr20:50565101- Lin28b ACGTGTGTTTAGGGGTTAGAAATCGGAGAG SEQ ID 50565103 NO:245 Liver chr1:11656262- Cited2 AGTTTGTAGTTTTTGGTTGTAAGGTTCGGTTTGT SEQ ID 11656264 NO:246 Liver chr1:14075108- Arfgef3 GCGATTTCGGGGTCGGTGGTTTGGTTT SEQ ID 14075110 NO:247 Liver chr1:16291452- Pde7b, Ahi1 AGGTCGGTAAGATGTTTTGGTGTAGGTGG SEQ ID 16291454 NO:248 Liver chr1:31506131- None AGGAAAAAGGAAACGGATTTTCGGGGGA SEQ ID 31506133 NO:249 Liver chr1:32428910- Slc6a3, Lpcat1 AGATGTTTTGAGAAGAAGTCGGTGTTTGGGA SEQ ID 32428912 NO:250 Liver chr1:40879306- Zbtb2, Akap12 ACGTCGGGTTTTGTGTTTTTTAGTTGATTTAAAGGT SEQ ID 40879308 NO:251 Liver chr1:50556753- Qk, Pacrg AGTCGGGAGGATGAAGGGAGGAGAAGT SEQ ID 50556755 NO:252 Liver chr1:80428006- Nkpd1, Ppp1r37 GGGAGGGAAGGATGGGGGTTGTCGTTT SEQ ID 80428008 NO:253 Liver chr1:82182712- Megf8 TAGACGTTAATGCGTAGGGGGTGGCGG SEQ ID 82182714 NO:254 Liver chr1:82498036- Ccdc97, Tgfb1 GTGGTAGAGCGTTTTTTAGGAAGCGTAAGG SEQ ID 82498038 NO:255 Liver chr1:82498057- Ccdc97, Tgfb1 AGGTTGTGGGAAGAAAGTTGTGATTAAGGATAGTT SEQ ID 82498059 NO:256 Liver chr1:84145775- Ltbp4, Numbl GGGTTTTTTCGGGGTCGTTTCGTCGGG SEQ ID 84145777 NO:257 Liver chr1:84145854- Ltbp4, Numbl GGGTTTTTTCGGGGTCGTTTCGTCGGG SEQ ID 84145856 NO:258 Liver chr1:84145861- Ltbp4, Numbl GGGTTTTTTCGGGGTCGTTTCGTCGGG SEQ ID 84145863 NO:259 Liver chr1:84145867- Ltbp4, Numbl GGGTTTTTTCGGGGTCGTTTCGTCGGG SEQ ID 84145869 NO:260 Liver chr1:84145870- Ltbp4, Numbl GGGTTTTTTCGGGGTCGTTTCGTCGGG SEQ ID 84145872 NO:261 Liver chr1:84145893- Ltbp4, Numbl CGTAGGTCGTATACGGCGGGGGTGAAG SEQ ID 84145895 NO:262 Liver chr1:84145899- Ltbp4, Numbl CGTAGGTCGTATACGGCGGGGGTGAAG SEQ ID 84145901 NO:263 Liver chr1:84147083- Ltbp4, Numbl CGGGAGTTCGGACGTTTGGTTTTTCGGT SEQ ID 84147085 NO:264 Liver chr1:84147133- Ltbp4, Numbl TAAAGGCGGTTTCGAGGGTCGTGGGTT SEQ ID 84147135 NO:265 Liver chr1:84147142- Ltbp4, Numbl AATGGGGGATTGGTAGGCGGCGGTAAT SEQ ID 84147144 NO:266 Liver chr1:84147155- Ltbp4, Numbl AATGGGGGATTGGTAGGCGGCGGTAAT SEQ ID 84147157 NO:267 Liver chr1:84213135- Shkbp1, Sptbn4 ACGAGAAAAGGTAGAGAAGTTGAAAATAGGGATGA SEQ ID 84213137 G NO:268 Liver chr1:85387406- Plekhg2 GAGGGCGAGGGGTAGGGTTGGGAAAAA SEQ ID 85387408 NO:269 Liver chr1:85387408- Plekhg2 GAGGGCGAGGGGTAGGGTTGGGAAAAA SEQ ID 85387410 NO:270P A T E N T Attorney Docket No.: 4552-2000740 Liver chr1:85387420- Plekhg2 GAGGGCGAGGGGTAGGGTTGGGAAAAA SEQ ID 85387422 NO:271 Liver chr1:89485131- Fxyd7 AAAACGGCGTTTGGTTCGTGGTGCGTA SEQ ID 89485133 NO:272 Liver chr1:89485152- Fxyd7 AAAACGGCGTTTGGTTCGTGGTGCGTA SEQ ID 89485154 NO:273 Liver chr1:100653139- Myh14, Kcnc3 TTCGGTGAGGGTGTGGAGAGTGGAAGA SEQ ID 100653141 NO:274 Liver chr1:142183718- Fes AGTGTTGGACGGCGGTTTTAGGGAGTT SEQ ID 142183720 NO:275 Liver chr1:142183744- Fes AGTGTTGGACGGCGGTTTTAGGGAGTT SEQ ID 142183746 NO:276 Liver chr1:144833197- Tmc3, Mex3b TGTGACGGGTAGGAAGGAGGATGTGGT SEQ ID 144833199 NO:277 Liver chr1:144833199- Tmc3, Mex3b TGTGACGGGTAGGAAGGAGGATGTGGT SEQ ID 144833201 NO:278 Liver chr1:144833229- Tmc3, Mex3b ATATCGCGTGGTAGGGTTCGTGGTGGG SEQ ID 144833231 NO:279 Liver chr1:163262949- Acer3 TTGAGCGCGGTTGTTGTTAGGTTCGGT SEQ ID 163262951 NO:280 Liver chr1:165901450- Relt CGAACGTGTGGTTGGGATATTGGGCGG SEQ ID 165901452 NO:281 Liver chr1:198128344- Coro1a AGTTTCGAGGAGGGTAGGGTGGGGTGA SEQ ID 198128346 NO:282 Liver chr1:209649294- Ebf3, 9430038I01Rik CGCGAGGTTAGATTTTCGGGTATCGGGG SEQ ID 209649296 NO:283 Liver chr1:213734807- Pgghg GTATGTGTAGGTTCGGGGTGGGAGGGT SEQ ID 213734809 NO:284 Liver chr1:217345188- Shank2 CGGCGAGTAGTGGTAGGCGTTTGGGC SEQ ID 217345190 NO:285 Liver chr1:217345400- Shank2 CGGTGTTTTTTGGTCGTTAGTTCGCGCG SEQ ID 217345402 NO:286 Liver chr1:218274316- Ccnd1, 1810010D01Rik GGGGTTAGAGGTTTGTTATTGTATATTGTTGGGCG SEQ ID 218274318 NO:287 Liver chr1:218274325- Ccnd1, 1810010D01Rik TGAAATTTTAGTTGGGTTTTCGGTCGTTGGT SEQ ID 218274327 NO:288 Liver chr1:218274391- Ccnd1, 1810010D01Rik TGAAATTTTAGTTGGGTTTTCGGTCGTTGGT SEQ ID 218274393 NO:289 Liver chr1:218657840- Gal AGTGGTGGGAATCGGGCGTAGTTGGTT SEQ ID 218657842 NO:290 Liver chr1:218657882- Gal GGGCGCGAGGGTCGTTTATTGTATGGC SEQ ID 218657884 NO:291 Liver chr1:218657929- Gal ATTAGCGGCGTAGGGAAGCGTACGAGG SEQ ID 218657931 NO:292 Liver chr1:220124930- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID 220124932 NO:293 Liver chr1:220124938- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID 220124940 NO:294 Liver chr1:220124956- Ctsf, Actn3 AGGGCGGGGTTTAATGAGGAGGGGTTG SEQ ID 220124958 NO:295 Liver chr1:222671352- 2700081O15Rik, Rtn3 GGGAGAGAGGGGTTTTAGGTGGGTGGG SEQ ID 222671354 NO:296 Liver chr1:224867192- Chrm1 GATCGGGGTTACGTGGGGGTTAGGTCG SEQ ID 224867194 NO:297 Liver chr1:226265504- Fen1, Myrf AGAAGAGGAATTGGAGATTTAGGCGATGGTT SEQ ID 226265506 NO:298 Liver chr1:260291271- Dntt, Opalin ACGTGTGTGGAATGTGTTCGTGTTTTTAGT SEQ ID 260291273 NO:299 Liver chr1:260582347- Tm9sf3, Pik3ap1 AGTTGTTTTGGGTTATCGGTGTGATTTCGTT SEQ ID 260582349 NO:300 Liver chr1:264481449- Pax2, Hif1an AGGTTCGGGGTAGTTGTAAGTCGGGCG SEQ ID 264481451 NO:301P A T E N T Attorney Docket No.: 4552-2000740 Liver chr1:267091342- Neurl1a, Sh3pxd2a AGGAAGGAAATTAGTGTGGTGTTTATTCGGAATTGA SEQ ID 267091344 NO:302 Liver chr1:274390024- Rbm20 TTGGAAAGGGTTTTGTAGTCGCGAGGT SEQ ID 274390026 NO:303 Liver chr1:274390140- None TTGGAAAGGGTTTTGTAGTCGCGAGGT SEQ ID 274390142 NO:304 Liver chr1:278193283- Ablim1, Fam160b1 GCGGCGGCGGTAGTTTTTCGGGTAATT SEQ ID 278193285 NO:305 Liver chr2:56892320- Gdnf, Wdr70 AGAGTTTCGTTCGGCGGCGGTATTTGC SEQ ID 56892322 NO:306 Liver chr2:56892336- Gdnf, Wdr70 AGAAGTAGCGGGTTCGGGAGTTGTGGT SEQ ID 56892338 NO:307 Liver chr2:56892338- Gdnf, Wdr70 AGAAGTAGCGGGTTCGGGAGTTGTGGT SEQ ID 56892340 NO:308 Liver chr2:57856643- Gm2310, Slc1a3 GAAGGGGGTCGGTAGAGGGGGAGGTTA SEQ ID 57856645 NO:309 Liver chr2:94106725- Fabp5, Pag1 CGGTTGTGGGGTTTGGTGGTTTTTGGT SEQ ID 94106727 NO:310 Liver chr2:94106764- Fabp5, Pag1 CGGTTGTGGGGTTTGGTGGTTTTTGGT SEQ ID 94106766 NO:311 Liver chr2:120897710- Dnajc19, Sox2 ACGTTTTGGCGAGTTACGGAAAATGAATAGAAG SEQ ID 120897712 NO:312 Liver chr2:181975105- Lrat, Fgg AGGTTTTTGAGTATAGCGGATTTGTGTTGCG SEQ ID 181975107 NO:313 Liver chr2:187372024- None CGGAGTTCGGGTTTTTGTGGTGGGTGG SEQ ID 187372026 NO:314 Liver chr2:195638466- Lingo4 AGTCGGTTGATGCGGTAGGTTGTCGGG SEQ ID 195638468 NO:315 Liver chr2:199095043- Gja5, Gja8 GGGTGTGGTTTGAGGTTTGGTAATAGCGCG SEQ ID 199095045 NO:316 Liver chr2:199095045- Gja5, Gja8 GGTGTTCGGTTGGTTTAGGGAGATCGGT SEQ ID 199095047 NO:317 Liver chr2:199095095- Gja5, Gja8 CGGAAGTTGGTTGTTGATTTTAGGTTTGGCG SEQ ID 199095097 NO:318 Liver chr2:207456297- Wnt2b CGTTGGTTAGGGTTCGGGAGAGTTCGGT SEQ ID 207456299 NO:319 Liver chr2:221659404- Snx7, Dpyd AGTCGTGTTTGGTGGAATTTTTTGGGAATTTGA SEQ ID 221659406 NO:320 Liver chr2:263962047- Ptger3, Cth AGGTTTGTTTAGGTGGTTTTCGGGTTTTGT SEQ ID 263962049 NO:321 Liver chr3:3543511-3543513 Nacc2 CGCGTTATTGTTTTTAAAGTTGGGGTTGGG SEQ ID NO:322 Liver chr3:3543572-3543574 Nacc2 GGAGTTTTGTAGGAGGGGTGGGGGTGG SEQ ID NO:323 Liver chr3:5642380-5642382 Adamtsl2, Fam163b AGGTTTTTGGGAAGGAGTTGAGAGGGG SEQ ID NO:324 Liver chr3:5642412-5642414 Adamtsl2, Fam163b AGGTTTTTGGGAAGGAGTTGAGAGGGG SEQ ID NO:325 Liver chr3:9544988-9544990 1700001O22Rik, Cstad AGAGTTCGGGGTTAAGGGGTTTTTGGT SEQ ID NO:326 Liver chr3:9544996-9544998 1700001O22Rik, Cstad AGAGTTCGGGGTTAAGGGGTTTTTGGT SEQ ID NO:327 Liver chr3:10705160- Fnbp1 CGGTTGTTTGGGGGGTTTGGAAGGACG SEQ ID 10705162 NO:328 Liver chr3:11750170- Cdk9 TGGGTAGAGAGGTTTTCGTAGGGTTTTTTGT SEQ ID 11750172 NO:329 Liver chr3:12675083- Zbtb43, Lmx1b AGTGGAGGAGTTTCGGGTTAGGGGGTA SEQ ID 12675085 NO:330 Liver chr3:61040240- Atp5g3, Lnpk AAGGAGGGGATAGAAGGTAGAGAACGTTGA SEQ ID 61040242 NO:331 Liver chr3:62421416- Hnrnpa3, Mtx2 AGGGAAAAGGTTTCGTTTTTTCGCGGT SEQ ID 62421418 NO:332P A T E N T Attorney Docket No.: 4552-2000740 Liver chr3:79612254- Agbl2 AAGGAATCGGGTTGGGGGTACGCGTAG SEQ ID 79612256 NO:333 Liver chr3:92289576- Trim44, Fjx1 GCGGGTTTGGTGTACGGGTATCGGGTA SEQ ID 92289578 NO:334 Liver chr3:111049821- Spint1 CGGTTGGGATTGCGTGCGTGTTTGTTG SEQ ID 111049823 NO:335 Liver chr3:123731822- Cdc25b AAAGTTTGAGAGGTGGCGCGGTCGTTG SEQ ID 123731824 NO:336 Liver chr3:147552235- Scrt2, Slc52a3 AGGGTTTGGAGAGGCGTTTCGGAGGAG SEQ ID 147552237 NO:337 Liver chr3:152811302- Myl9, Dlgap4 AGAGAGAAGGGGCGATAGGGGATGGGG SEQ ID 152811304 NO:338 Liver chr3:167021754- Zfp217, Bcas1 TAGTGTGTGTGTGTGCGTGTGCGTGTG SEQ ID 167021756 NO:339 Liver chr3:170398848- Cass4 TGGGGTTGTATTCGGTGTTTTAGGTAGCG SEQ ID 170398850 NO:340 Liver chr3:170398872- Cass4 GGGGTTGTATTCGGTGTTTTAGGTAGCGT SEQ ID 170398874 NO:341 Liver chr3:170398929- None GGGGTTGTATTCGGTGTTTTAGGTAGCGT SEQ ID 170398931 NO:342 Liver chr3:176721681- Fndc11 CGAGGTACGGAGTCGTCGCGGAATAAT SEQ ID 176721683 NO:343 Liver chr3:176721905- Fndc11 GTAGGGGGAGCGCGGATTTGGTAGTGT SEQ ID 176721907 NO:344 Liver chr3:176722030- Fndc11 GTAGGGGGAGCGCGGATTTGGTAGTGT SEQ ID 176722032 NO:345 Liver chr4:7230864-7230866 Agap3, Gbx1 AGGGTTTGGACGTACGGGAAGTTCGGG SEQ ID NO:346 Liver chr4:7338902-7338904 Nos3, Atg9b CGGAATTTTAGAGGAAGTGGGTATGAGGCG SEQ ID NO:347 Liver chr4:57861123- Cpa4, Cpa2 AGAAAGAAAGGGGGTGGGGGTGTTTGT SEQ ID 57861125 NO:348 Liver chr4:62387060- Tmem140, CGGGTTGGGGATTTAGTTTAGTGGTAAAGCG SEQ ID 62387062 3110062M04Rik NO:349 Liver chr4:62387070- Tmem140, CGGGTTGGGGATTTAGTTTAGTGGTAAAGCG SEQ ID 62387072 3110062M04Rik NO:350 Liver chr4:62387104- Tmem140, AGTAAGAGGTTTTAGTGATTGTTGAATTACGGTGGT SEQ ID 62387106 3110062M04Rik NO:351 Liver chr4:84321843- Prr15, Chn2 GGATGGTTGAGTGAACGAGTTTGAGAGGT SEQ ID 84321845 NO:352 Liver chr4:115701343- Dysf, Zfp638 CGTTGATGTCGGAGTTCGGGGTGTGGA SEQ ID 115701345 NO:353 Liver chr4:116275686- Cyp26b1, Dysf CGAGAGAAAGGAAAGAGAGGAGGGGGGT SEQ ID 116275688 NO:354 Liver chr4:120755763- Abtb1, Mgll AGAGGGGTAGTTTGGGTTGGTGAGTAGT SEQ ID 120755765 NO:355 Liver chr4:120755814- Abtb1, Mgll AGAGGGGTAGTTTGGGTTGGTGAGTAGT SEQ ID 120755816 NO:356 Liver chr4:126785902- Kbtbd8, Lrig1 ATGTGGTGCGGTCGGAAGTTTGTGGTT SEQ ID 126785904 NO:357 Liver chr4:153775244- Tuba8 CGGTTATCGGTTTGGGTTTGGGGCGTT SEQ ID 153775246 NO:358 Liver chr4:153778254- Usp18, Tuba8 ATAGGAATTAGTTGGGGGAGGGGTGCG SEQ ID 153778256 NO:359 Liver chr4:158085215- Vwf AGGGAGGGAGGGGATGGGAAGGGAAAT SEQ ID 158085217 NO:360 Liver chr4:170931773- Arhgdib GGTGTTTTTGTGAAGGGGTGGTTTGGGGG SEQ ID 170931775 NO:361 Liver chr4:179198004- None AGTTTGCGTGTATCGTAAGTTTTTGGTTGGT SEQ ID 179198006 NO:362 Liver chr5:5869029-5869031 Slco5a1 TGGGTTCGGGATTGCGTAGTTTTTTCGT SEQ ID NO:363P A T E N T Attorney Docket No.: 4552-2000740 Liver chr5:5874564-5874566 Slco5a1, Sulf1 AGGAAGGAGTTGTGGGTGAGTTGGTGT SEQ ID NO:364 Liver chr5:5874566-5874568 Slco5a1, Sulf1 AGGAAGGAGTTGTGGGTGAGTTGGTGT SEQ ID NO:365 Liver chr5:5874570-5874572 Slco5a1, Sulf1 AGGAAGGAGTTGTGGGTGAGTTGGTGT SEQ ID NO:366 Liver chr5:35835348- Prdm13 CGCGGGTTTTTCGGGTAGAGGTCGGTA SEQ ID 35835350 NO:367 Liver chr5:57429153- Aqp3 CGAAGTAGTCGGTAGCGGATGTGGAGT SEQ ID 57429155 NO:368 Liver chr5:57429189- Aqp3 CGAAGTAGTCGGTAGCGGATGTGGAGT SEQ ID 57429191 NO:369 Liver chr5:57429198- Aqp3 CGAAGTAGTCGGTAGCGGATGTGGAGT SEQ ID 57429200 NO:370 Liver chr5:57429201- Aqp3 CGAAGTAGTCGGTAGCGGATGTGGAGT SEQ ID 57429203 NO:371 Liver chr5:58982899- Cd72, Sit1 CGCGTTTTTCGGGTGCGGATTTTGAAT SEQ ID 58982901 NO:372 Liver chr5:62131260- Nans, Trim14 AATATCGTGGGGGAAGAGGGGGAGGGT SEQ ID 62131262 NO:373 Liver chr5:62131277- Nans, Trim14 AATATCGTGGGGGAAGAGGGGGAGGGT SEQ ID 62131279 NO:374 Liver chr5:62131330- Nans, Trim14 AATATCGTGGGGGAAGAGGGGGAGGGT SEQ ID 62131332 NO:375 Liver chr5:82587861- Tlr4 CGGTTTTCGTTGGTTGTAGAAAATGTTAGGATGA SEQ ID 82587863 NO:376 Liver chr5:100417180- Mpdz, Nfib ACGTGGGGGATGGGATAAGGATTTATGGT SEQ ID 100417182 NO:377 Liver chr5:101360470- Frem1, Ttc39b TGCGTTTGTTTGAGTTGTAGAGGTTGTGGT SEQ ID 101360472 NO:378 Liver chr5:101360475- Frem1, Ttc39b TGCGTTTGTTTGAGTTGTAGAGGTTGTGGT SEQ ID 101360477 NO:379 Liver chr5:101360527- Frem1, Ttc39b TGAGGGCGAGTGTTGTAATTGTAGAAAGTCG SEQ ID 101360529 NO:380 Liver chr5:101360550- Frem1, Ttc39b TTGTGGGAGGTTCGGGAGTTTTAGGGT SEQ ID 101360552 NO:381 Liver chr5:101360582- Frem1, Ttc39b TTGTGGGAGGTTCGGGAGTTTTAGGGT SEQ ID 101360584 NO:382 Liver chr5:118237999- Foxd3, Gm12689 AGAAATGATTGAGTAGGTAAGGTTTGTGGGGATT SEQ ID 118238001 NO:383 Liver chr5:118238017- Foxd3, Gm12689 AGAAATGATTGAGTAGGTAAGGTTTGTGGGGATT SEQ ID 118238019 NO:384 Liver chr5:118238038- Foxd3, Gm12689 AGAAATGATTGAGTAGGTAAGGTTTGTGGGGATT SEQ ID 118238040 NO:385 Liver chr5:118238047- Foxd3, Gm12689 AGAAATGATTGAGTAGGTAAGGTTTGTGGGGATT SEQ ID 118238049 NO:386 Liver chr5:118238072- Foxd3, Gm12689 AGAAATGATTGAGTAGGTAAGGTTTGTGGGGATT SEQ ID 118238074 NO:387 Liver chr5:133864323- Tal1 GGCGCGCGTGGTTATGTTGGGTAGTTT SEQ ID 133864325 NO:388 Liver chr5:137264603- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264605 NO:389 Liver chr5:137264608- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264610 NO:390 Liver chr5:137264616- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264618 NO:391 Liver chr5:137264650- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264652 NO:392 Liver chr5:137264659- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264661 NO:393 Liver chr5:137264685- Cdc20 AGGTGTTGGGTTGGTGCGAATTGTGGT SEQ ID 137264687 NO:394P A T E N T Attorney Docket No.: 4552-2000740 Liver chr5:141864268- Rragc, 3100002H09Rik GGAGAAGGCGGTTGTTTAGAAGGCGCG SEQ ID 141864270 NO:395 Liver chr5:142689429- Fhl3 CGTTGCGTTCGGATTAGGGTTGGCGTT SEQ ID 142689431 NO:396 Liver chr5:146089686- Csmd2 TGTGATGGGGGTGGGGAATGGGATTCG SEQ ID 146089688 NO:397 Liver chr5:148380443- Hcrtr1, Tinagl1 GGGTCGAATTTTTAGGGGTTCGTGGGGT SEQ ID 148380445 NO:398 Liver chr5:157623078- Minos1, Capzb CGGCGATTTGGAGGTATTTTAGGGATTAAGGT SEQ ID 157623080 NO:399 Liver chr5:157623130- Minos1, Capzb CGGCGATTTGGAGGTATTTTAGGGATTAAGGT SEQ ID 157623132 NO:400 Liver chr5:157623154- Minos1, Capzb GGTTTGGGGTGAAAAAGTTATGTTTTCGGGT SEQ ID 157623156 NO:401 Liver chr5:157623208- Minos1, Capzb AGGGAGGGTGGTTGATTTGGAGTTGAG SEQ ID 157623210 NO:402 Liver chr5:157981929- Iffo2, Ubr4 AGAGAGAGAGAGAGAGAGAGAGCGCGT SEQ ID 157981931 NO:403 Liver chr5:158083296- Aldh4a1, Gm21969 GCGGGAGGCGGATGTGGAGTTTATGGT SEQ ID 158083298 NO:404 Liver chr5:158083359- None GGGTGGGTGGTGGAGGAAGGAAGGAAG SEQ ID 158083361 NO:405 Liver chr5:158083378- Aldh4a1, Gm21969 GGGTGGGTGGTGGAGGAAGGAAGGAAG SEQ ID 158083380 NO:406 Liver chr5:158287563- Pax7, Tas1r2 AGGAGGAGGAGGAGGAGGAGGAGGAGG SEQ ID 158287565 NO:407 Liver chr5:167170232- Slc2a7, Slc2a5 CGGAAGGAGGATGAGGTTGAGAAGGCG SEQ ID 167170234 NO:408 Liver chr5:167170298- Slc2a7, Slc2a5 CGGAAGGAGGATGAGGTTGAGAAGGCGG SEQ ID 167170300 NO:409 Liver chr5:169269274- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269276 NO:410 Liver chr5:169269304- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269306 NO:411 Liver chr5:169269306- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269308 NO:412 Liver chr5:169269327- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269329 NO:413 Liver chr5:169269334- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269336 NO:414 Liver chr5:169269351- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269353 NO:415 Liver chr5:169269363- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269365 NO:416 Liver chr5:169269366- Plekhg5 GAGTTGGGTTTGGTTGTCGTTCGGCGT SEQ ID 169269368 NO:417 Liver chr5:169707340- Nphp4, Ajap1 AAGGAGGGGGAGGGGAAGGTGATTGGA SEQ ID 169707342 NO:418 Liver chr6:26192879- Mrpl33, Slc4a1ap GTGGTGGTGGCGAGATTGGAGAGGGAA SEQ ID 26192881 NO:419 Liver chr6:26193052- Mrpl33, Slc4a1ap GGAGGTTTTTGGGGAGGACGTTGTAGG SEQ ID 26193054 NO:420 Liver chr6:26193088- Mrpl33, Slc4a1ap GGAGGTTTTTGGGGAGGACGTTGTAGG SEQ ID 26193090 NO:421 Liver chr6:26193101- Mrpl33, Slc4a1ap GGAGGTTTTTGGGGAGGACGTTGTAGG SEQ ID 26193103 NO:422 Liver chr6:27440313- Drc1, Otof GGTTGTTGATATTCGGTTGTTTGGGGGT SEQ ID 27440315 NO:423 Liver chr6:27440327- Drc1, Otof GGTTGTTGATATTCGGTTGTTTGGGGGT SEQ ID 27440329 NO:424 Liver chr6:33911362- Laptm4a, Sdc1 AGGAGAGGTTATGGGAGGAGAGGGGGC SEQ ID 33911364 NO:425P A T E N T Attorney Docket No.: 4552-2000740 Liver chr6:43003250- 5730507C01Rik, Hpcal1 AGTTAAGGTAGGCGGGGTTTGGGGGTG SEQ ID 43003252 NO:426 Liver chr6:45275346- Id2, Rnf144a AGTTTAGGGCGTTGGGGGAAGGGAGAA SEQ ID 45275348 NO:427 Liver chr6:103169570- Zfp36l1, Rad51b AGGTTCGGGGAGATGGGTGATGGTTGG SEQ ID 103169572 NO:428 Liver chr6:129216660- None TGGCGATGTTGGGGTATTATTTGTTTAGGTGA SEQ ID 129216662 NO:429 Liver chr6:129216821- D430019H16Rik, Tunar TGTTTAAGTAGGTGGAGTTCGGTTGTTGAGT SEQ ID 129216823 NO:430 Liver chr6:137671155- Gpr132, Jag2 AGGTATTCGGTGTTGAATAGATGAATTTAGTCGTGT SEQ ID 137671157 NO:431 Liver chr6:137671238- Gpr132, Jag2 AGGTATTCGGTGTTGAATAGATGAATTTAGTCGTGT SEQ ID 137671240 NO:432 Liver chr6:137671245- Gpr132, Jag2 AGGTATTCGGTGTTGAATAGATGAATTTAGTCGTGT SEQ ID 137671247 NO:433 Liver chr6:137671249- Gpr132, Jag2 AGGTATTCGGTGTTGAATAGATGAATTTAGTCGTGT SEQ ID 137671251 NO:434 Liver chr7:11334532- Matk GGTGGGGGTGGGGTGGTATGGTGTTTT SEQ ID 11334534 NO:435 Liver chr7:11334536- Matk GGTGGGGGTGGGGTGGTATGGTGTTTT SEQ ID 11334538 NO:436 Liver chr7:12077539- Onecut3, Atp8b3 GGTGGTTTGGAAATTGTGGTTTTTTGGAGTGG SEQ ID 12077541 NO:437 Liver chr7:12282528- Apc2, Rps15 ACGGCGTTTGAATCGAGGTTTGCGGAG SEQ ID 12282530 NO:438 Liver chr7:12282573- Apc2, Rps15 TGGGTGGGTTGGAGGGTTGTGTTTTGG SEQ ID 12282575 NO:439 Liver chr7:12869049- Hcn2, Polrmt AAGGACGCGTTCGGGAGGTTTTCGAGA SEQ ID 12869051 NO:440 Liver chr7:12949252- Shc2 CGCGATTTCGAGTTTCGGTAGCGGTCG SEQ ID 12949254 NO:441 Liver chr7:14217545- Ephx3 AGGTGGTGGGTTGTCGGTATTAGCGTT SEQ ID 14217547 NO:442 Liver chr7:14340438- Akap8 AGACGAGGTGGAGGTTGGCGTTTTGGA SEQ ID 14340440 NO:443 Liver chr7:14340462- Akap8 AGGAATAAGACGAGGTGGAGGTTGGCG SEQ ID 14340464 NO:444 Liver chr7:14340477- Akap8 AGTTGGAGCGATATTTTAAGGTGAGGTAAAGGT SEQ ID 14340479 NO:445 Liver chr7:26845204- Chst11, Slc41a2 0 SEQ ID 26845206 NO:446 Liver chr7:53333359- Csrp2, E2f7 GAATTGGTATTGTTTGGATGTAATATTGTGGCGGT SEQ ID 53333361 NO:447 Liver chr7:53333395- Csrp2, E2f7 GAATTGGTATTGTTTGGATGTAATATTGTGGCGGT SEQ ID 53333397 NO:448 Liver chr7:53333401- Csrp2, E2f7 GAATTGGTATTGTTTGGATGTAATATTGTGGCGGT SEQ ID 53333403 NO:449 Liver chr7:70521760- Pip4k2c, Kif5a AGGGTTCGGAAAGTTTTGGGTTGGAGT SEQ ID 70521762 NO:450 Liver chr7:107776233- Ndrg1 AAGGGAGTTGTGGGGCGTTAGGATCGG SEQ ID 107776235 NO:451 Liver chr7:117254714- BC024139, Plec AGGTTTTTAGGTTCGGGTATACGGAGTCG SEQ ID 117254716 NO:452 Liver chr7:117254799- BC024139, Plec GGGTGTGGTTATGGGGGAGGGGTTGTT SEQ ID 117254801 NO:453 Liver chr7:135934803- None AGGTTGATCGGGATTATCGGCGAGTTT SEQ ID 135934805 NO:454 Liver chr7:137858118- Scaf11 TGGGAGATGAATGGGGAGGAGGGGAGG SEQ ID 137858120 NO:455 Liver chr7:138820180- Amigo2, Rpap3 TAGTAGTGGGTGGTGCGGTTTTGGGGT SEQ ID 138820182 NO:456P A T E N T Attorney Docket No.: 4552-2000740 Liver chr7:139317887- Hdac7, Slc48a1 GGTGTTTCGGGGCGGAAGGTTTGGAAG SEQ ID 139317889 NO:457 Liver chr7:139404519- Tmem106c, Vdr TGAAGGAAGATAATAAGCGATTTCGGGAGGG SEQ ID 139404521 NO:458 Liver chr7:141135498- Nckap5l, Bcdin3d ACGGAGTTCGGGGATGGAGAGAATTTG SEQ ID 141135500 NO:459 Liver chr7:142397475- Slc4a8 CGCGGGTTGATGGTTATGAAGGTGGCG SEQ ID 142397477 NO:460 Liver chr7:142718366- Fignl2, Scn8a CGGTTGTCGTTGGGGGCGGGATTAAAA SEQ ID 142718368 NO:461 Liver chr7:144677353- Hoxc4, Smug1 GGACGGTCGGTCGGGTAATTACGGGTT SEQ ID 144677355 NO:462 Liver chr7:144793158- Smug1, Cbx5 ACGGGTTTGAGAGCGTTTGAATCGGTGT SEQ ID 144793160 NO:463 Liver chr8:11933262- Maml2, Ccdc82 AGTTAGGAAGAAGTAGTGGGTCGGTTGGA SEQ ID 11933264 NO:464 Liver chr8:12101144- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101146 NO:465 Liver chr8:12101148- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101150 NO:466 Liver chr8:12101172- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101174 NO:467 Liver chr8:12101212- Maml2, Ccdc82 AGGAAACGGATTGTGTTGGTTGTTTTTTCGT SEQ ID 12101214 NO:468 Liver chr8:13662925- Panx1, Hephl1 AGTTAGTTTTTGGGGGCGCGGGAGTTT SEQ ID 13662927 NO:469 Liver chr8:13662944- Panx1, Hephl1 AGCGGAGGTTGGTTTTGGATTTTGGGA SEQ ID 13662946 NO:470 Liver chr8:45319038- Crtam, Ubash3b TAGTGGAGGGGAGGGGGAAGGGAATCG SEQ ID 45319040 NO:471 Liver chr8:45319111- Crtam, Ubash3b TAGTGGAGGGGAGGGGGAAGGGAATCG SEQ ID 45319113 NO:472 Liver chr8:48861672- Cxcr5, Bcl9l AGGTGGGGGAGGGGGGTGATAGGTTAG SEQ ID 48861674 NO:473 Liver chr8:48861750- Cxcr5, Bcl9l GGGGTTTTGTGCGTGTGTGGGTTAGGT SEQ ID 48861752 NO:474 Liver chr8:48861770- Cxcr5, Bcl9l GGGGTTTTGTGCGTGTGTGGGTTAGGT SEQ ID 48861772 NO:475 Liver chr8:49184301- Ttc36, Kmt2a TTTGGAAGGGGGTGGAGGAAAGTCGGG SEQ ID 49184303 NO:476 Liver chr8:63251374- Tbc1d21, 6030419C18Rik AAGGGGATTGGGGTAGAGTTGGTGCGG SEQ ID 63251376 NO:477 Liver chr8:71125479- Pif1 ATATCGAGTTGCGGTGTCGGGTAGTCG SEQ ID 71125481 NO:478 Liver chr8:71125510- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125512 NO:479 Liver chr8:71125516- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125518 NO:480 Liver chr8:71125528- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125530 NO:481 Liver chr8:71125530- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125532 NO:482 Liver chr8:71125533- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125535 NO:483 Liver chr8:71125552- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125554 NO:484 Liver chr8:71125561- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125563 NO:485 Liver chr8:71125564- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125566 NO:486 Liver chr8:71125579- Pif1 TCGGTCGGGAGTCGTAAAGTGTTGCGT SEQ ID 71125581 NO:487P A T E N T Attorney Docket No.: 4552-2000740 Liver chr8:73064453- Tpm1, Tln2 CGGGTAAGGTTTTTGAAGGGAGGAACGGT SEQ ID 73064455 NO:488 Liver chr8:77641023- Aldh1a2 TCGGATTTAGGGTTGTGCGATCGCGTC SEQ ID 77641025 NO:489 Liver chr8:81750601- Onecut1, Wdr72 CGGTTTGGTGGGGGTCGGGATTAGGAT SEQ ID 81750603 NO:490 Liver chr8:81750614- Onecut1, Wdr72 CGGTTTGGTGGGGGTCGGGATTAGGAT SEQ ID 81750616 NO:491 Liver chr8:81750630- Onecut1, Wdr72 CGGTTTGGTGGGGGTCGGGATTAGGAT SEQ ID 81750632 NO:492 Liver chr8:81758301- Onecut1, Wdr72 AACGAGAAGGGGGTAGGAATTGGGTTT SEQ ID 81758303 NO:493 Liver chr8:81758327- Onecut1, Wdr72 AACGAGAAGGGGGTAGGAATTGGGTTT SEQ ID 81758329 NO:494 Liver chr8:97244866- Ankrd34c, Rasgrf1 TGAGGGGAAATGGAAATTATTGTTTCGGGTGA SEQ ID 97244868 NO:495 Liver chr8:114897388- Ppm1m, Twf2 CGGATGGAGGGCGGATAGGGGTTTTGT SEQ ID 114897390 NO:496 Liver chr8:114897470- Ppm1m, Twf2 TGGGGGCGGATGTGTTTGTGTATATTGGT SEQ ID 114897472 NO:497 Liver chr8:116764492- Fam212a GGGCGGGTAGGTAGAGTGGAGGAAGGA SEQ ID 116764494 NO:498 Liver chr8:121894228- Pdcd6ip AGTATGGCGCGTAGTTGTCGGAGTTAA SEQ ID 121894230 NO:499 Liver chr8:121894281- Pdcd6ip AGTATGGCGCGTAGTTGTCGGAGTTAA SEQ ID 121894283 NO:500 Liver chr8:122840428- Cmtm7 AGGAGGGGGGATAAAAGAAGGGTGGGT SEQ ID 122840430 NO:501 Liver chr8:122840442- Cmtm7 CGCGTTTCGTATTCGGGTAGGGGAGGG SEQ ID 122840444 NO:502 Liver chr8:122840460- Cmtm7 CGCGTTTCGTATTCGGGTAGGGGAGGG SEQ ID 122840462 NO:503 Liver chr8:122840508- Cmtm7 CGCGTTTCGTATTCGGGTAGGGGAGGG SEQ ID 122840510 NO:504 Liver chr8:130475174- Ccdc13 GGCGGAGGAAGCGTTCGTCGTTTTGAA SEQ ID 130475176 NO:505 Liver chr9:18140411- Runx2, Cdc5l TGGGTTAAGTCGGTTGAGTTATCGTTTCGT SEQ ID 18140413 NO:506 Liver chr9:18644965- Supt3, Clic5 CGGTGGGTGGTTTTCGTCGGAGGTTTG SEQ ID 18644967 NO:507 Liver chr9:29462567- Cd96, Gm4737 CGGAGTTGGGGATCGAATTTAGGGTTTTGCG SEQ ID 29462569 NO:508 Liver chr9:29463402- 4933415F23Rik, Ogfrl1 ATTGGTGATAGTGTTAGGCGTTTTCGTTGTTT SEQ ID 29463404 NO:509 Liver chr9:43045083- Cnnm4 TGGGTCGGAGAAGAAATTGAAGAGCGG SEQ ID 43045085 NO:510 Liver chr9:43045094- Cnnm4 TGGGTCGGAGAAGAAATTGAAGAGCGG SEQ ID 43045096 NO:511 Liver chr9:43045134- Cnnm4 TGGGTCGGAGAAGAAATTGAAGAGCGG SEQ ID 43045136 NO:512 Liver chr9:47185325- Il18r1 AGGGAAGGAGAGTATGGTTAGATAGGGTTAGGA SEQ ID 47185327 NO:513 Liver chr9:61428815- Pgap1, Ankrd44 TGGGGAGAGTTAGTCGTTAGTTGCGTTGT SEQ ID 61428817 NO:514 Liver chr9:66264034- Fzd7, Cdk15 TAGAAAAGTCGGCGGTGGGGAGGAAGG SEQ ID 66264036 NO:515 Liver chr9:66264094- Fzd7, Cdk15 AGATTCGATTTTGTGGGAGGTATTGGGTATGT SEQ ID 66264096 NO:516 Liver chr9:66264122- Fzd7, Cdk15 AGATTCGATTTTGTGGGAGGTATTGGGTATGT SEQ ID 66264124 NO:517 Liver chr9:81670848- Ctdsp1 TCGTAGGAAGTTTTCGGGTCGCGTCGT SEQ ID 81670850 NO:518P A T E N T Attorney Docket No.: 4552-2000740 Liver chr9:81670890- Ctdsp1 GCGTGCGTGTTAAGGCGTGGTATTCGT SEQ ID 81670892 NO:519 Liver chr9:82540719- Dnpep, Des TCGAGGTTGGAAAGAGATTTTGAGGTCGA SEQ ID 82540721 NO:520 Liver chr9:95592768- Glrp1, Arl4c AGCGATGGGAAAGAGTTAGGAGGGAGA SEQ ID 95592770 NO:521 Liver chr9:122081511- Ptchd3 TGTTCGTTCGTTCGGTTTTTCGATTTTGTGT SEQ ID 122081513 NO:522 Liver chr10:11174461- Glis2 TCGGTGAGTAAAGGCGGTTGTTAGATGT SEQ ID 11174463 NO:523 Liver chr10:11174487- Glis2 TCGGTGAGTAAAGGCGGTTGTTAGATGT SEQ ID 11174489 NO:524 Liver chr10:11390689- Adcy9 0 SEQ ID 11390691 NO:525 Liver chr10:11810784- Nlrc3 AGAGATTTTGGTTTGTTCGGAGTCGAGGA SEQ ID 11810786 NO:526 Liver chr10:11810831- Nlrc3 CGAGGTAGAGATTTTGGTTTGTTCGGAGTCG SEQ ID 11810833 NO:527 Liver chr10:37707258- Tcf7, Vdac1 AGGTTGTTTGTTTGGAAGTTTGCGTGATGT SEQ ID 37707260 NO:528 Liver chr10:38823928- Gm9837, Shroom1 AGGAGCGTAGATGTTTTGCGGGTAGTT SEQ ID 38823930 NO:529 Liver chr10:38877692- 45543 AGAAGAGTCGGGGGCGTTCGGGATTTT SEQ ID 38877694 NO:530 Liver chr10:38877699- 45543 AGAAGAGTCGGGGGCGTTCGGGATTTT SEQ ID 38877701 NO:531 Liver chr10:39179667- None AGGAAGGTATATCGAAAACGGGTAAGTGGTG SEQ ID 39179669 NO:532 Liver chr10:46332038- Rasd1 GGTTCGTGAGGAAGCGCGATACGATGG SEQ ID 46332040 NO:533 Liver chr10:46332412- Rasd1 CGTAAAGCGCGGATTGTAACGTTGGAA SEQ ID 46332414 NO:534 Liver chr10:46548301- Srebf1, Rai1 TAGAGCGCGGTTGTCGTCGGGAGAAAA SEQ ID 46548303 NO:535 Liver chr10:46548338- Srebf1, Rai1 TAGAGCGCGGTTGTCGTCGGGAGAAAA SEQ ID 46548340 NO:536 Liver chr10:46548525- Srebf1, Rai1 GGGTGGGGTTTGCGGTTTTTTCGTCGA SEQ ID 46548527 NO:537 Liver chr10:46548534- Srebf1, Rai1 GGGTGGGGTTTGCGGTTTTTTCGTCGA SEQ ID 46548536 NO:538 Liver chr10:46548558- Srebf1, Rai1 GGGTGGGGTTTGCGGTTTTTTCGTCGA SEQ ID 46548560 NO:539 Liver chr10:46548578- Srebf1, Rai1 GGGAGACGAGGAGGGGGAGGGGAATAT SEQ ID 46548580 NO:540 Liver chr10:46548639- Srebf1, Rai1 GGGAGACGAGGAGGGGGAGGGGAATAT SEQ ID 46548641 NO:541 Liver chr10:46548658- Srebf1, Rai1 GGGAGACGAGGAGGGGGAGGGGAATAT SEQ ID 46548660 NO:542 Liver chr10:46548664- Srebf1, Rai1 GGGAGACGAGGAGGGGGAGGGGAATAT SEQ ID 46548666 NO:543 Liver chr10:48903714- None AGTGCGTCGTAGGAGAAGGGCGTGTTT SEQ ID 48903716 NO:544 Liver chr10:56505810- Acap1 GGACGGATAGGGTCGTGGGTTTAGCGT SEQ ID 56505812 NO:545 Liver chr10:56606983- Dvl2 TGGGGGTTGGTTGGTTTGGTTAGGCGA SEQ ID 56606985 NO:546 Liver chr10:56638056- Asgr1, Dlg4 AGCGAGGCGTGTTTTGGTTTTTGACGT SEQ ID 56638058 NO:547 Liver chr10:59529414- Atp2a3 AGAGATGCGAGTGTATGAGGAGTGGGT SEQ ID 59529416 NO:548 Liver chr10:62654897- Trp53i13, Git1 GGTGTGGGTGGGAGTAGGGGTCGTTTT SEQ ID 62654899 NO:549P A T E N T Attorney Docket No.: 4552-2000740 Liver chr10:63738259- Inpp5k, Pitpna AGGGGAGTGGAAGTTCGGGAAGTGTGC SEQ ID 63738261 NO:550 Liver chr10:71162850- Ddx52, Hnf1b AGTGGTTTCGGGAAAGGAGGAATTAATAGCG SEQ IDLiver chr10:82802466- Samd14, Ppp1r9b AGAGAGGGGGGTGGATAATGGTCGGGT SEQ ID 82802468 NO:559 Liver chr10:85772304- B230217C12Rik, Lasp1 GGGAAATTGGAATGGTTTACGAAGTTGGGG SEQ ID 85772306 NO:560 Liver chr10:90189475- BC030867 AAGGAAGGGGCGGAGGAGAGTCGTTTC SEQ ID 90189477 NO:561 Liver chr10:90551662- Meioc, Fzd2 AGTGGGTCGGGTAGGGGATGGTTAGGT SEQ ID 90551664 NO:562 Liver chr10:94220346- Dcaf7, Kcnh6 AGGCGGGGTAGTGTTGTAGTAGAGCGC SEQ ID 94220348 NO:563 Liver chr10:98744072- Kcnj16, Map2k6 AAAAAATATGGGGACGTTTTTGTGATACGGTTGA SEQ ID 98744074 NO:564 Liver chr10:105103653- Acox1, Evpl AGTTTGGTTGCGAGGACGGCGTTTTTT SEQ ID 105103655 NO:565 Liver chr10:106150193- Sept9, Sec14l1 TGGGGGTGAGTGTGGGTGTAGTAGAGT SEQ ID 106150195 NO:566 Liver chr10:106241781- Gm11733, Sept9 GCGAGTTGGGTAGGAGTTTTTAGGCGGG SEQ ID 106241783 NO:567 Liver chr10:106241788- Gm11733, Sept9 GCGAGTTGGGTAGGAGTTTTTAGGCGGG SEQ ID 106241790 NO:568 Liver chr10:106241801- Gm11733, Sept9 GGAGTTTTTAGGCGGGTTTGAGACGGG SEQ ID 106241803 NO:569 Liver chr10:110138638- Slc16a3 ACGTGTCGCGCGACGGATGAGAGTATT SEQ ID 110138640 NO:570 Liver chr10:110894553- Ptchd3, Metrnl AGATCGGTGTTGGAGTATTCGGGAGGT SEQ ID 110894555 NO:571 Liver chr10:110894686- Ptchd3, Metrnl TGGGGTAATGCGTGTGATGGGTGATTT SEQ ID 110894688 NO:572 Liver chr11:35729354- Erg, Kcnj15 TGAAGGAAAGGGAAGTTTTGTCGGAAATGAGA SEQ ID 35729356 NO:573 Liver chr11:70672500- Zfp148, Snx4 AGGAGGGAGAAAGGGAGGGAAGGGAGG SEQ ID 70672502 NO:574 Liver chr11:72614750- Bdh1 TCGGGGAAGTATGGGGATAATGGGGGA SEQ ID 72614752 NO:575 Liver chr11:72614753- Bdh1 TCGGGGAAGTATGGGGATAATGGGGGA SEQ ID 72614755 NO:576 Liver chr11:76465523- Rtp1, BC106179 GGGATCGGTTGTGTGGTTTATGGTAGGT SEQ ID 76465525 NO:577 Liver chr12:1237582- Stard13, Vmn2r18 AAGGCGTGGGGTGGGGGATAGTTGTTT SEQ ID 1237584 NO:578 Liver chr12:4473765- Cers4 GGTGGACGTGATAGGAAAATGCGCGGG SEQ ID 4473767 NO:579 Liver chr12:4473857- Cers4 CGGTTTTCGCGGGTTAGTAGTATTTAGTAGGCG SEQ ID 4473859 NO:580P A T E N T Attorney Docket No.: 4552-2000740 Liver chr12:6779245- Medag, Alox5ap CGGAATCGAATGATTTGTTTTGTTAACGGTAGTTGT SEQ ID 6779247 NO:581 Liver chr12:9455621- Cdx2, Urad ATGTGGGCGATGCGTGTTTTTGTGAAT SEQ ID 9455623 NO:582 Liver chr12:9455646- Cdx2, Urad AGATGTGGGCGATGCGTGTTTTTGTGA SEQ ID 9455648 NO:583 Liver chr12:10254442- Gpr12 CGTTCGCGAGTGGAAATTATTTAGGGCGT SEQ ID 10254444 NO:584 Liver chr12:10254477- Gpr12 AGGTTCGGGTTGGCGGAGATTTTTAGT SEQ ID 10254479 NO:585 Liver chr12:13213820- Kdelr2 ACGGGGTTTATGTAGTTTGGGGATGGGGT SEQ ID 13213822 NO:586 Liver chr12:16236822- Chst12, Gm4869 GTGGAGTTATAGGGAGGTATTGAGGAAGGAGT SEQ ID 16236824 NO:587 Liver chr12:39395649- P2rx7 ACGTTAGGTTAGTGGGGCGTGGGATGG SEQ ID 39395651 NO:588 Liver chr12:43909099- Med13l, 2410131K14Rik ACGTGTTTTGGCGTTTAGGTGGTAGGT SEQ ID 43909101 NO:589 Liver chr12:43909171- Med13l, 2410131K14Rik TTTAGTTGTCGGCGGGTGGAGGTCGAG SEQ ID 43909173 NO:590 Liver chr12:46845675- Pxn 0 SEQ ID 46845677 NO:591 Liver chr12:46845690- Pxn 0 SEQ ID 46845692 NO:592 Liver chr12:52377291- Lrcol1, Fbrsl1 CGTCGTTCGTTGCGGGATTCGTTTCGT SEQ ID 52377293 NO:593 Liver chr13:48446623- Rab7b, Ctse AGGGCGGGGGATGGTAGAGGAGTAGTA SEQ ID 48446625 NO:594 Liver chr13:51534217- Syt2 CGATCGGTGTGGGTTGGTGGAGAAGGT SEQ ID 51534219 NO:595 Liver chr13:79651128- Fasl, Tnfsf18 TGAGGGCGAAGTGTGGAGAAATTTGGA SEQ ID 79651130 NO:596 Liver chr13:79651200- Fasl, Tnfsf18 TGAGGGCGAAGTGTGGAGAAATTTGGA SEQ ID 79651202 NO:597 Liver chr13:99061002- H3f3a, Acbd3 TCGGAGTTGAGGATCGAATTTAGGGTTTTGT SEQ ID 99061004 NO:598 Liver chr13:101252035- Tlr5, Susd4 AGGGCGTTTCGGGTTATAGGTTTTGGT SEQ ID 101252037 NO:599 Liver chr13:110784618- Traf5, Rd3 TGGATTTTTTGGTGTTTTGTGAAAAGTCGGTAGA SEQ ID 110784620 NO:600 Liver chr13:110784621- Traf5, Rd3 TGGATTTTTTGGTGTTTTGTGAAAAGTCGGTAGA SEQ ID 110784623 NO:601 Liver chr14:14316463- Bmp2k, Anxa3 AGCGGTTCGGTAGTTTTGATGCGTTTT SEQ ID 14316465 NO:602 Liver chr14:33174127- Spink2, Rest GTTGTTTCGCGGTTTCGGTTTAGTTTAGGT SEQ ID 33174129 NO:603 Liver chr14:33174184- Spink2, Rest GTTGTTTCGCGGTTTCGGTTTAGTTTAGGT SEQ ID 33174186 NO:604 Liver chr14:34961115- Kit, Kdr GAAGGGTTTGGAGGAGGTAGTCGTCGT SEQ ID 34961117 NO:605 Liver chr14:35434614- Kit, Pdgfra GTGGGGTTTTTCGGGGAGTTGAAATGT SEQ ID 35434616 NO:606 Liver chr14:35434622- Kit, Pdgfra AGTTCGTTATAGTTGGGGTCGTGTGATCG SEQ ID 35434624 NO:607 Liver chr14:60711490- Lgi2, Sepsecs AGAAGGGGTCGGTGGTTAGAGTTCGGA SEQ ID 60711492 NO:608 Liver chr14:60713359- Lgi2, Sepsecs AGGGATAGTTTTAGGGATAGGATGGTCGGT SEQ ID 60713361 NO:609 Liver chr14:60810607- Ccdc149, Lgi2 AGCGGTGATGAGTAAGCGTTGGGTCGA SEQ ID 60810609 NO:610 Liver chr14:71754226- Cd38 GAGTAGCGGGATCGGGGAAGTCGGTTG SEQ ID 71754228 NO:611P A T E N T Attorney Docket No.: 4552-2000740 Liver chr14:83512769- Pik3ip1, Patz1 TAGTTTTTCGGGGAGGGGTGGGTGTGG SEQ ID 83512771 NO:612 Liver chr14:83813416- Morc2a, Smtn AGTGAAGTGGTTTTTCGGGAAGTGGGT SEQ ID 83813418 NO:613 Liver chr14:83813442- Morc2a, Smtn AGTGAAGTGGTTTTTCGGGAAGTGGGT SEQ ID 83813444 NO:614 Liver chr14:86101052- Aebp1 AGGGTTTGGGTGTAGGGCGTTTAGGGG SEQ ID 86101054 NO:615 Liver chr14:103176757- Etaa1, Meis1 TATGGGGTGGGGAGGGGCGGCGTTTAG SEQ ID 103176759 NO:616 Liver chr15:19877200- Fermt2 GGGAACGTGGAAGTGGGTTGTCGGAGA SEQ ID 19877202 NO:617 Liver chr15:41826863- Kpna3, Spryd7 GAGTTTCGTCGGGGAAGTTGTAGCGCG SEQ ID 41826865 NO:618 Liver chr15:41826893- Kpna3, Spryd7 CGGGGAGGTTGTTGTTGGTTATTTCGTGG SEQ ID 41826895 NO:619 Liver chr15:41826913- Kpna3, Spryd7 GAGTTTCGTCGGGGAAGTTGTAGCGCG SEQ ID 41826915 NO:620 Liver chr15:47362111- Rp1l1, Prss55 CGGAGTATTTGGAACGGTTTTATGGCGGT SEQ ID 47362113 NO:621 Liver chr15:51434679- Tnfrsf10b GGAGGGAGGGAAGTTTCGACGTTGGGT SEQ ID 51434681 NO:622 Liver chr15:52244469- Nudt18, Hr AGTTATTTTCGATTCGGGGCGCGCGTT SEQ ID 52244471 NO:623 Liver chr15:90175667- Spry2, Gm10076 TGTTTTTTGGAAAAGGATAGCGAATAAGGTAGGTGA SEQ ID 90175669 NO:624 Liver chr15:90194719- Spry2, Gm4775 AGGGAGTCGGGTAGTTCGGAGTTTGTA SEQ ID 90194721 NO:625 Liver chr15:104170601- Dzip1 AGCGTTCGGTTTTCGTTTAGGAGCGCG SEQ ID 104170603 NO:626 Liver chr15:108463901- Tm9sf2, Timm8a2 GGGATATTGGGAGTGGAATTTAGGGTTATGTGT SEQ ID 108463903 NO:627 Liver chr15:108463922- Tm9sf2, Timm8a2 GGGATATTGGGAGTGGAATTTAGGGTTATGTGT SEQ ID 108463924 NO:628 Liver chr16:1894317- Ppif, Zmiz1 ATTGGTTGGAAGGAAGAGGTCGCGGTT SEQ ID 1894319 NO:629 Liver chr16:1894342- Ppif, Zmiz1 GGTAAGGGGCGGGGTAGGTTGGGGATA SEQ ID 1894344 NO:630 Liver chr16:1894357- Ppif, Zmiz1 TAGTATCGGGAGTAGGGGCGGGGTTGT SEQ ID 1894359 NO:631 Liver chr16:1894366- Ppif, Zmiz1 TAGTATCGGGAGTAGGGGCGGGGTTGT SEQ ID 1894368 NO:632 Liver chr16:1894390- Ppif, Zmiz1 TAGTATCGGGAGTAGGGGCGGGGTTGT SEQ ID 1894392 NO:633 Liver chr16:1894403- Ppif, Zmiz1 TAGTATCGGGAGTAGGGGCGGGGTTGT SEQ ID 1894405 NO:634 Liver chr16:1894407- Ppif, Zmiz1 TAGTATCGGGAGTAGGGGCGGGGTTGT SEQ ID 1894409 NO:635 Liver chr16:10860796- Bmpr1a, 9230112D13Rik GCGGTTGTTTATATCGGCGGAGGAAGCG SEQ ID 10860798 NO:636 Liver chr16:10860839- Bmpr1a, 9230112D13Rik CGGCGGAGGAAGCGTTGAATGTTGGAT SEQ ID 10860841 NO:637 Liver chr16:19772015- Ocel1, Nr2f6 AGCGGTGTAGCGCGGTCGTATTTCGTA SEQ ID 19772017 NO:638 Liver chr16:54444443- Pdgfrl, Mtus1 GGTGTGGTGGTAAAAGATGGAGGGAGACG SEQ ID 54444445 NO:639 Liver chr16:54765406- Mtmr7 CGTCGGGAATTTTGTAGACGCGGGTCG SEQ ID 54765408 NO:640 Liver chr16:67049159- Unc5d AGATAGAATAGGAGAGGTGGTTAGTTCGGTGT SEQ ID 67049161 NO:641 Liver chr16:69035163- Rab11fip1, Got1l1 TGAGGGGTTGGGTTTAAGTTGTGGTCG SEQ ID 69035165 NO:642P A T E N T Attorney Docket No.: 4552-2000740 Liver chr16:71630150- Tacc1 GGGTTAAGGAGGGCGGAGGAGCGATTT SEQ ID 71630152 NO:643 Liver chr17:4982873- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982875 NO:644 Liver chr17:4982886- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982888 NO:645 Liver chr17:4982912- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982914 NO:646 Liver chr17:4982918- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982920 NO:647 Liver chr17:4982942- None AGGAGAGGAAGGTTTGGGTTAGGGGTT SEQ ID 4982944 NO:648 Liver chr17:6701758- Kif27 AAATTATCGGTTTTTCGGGAGGTGGCG SEQ ID 6701760 NO:649 Liver chr17:6925491- Klhl3, Hnrnpa0 GCGTTAATTCGAGGATGAGGAGGTGGT SEQ ID 6925493 NO:650 Liver chr17:6925522- Klhl3, Hnrnpa0 GCGTTAATTCGAGGATGAGGAGGTGGT SEQ ID 6925524 NO:651 Liver chr17:8883311- Pitx1, Catsper3 GTTTTCGTTGCGTTTTGTCGGTCGGCG SEQ ID 8883313 NO:652 Liver chr17:9254785- H2afy, Tifab GACGACGGTTATCGGGGTTGCGGAGAT SEQ ID 9254787 NO:653 Liver chr17:9791421- Rgs14 AGTGGGGTATTGGAAGGGTTTTGGGGT SEQ ID 9791423 NO:654 Liver chr17:12669223- Syk, Auh TTATGGGCGGGTTTTAGCGAGTACGTC SEQ ID 12669225 NO:655 Liver chr17:12669260- Syk, Auh ACGGTTATGTATTTGGGGGAAGAAAGATGGT SEQ ID 12669262 NO:656 Liver chr17:12669304- Syk, Auh TGGGGGAAGAAAGATGGTTTTGTTTCGTG SEQ ID 12669306 NO:657 Liver chr17:15749658- Fgd3 GGAAGAGGCGGAATTTAGTTTTGTTGGGGT SEQ ID 15749660 NO:658 Liver chr17:15749669- Fgd3 GGAAGAGGCGGAATTTAGTTTTGTTGGGGT SEQ ID 15749671 NO:659 Liver chr17:15749708- Fgd3 GCGAGAGGAGGTTGGTTTGTCGTTGGT SEQ ID 15749710 NO:660 Liver chr17:23467084- Phactr1, Tbc1d7 AGTTTGAAAGGTTGTTGGGAAAGTGAAGTTTTGT SEQ ID 23467086 NO:661 Liver chr17:42226316- D130043K22Rik TGAGGTTCGGTCGGGTTATTTGCGAGGT SEQ ID 42226318 NO:662 Liver chr17:42549171- Ripor2, Cmah TGAGGTTGTGGGGAAGAGAGAGGAGGT SEQ ID 42549173 NO:663 Liver chr17:42549173- Ripor2, Cmah TGAGGTTGTGGGGAAGAGAGAGGAGGT SEQ ID 42549175 NO:664 Liver chr17:43831315- Btn2a2, Hist1h4h TCGCGATTTTAGGTCGGTTTATAGGTATGAAGTT SEQ ID 43831317 NO:665 Liver chr17:70337279- Gdi2 AGAGTGTCGGGAGTGTAATTGTAGATAAGGTAGATT SEQ ID 70337281 NO:666 Liver chr17:86000430- Msrb2, Armc3 AGGATAGGGGGAGATTTAGGGTTGTTGGT SEQ ID 86000432 NO:667 Liver chr18:24717683- Lims2 TAGGTTGGGTGGAGTCGTTTTCGCGGT SEQ ID 24717685 NO:668 Liver chr18:24717694- Lims2 TAGGTTGGGTGGAGTCGTTTTCGCGGT SEQ ID 24717696 NO:669 Liver chr18:24717696- Lims2 TAGGTTGGGTGGAGTCGTTTTCGCGGT SEQ ID 24717698 NO:670 Liver chr18:24717710- Lims2 TAGGTTGGGTGGAGTCGTTTTCGCGGT SEQ ID 24717712 NO:671 Liver chr18:28442195- Mzb1 GAGGGAGAGGGCGACGGTGGTAGTAGA SEQ ID 28442197 NO:672 Liver chr18:28442387- Mzb1 GTCGTCGTCGGAGGATTCGGAAGGAGG SEQ ID 28442389 NO:673P A T E N T Attorney Docket No.: 4552-2000740 Liver chr18:28442431- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442433 NO:674 Liver chr18:28442462- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442464 NO:675 Liver chr18:28442468- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442470 NO:676 Liver chr18:28442481- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442483 NO:677 Liver chr18:28442517- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442519 NO:678 Liver chr18:28442532- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442534 NO:679 Liver chr18:28442536- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442538 NO:680 Liver chr18:28442555- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442557 NO:681 Liver chr18:28442563- Mzb1 ATTCGGAAGGAGGGGCGTTTGGATCGT SEQ ID 28442565 NO:682 Liver chr18:29014262- Nrg2, Psd2 AGGTAGGTTTTCGGGAGTTGAGCGGGG SEQ ID 29014264 NO:683 Liver chr18:47512076- Lox, Srfbp1 ACGTGGATGTTTGGATGTAGTAGGGATCG SEQ ID 47512078 NO:684 Liver chr18:63937643- Fam210a, Ldlrad4 GCGTTTGCGTGGGTGTAGGGGATTTGA SEQ ID 63937645 NO:685 Liver chr18:72425919- Smad2, Zbtb7c CGGGTGATTTAGGTTGGGCGTTTGGTGG SEQ ID 72425921 NO:686 Liver chr18:72499818- Smad2, Zbtb7c AGATAGGGTTAGTTTGGGAGTCGGTGTTAGA SEQ ID 72499820 NO:687 Liver chr18:73997208- Rnf165, Haus1 ACGGGTGTTTATTTTAGTTGCGGGGGG SEQ ID 73997210 NO:688 Liver chr18:74504534- Slc14a1, Slc14a2 GGGATATCGGGTATTAATAGGTAGGAGGAAGCG SEQ ID 74504536 NO:689 Liver chr18:74504601- Slc14a1, Slc14a2 GGGATATCGGGTATTAATAGGTAGGAGGAAGCG SEQ ID 74504603 NO:690 Liver chr18:79385037- Mbp, Zfp236 TTGTTGTATTTTGCGGGGGTGGGGTGG SEQ ID 79385039 NO:691 Liver chr18:79385100- Mbp, Zfp236 TTGTTGTATTTTGCGGGGGTGGGGTGG SEQ ID 79385102 NO:692 Liver chr18:79606630- Zfp516, Zfp236 ACGCGTGTGTTAAGTTTTATCGTTGTGAGG SEQ ID 79606632 NO:693 Liver chr18:79606713- None ACGCGTGTGTTAAGTTTTATCGTTGTGAGG SEQ ID 79606715 NO:694 Liver chr18:79761504- Zfp236, Zfp516 AGGAGCGGTTGGGGAGGTAAGAGGTTA SEQ ID 79761506 NO:695 Liver chr19:837038-837040 Cmtm3 ACGGTGCGGGAGGGAGGAAGAAGAGTA SEQ ID NO:696 Liver chr19:16419865- Irx6, Irx5 GAATTCGGGTCGGGTCGCGTGGTTTTT SEQ ID 16419867 NO:697 Liver chr19:18079516- Tox3 TATGTGTGTACGGGGGTAGGGGGTACG SEQ ID 18079518 NO:698 Liver chr19:19745113- Adcy7 CGTTTTTGTCGAGTAGGAAGTGGTGGGT SEQ ID 19745115 NO:699 Liver chr19:19745130- Adcy7 CGTTTTTGTCGAGTAGGAAGTGGTGGGT SEQ ID 19745132 NO:700 Liver chr19:19745190- Adcy7 GGCGTTATTCGGTGTTGTGTCGGAATCG SEQ ID 19745192 NO:701 Liver chr19:25307800- Nanos3, Zswim4 CGTCGTGGCGATCGATTGTGTTGTGGA SEQ ID 25307802 NO:702 Liver chr19:25307861- Nanos3, Zswim4 CGTCGTGGCGATCGATTGTGTTGTGGA SEQ ID 25307863 NO:703 Liver chr19:26236259- Zfp791, Man2b1 AGTTAGTGGTTTAACGTTTTGAGTTAAGGGTTGAGT SEQ ID 26236261 NO:704P A T E N T Attorney Docket No.: 4552-2000740 Liver chr19:41380301- Hydin TCGGCGTTTCGGTTTTTGTGTTGTTTTTT SEQ ID 41380303 NO:705 Liver chr19:41380364- Hydin TAATAGAGAGTTGGTGGCGAGGGGCGG SEQ ID

[0068] In some embodiments, the present kits, devices, systems or articles of manufacture can comprise a common primer, e.g., a common primer for amplifying each of the tissue- specific or organ-specific target polynucleotides whose methylation status is to be assessed. An exemplary common primer can comprise, consist essentially of, or consist of a sequence setP A T E N T Attorney Docket No.: 4552-2000740 forth in SEQ ID NO:731 (CACTCTTTCCCTACACGACGC), or a complementary or substantially complementary sequence thereof.

[0069] The present kits, devices, systems or articles of manufacture can further comprise any other suitable reagents. In some embodiments, the present kits, devices, systems or articles of manufacture can further comprise any other suitable reagents disclosed and / or claimed in U.S. provisional application serial No.62 / 487,422, filed on April 19, 2017, U.S. provisional application serial No.62 / 487,423, filed on April 19, 2017, US 2020 / 0048697 A1 and US 2020 / 0123538 A1.

[0070] For example, the present kits, devices, systems or articles of manufacture can further comprise an agent for isolating the tissue-specific or organ-specific target polynucleotide(s) from a sample that comprises cell-free target polynucleotide(s) from a subject, e.g., a blood or plasma sample.

[0071] In another example, the present kits, devices, systems or articles of manufacture can further comprise a reagent for preparing a library of the tissue-specific or organ-specific target polynucleotide(s). Any suitable reagents for preparing a library of the targets can be included. In some embodiments, the reagent for preparing a library of the tissue-specific or organ-specific target polynucleotide(s) can comprise an enzyme, e.g., a ligase or a single-stranded DNA (ssDNA) ligase. Any suitable ssDNA ligase can be included, e.g., a Thermus bacteriophage RNA ligase such as a bacteriophage TS2126 RNA ligase (e.g., CircLigase™ and CircLigase II™), or an archaebacterium RNA ligase such as Methanobacterium thermoautotrophicum RNA ligase 1.

[0072] In still another example, the present kits, devices, systems or articles of manufacture can further comprise a reagent for amplifying the tissue-specific or organ-specific target polynucleotide(s) or a library of tissue-specific or organ-specific target polynucleotide(s). Any suitable reagents for amplifying the targets or a library of the targets can be included. In some embodiments, the reagent for amplifying the targets or a library of the targets can comprise an enzyme, e.g., an enzyme to be used in a polynucleotide amplification reaction. Exemplary polynucleotide amplification reactions include polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), ligase chain reaction (LCR), nucleic acid sequence based amplification (NASBA), primer extension, rollingP A T E N T Attorney Docket No.: 4552-2000740 circle amplification (RCA), self-sustained sequence replication (3SR), and loop-mediated isothermal amplification (LAMP).

[0073] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise an agent for purifying the tissue-specific or organ-specific target polynucleotide(s), a library of the tissue-specific or organ-specific target polynucleotide(s), amplified tissue-specific or organ-specific target polynucleotide(s) or a library of amplified tissue-specific or organ-specific target polynucleotide(s).

[0074] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a reagent for assessing methylation status of the tissue-specific or organ- specific target polynucleotide(s). Any suitable reagents for assessing methylation status of the targets can be included. In some embodiments, the reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be a reagent to be used in a polynucleotide methylation, e.g., DNA methylation, detecting method such as mass spectrometry, methylation-specific PCR (MSP), bisulphite sequencing, the HpaII tiny fragment Enrichment by ligation-mediated PCR assay (HELP Assay), Glal hydrolysis and ligation adapter dependent PCR assay (GLAD-PCR assay), restriction landmark genomic scanning (RLGS), methylated DNA immunoprecipitation (MeDIP or mDIP), pyrosequencing, molecular break light assay for DNA adenine methyltransferase activity, methyl sensitive Southern blotting and high resolution Melt (HRM) analysis.

[0075] The reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be a chemical agent, e.g., bisulfite or sodium bisulfite. The reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) can also be a biological agent, e.g., a polypeptide or an enzyme.

[0076] Any suitable enzyme can be included. In some embodiments, the enzyme can be a methylation-sensitive restriction enzyme (MSRE). The MSRE can selectively cleave at a residue when it is unmethylated. The MSRE can also selectively cleave at the residue when it is methylated. Exemplary MSRE can be selected from the group consisting of HpaII, SalI, SalI- HF®, ScrFI, BbeI, NotI, SmaI, XmaI, MboI, BstBI, ClaI, MluI, NaeI, NarI, PvuI, SacII, HhaI, and a combination thereof.

[0077] In some embodiments, the enzyme can be a polynucleotide polymerase. The polynucleotide polymerase is configured to be used in polynucleotide amplification reaction,P A T E N T Attorney Docket No.: 4552-2000740 e.g., PCR. Any suitable polynucleotide polymerase can be included. For example, the polynucleotide polymerase can be a DNA polymerase, e.g., a DNA polymerase without a 3’ to 5’ exonuclease activity.

[0078] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a denaturing reagent for denaturing a double-stranded polynucleotide from a sample to obtain the single-stranded polynucleotide.

[0079] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a crowding agent for the ligation reaction. In one aspect, the crowding agent comprises a polyethylene glycol (PEG), such as PEG 4000 or PEG 6000, Dextran, and / or Ficoll.

[0080] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a set of primers each comprising a sequence that is reverse-complement to the adaptor and / or hybridizable to the adaptor, for converting the single-stranded polynucleotide to a double-stranded polynucleotide.

[0081] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a reagent for removing primer dimer and / or primer-adaptor duplex.

[0082] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a primer comprising a sequence specific for a target sequence (e.g., a target sequence listed in Table 2), for obtaining an amplified linear, double-stranded ligation product comprising sequence information of the target sequence. In a further aspect, the kit can further comprise a sequencing adapter and / or a sample-specific barcode, for sequencing the amplified linear, double-stranded ligation product.

[0083] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a panel of isolated polynucleotides described in the above Section B.

[0084] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a reference sample and / or information of a control locus.

[0085] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise separate containers, e.g., vials, for one or more components and / or instructions for using the kits, devices, systems or articles of manufacture.

[0086] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a computer readable medium containing executable instructions forP A T E N T Attorney Docket No.: 4552-2000740 obtaining a methylation metric of a sample based on the methylation status assessment. The computer readable medium can be configured for obtaining a methylation metric in any suitable form, e.g., in the form of average methylation frequency, methylation haplotype load, unmethylation haplotype load, percent discordant reads, or a combination thereof.

[0087] In yet another example, the present kits, devices, systems or articles of manufacture can further comprise a computer readable medium containing executable instructions for classification using the methylation metric(s). Exemplary classification algorithm can be linear discriminant analysis, logistic regression, naïve bayes classification, perceptron classification, quadratic classification, k-nearest neighbors, boosting, decision tree, random forest, neural network, learning vector quantization, or support vector machines, or a combination thereof.

[0088] The present kits, devices, systems or articles of manufacture can be configured for any suitable use or purpose. For example, the present kits, devices, systems or articles of manufacture can be configured for assessing classifying a sample, or is configured for assessing tissue damage or toxicity in the subject.

[0089] In some embodiments, the kit may additionally comprise reagents for detecting presence of polypeptides. Such reagents may be antibodies or other binding molecules that specifically bind to a polypeptide. In some embodiments, such antibodies or binding molecules may be capable of distinguishing a structural variation to the polypeptide as a result of polymorphism, and thus may be used for genotyping. The antibodies or binding molecules may be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme. Other reagents for performing binding assays, such as ELISA, may be included in the kit.

[0090] In some embodiments, the kits comprise reagents for genotyping at least two, at least three, at least five, at least ten, or more markers. The markers may be a polynucleotide marker (such as a cancer-associated mutation or SNP) or a polypeptide marker (such as overexpression or a post-translational modification, including hyper- or hypo-phosphorylation, of a protein) or any combination thereof. In some embodiments, the kits may further comprise a surface or substrate (such as a microarray) for capture probes for detecting of amplified nucleic acids.

[0091] The kits may further comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method. ForP A T E N T Attorney Docket No.: 4552-2000740 example, one of the container means may comprise a probe that is or can be detectably labeled. Such probe may be a polynucleotide specific for a biomarker. The kit may also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and / or a container comprising a reporter-means bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.

[0092] The kit typically comprises the container(s) described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. A label may be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, and may also indicate directions for either in vivo or in vitro use, such as those described above.

[0093] The kit can further comprise a set of instructions and materials for preparing a tissue or cell or body fluid sample and preparing nucleic acids (such as ctDNA) from the sample, e.g., a blood sample, a serum sample or a plasma sample.

[0094] The one or more tissue-specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2 consecutive polynucleotides of a tissue- specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue- specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject.

[0095] In some embodiments, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject. For example, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more tissues or organs of the subject. In some embodiments, the tissue-specific or organ-specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject.P A T E N T Attorney Docket No.: 4552-2000740

[0096] In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes an RNA that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes a polypeptide that is specific for the tissue or organ in the subject.

[0097] In some embodiments, the one or more tissue-specific or organ-specific target polynucleotide(s) / gene(s) is or are listed in Table 1 or 2, or is or are a subgroup of the tissue- specific or organ-specific target polynucleotide(s) / gene(s) that is or are listed in Table 1 or 2. For example, the tissue-specific or organ-specific target polynucleotide(s) / gene(s) can be a single, multiple or all tissue-specific or organ-specific target polynucleotide(s) / gene(s) for a particular tissue or organ or for selective groups of tissues or organs listed in Table 1 or 2. D. Methods for assessing cancer or neoplasia in a subject

[0098] In still another aspect, provided herein is an in vitro method for classifying a sample, which method comprises: a) in vitro assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from said subject; and b) classifying said sample into a category based on said methylation status of said one or more tissue-specific or organ-specific target polynucleotide(s) in said sample obtained in a).

[0099] In some embodiments, step 1) of the present methods comprises in vitro assessing methylation status of one tissue-specific or organ-specific target polynucleotide of a subject in a sample that comprises cell-free target polynucleotide from the subject. In some embodiments, step 1) of the present methods comprises in vitro assessing methylation status of two or more tissue-specific or organ-specific target polynucleotides of a subject in a sample that comprises cell-free target polynucleotides from the subject.

[0100] In some embodiments, step 1) of the present methods comprises in vitro assessing methylation status of one or more tissue-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject.

[0101] The present methods can be used for any suitable purposes. In some embodiments, the present methods can be used for assessing tissue damage or toxicity in the subject. In someP A T E N T Attorney Docket No.: 4552-2000740 embodiments, the present methods can be used for assessing damage or toxicity of a connective tissue, an epithelial tissue, a muscle tissue and / or a nervous tissue in the subject.

[0102] In some embodiments, step 1) of the present methods comprises in vitro assessing methylation status of one or more organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject.

[0103] The present methods can be used for any suitable purposes. In some embodiments, the present methods can be used for assessing organ damage or toxicity in the subject. The present methods can be used for assessing any suitable organ damage or toxicity in the subject. Exemplary organs include an organ of a system that is selected from the group consisting of cardiovascular system, e.g., lung heart, blood and blood vessels; digestive system, e.g., salivary glands, esophagus, stomach, liver, gallbladder, pancreas, intestines, colon, mesentery, rectum and anus; endocrine system, e.g. endocrine glands such as the hypothalamus, pituitary gland, pineal body or pineal gland, thyroid, parathyroids and adrenals, i.e., adrenal glands; excretory system, e.g., kidneys, ureters, bladder and urethra; lymphatic system, e.g., the lymph and the nodes and vessels that transport it including the immune system: defending against disease- causing agents with leukocytes, tonsils, adenoids, thymus and spleen; integumentary system, e.g., skin, hair and nails of a mammal; muscular system, e.g., muscles; nervous system, e.g., brain, spinal cord and nerves; reproductive system, e.g., the sex organs, such as ovaries, oviducts, uterus, vulva, vagina, testicles, vas deferens, seminal vesicles, prostate and penis; respiratory system, e.g., pharynx, larynx, trachea, bronchi, lungs and diaphragm; and skeletal system, e.g., bones, cartilage, ligaments and tendons. In some embodiments, the present methods can be used for assessing damage or toxicity of liver, kidney, heart, stomach, lungs, testis, small intestine, colon, and / or gastrocnemius in a subject.

[0104] The present methods can be used for assessing damage or toxicity of any suitable number of organ(s) in a subject. In some embodiments, the present methods can be used for assessing damage or toxicity of a single organ in a subject. In some embodiments, the present methods can be used for assessing damage or toxicity of multiple organs in a subject, e.g., least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more organs in a subject. In some embodiments, the present methods can be used for assessing damage or toxicity of all organs in a subject.P A T E N T Attorney Docket No.: 4552-2000740

[0105] The present methods can be used for assessing tissue or organ damage or toxicity in the subject that is caused by or due any suitable causes or reasons. In some embodiments, the present methods can be used for assessing tissue or organ damage or toxicity in a subject that is caused by treating the subject with a substance.

[0106] The tissue or organ damage or toxicity in a subject can be caused by treating the subject with any suitable substance. In some embodiments, the substance is a drug or a drug candidate. For example, the drug or drug candidate can be a chemical or small molecule drug or drug candidate. In another example, the drug or drug candidate can be a biological molecule drug or drug candidate, e.g., a polypeptide, polynucleotide or a complex thereof. In some embodiments, the drug or drug candidate is a conjugated drug or drug candidate, such as a chemical or small molecule drug or drug candidate conjugated to a polypeptide or antibody, polynucleotide or a complex thereof. In some embodiments, the drug or drug candidate is a conjugated drug or drug candidate, such as a chemical or small molecule drug or drug candidate conjugated to an antibody.

[0107] The present methods can be used for any suitable purposes. In some embodiments, step b) of the present methods can comprise generating a methylation status score with a computer algorithm based on the assessed methylation status of the one or more tissue-specific or organ-specific target polynucleotide(s), and classifying the sample into a category based on the methylation status score.

[0108] The present methods can be used on any suitable sample, e.g., any suitable sample that comprises cell-free target polynucleotide from the subject. In some embodiments, the sample is a blood sample, a urine sample, a cerebrospinal fluid sample, a pleural fluid sample and a saliva sample. In some embodiments, the blood sample is a serum sample, a plasma sample, or any combination thereof.

[0109] The present methods can be used for assessing tissue and / or organ damage or toxicity in any suitable subject. For example, the present methods can be used for assessing tissue and / or organ damage or toxicity in a mammal. The mammal can be a non-human mammal, e.g., a pet, a farm animal, a companion animal or an experimental animal. The mammal can also be a human.

[0110] The present methods can be used for assessing methylation status of any suitable number of tissue-specific or organ-specific target polynucleotides. For example, the presentP A T E N T Attorney Docket No.: 4552-2000740 methods can comprise assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides. In some embodiments, the present methods can comprise assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides located in one or more genes listed in Table 1 or 2 (see e.g., Section C above). In some embodiments, the present methods can comprise assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue- specific or organ-specific target polynucleotides located in one or more genes for one organ or for multiple organs listed in Table 1 or 2 (see e.g., Section C above).

[0111] The methylation status of target polynucleotides can be assessed using any suitable methods or reagents. For example, the methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be assessed using a probe or primer configured for hybridizing with each of the target polynucleotide(s). In some embodiments, the methylation status of the tissue- specific or organ-specific target polynucleotide(s) is assessed using a single probe or primer configured for hybridizing with the target polynucleotide. In some embodiments, the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using multiple probes or primers configured for hybridizing with the tissue-specific or organ- specific target polynucleotide(s).

[0112] In some embodiments, the one or more primers used in the in the present methods can comprise, consist essentially of, or consist of, a sequence set forth in SEQ ID NOs: 1-730 listed in Table 2, a complementary or substantially complementary sequence thereof, or any combination thereof. For each Target listed in Table 2, the one or more primers used in the present methods can comprise, consist essentially of, or consist of, one or more corresponding primers for that Target. For example, the one or more primers may comprise, consist essentially of, or consist of, a sequence set forth in any of SEQ ID NO:1 - SEQ ID NO:730, a complementary or substantially complementary sequence thereof, or any combination thereof.

[0113] The present methods can further comprise using a common primer for amplifying each of the target polynucleotide whose methylation status is to be assessed. An exemplary common primer can comprise, consist essentially of, or consist of a sequence set forth in SEQP A T E N T Attorney Docket No.: 4552-2000740 ID NO:731 (CACTCTTTCCCTACACGACGC), or a complementary or substantially complementary sequence thereof.

[0114] The present methods can further comprise any other suitable steps. In some embodiments, the present methods can further comprise any other suitable steps disclosed and / or claimed in U.S. provisional application serial No.62 / 487,422, filed on April 19, 2017, U.S. provisional application serial No.62 / 487,423, filed on April 19, 2017, US 2020 / 0048697 A1 and US 2020 / 0123538 A1. For example, techniques and steps for constructing single-stranded polynucleotide, conversion of single-stranded polynucleotide library to double-stranded polynucleotide library, semi-targeted amplification of double-stranded polynucleotide library, and construction of sequence library and analysis of sequencing reads disclosed and / or claimed in U.S. provisional application serial No.62 / 487,423, filed on April 19, 2017 and US 2020 / 0123538 A1, can be used to obtain and / or prepare target polynucleotides to be analyzed.

[0115] For example, the present methods can further comprise isolating the tissue-specific or organ-specific target polynucleotide(s) from a sample, e.g., a blood sample.

[0116] In another example, the present methods can further comprise preparing a library of tissue-specific or organ-specific target polynucleotide(s). Any suitable reagents for preparing a library of tissue-specific or organ-specific target polynucleotide(s) can be used. In some embodiments, the reagent for preparing a library of the tissue-specific or organ-specific target polynucleotide(s) can comprise an enzyme, e.g., a ligase or a single-stranded DNA (ssDNA) ligase. Any suitable ssDNA ligase can be included, e.g., a Thermus bacteriophage RNA ligase such as a bacteriophage TS2126 RNA ligase (e.g., CircLigase™ and CircLigase II™), or an archaebacterium RNA ligase such as Methanobacterium thermoautotrophicum RNA ligase 1.

[0117] In still another example, the present methods can further comprise amplifying the tissue-specific or organ-specific target polynucleotide(s). In some embodiments, the reagent for amplifying the tissue-specific or organ-specific target polynucleotide(s) or a library of the tissue- specific or organ-specific target polynucleotide(s) can comprise an enzyme, e.g., an enzyme to be used in a polynucleotide amplification reaction. Exemplary polynucleotide amplification reactions include polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), ligase chain reaction (LCR), nucleic acid sequence based amplification (NASBA), primer extension, rolling circle amplification (RCA), self- sustained sequence replication (3SR), and loop-mediated isothermal amplification (LAMP).P A T E N T Attorney Docket No.: 4552-2000740

[0118] In yet another example, the present methods can further comprise purifying the tissue-specific or organ-specific target polynucleotide(s), a library of the tissue-specific or organ-specific target polynucleotides, amplified tissue-specific or organ-specific target polynucleotide(s), or a library of the amplified tissue-specific or organ-specific target polynucleotides.

[0119] The methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be assessed using any suitable methods and / or regents. In some embodiments, the methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be assessed using mass spectrometry, methylation-specific PCR (MSP), methylation-sensitive sequencing, e.g., bisulphite sequencing, the HpaII tiny fragment Enrichment by ligation-mediated PCR assay (HELP Assay), Glal hydrolysis and ligation adapter dependent PCR assay (GLAD-PCR assay), restriction landmark genomic scanning (RLGS), methylated DNA immunoprecipitation (MeDIP or mDIP), pyrosequencing, molecular break light assay for DNA adenine methyltransferase activity, methyl sensitive Southern blotting or high resolution Melt (HRM) analysis.

[0120] In some embodiments, the methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be assessed using a chemical agent, e.g., bisulfite or sodium bisulfite. In some embodiments, the methylation status of the tissue-specific or organ-specific target polynucleotide(s) can be assessed using a biological agent, e.g., a polypeptide or an enzyme.

[0121] Any suitable enzyme can be used. In some embodiments, the enzyme can be a methylation-sensitive restriction enzyme (MSRE). The MSRE can selectively cleave at a residue when it is unmethylated. The MSRE can also selectively cleave at the residue when it is methylated. Exemplary MSRE can be selected from the group consisting of HpaII, SalI, SalI- HF®, ScrFI, BbeI, NotI, SmaI, XmaI, MboI, BstBI, ClaI, MluI, NaeI, NarI, PvuI, SacII, HhaI, and a combination thereof.

[0122] In some embodiments, the enzyme can be a polynucleotide polymerase. The polynucleotide polymerase can be used in polynucleotide amplification reaction, e.g., PCR. Any suitable polynucleotide polymerase can be used. For example, the polynucleotide polymerase can be a DNA polymerase, e.g., a DNA polymerase without a 3’ to 5’ exonuclease activity.P A T E N T Attorney Docket No.: 4552-2000740

[0123] In some embodiments, the methylation status of tissue-specific or organ-specific target polynucleotide(s) can be assessed using methylation-sensitive sequencing, e.g., bisulphite sequencing. Bisulfite conversion is a method that uses bisulfite to determine the methylation pattern of DNA. DNA methylation is a biochemical process involving the addition of a methyl group to the cytosine or adenine DNA nucleotides. DNA methylation stably alters the expression of genes in cells as cells divide and differentiate from embryonic stem cells into specific tissues. In bisulfite conversion, target nucleic acids are first treated with bisulfite reagents that specifically convert un-methylated cytosines to uracils while having no impact of methylated cytosine. One consequence of bisulfite conversion is that the double-stranded conformation of the original target is disrupted due to loss of sequence complementarity. The target sequences exist as two separate single-stranded DNAs during sample preparation and analytical or diagnostic testing. Target nucleic acid sequences frequently also exist at very low concentrations. This is an especially important consideration for circulating tumor DNA (also referred to as “cell-free tumor DNA,” or “ctDNA”) due to its often low concentration in circulation and the very low variant allele fraction.

[0124] Any suitable format of methylation-sensitive sequencing can be used. For example, the methylation-sensitive sequencing can be conducted with a format selected from the group consisting of Maxam-Gilbert sequencing, a chain-termination method, shotgun sequencing, bridge PCR, single-molecule real-time sequencing, ion semiconductor (ion torrent sequencing), sequencing by synthesis, sequencing by ligation (SOLiD sequencing), chain termination (Sanger sequencing), massively parallel signature sequencing (MPSS), polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, single molecule real time (SMRT) sequencing, nanopore DNA sequencing, tunnelling currents DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, a microscopy-based technique, RNAP sequencing, and in vitro virus high-throughput sequencing.

[0125] In some embodiments, the present methods can further comprise, prior to the methylation-sensitive sequencing, e.g., bisulphite sequencing, obtaining a library of linear, single-stranded ligation products, each of the linear, single-stranded ligation products comprises of a linear, single-stranded target polynucleotide linked to an adaptor comprising a unique molecular identifier (UMI) sequence that earmarks the single-stranded target polynucleotide toP A T E N T Attorney Docket No.: 4552-2000740 which the adaptor is ligated. The sequencing reads from the tissue-specific or organ-specific target polynucleotide(s) can be first adapter trimmed to remove any adapter sequence originating from the library construction process to obtain trimmed sequencing reads. The trimmed sequencing reads can be mapped to a reference genome, e.g., a human reference genome, using an alignment program to obtain an aligned read file.

[0126] Methylation status of one, more or each of the tissue-specific or organ-specific target polynucleotides can be assessed. In some embodiments, methylation status of each of the tissue- specific or organ-specific target polynucleotides can be assessed.

[0127] In some embodiments, methylation status of each of the tissue-specific or organ- specific target polynucleotides can be assessed to obtain a methylation metric, e.g., in the form of average methylation frequency, methylation haplotype load, unmethylation haplotype load, percent discordant reads, or a combination thereof. In some embodiments, methylation status of a sample, e.g., a blood sample, is assessed using the methylation metrics from each of the tissue- specific or organ-specific target polynucleotides.

[0128] Methylation status of a sample can be assessed using the methylation metrics from each of the tissue-specific or organ-specific target polynucleotide(s). The methylation metrics can be analyzed or used in any suitable manner. For example, methylation metric for each of the tissue-specific or organ-specific target polynucleotides can be compared to a threshold or reference value to assess methylation status of a sample, e.g., a blood sample.

[0129] In another example, a numerical methylation matrix can be computed using the methylation metrics from each of the tissue-specific or organ-specific target polynucleotides to assess methylation status of a sample, e.g., a blood sample. The numerical methylation matrix can be in any suitable format. In some embodiments, the numerical methylation matrix from a sample, e.g., a blood sample, can comprise a single numerical number or value. In other embodiments, the numerical methylation matrix from a sample, e.g., a blood sample, can comprise multiple numerical numbers or values.

[0130] The numerical methylation matrix can be obtained or computed using any suitable formulae or algorithm. In some embodiments, the numerical methylation matrix can be computed using a classification algorithm, e.g., linear discriminant analysis, logistic regression, naïve bayes classification, perceptron classification, quadratic classification, k-nearestP A T E N T Attorney Docket No.: 4552-2000740 neighbors, boosting, decision tree, random forest, neural network, learning vector quantization, or support vector machines.

[0131] The methylation matrix can be used in any suitable manner in assessing methylation status of a sample. For example, the methylation matrix can be compared to a threshold or reference value to assess methylation status of a sample, e.g., a blood sample.

[0132] The methylation status of at least two tissue-specific or organ-specific target polynucleotides from multiple samples, e.g., multiple samples from multiple subjects, can be assessed sequentially or simultaneously. In some embodiments, the methylation status of at least two target polynucleotides from multiple samples, e.g., multiple samples from multiple subjects, can be assessed sequentially. For example, methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides listed in Table 1 or 2, or a numerical range or subrange thereof, can be assessed sequentially. In other embodiments, the methylation status of at least two target polynucleotides from multiple samples, e.g., multiple samples from multiple subjects, can be assessed simultaneously. For example, methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides listed in Table 1 or 2, or a numerical range or subrange thereof, can be assessed simultaneously.

[0133] In some embodiments, the methylation metric for each of the target polynucleotides is obtained using a computer. In other embodiments, the methylation matrix of a sample is obtained using a computer based on the methylation metrics from each of the target polynucleotides.

[0134] In some embodiments, methylation matrix of a sample, e.g., a blood sample, is obtained using a computer based on the methylation metrics from each of the tissue-specific or organ-specific target polynucleotides.

[0135] In some embodiments, methylation status of at least two of the tissue-specific or organ-specific target polynucleotides from multiple samples, e.g., multiple samples from multiple subjects, are assessed sequentially or simultaneously.

[0136] The present tests can have any suitable sensitivity. For example, the present tests can have a sensitivity of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%,P A T E N T Attorney Docket No.: 4552-2000740 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.999%, 99.9999%, or 100%. In some embodiments, the present methods have a sensitivity for assessing tissue or organ damage or toxicity in a subject that is higher than a sensitivity for assessing tissue or organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. In some embodiments, the present methods have a sensitivity for assessing tissue damage or toxicity in a subject that is higher than a sensitivity for assessing tissue damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. In some embodiments, the present methods have a sensitivity for assessing organ damage or toxicity in a subject that is higher than a sensitivity for assessing organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the organ damage or toxicity.

[0137] The present tests can have any suitable specificity. For example, the present tests can have a specificity of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.999%, 99.9999%, or 100%. . In some embodiments, the present methods have a specificity for assessing tissue or organ damage or toxicity in a subject that is higher than a specificity for assessing tissue or organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. . In some embodiments, the present methods have a specificity for assessing tissue damage or toxicity in a subject that is higher than a specificity for assessing tissue damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. . In some embodiments, the present methods have a specificity for assessing organ damage or toxicity in a subject that is higher than a specificity for assessing organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity.

[0138] The present methods can be used for any suitable purpose. For example, the present methods can be used for assessing tissue or organ damage or toxicity in a subject at a stage when the tissue or organ damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. In some embodiments, the present methods can be used for assessing tissue damage orP A T E N T Attorney Docket No.: 4552-2000740 toxicity in a subject at a stage when the tissue damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. In some embodiments, the present methods can be used for assessing organ damage or toxicity in a subject at a stage when the organ damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity.

[0139] The present methods can be used for assessing damage or toxicity of multiple tissues and / or multiple organs in a subject, e.g., all tissues and / or organs in the subject, in one test. In some embodiments, the present methods can be used for assessing damage or toxicity of multiple tissues in a subject, e.g., all tissues in the subject, in one test. In some embodiments, the present methods can be used for assessing damage or toxicity of multiple organs in a subject, e.g., all organs in the subject, in one test.

[0140] In some embodiments, the present methods can further comprise assessing tissue or organ damage or toxicity in a subject by assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity.

[0141] In some embodiments, the present methods can be used for assessing tissue or organ damage or toxicity in an animal subject in an animal test.

[0142] In some embodiments, the present methods can be used for assessing tissue or organ damage or toxicity over time from a single animal.

[0143] In some embodiments, the present methods can be used for assessing tissue or organ damage or toxicity in a human subject, e.g., in a human subject in a pre-clinical study or in a clinical study.

[0144] In some embodiments, the present methods can be used for diagnosis, prognosis, stratification, risk assessment, or treatment monitoring of tissue or organ damage or toxicity in a subject.

[0145] In some embodiments, the present methods can be used for assessing liver damage or toxicity in a subject. In these methods or test, the tissue-specific or organ-specific target polynucleotide(s): a) can be located in one or more gene(s) that is or are specific for liver as listed in Table 1 or 2; or c) can comprise, consist essentially of, or consist of one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof.P A T E N T Attorney Docket No.: 4552-2000740

[0146] In some embodiments, the present methods can be used for assessing testicle or testes damage or toxicity in a subject. In these methods or test, the tissue-specific or organ-specific target polynucleotide(s): a) can be located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) can be located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 1 or 2; or c) can comprise, consist essentially of, or consist of one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof.

[0147] The one or more tissue-specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2 consecutive polynucleotides of a tissue- specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue- specific or organ-specific target polynucleotide(s) can comprise, consist of or essentially consist of, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject.

[0148] In some embodiments, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject. For example, the tissue-specific or organ-specific target gene can be selectively or predominantly expressed and / or translated in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more tissues or organs of the subject. In some embodiments, the tissue-specific or organ-specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject.

[0149] In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes an RNA that is specific for the tissue or organ in the subject. In some embodiments, the one or more tissue-specific or organ-specific target gene(s) of a subject encodes a polypeptide that is specific for the tissue or organ in the subject.P A T E N T Attorney Docket No.: 4552-2000740

[0150] In some embodiments, the one or more tissue-specific or organ-specific target polynucleotide(s) / gene(s) is or are listed in Table 1 or 2, or is or are a subgroup of the tissue- specific or organ-specific target polynucleotide(s) / gene(s) that is or are listed in Table 1 or 2. For example, the tissue-specific or organ-specific target polynucleotide(s) / gene(s) can be a single, multiple or all tissue-specific or organ-specific target polynucleotide(s) / gene(s) for a particular tissue or organ or for selective groups of tissues or organs listed in Table 1 or 2. E. Exemplary Generation Data Analysis Methods Generation of RRBS Libraries for Sequencing (MONOD)

[0151] In some embodiments, DNA is first extracted from samples of interest using a commercial DNA extraction kit, such as the QIAGEN DNeasy or the Thermo Fisher MagMax Total Nucleic Acid extraction kit. Isolated DNA is then treated with a methylation-insensitive restriction enzyme (e.g. MspI) to obtain fragmented DNA with a sticky overhang matching the restriction digest site. DNA can optionally be end-repaired and A-tailed using an enzymatic process prior to this step to create an A-overhang, or the untreated restriction digest site can be retained as an overhang. Specialized RRBS sequencing adapters are then ligated to the end of each DNA fragment using DNA ligase; these sequencing adapters contain 5’-methylcytosine instead of unmethylated cytosine to protect the adapter region from bisulfite conversion. The ligated molecules are then treated with sodium bisulfite, which converts all unmethylated cytosines to uracil and leaves methylated cytosines intact as cytosines, and the treated molecules are eluted using a DNA cleanup column. Libraries are then loaded onto an NGS sequencer (such as the Illumina NextSeq 500) and sequenced as per the manufacturer’s instructions.

[0152] Other bisulfite library construction methods can also be utilized instead of RRBS, such as WGBS (in which the DNA is fragmented using a random fragmentase such as DNAse I instead of a restriction enzyme) or Singlera’s patented TitanSeq approach (which utilizes a single-strand ligation and semi-PCR approach after bisulfite conversion). Data Analysis Methods PreprocessingP A T E N T Attorney Docket No.: 4552-2000740

[0153] In some embodiments, sequencing reads are first adapter trimmed (to remove any synthetic adapter sequence originating from the sequencing library construction process) using a trimming program such as Cutadapt (http: / / journal.embnet.org / index.php / embnetjournal / article / view / 200 / 479) or Trimmomatic (https: / / www.ncbi.nlm.nih.gov / pubmed / 24695404). Trimmed reads are then mapped to the human reference genome using an alignment program such as Bowtie (http: / / bowtie- bio.sourceforge.net / index.shtml), Bowtie2 (http: / / bowtie- bio.sourceforge.net / bowtie2 / index.shtml), or BWA (http: / / bio-bwa.sourceforge.net). The resultant aligned read file is then sorted and indexed using Samtools (https: / / github.com / samtools / samtools). Reads are then grouped into sets corresponding to each target region that can be used for methylation metric computation. Methylation Metric Computation

[0154] In some embodiments, for each target, a “methylation metric” representing that individual region’s methylation state is computed using the aligned reads. Four metrics that can be used are Average Methylation Frequency (AMF), Methylation Haplotype Load (MHL), UnMethylation Haplotype Load (UMHL), and Percent Discordant Reads (PDR).

[0155] Average Methylation Frequency is computed by summing the number of cytosine bases observed at CpG sites within the target region and dividing by the number of cytosine and thymine bases observed at CpG sites within the target region: ∑^^^ = ^^^ ^^ ^^^Where N is the number of reads i is the ith read in the target region, Ci is the number of cytosines observed in the ith read, and Ti is the number of thymines observed in the ith read.

[0156] Methylation Haplotype Load is computed by taking all possible substrings of adjacent CpG sites within a target region and calculating a weighted sum of the fraction of reads showing full methylation within each substring:P A T E N T Attorney Docket No.: 4552-2000740 ∑^ ^^^^^^ ^^^^^ = ^^Where n is the number of CpGregion, Li is the length of the current substring, Ciis the number of reads containing all cytosines at CpG sites within substrings of length Li, and Ni is the number of reads containing a substring of length Li.

[0157] Unmethylation Haplotype Load is computed by taking all possible substrings of adjacent CpG sites within a target region and calculating a weighted sum of the fraction of reads showing no methylation within each substring: ∑^ ^^^^^^ ^^^^^^ = ^^Where n is the number of CpGLi is the length of the current substring, Tiis the number of reads containing all thymines at CpG sites within substrings of length Li, and Ni is the number of reads containing a substring of length Li.

[0158] Percent Discordant Reads is computed by taking one hundred minus the percent of reads within each region showing all cytosines or all thymines at CpG sites within the target region: ^^^ = 100(1 − ^^ + ^^^ )^Where Niis the number of reads within the target region, Ciis the number of reads containing cytosines at all covered CpG sites, and Ti is the number of reads containing thymines at all covered CpG sites. Tissue Signature Derivation

[0159] In some embodiments, in order to classify plasma samples as containing methylation signatures derived from individual tissue samples, a reference tissue methylation database must be generated for the target genome of interest. Tissue samples from a variety of cells and organsP A T E N T Attorney Docket No.: 4552-2000740 (including but not limited to colon, gastrocnemius, heart, kidney, liver, lung, lymphocytes, small intestine, stomach, thymus, and testes) are processed using the DNA methylation assay and bioinformatics. These reference methylation metrics (AMF, MHL, UMHL, and PDR) are stored as a reference database for classification of individual plasma sample cell-free DNA. Classification

[0160] In some embodiments, using the methylation metrics for each target region, a numerical matrix is computed (with one row for each target region, one column for each sample, and values representing the methylation metric for that region and sample). Samples are then classified against the reference tissue signatures using a classification algorithm such as logistic regression, k-nearest neighbors, random forest, or support vector machines.

[0161] Logistic Regression classification involves curve-fitting an equation for the probability of a sample containing DNA from a tissue type of interest to the weighted sum of methylation metric values using a set of known samples. Using a least-squares regression on data from samples with known categories, the parameters for the below equation are estimated: !^log1 − !" = #$ + % #^^^^Where n is the set of targetMi is the methylation metric value for the ith target region, ßiis the least-square parameter for the ith target region, and p is the probability that the sample contains DNA from a tissue type of interest. Once the parameters for this equation are derived using known samples, an unknown sample can be classified as positive or negative for tissue-derived DNA by computing the weighted sum of methylation metric values, computing the probability using the derived equation, and comparing to a threshold.

[0162] K-nearest neighbor algorithm classifies an unknown sample using the distance of methylation metric values between the unknown sample and its k closest neighbors with known categories. First, the distances (in this case Euclidean distances) between the methylation metric values of the current sample and all other samples are computed:P A T E N T Attorney Docket No.: 4552-2000740 ^^&^ = '% % − ^ *Where N is the set of knownsample, n is the set of target regions, j is the current target region, Mj is the methylation metric value of the unknown sample in the jth target region, mij is the methylation metric value of the ith known sample in the jth target region, and Ei is the Euclidean distance between the current sample and the ith known sample. The categories of the k known samples with the lowest Euclidean distance are used to determine the category of the unknown sample; the category with the highest occurrence is assigned to the unknown sample. In this case, the unknown sample would be compared to a reference library of known tissue samples as well as baseline plasma DNA.

[0163] Random Forest classification involves creating multiple decision trees using a randomly chosen subset of samples with known categories and a subset of target regions; the methylation metric values of an unknown sample are then subjected to each individual decision tree, and the majority vote is used for classification. For example, using known data, the following three decision trees might be constructed: ≥0.5: ^ / 012^^^^ < 0.5: ^45 / 6789^^^ ≥ 0.1: 5:4)8;ℎ* < 0.1: ^45 / 6789< 0.2: ^1?:1?^^^= ≥ 0.2: ^45 / 6789An unknown sample containing the MHL values (MHL1: 0.6, MHL2: 0.08, MHL3: 0.36) would then be classified as Liver, as it would have two votes for Liver and two votes for no signal.

[0164] Support Vector Machines construct a hyperplane between known samples of different categories that maximizes the distance between each known sample and the hyperplane. This plane is then used as a “divider” to classify unknown samples, with samples falling on different sides of the plane being categorized differently. To illustrate an example using 2 target regions, the methylation metric values of known samples are plotted in space, andP A T E N T Attorney Docket No.: 4552-2000740 a hyperplane is drawn between the different groups (see Figure 1), Where X1 is the methylation metric value of the first target region, X2is the methylation metric value of the second target region, reference tissue samples are drawn in black, known no signal samples are drawn in white, and the black line represents the hyperplane. To classify an unknown sample (shown in orange), the methylation metric values are compared to the hyperplane; if the sample falls on the same side as the known no signal samples (as it does here), the sample is classified as “no signal.”. Image of Figure 1 is taken from (Wikipedia: https: / / en.wikipedia.org / wiki / Support_vector_machine) for illustration purpose only, and does not represent any DNA methylation status analysis or assessment of tissue and / or organ damage or toxicity. F. Exemplary polynucleotide fragment analysis by library construction and polynucleotide sequencing

[0165] In one aspect, the target (or template) polynucleotide of the present method is a fragmented polynucleotide, for example, ranging from about 100 residues to about 1,000 residues, and in some embodiments, ranging from about 150 residues to about 400 residues.

[0166] The target or template DNA can include regular genomic DNA, chromosomal DNA, extrachromosomal DNA (such as mitochondrial DNA), or a fragment thereof. In other embodiments, the target or template DNA is a processed DNA, for example, one that has undergone enzyme digestion, cross-linking, chemical or physical shearing, bisulfite conversion, and / or degradation.

[0167] Bisulfite conversion is a method that uses bisulfite to determine the methylation pattern of DNA. DNA methylation is a biochemical process involving the addition of a methyl group to the cytosine or adenine DNA nucleotides. DNA methylation stably alters the expression of genes in cells as cells divide and differentiate from embryonic stem cells into specific tissues. In bisulfite conversion, target nucleic acids are first treated with bisulfite reagents that specifically convert un-methylated cytosines to uracils while having no impact of methylated cytosine. One consequence of bisulfite conversion is that the double-stranded conformation of the original target is disrupted due to loss of sequence complementarity. The target sequences exist as two separate single-stranded DNAs during sample preparation and analytical or diagnostic testing. Target nucleic acid sequences frequently also exist at very low concentrations. This is an especially important consideration for circulating tumor DNA (alsoP A T E N T Attorney Docket No.: 4552-2000740 referred to as “cell-free tumor DNA,” or “ctDNA”) due to its often low concentration in circulation and the very low variant allele fraction.

[0168] In some embodiments, the nucleic acid molecule of interest disclosed herein is a cell- free DNA, such as cell-free fetal DNA (also referred to as “cfDNA”) or ctDNA. cfDNA circulates in the body, such as in the blood, of a pregnant mother, and represents the fetal genome, while ctDNA circulates in the body, such as in the blood, of a cancer patient, and is generally pre-fragmented. In other embodiments, the nucleic acid molecule of interest disclosed herein is an ancient and / or damaged DNA, for example, due to storage under damaging conditions such as in formalin-fixed samples, or partially digested samples.

[0169] As cancer cells die, they release DNA into the bloodstream. This DNA, known as circulating tumor DNA (ctDNA), is highly fragmented, with an average length of approximately 150 base pairs. Once the white blood cells are removed, ctDNA generally comprises a very small fraction of the remaining plasma DNA, for example, ctDNA may constitute less than about 10% of the plasma DNA. Generally, this percentage is less than about 1%, for example, less than about 0.5% or less than about 0.01%. Additionally, the total amount of plasma DNA is generally very low, for example, at about 10 ng / mL of plasma.

[0170] The variants in the ctDNA can be interrogated using various methods, including next generation sequencing. Due to the low ratio of ctDNA to plasma DNA, it is difficult to call a variant with high confidence due to PCR and sequencing errors. Unique molecular identifiers (UMIs) are generally used to tag original molecules such that any variant seen can be compared to a consensus sequence. This is an effective manner to separate true from false positives. If the variant is matched to a consensus, it is a true positive. Otherwise, it is removed from analysis. Furthermore, it is essential that a high percentage of original molecules are turned into sequencing libraries so that the sensitivity remains high, i.e., variants are not missed due to dropout. Thus, ligation efficiency is extremely important during library construction.

[0171] In one aspect, provided herein is a technique to vastly improve ligation efficiency while still targeting selected regions of the genome. In one embodiment, polynucleotides to be detected by sequencing, such as ctDNA, are first dephosphorylated to remove 5’ phosphates to prevent ligation of ctDNA to itself. The ctDNA is then denatured such that all DNA is single stranded. Circligase™, a single stranded DNA ligase, is used to ligate an adapter to the 3’ end of the ctDNA. In one aspect, the adapter contains 2 specific bases on the 5’ end to optimizeP A T E N T Attorney Docket No.: 4552-2000740 ligation efficiency, followed by a UMI. In one aspect, the 3’ end of the adapter contains a carbon spacer to prevent self-ligation of the adapters. In another aspect, the ligation reaction is further optimized using a crowding agent, such as PEG 4000. In one aspect, following ligation, molecules are double-stranded using a primer that is reverse complement to the adapter. This allows efficient removal of excess unligated adapters without removed usable DNA by a standard purification.

[0172] In one aspect, the DNA is then amplified using a semi-targeted PCR. One primer is reverse complement to the adapter, while the other (e.g., as one primer in a primer pool) anneals to specific, targeted regions of the genome. The specific primers were designed to minimize primer-dimer interactions and off-target annealing. In one aspect, the target-specific primers are further optimized to land in close proximity to specific variants due to the small DNA size. Following another cleanup, a PCR adds the full-length sequencing adapters and barcodes. The final library is then sequenced, for example, on an Illumina machine.

[0173] In one aspect, the semi-targeted PCR results in enrichments of > about 40,000 fold of the original molecule set despite having a relatively small target region of ~30,000 bp. In one aspect, the overall conversion rates of the present method are at least 60%, implying that at least ~3 times more of the original molecules are converted into sequenceable material when compared to standard library construction and hybridization capture. In other embodiments, the overall conversion rates are between about 60% and about 70%, between about 70% and about 80%, between about 80% and about 90%, or over 90%. In one aspect, the present method thus is able to accurately call genetic or genomic variants, such as SNVs, indels, CNVs, and fusions at extremely low mutant allele fractions, for example, as low as 0.01%. In other aspects, the allele fraction of the genetic or genomic variant is about 0.05%, about 0.1%, about 0.5%, about 1%, or about 2%.

[0174] The following sections describe certain steps of the present method in greater detail. Single-stranded polynucleotide libraries and method of constructing the same

[0175] Library construction for next generation sequencing, for example, for ctDNA, generally consists of several steps, including end repair, A-tailing, and a double stranded ligation of an adapter molecule. These ligated molecules can then be enriched 1000-2000 times at certain genomic regions using hybridization capture. Despite several improvements in libraryP A T E N T Attorney Docket No.: 4552-2000740 construction over the last several years, the process remains inefficient, resulting in many original molecules lost during the various steps. Double stranded ligation efficiency remains low, with ~20-30% of the molecules being properly ligated. Additionally, many molecules are lost during the purification and hybridization capture steps, so that the final conversion rate approximates 10-20%. Sensitivity remains low when interrogating low allele fraction variants found in ctDNA. This limits the accuracy when calling low allele fraction mutants, since the low efficiency will result in sensitivity loss when looking at libraries with low allele fractions.

[0176] In addition, the small size of certain polynucleotides, such as ctDNA, prevents the use of tagmentation-based library construction. For example, the polynucleotides are first tagged (e.g., with biotin) to generate a targeted library, and then enriched by capturing the tags (e.g., by streptavidin). This way, the library for the regions of interest can be enriched by about 1000-2000 fold. Finally, a PCR is performed to amplify and index the molecules for sequencing. However, PCR based methods prove difficult to add UMIs to original molecules and result in high error rates.

[0177] In one aspect, the compositions, kits, and methods described herein addressed the above problems. In some embodiments, the compositions, kits, and methods are useful in sequencing nucleic acid molecules, including but not limited to construction of various libraries, various amplification reactions (such as by PCR and / or primer extension), purification of the constructed libraries, and analysis of sequencing reads.

[0178] In certain aspects, a sequencing library can be prepared, for example, from a sample containing fragmented polynucleotides, such as fragment DNA. In one aspect, the sample is obtained a naturally occurring sample, for example, directly from a subject, such as tissue fluid or body fluid, including but not limited to blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, semen, sputum, tear, mucus, or amniotic fluid. In other aspects, a sequencing library can be prepared by forming fragments of DNA (for example, by shearing the DNA), and attaching the adapters herein to the DNA fragments. In particular embodiments, the fragmented polynucleotides and the adapters are single-stranded.

[0179] The fragments (for example, the ctDNA or fragments formed by fragmenting longer DNA strands) are sometimes referred to as “inserts,” as they can be “inserted” or ligated adjacent to an adapter such as a single-stranded adaptor disclosed herein. RNA molecules canP A T E N T Attorney Docket No.: 4552-2000740 also be sequenced, for example by reverse transcribing the RNA molecules to form DNA molecules, which are attached to the adapters.

[0180] In one aspect, a method comprising ligating a set of adaptors to a library of single- stranded polynucleotides is provided, and in the method, the ligation is catalyzed by a single- stranded DNA (ssDNA) ligase. As used herein, a ssDNA ligase is capable of ligating ends of ssDNA in the absence of a complementary sequence. For example, CircLigase™ ssDNA Ligase and CircLigase™ II ssDNA Ligase are both thermostable ligases that are typically used to catalyze intramolecular ligation (i.e., circularization) of ssDNA templates having a 5´-phosphate and a 3´-hydroxyl group. In contrast to T4 DNA Ligase and Ampligase®DNA Ligase, which ligate DNA ends that are annealed adjacent to each other on a complementary DNA sequence, a ssDNA ligase ligates ends of ssDNA in the absence of a complementary sequence. The enzyme is therefore useful for making circular ssDNA molecules from linear ssDNA. Circular ssDNA molecules can be used as substrates for rolling-circle replication or rolling-circle transcription. In addition to its activity on ssDNA, a CircLigase enzyme also has activity in ligating a single- stranded nucleic acid having a 3´-hydroxyl ribonucleotide and a 5´-phosphorylated ribonucleotide or deoxyribonucleotide.

[0181] Either CircLigase™ ssDNA Ligase or CircLigase™ II ssDNA Ligase can be used in the present disclosure. The two enzymes are different in that CircLigase I is far less adenylated than CircLigase II and requires ATP for best activity. CircLigase I recircularizes ssDNA in the presence of ATP. CircLigase II is nearly 100% adenylated, therefore it is not necessary to add ATP to the reaction buffer. CircLigase II works as a stoichiometric reaction, where the enzyme bonds the 5´-end of an oligo that is adenylated in the enzyme active site, and then ligates the oligo and stops. Since the reaction doesn’t contain ATP, CircLigase II works in a 1:1 enzyme:oligo configuration. Once the circularization is complete, the circular ssDNA is released from the active site and the reaction stops.

[0182] In one aspect, each single-stranded polynucleotide is blocked at the 5’ end to prevent ligation at the 5’ end, each adaptor comprises a unique molecular identifier (UMI) sequence that earmarks the single-stranded polynucleotide to which the adaptor is ligated, each adaptor is blocked at the 3’ end to prevent ligation at the 3’ end, and the 5’ end of the adaptor is ligated to the 3’ end of the single-stranded polynucleotide by the ssDNA ligase to form a linear ligation product, thereby obtaining a library of linear, single-stranded ligation products. Template-P A T E N T Attorney Docket No.: 4552-2000740 independent circularization of single-stranded DNA is described in WO2010 / 094040 A1, the disclosure of which is incorporated herein in its entirety. WO2010 / 094040 A1, however, only discloses intramolecular ligation (e.g., circularization) of single-stranded polynucleotides.

[0183] Thus, the present method uses a ssDNA ligase, such as CircLigase or CircLigase II, in an unconventional manner. Instead of circularization, the present ligation method aims to generate a linear ligation product between the single-stranded target polynucleotide and an adaptor molecule. In one aspect, the present disclosure uses a ssDNA ligase to carry out intramolecular ligate, e.g., for ligating an adaptor to single-stranded polynucleotides. In order to do, in one aspect, the single-stranded polynucleotide is blocked at the 5’ end to prevent circularization. This way, intramolecular ligation of the 3’ end of an ssDNA to its own 5’ end, as well as intermolecular ligation of the 3’ end of one ssDNA to the 5’ end of another ssDNA within the same library, is prevented. Thus, in one aspect, both circularization of the single- stranded polynucleotide and formation of linear concatemers (containing the single-stranded polynucleotides and / or the adaptors) are prevented during the ligation reaction. As shown in Figure 2, the blocking of each single-stranded polynucleotide can comprise dephosphorylation at its 5’ end to prevent ligation at that end.

[0184] In another aspect, each adaptor is blocked at the 3’ end to prevent ligation at the 3’ end. This way, intramolecular ligation of the 3’ end of an adaptor to its own 5’ end, as well as intermolecular ligation of the 3’ end of one adaptor molecule to the 5’ end of another adaptor molecule, is prevented. The blocking of each adaptor can comprise a carbon spacer, ddCTP, ddATP, ddTTP, ddGTP, hexanediol, triethylene glycol (TEG), and / or hexaethylene glycol, to prevent ligation at its 3’ end. Thus, in one aspect, both circularization of the single-stranded adaptor and formation of linear concatemers (containing the single-stranded polynucleotides and / or the adaptors) are prevented during the ligation reaction.

[0185] The adaptor may comprise one or more copies of one or more spacers, in any suitable combination. For example, Gansauge and Meyer disclosed an adaptor that comprises ten copies of a C3Spacer and a biotinylated TEG spacer. Gansauge and Meyer (2013), “Single-stranded DNA library preparation for the sequencing of ancient or damaged DNA,” Nature Protocols, 8(4): 737-48, which is incorporated herein by reference in its entirety. This reference, however, requires capturing the ligated ssDNA, via biotin-streptavidin interaction, immediately after ligation. This step may cause a significant loss of the ssDNA molecules in the library. TheP A T E N T Attorney Docket No.: 4552-2000740 reference then converts the captured ssDNA to dsDNA while the ssDNA remains captured on a bead.

[0186] As shown in Figure 2, the present disclosure does not require capturing the ligated ssDNA immediately after ligation. Instead, the ligated ssDNA remains in the ligation reaction volume when it is converted into dsDNA.

[0187] In one aspect, the ligation efficiency of the ssDNA in the library is high, for example, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the single-stranded polynucleotides in the sample are ligated to an adaptor. In particular embodiments, the ligation efficiency is about 80%. With this vastly improved ligation efficiency, the presently claimed method is still capable of targeting selected regions of the genome, as explained below.

[0188] In one aspect, the adaptor has the following structure: / 5’Phos / N1N2...Ni-UMI- M1M2...Mj-Blocker, wherein “5’Phos” represents a 5’ phosphate group, “N1N2...Ni” represents the sequence 5’ to the UMI sequence, “M1M2...Mj” represents the sequence 3’ to the UMI sequence, and “Blocker” indicates that the 3’ end of the adaptor is blocked to prevent ligation thereto. Both i and j are integers, wherein i can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or greater than 30; and j can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or greater than 50. In specific embodiments, i can be 2. In some embodiments, the dinucleotide sequence N1N2 at the 5’ end of N1N2...Nican be GA (5’ to 3’), GG (5’ to 3’), AA (5’ to 3’), or AG (5’ to 3’), in order to enhance the ligation efficiency.

[0189] In one aspect, a portion or all of the M1M2...Mjsequence is used in later steps for designing a reverse-complement sequence that is used as a primer to convert the ligated single- stranded polynucleotide into a double-stranded polynucleotide, and / or for the semi-targeted PCR to amplify a selected target sequence (the other primer of the primer pair being the target- specific primer). In one aspect, the M1M2...Mj sequence comprises AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG (SEQ ID NO:732) or a portion thereof that comprises between about 18 and 22 nucleotide residues.P A T E N T Attorney Docket No.: 4552-2000740

[0190] In another aspect, the “Blocker” comprises a carbon spacer, ddCTP, ddATP, ddTTP, ddGTP, hexanediol, triethylene glycol (TEG), and / or hexaethylene glycol, in one or more copies of one or more blocker groups in any suitable combination and order in the 5’ to 3’ direction.

[0191] In one aspect, use of the UMI facilitates the determination, selection, and / or isolation of error-free sequencing reads of a target sequence, and the sequencing reads can be selected with high accuracy and high throughput. Such validated, error-free sequencing reads are useful in any technique that requires sequence fidelity, including the construction of larger molecules of known sequence, polymorphism and / or mutation screening, massively parallel sequencing, and quantification methods to preclude bias in the methodologies.

[0192] In one aspect, the Unique Molecular Identifier is associated with and uniquely identifies a ligated construct comprising a single-stranded target polynucleotide and an adaptor. In other words, two single-stranded target polynucleotides having the same sequence may be ligated to two different adaptors which differ from each other at their UMI sequences; the resultant ligation products are different, and each ligation product (rather than the target polynucleotides having the same sequence) is uniquely identified by the UMI. In another aspect, when the single-stranded ligation products are converted into double-stranded polynucleotides and amplified, amplification errors may be introduced during repeated copying even though very high fidelity polymerases are available. As a result, even a low error rate can have a significant impact, particularly in the construction of large libraries. Although massively parallel sequencing has advantages in cost and throughput, the accuracy of the reads can be comprised by the limitations of the amplification and / or detection technologies.

[0193] By using the UMI, the present method is capable of identifying error-free amplification products and / or sequencing reads, and excluding those with technical errors from analysis. The amplification products and / or sequencing reads having the same UMI can be confirmed as related (identical by descent), and thus sequence differences between molecules with the same UMI can be identified as technical errors rather than real differences in the sequence (e.g., sequence differences between a wild-type sequence and a cancer-related mutant sequence). In other words, since each single-stranded ligation product is unique identifiable by its UMI, all of its descendants (due to amplification and / or sequencing) should have the same target sequence if no technical error is introduced. If, however, an error such as a single- nucleotide insertion is introduced into the target sequence during amplification and / orP A T E N T Attorney Docket No.: 4552-2000740 sequencing, some amplification products and / or sequencing reads identical by descent (e.g., sharing the same UMI) will have the insertion while the others will not. The exact ratio between the products having the insertion and those that do not have the insert will vary, depending on when the error occurs during the amplification and / or sequencing process. In general, when very high fidelity polymerases are used, the products without errors will be in the majority. In another aspect, because amplification products and / or sequencing reads that are identical by descent can be identified, a consensus sequence can be determined using data from multiple molecules, thereby achieving a high accuracy for high throughput sequencing.

[0194] In one aspect, the UMI is a degenerate nucleic acid sequence, and the number of nucleotides in the UMI is designed such that the number of potential and actual sequences represented by the UMI sequences is greater than the total number of target single-stranded target polynucleotide in the initial library. In one aspect, UMI sequence diversity (or “uniqueness” with regard to each single UMI sequence) can be provided by using a degenerate collection of sequences randomly generated by synthesizing with a mixture of all four bases at each position. Alternatively, a diverse but pre-defined set of sequences can be synthesized and ligated to the initial single-stranded polynucleotide library. The diversity of the UMI set needs to be sufficient so that molecules that are not related by descent won’t be mistaken as such. In one aspect, a “unique” molecular identifier need not be absolutely unique, and may be used on different target single-stranded polynucleotides provided it is clear that they are different and not mistaken for a molecule that is identical by descent. The large number of UMI sequences that can be generated from the random assembly of nucleotides provides a high probability that each individual ligation product can be uniquely identified. For example, if the UMI comprises a 12- mer synthesized with a mixture of A, C, G and T at each position, there are 412possible sequences. If the UMI comprises a 20-mer synthesized with a mixture of A, C, G and T at each position, there are 420(about 1012) possible sequences. The use of such random identifiers allows a large library with single-stranded target polynucleotides that can be individually distinguished from each other.

[0195] In particular aspects, the UMI is a 5-mer, 6-mer, 7-mer, 8-mer, 9-mer, 10-mer, 11- mer, 12-mer, 13-mer, 14-mer, 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, 20-mer, 21-mer, 22- mer, 23-mer, 24-mer, 25-mer, or even longer degenerate sequence. In one aspect, the adaptor has the following structure: / 5’Phos / P A T E N T Attorney Docket No.: 4552-2000740 GANNNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG / 3SpC3 / , wherein “NNNNNNNNNNNN” represents a 12-mer UMI sequence, and “3SpC3” represents a 3’ carbon spacer. The sequence of GANNNNNNNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG is SEQ ID NO: 733.

[0196] The concentration of DNA can be artificially increased by adding condensing agents such as cobalt hexamine and biogenic polyamines such as spermidine, or by using crowding agents such as polyethylene glycol (PEG) which also increase the effective concentration of enzymes. In one aspect, additives such as cobalt hexamine can produce exclusively intermolecular reaction, resulting in linear ligation products rather than circular products. Thus, in case the 5’ ends of the single-stranded target polynucleotides and the 3’ ends of the single- stranded adaptor may not be completely blocked to prevent ligation, additives such as cobalt hexamine may be used to enhance intermolecular reaction and further prevent circularization of the single-stranded target polynucleotide and / or the adaptor.

[0197] In some embodiments, more than one configurations of the adaptor can be used in the same ligation reaction. For example, two configurations of the adaptor may be used: Configuration No.1: / 5’Phos / N1N2...Ni-UMI1-M1M2...Mj-Blocker1, and Configuration No.2: / 5’Phos / P1P2...Pk-UMI2-Q1Q2...Ql-Blocker2.

[0198] N1N2...Ni and P1P2...Pk can be the same or different, UMI1 and UMI2 can be the same or different, M1M2...Mjand Q1Q2...Ql, can be the same or different, and Blocker1and Blocker2 can be the same or different. In one embodiment, UMI1 is different from UMI2 (for example, UMI1is a 12-mer degenerate sequence while UMI2is a 13-mer degenerate sequence), while the other features of the adaptors are the same. In another embodiment, N1N2...Ni is different from P1P2...Pk(for example, one is AG while the other is GA), while the other features of the adaptors are the same. In yet another embodiment, M1M2...Mj is different from Q1Q2...Ql, while the other features of the adaptors are the same. In still another embodiment, Blocker1 and Blocker2 are different, while the other features of the adaptors are the same.

[0199] After the ligation reaction, the single-stranded ligation products, without any need for purification (e.g., separation of the ligation products from the excess, unligated adaptor molecules), can be immediately subject to conversion into double-stranded ligation products. In addition, neither the single-stranded target polynucleotide nor the adaptor needs to be capturedP A T E N T Attorney Docket No.: 4552-2000740 on a solid support (e.g., by biotin-streptavidin mediated binding to a bead) in order for the subsequent conversion of the ligation product into a double-stranded polynucleotide and / or amplification step. Thus, the present method avoids and / or reduces loss of the already small allele fraction of the mutant in a DNA sample, such as ctDNA, due to the purification or isolation of the single-stranded ligation products. Instead, in one aspect, the single-stranded ligation products remain in the solution which is directed subject to primer extension. Conversion of single-stranded polynucleotide library to double-stranded polynucleotide library

[0200] In one aspect as shown in Figure 2, following construction of the library containing the single-stranded ligation products, the method can further comprise converting the library of linear, single-stranded ligation products into a library of linear, double-stranded ligation products. In one aspect, the conversion uses a primer or a set of primers each comprising a sequence that is reverse-complement to the adaptor and / or hybridizable to the adaptor.

[0201] For an adaptor having the following structure: / 5’Phos / N1N2...Ni-UMI-M1M2...Mj- Blocker, the primer can comprise a sequence that is reverse-complement and / or hybridizable to M1M2...Mj. In this example, when the primer hybridizes to the ligated product having the structure ssDNA-N1N2...Ni-UMI-M1M2...Mj-Blocker, the primer extension reaction can convert the ssDNA-N1N2...Ni-UMI sequence (and optionally, all or a portion of the M1M2...Mj sequence) into double-stranded polynucleotides. In one specific example, a reverse-complement primer comprises the sequence set forth in SEQ ID NO:731, CACTCTTTCCCTACACGACGC (5’ to 3’).

[0202] In some embodiments, the primer may not be a perfect reverse-complement of M1M2...Mjor a portion therefore; nonetheless, the primer is hybridizable to M1M2...Mj(and thus the ssDNA ligated to the adaptor) under stringent conditions.

[0203] In any of the preceding embodiments, the method can further comprise amplifying and / or purifying the library of linear, double-stranded ligation products. In one aspect, the double-stranded ligation products are purified and size selected to remove unbound adaptor molecules and / or unbound primers, and / or complexes formed between an adaptor and its reverse-complement primer. Any suitable methods can be used to remove these fragments which are generally shorter than the desired double-stranded ligation products. For example,P A T E N T Attorney Docket No.: 4552-2000740 using PCR purification column from Qiagen could help to eliminate the smaller fragments from the samples and running the column-purified samples on 2% certified low range ultra agarose gel can help to select the desired fragment size. The beads-based DNA purification including AMPure method is also helpful to remove the smaller fragments. In some embodiments, the desired double-stranded ligation products size is from about 100bps to about 600 bps, such as from about 100bps to about 400 bps, from about 150bps to about 200 bps, from about 200bps to about 250 bps, and from about 250bps to about 300 bps. In one embodiment, dsDNA (>150 bps and <400 bps) is purified and collected, for example, by eluting beads suspended in a Tri-EDTA buffer.

[0204] In one aspect, the purification is bead-based. In another aspect, the purification is based on size selection, for example, the purification step selectively purifies polynucleotides between about 50 nucleotides and about 1000 nucleotides in lengths, for example, adaptors of about 40 nucleotides in length (and primer dimers and / or primer-adaptor duplexes of about 40bp) are removed. In one aspect, the purification is column-based, for example, by using a dsDNA or ssDNA purification column, such as those from Zymo or Qiagen.

[0205] In another aspect, the purification does not comprise using a specific binding pair (such as biotin / streptavidin), one of which is attached to the linear, double-stranded ligation product and the other is attached to a solid support (such as a bead).

[0206] In any of the preceding embodiments, the method herein can further comprise amplifying the library of linear, double-stranded ligation products, e.g., by a polymerase chain reaction (PCR), to obtain an amplified library of linear, double-stranded ligation products comprising sequence information of a target sequence. This amplification can be an unbiased amplification, for example, by ligating a universal adaptor pair to the ends of the double- stranded ligation products, and amplifying all the tagged double-stranded ligation products with a universal primer pair. In other embodiments, a semi-targeted amplification is conducted in lieu of or in addition to the unbiased amplification. The semi-targeted amplification can be performed before or after the unbiased amplification. Semi-targeted amplification of double-stranded polynucleotide library

[0207] In one aspect, as shown in Figure 2, a semi-targeted amplification of the double- stranded ligation product library comprises using a primer comprising a sequence that is reverse-P A T E N T Attorney Docket No.: 4552-2000740 complement and / or hybridizable to the adaptor, and a primer hybridizable to a target sequence (e.g., a Target listed in Table 2) or primers hybridizable to the same target sequence or multiple target sequences.

[0208] For an adaptor having the following structure: / 5’Phos / N1N2...Ni-UMI-M1M2...Mj- Blocker, the primer can comprise a sequence that is reverse-complement and / or hybridizable to M1M2...Mj. This way, when the primer hybridizes to one strand of the dsDNA and the target- specific primer hybridizes to the other strand of the dsDNA, the PCR product will contain a target sequence as well as the N1N2...Ni-UMI sequence (and optionally, all or a portion of the M1M2...Mj sequence). In one specific example, a reverse-complement primer comprises the sequence set forth in SEQ ID NO:731, CACTCTTTCCCTACACGACGC (5’ to 3’).

[0209] In one aspect, a plurality of target-specific primers can be used, each comprising a sequence specific for the same or a different target sequence. In other words, the primers can have the same or different target sequences. In some embodiments, the pool of target-specific primers comprises about 5, about 10, about 25, about 50, about 100, about 150, about 200, about 250, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000, or more than about 1000 different primers, such as about 104, about 105, about 106, or more primers. In other embodiments, the pool comprises between about 20 and about 60, between about 60 and about 100, between about 100 and about 140, between about 140 and about 180, between about 180 and about 220, between about 220 and about 260, between about 260 and about 300, between about 300 and about 350, or between about 350 and about 400 different primers. In one aspect, the pool of target-specific primers are used together with one common reverse-complement primer, wherein the common reverse-complement primer forms a primer pair with each individual target-specific primer in the pool to amplify the target sequence in and / or between the primers in a semi-targeted fashion. Thus, in this aspect, the semi-targeted amplification is not a whole genome amplification.

[0210] Since ctDNA fragments randomly, in one aspect, the primer position of the target- specific primer may be important. For example, if the primer landing spans a break point, it may result in lower conversion rates. A larger target-specific primer pool and / or using multiple partially overlapping primers for the same target sequence may solve the problem.

[0211] In one aspect, the sequence information of the target sequence can comprise a mutation, a single nucleotide polymorphism (SNP), a copy number variation (CNV), or anP A T E N T Attorney Docket No.: 4552-2000740 epigenetic change. In one aspect, the mutation comprises a point mutation, an insertion, a deletion, an inversion, a truncation, a fusion, an amplification, or any combination thereof.

[0212] In some embodiments, the amplified library of linear, double-stranded ligation products can be a library other than a whole genome library, for example, a semi-targeted genome library.

[0213] In some embodiments, the method can further comprise purifying the amplified library of linear, double-stranded ligation products. Any suitable methods can be used to remove smaller fragments including primer dimers. For example, using PCR purification column from Qiagen could help to eliminate the smaller fragments from the samples and running the column-purified samples on 2% certified low range ultra agarose gel can help to select the desired fragment size. The beads-based DNA purification including AMPure method is also helpful to remove the smaller fragments. In some embodiments, the amplification product size is from about 100bps to about 600 bps, such as from about 100bps to about 400 bps, from about 150bps to about 200 bps, from about 200bps to about 250 bps, and from about 250bps to about 300 bps. In one embodiment, dsDNA (>150 bps and <400 bps) is purified and collected, for example, by eluting beads suspended in a Tri-EDTA buffer.

[0214] In one aspect, the purification is bead-based. In another aspect, the purification is based on size selection, for example, the purification step selectively purifies polynucleotides greater about 150 nucleotides in lengths. In another aspect, the purification does not comprise using a specific binding pair (such as biotin / streptavidin), one of which is attached to the linear, double-stranded ligation product and the other is attached to a solid support (such as a bead). In one aspect, the purification is column-based, for example, by using a dsDNA or ssDNA purification column, such as those from Zymo or Qiagen. Construction of sequence library and analysis of sequencing reads

[0215] In one aspect, the method further comprises sequencing the purified amplified library of linear, double-stranded ligation products. In one aspect, the sequencing step comprises attaching a sequencing adapter and / or a sample-specific barcode to each linear, double-stranded ligation product. In one particular aspect, the attaching step is performed using a polymerase chain reaction (PCR).P A T E N T Attorney Docket No.: 4552-2000740

[0216] Figure 3 shows an exemplary configuration of a construct comprising a target molecule for sequencing. For Illumina sequencing, on each end, these constructs have flow cell binding sites, P5 and P7, which allow the library fragment to attach to the flow cell surface. The P5 and P7 regions of single-stranded library fragments anneal to their complementary oligos on the flowcell surface. The flow cell oligos act as primers and a strand complementary to the library fragment is synthesized. Then, the original strand is washed away, leaving behind fragment copies that are covalently bonded to the flowcell surface in a mixture of orientations. Copies of each fragment are then generated by bridge amplification, creating clusters. Then, the P5 region is cleaved, resulting in clusters containing only fragments which are attached by the P7 region. This ensures that all copies are sequenced in the same direction. The sequencing primer anneals to the P5 end of the fragment, and begins the sequencing by synthesis process. Index reads are performed when a sample is barcoded. When Read 1 is finished, everything from Read 1 is removed and an index primer is added, which anneals at the P7 end of the fragment and sequences the barcode. Then, everything is stripped from the template, which forms clusters by bridge amplification as in Read 1. This leaves behind fragment copies that are covalently bonded to the flowcell surface in a mixture of orientations. This time, P7 is cut instead of P5, resulting in clusters containing only fragments which are attached by the P5 region. This ensures that all copies are sequenced in the same direction (opposite Read 1). The sequencing primer anneals to the P7 region and sequences the other end of the template.

[0217] Next-generation sequencing platforms, such as MiSeq (Illumina Inc., San Diego, CA), can be used for highly multiplexed assay readout. A variety of statistical tools, such as the Proportion test, multiple comparison corrections based on False Discovery Rates (see Benjamini and Hochberg, 1995, Journal of the Royal Statistical Society Series B (Methodological) 57, 289- 300), and Bonferroni corrections for multiple testing, can be used to analyze assay results. In addition, approaches developed for the analysis of differential expression from RNA-Seq data can be used to reduce variance for each target sequence and increase overall power in the analysis. See Smyth, 2004, Stat. Appl. Genet. Mol. Biol.3, Article 3.

[0218] Overall, in some embodiments, the conversion rate of the present method is at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%. In one aspect, the conversion rate is the percentage of targeted single-stranded polynucleotides in the initial library that give rise to sequencing reads.P A T E N T Attorney Docket No.: 4552-2000740

[0219] In any of the preceding embodiments, the method can be used for the diagnosis and / or prognosis of a disease or condition in a subject, predicting the responsiveness of a subject to a treatment, identifying a pharmacogenetics marker for the disease / condition or treatment, and / or screening a population for a genetic information. In one aspect, the disease or condition is a cancer or neoplasia, and the treatment is a cancer or neoplasia treatment.

[0220] Mutant DNA molecules offer unique advantages over cancer-associated biomarkers because they are so specific. Though mutations occur in individual normal cells at a low rate (about 10−9to 10−10mutations / bp / generation), such mutations represent such a tiny fraction of the total normal DNA that they are orders of magnitude below the detection limit of certain art methods. Several studies have shown that mutant DNA can be detected in stool, urine, and blood of CRC patients (Osborn and Ahlquist, Stool screening for colorectal cancer: molecular approaches, Gastroenterology 2005;128:192-206).

[0221] Based on the sequencing results herein, detection of circulating tumor DNA in the patient can be made, and diagnosis of cancer and predictions regarding tumor recurrence can be made. Based on the predictions, treatment and surveillance decisions can be made. For example, circulating tumor DNA which indicates a future recurrence, can lead to additional or more aggressive therapies as well as additional or more sophisticated imaging and monitoring. Circulating DNA refers to DNA that is ectopic to a tumor.

[0222] Samples which can be monitored for ctDNA include blood and stool. Blood samples may be for example a fraction of blood, such as serum or plasma. Similarly stool can be fractionated to purify DNA from other components. Tumor samples are used to identify a somatically mutated gene in the tumor that can be used as a marker of tumor in other locations in the body. Thus, as an example, a particular somatic mutation in a tumor can be identified by any standard means known in the art. Typical means include direct sequencing of tumor DNA, using allele-specific probes, allele-specific amplification, primer extension, etc. Once the somatic mutation is identified, it can be used in other compartments of the body to distinguish tumor derived DNA from DNA derived from other cells of the body. Somatic mutations are confirmed by determining that they do not occur in normal tissues of the body of the same patient. Types of tumors which can be diagnosed and / or monitored in this fashion are virtually unlimited. Any tumor which sheds cells and / or DNA into the blood or stool or other bodily fluid can be used. Such tumors include, in addition to colorectal tumors, tumors of the breast,P A T E N T Attorney Docket No.: 4552-2000740 lung, kidney, liver, pancreas, stomach, brain, head and neck, lymphatics, ovaries, uterus, bone, blood, etc.

[0223] In one aspect, the method disclosed herein can be used to construct a library for use in sequencing and / or in determining an epigenetic status / state of one or more regions of the target sequence. DNA methylation was first the discovered epigenetic mark. Epigenetics is the study of changes in gene expression or cellular phenotype caused by mechanisms other than changes in the underlying DNA sequence. Methylation predominately involves the addition of a methyl group to the carbon-5 position of cytosine residues of the dinucleotide CpG and is associated with repression or inhibition of transcriptional activity.

[0224] Bisulfite conversion is the use of bisulfite reagents to treat DNA to determine its pattern of methylation. The treatment of DNA with bisulfite converts cytosine residues to uracil but leaves 5-methylcytosine residues unaffected. Thus, bisulfite treatment introduces specific changes in the DNA sequence that depend on the methylation status of the individual cytosine residues. Various analyses can be performed on the altered sequence to retrieve this information, for example, in order to differentiate between single nucleotide polymorphisms (SNP) resulting from the bisulfite conversion. U.S. Patent No.7,620,386, U.S. Patent No. 9,365,902, and U.S. Patent Application Publication 2006 / 0134643, all of which are incorporated herein by reference, exemplify methods known to one of ordinary skill in the art with regard to detecting sequences altered due to bisulfite conversion.

[0225] As discussed above, one consequence of bisulfite conversion is that the double- stranded conformation of the original target is disrupted due to loss of sequence complementarity. While this may cause problem for traditional methods for constructing double-stranded libraries, in one aspect the present method is uniquely suited to construct single- stranded libraries from bisulfite conversion sample for sequencing analysis.

[0226] In another aspect, the present method can be used in combination with a method for determining a methylation state / status, for example, as described in U.S. Provisional Application No.62 / 487,422, entitled “Compositions and Methods for Detection of Genomic Variance and DNA Methylation Status,” filed April 19, 2017, and US 2020 / 0048697 A1, which are incorporated herein by reference in their entireties for all purposes. In one embodiment, a sample is contacted with a methylation-sensitive restriction enzyme (MSRE) before theP A T E N T Attorney Docket No.: 4552-2000740 dephosphorylation and / or the denaturing step, and methylation profiles are then be analyzed by constructing a single-stranded library by ligation as disclosed herein. Further exemplary embodiments

[0227] In any of the preceding embodiments, the ssDNA ligase can be a Thermus bacteriophage RNA ligase such as a bacteriophage TS2126 RNA ligase (e.g., CircLigase™ and CircLigase II™), or an archaebacterium RNA ligase such as Methanobacterium thermoautotrophicum RNA ligase 1. In other aspects, the ssDNA ligase is an RNA ligase, such as a T4 RNA ligase, e.g., T4 RNA ligase I, e.g., New England Biosciences, M0204S, T4 RNA ligase 2, e.g., New England Biosciences, M0239S, T4 RNA ligase 2 truncated, e.g., New England Biosciences, M0242S, T4 RNA ligase 2 truncated KQ, e.g., M0373S, or T4 RNA ligase 2 truncated K227Q, e.g., New England Biosciences, M0351S. In any of the preceding embodiments, the kit can also comprise a thermostable 5’ App DNA / RNA ligase, e.g., New England Biosciences, M0319S, or T4 DNA ligase, e.g., New England Biosciences, M0202S.

[0228] In some embodiments, the present methods comprise ligating a set of adaptors to a library of single-stranded polynucleotides using a single-stranded DNA (ssDNA) ligase. Any suitable ssDNA ligase, including the ones disclosed herein, can be used. The adaptors can be used at any suitable level or concentration, e.g., from about 1 μM to about 100 μM such as about 1 μM, 10 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, or 100 μM, or any subrange thereof. The adapter can comprise or begin with any suitable sequences or bases. For example, the adapter sequence can begin with all 2 bp combinations of bases.

[0229] In some embodiments, the ligation reaction can be conducted in the presence of a crowding agent. In one aspect, the crowding agent comprises a polyethylene glycol (PEG), such as PEG 4000, PEG 6000, or PEG 8000, Dextran, and / or Ficoll. The crowding agent, e.g., PEG, can be used at any suitable level or concentration. For example, the crowding agent, e.g., PEG, can be used at a level or concentration from about 0% (w / v) to about 25% (w / v), e.g., at about 0% (w / v), 1% (w / v), 2% (w / v), 3% (w / v), 4%(w / v), 5% (w / v), 6% (w / v), 7%(w / v), 8% (w / v), 9%(w / v), 10% (w / v), 11%(w / v), 12% (w / v), 13%(w / v), 14% (w / v), 15% (w / v), 16% (w / v), 17% (w / v), 18% (w / v), 19% (w / v), 20% (w / v), 21% (w / v), 22% (w / v), 23% (w / v), 24% (w / v), or 25% (w / v), or any subrange thereof.P A T E N T Attorney Docket No.: 4552-2000740

[0230] In some embodiments, the ligation reaction can be conducted for any suitable length of time. For example, the ligation reaction can be conducted for a time from about 2 to about 16 hours, %, e.g., for about 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, or 16 hours, or any subrange thereof.

[0231] In some embodiments, the ssDNA ligase in the ligation reaction can be used in any suitable volume. For example, the ssDNA ligase in the ligation reaction can be used at a volume from about 0.5 μl to about 2 μl, %, e.g., at about 0.5 μl, 0.6 μl, 0.7 μl, 0.8 μl, 0.9 μl 1 μl, 1.1 μl, 1.2 μl, 1.3 μl, 1.4 μl, 1.5 μl, 1.6 μl, 1.7 μl, 1.8 μl, 1.9 μl, or 2 μl, or any subrange thereof.

[0232] In some embodiments, the ligation reaction can be conducted in the presence of a ligation enhancer, e.g., betaine. The ligation enhancer, e.g., betaine, can be used at any suitable volume, e.g., from about 0 ul to about 1 μl, e.g., at about 0 μl, 0.1 μl, 0.2 μl, 0.3 μl, 0.4 μl, 0.5 μl, 0.6 μl, 0.7 μl, 0.8 μl, 0.9 μl, 1 μl, or any subrange thereof.

[0233] In some embodiments, the ligation reaction can be conducted using a T4 RNA ligase I, e.g., the T4 RNA ligase I from New England Biosciences, M0204S, in the following exemplary reaction mix (20 μl): 1 X Reaction Buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT), 25% (wt / vol) PEG 8000, 1 mM hexamine cobalt chloride (optional), 1 μl (10 units) T4 RNA Ligase, and 1 mM ATP. The reaction can be incubated at 25°C for 16 hours. The reaction can be stopped by adding 40 μl of 10 mM Tris-HCl pH 8.0, 2.5 mM EDTA.

[0234] In some embodiments, the ligation reaction can be conducted using a Thermostable 5’ App DNA / RNA ligase, e.g., the Thermostable 5’ App DNA / RNA ligase from New England Biosciences, M0319S, in the following exemplary reaction mix (20 μl): ssDNA / RNA Substrate 20 pmol (1 pmol / ul), 5´ App DNA Oligonucleotide 40 pmol (2 pmol / µl), 10X NEBuffer 1 (2 µl), 50 mM MnCl2 (for ssDNA ligation only) (2 µl), Thermostable 5´ App DNA / RNA Ligase (2 µl (40 pmol)), and Nuclease-free Water (to 20 µl). The reaction can be incubated at 65°C for 1 hour. The reaction can be stopped by heating at 90°C for 3 minutes.

[0235] In some embodiments, the ligation reaction can be conducted using a T4 RNA ligase 2, e.g., the T4 RNA ligase 2 from New England Biosciences, M0239S, in the following exemplary reaction mix (20 μl): T4 RNA ligase buffer (2 µl), enzyme (1 µl), PEG (10 µl), DNA (1 µl), Adapter (2 µl), and water (4 µl). The reaction can be incubated at 25°C for 16 hours. The reaction can be stopped by heating at 65°C for 20 minutes.P A T E N T Attorney Docket No.: 4552-2000740

[0236] In some embodiments, the ligation reaction can be conducted using a T4 RNA ligase 2 Truncated, e.g., the T4 RNA ligase 2 Truncated from New England Biosciences, M0242S, in the following exemplary reaction mix (20 μl): T4 RNA ligase buffer (2 µl), enzyme (1 µl), PEG (10 µl), DNA (1 µl), Adapter (2 µl), and water (4 µl). The reaction can be incubated at 25°C for 16 hours. The reaction can be stopped by heating at 65°C for 20 minutes.

[0237] In some embodiments, the ligation reaction can be conducted using a T4 RNA ligase 2 Truncated K227Q, e.g., the T4 RNA ligase 2 Truncated K227Q from New England Biosciences, M0351S, in the following exemplary reaction mix (20 μl): T4 RNA ligase buffer (2 µl), enzyme (1 µl), PEG (10 µl), DNA (1 µl), Adenylated Adapter (0.72 µl), and water (5.28 µl). The reaction can be incubated at 25°C for 16 hours. The reaction can be stopped by heating at 65°C for 20 minutes.

[0238] In some embodiments, the ligation reaction can be conducted using a T4 RNA ligase 2 Truncated KQ, e.g., the T4 RNA ligase 2 Truncated KQ from New England Biosciences, M0373S, in the following exemplary reaction mix (20 μl): T4 RNA ligase buffer (2 µl), enzyme (1 µl), PEG (10 µl), DNA (1 µl), Adenylated Adapter (0.72 µl), and water (5.28 µl). The reaction can be incubated at 25°C for 16 hours. The reaction can be stopped by heating at 65°C for 20 minutes.

[0239] In some embodiments, the ligation reaction can be conducted using a T4 DNA ligase, e.g., the T4 DNA ligase from New England Biosciences, M0202S, in the following exemplary reaction mix (20 μl): T4 RNA ligase buffer (2 µl), enzyme (1 µl), PEG (10 µl), DNA (1 µl), Adenylated Adapter (0.72 µl), and water (5.28 µl). The reaction can be incubated at 16°C for 16 hours. The reaction can be stopped by heating at 65°C for 10 minutes.

[0240] The second strand synthesis step can be conducted using any suitable enzyme. For example, the second strand synthesis step can be conducted using Bst polymerase, e.g., New England Biosciences, M0275S or Klenow fragment (3’->5’ exo-), e.g., New England Biosciences, M0212S.

[0241] In some embodiments, the second strand synthesis step can be conducted using Bst polymerase, e.g., New England Biosciences, M0275S, in the following exemplary reaction mix (10 μl): water (1.5 μl), primer (0.5 μl), dNTP (1 μl), ThermoPol Reaction buffer (5 μl), and Bst (2 μl). The reaction can be incubated at 62°C for 2 minutes and at 65°C for 30 minutes. After the reaction, the double stranded DNA molecules are further purified.P A T E N T Attorney Docket No.: 4552-2000740

[0242] In some embodiments, the second strand synthesis step can be conducted using Klenow fragment (3’->5’ exo-), e.g., New England Biosciences, M0212S, in the following exemplary reaction mix (10 μl): water (0.5 μl), primer (0.5 μl), dNTP (1 μl), NEB buffer (2 μl), and exo- (3 μl). The reaction can be incubated at 37°C for 5 minutes and at 75°C for 20 minutes. After the reaction, the double stranded DNA molecules are further purified.

[0243] After the second strand synthesis, but before the first or semi-targeted PCR, the double stranded DNA can be purified. The double stranded DNA can be purified using any suitable technique or procedure. For example, the double stranded DNA can be purified using any of the following kits: Zymo clean and concentrator, Zymo research, D4103; Qiaquick, Qiagen, 28104; Zymo ssDNA purification kit, Zymo Research, D7010; Zymo Oligo purification kit, Zymo Research, D4060; and AmpureXP beads, Beckman Coulter, A63882: 1.2x-4x bead ratio.

[0244] The first or semi-targeted PCR can be conducted using any suitable enzyme or reaction conditions. For example, the polynucleotides or DNA strands can be annealed at a temperature ranging from about 52°C to about 72°C, e.g., at about 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, or 72°C, or any subrange thereof. The first or semi-targeted PCR can be conducted for any suitable rounds of cycles. For example, the first or semi-targeted PCR can be conducted for 10-40 cycles, e.g., for 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 cycles. The primer pool can be used at any suitable concentration. For example, the primer pool can be used at a concentration ranging from about 5 nm to about 200 nM, , e.g., at about 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, or 200 nm, or any subrange thereof.

[0245] The first or semi-targeted PCR can be conducted using any suitable temperature cycle conditions. For example, the first or semi-targeted PCR can be conducted using any of the following cycle conditions: 95°C 3 minutes, (95°C 15 seconds, 62°C 30 seconds, 72°C 90 seconds) x3 or x5; or (95°C 15 seconds, 72°C 90 seconds) x23 or x 21, 72C 1 minute, 4°C forever.

[0246] In some embodiments, the first or semi-targeted PCR can be conducted using KAPA SYBR FAST, e.g., KAPA biosciences, KK4600, in the following exemplary reaction mix (50P A T E N T Attorney Docket No.: 4552-2000740 μl): DNA (2 μl), KAPASYBR (25 μl), Primer Pool (26nM each) (10 μl), Aprimer (100uM) (.4 μl), and water (12.6 μl). The first or semi-targeted PCR can be conducted using any of the following cycle conditions: 95°C 30 seconds, (95°C 10 seconds, 50-56°C 45 seconds, 72°C 35 seconds) x40.

[0247] In some embodiments, the first or semi-targeted PCR can be conducted using KAPA HiFi, e.g., KAPA Biosciences, KK2601, in the following exemplary reaction mix (50 μl): DNA (15 μl), KAPAHiFi (25 μl), Primer Pool (26nM each) (10 μl), and Aprimer (100uM) (0.4 μl). The first or semi-targeted PCR can be conducted using any of the following cycle conditions: 95°C 3min, (98°C 20 seconds, 53-54°C 15 seconds, 72°C 35 seconds) x15, 72°C 2 minutes, 4°C forever.

[0248] Bisulfite conversion can be conducted using any suitable techniques, procedures or reagents. In some embodiments, bisulfite conversion can be conducted using any of the following kits and procedures provided in the kit: EpiMark Bisulfite Conversion Kit, New England Biosciences, E3318S; EZ DNA Methylation Kit, Zymo Research, D5001; MethylCode Bisulfite Conversion Kit, Thermo Fisher Scientific, MECOV50; EZ DNA Methylation Gold Kit, Zymo Research, D5005; EZ DNA Methylation Direct Kit, Zymo Research, D5020; EZ DNA Methylation Lightning Kit, Zymo Research, D5030T; EpiJET Bisulfite Conversion Kit, Thermo Fisher Scientific, K1461; or EpiTect Bisulfite Kit, Qiagen, 59104.

[0249] In some embodiments, DNA molecules can be prepared using the procedures illustrated in Example 3, including the steps for constructing single-stranded polynucleotide, conversion of single-stranded polynucleotide library to double-stranded polynucleotide library, semi-targeted amplification of double-stranded polynucleotide library, and construction of sequence library. Such DNA molecules can further be analyzed for methylation status using any suitable methods or procedures.

[0250] In some aspects, the present invention is further illustrated in the following exemplary embodiments. 1. An in vitro method for classifying a sample, which method comprises: a) in vitro assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from said subject; andP A T E N T Attorney Docket No.: 4552-2000740 b) classifying said sample into a category based on said methylation status of said one or more tissue-specific or organ-specific target polynucleotide(s) in said sample obtained in a). 2. The method of embodiment 1, wherein step 1) comprises in vitro assessing methylation status of one tissue-specific or organ-specific target polynucleotide of a subject in a sample that comprises cell-free target polynucleotide from the subject. 3. The method of embodiment 1, wherein step 1) comprises in vitro assessing methylation status of two or more tissue-specific or organ-specific target polynucleotides of a subject in a sample that comprises cell-free target polynucleotides from the subject. 4. The method of any one of embodiments 1-3, wherein step 1) comprises in vitro assessing methylation status of one or more tissue-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject 5. The method of embodiment 4, which is used for assessing tissue damage or toxicity in the subject. 6. The method of embodiment 5, wherein the tissue is selected from the group consisting of a connective tissue, an epithelial tissue, a muscle tissue and a nervous tissue. 7. The method of any one of embodiments 1-3, wherein step 1) comprises in vitro assessing methylation status of one or more organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject. 8. The method of embodiment 7, which is used for assessing organ damage or toxicity in the subject. 9. The method of embodiment 8, wherein the organ is an organ of a system that is selected from the group consisting of cardiovascular system, e.g., lung heart, blood and blood vessels; digestive system, e.g., salivary glands, esophagus, stomach, liver, gallbladder, pancreas, intestines, colon, mesentery, rectum and anus; endocrine system, e.g. endocrine glands such as the hypothalamus, pituitary gland, pineal body or pineal gland, thyroid, parathyroids and adrenals, i.e., adrenal glands; excretory system, e.g., kidneys, ureters, bladder and urethra; lymphatic system, e.g., the lymph and the nodes and vessels that transport it including the immune system: defending against disease-causing agents with leukocytes, tonsils, adenoids, thymus and spleen; integumentary system, e.g., skin, hair and nails of a mammal; muscular system, e.g., muscles; nervous system, e.g., brain, spinal cord and nerves; reproductive system, e.g., the sex organs, such as ovaries, oviducts, uterus, vulva, vagina, testicles, vas deferens, seminal vesicles, prostate and penis; respiratory system, e.g., pharynx, larynx, trachea, bronchi, lungs and diaphragm; and skeletal system, e.g., bones, cartilage, ligaments and tendons. 10. The method of embodiment 8, wherein the organ is selected from the group consisting of liver, kidney, heart, stomach, lungs, testis, small intestine, colon, and gastrocnemius.P A T E N T Attorney Docket No.: 4552-2000740 11. The method of any one of embodiments 5-10, wherein the tissue or organ damage or toxicity in the subject is caused by treating the subject with a substance. 12. The method of embodiment 11, wherein the substance is a drug or a drug candidate. 13. The method of embodiment 12, wherein the drug or drug candidate is a chemical or small molecule drug or drug candidate. 14. The method of embodiment 12, wherein the drug or drug candidate is a biological molecule drug or drug candidate. 15. The method of embodiment 14, wherein the biological molecule drug or drug candidate is a polypeptide, polynucleotide or a complex thereof. 16. The method of any one of embodiments 12-15, wherein the drug or drug candidate is a conjugated drug or drug candidate. 17. The method of any one of embodiments 1-16, wherein step b) comprises generating a methylation status score with a computer algorithm based on the assessed methylation status of the one or more tissue-specific target polynucleotide(s), and classifying the sample into a category based on the methylation status score. 18. The method of any one of embodiments 1-17, wherein the sample is a blood sample, a urine sample, a cerebrospinal fluid sample, a pleural fluid sample and a saliva sample. 19. The method of embodiment 18, wherein the blood sample is a serum sample, a plasma sample, or any combination thereof. 20. The method of any one of embodiments 1-19, wherein the subject is a mammal. 21. The method of embodiment 20, wherein the mammal is a non-human mammal, e.g., a pet, a farm animal, a companion animal or an experimental animal. 22. The method of embodiment 20, wherein the mammal is a human. 23. The method of any one of embodiments 1-22, which comprises assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides. 24. The method of any one of embodiments 1-23, wherein the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using a probe or primer configured for hybridizing with each of the target polynucleotide(s).P A T E N T Attorney Docket No.: 4552-2000740 25. The method of any one of embodiments 1-24 wherein the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using a single probe or primer configured for hybridizing with the target polynucleotide. 26. The method of any one of embodiments 1-24 wherein the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using multiple probes or primers configured for hybridizing with the tissue-specific or organ-specific target polynucleotide(s). 27. The method of any one of embodiments 1-26 which further comprises using a common primer for amplifying each of the tissue-specific or organ-specific target polynucleotide(s) whose methylation status is to be assessed. 28. The method of embodiment 27, wherein the common primer comprises, consists essentially of, or consists of a sequence set forth in SEQ ID NO:731 (CACTCTTTCCCTACACGACGC),, a complementary or substantially complementary sequence thereof. 29. The method of any one of embodiments 1-28 which further comprises isolating the tissue-specific or organ-specific target polynucleotide(s) from a sample, e.g., a blood sample. 30. The method of any one of embodiments 1-29 which further comprises preparing a library of the tissue-specific or organ-specific target polynucleotide(s). 31. The method of embodiment 30, wherein the library of the tissue-specific or organ- specific target polynucleotide(s) is prepared using an enzyme, e.g., a ligase or a single-stranded DNA (ssDNA) ligase. 32. The method of embodiment 31, wherein the ssDNA ligase is T4 RNA ligase I, thermostable 5’ App DNA / RNA ligase, T4 RNA ligase 2, truncated T4 RNA ligase 2, e.g., T4 RNA ligase 2 Truncated, T4 RNA ligase2 Truncated K227Q, T4 RNA ligase2 Truncated KQ, or T4 DNA ligase, a Thermus bacteriophage RNA ligase such as a bacteriophage TS2126 RNA ligase (e.g., CircLigase™ and CircLigase II™), or an archaebacterium RNA ligase such as Methanobacterium thermoautotrophicum RNA ligase 1. 33. The method of any one of embodiments 1-32 which further comprises amplifying the tissue-specific or organ-specific target polynucleotide(s). 34. The method of embodiment 33, wherein the tissue-specific or organ-specific target polynucleotide(s) is or are amplified using a procedure selected from the group consisting of polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), ligase chain reaction (LCR), nucleic acid sequence based amplification (NASBA), primer extension, rolling circle amplification (RCA), self-sustained sequence replication (3SR), and loop-mediated isothermal amplification (LAMP).P A T E N T Attorney Docket No.: 4552-2000740 35. The method of any one of embodiments 1-34 which further comprises purifying the tissue-specific or organ-specific target polynucleotide(s), a library of the tissue-specific or organ-specific target polynucleotides, amplified tissue-specific or organ-specific target polynucleotide(s), or a library of the amplified tissue-specific or organ-specific target polynucleotides. 36. The method of any one of embodiments 1-35, wherein the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using mass spectrometry, methylation-specific PCR (MSP), methylation-sensitive sequencing, e.g., bisulphite sequencing, the HpaII tiny fragment Enrichment by ligation-mediated PCR assay (HELP Assay), Glal hydrolysis and ligation adapter dependent PCR assay (GLAD-PCR assay), restriction landmark genomic scanning (RLGS), methylated DNA immunoprecipitation (MeDIP or mDIP), pyrosequencing, molecular break light assay for DNA adenine methyltransferase activity, methyl sensitive Southern blotting or high resolution Melt (HRM) analysis. 37. The method of embodiment 36, wherein assessing methylation status of the tissue- specific or organ-specific target polynucleotide(s) comprises using a chemical agent, e.g., bisulfite or sodium bisulfite. 38. The method of embodiment 36, wherein assessing methylation status of the tissue- specific or organ-specific target polynucleotide(s) comprises using a biological agent, e.g., a polypeptide or an enzyme. 39. The method of embodiment 38, wherein the enzyme is a methylation-sensitive restriction enzyme (MSRE). 40. The method of embodiment 39, wherein the MSRE selectively cleaves at a residue when it is unmethylated. 41. The method of embodiment 39, wherein the MSRE selectively cleaves at the residue when it is methylated. 42. The method of embodiments 39-41, wherein the MSRE is selected from the group consisting of HpaII, SalI, SalI-HF®, ScrFI, BbeI, NotI, SmaI, XmaI, MboI, BstBI, ClaI, MluI, NaeI, NarI, PvuI, SacII, HhaI, and a combination thereof. 43. The method of embodiment 38, wherein the enzyme is a polynucleotide polymerase. 44. The method of embodiment 43, wherein the polynucleotide polymerase is configured to be used in PCR. 45. The method of embodiment 44, wherein the polynucleotide polymerase is a DNA polymerase, e.g., a DNA polymerase without a 3’ to 5’ exonuclease activity.P A T E N T Attorney Docket No.: 4552-2000740 46. The method of any one of embodiments 1-45, wherein the methylation status of the tissue-specific or organ-specific target polynucleotide(s) is assessed using methylation-sensitive sequencing, e.g., bisulphite sequencing. 47. The method of embodiment 46, wherein the methylation-sensitive sequencing is conducted with a format selected from the group consisting of Maxam-Gilbert sequencing, a chain-termination method, shotgun sequencing, bridge PCR, single-molecule real-time sequencing, ion semiconductor (ion torrent sequencing), sequencing by synthesis, sequencing by ligation (SOLiD sequencing), chain termination (Sanger sequencing), massively parallel signature sequencing (MPSS), polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, single molecule real time (SMRT) sequencing, nanopore DNA sequencing, tunnelling currents DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, a microscopy-based technique, RNAP sequencing, and in vitro virus high- throughput sequencing. 48. The method of embodiment 46 or 47, which further comprises, prior to the methylation- sensitive sequencing, e.g., bisulphite sequencing, obtaining a library of linear, single-stranded ligation products, each of the linear, single-stranded ligation products comprises of a linear, single-stranded target polynucleotide linked to an adaptor comprising a unique molecular identifier (UMI) sequence that earmarks the single-stranded target polynucleotide to which the adaptor is ligated. 49. The method of embodiment 48, wherein the sequencing reads from the tissue-specific or organ-specific target polynucleotide(s) are first adapter trimmed to remove any adapter sequence originating from the library construction process to obtain trimmed sequencing reads. 50. The method of embodiment 49, wherein the trimmed sequencing reads are mapped to a reference genome, e.g., a human reference genome, using an alignment program to obtain an aligned read file. 51. The method of any one of embodiments 1-50, wherein methylation status of each of the tissue-specific or organ-specific target polynucleotides is assessed. 52. The method of embodiment 51, wherein the methylation status of each of the tissue- specific or organ-specific target polynucleotides is assessed to obtain a methylation metric, e.g., in the form of average methylation frequency, methylation haplotype load, unmethylation haplotype load, percent discordant reads, or a combination thereof. 53. The method of embodiment 52, wherein methylation status of a sample, e.g., a blood sample, is assessed using the methylation metrics from each of the tissue-specific or organ- specific target polynucleotides. 54. The method of embodiment 53, wherein the methylation metric for each of the tissue- specific or organ-specific target polynucleotides is compared to a threshold or reference value to assess methylation status of a sample, e.g., a blood sample.P A T E N T Attorney Docket No.: 4552-2000740 55. The method of embodiment 53 or 54, wherein a numerical methylation matrix is computed using the methylation metrics from each of the tissue-specific or organ-specific target polynucleotides to assess methylation status of a sample, e.g., a blood sample. 56. The method of embodiment 55, wherein the numerical methylation matrix from a sample, e.g., a blood sample, comprises a single numerical number or value. 57. The method of embodiment 55, wherein the numerical methylation matrix from a sample, e.g., a blood sample, comprises multiple numerical numbers or values. 58. The method of any one of embodiments 55-57, wherein the numerical methylation matrix is computed using a classification algorithm. 59. The method of embodiment 58, wherein the classification algorithm is linear discriminant analysis, logistic regression, naïve bayes classification, perceptron classification, quadratic classification, k-nearest neighbors, boosting, decision tree, random forest, neural network, learning vector quantization, or support vector machines. 60. The method of any one of embodiments 55-59, wherein the methylation matrix is compared to a threshold or reference value to assess methylation status of a sample, e.g., a blood sample. 61. The method of any one of embodiments 52-60, wherein the methylation metric for each of the target polynucleotides is obtained using a computer. 62. The method of any one of embodiments 55-61, wherein the methylation matrix of a sample, e.g., a blood sample, is obtained using a computer based on the methylation metrics from each of the tissue-specific or organ-specific target polynucleotides. 63. The method of any of embodiments 1-62, wherein methylation status of at least two of the tissue-specific or organ-specific target polynucleotides from multiple samples, e.g., multiple samples from multiple subjects, are assessed sequentially or simultaneously. 64. The method of any one of embodiments 1-63, which has sensitivity of at least 10%. 65. The method of any one of embodiments 5-63, which has a sensitivity for assessing tissue or organ damage or toxicity in a subject that is higher than a sensitivity for assessing tissue or organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. 66. The method of embodiment 65, which has a sensitivity for assessing tissue damage or toxicity in a subject that is higher than a sensitivity for assessing tissue damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity.P A T E N T Attorney Docket No.: 4552-2000740 67. The method of embodiment 65, which has a sensitivity for assessing organ damage or toxicity in a subject that is higher than a sensitivity for assessing organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the organ damage or toxicity. 68. The method of any one of embodiments 1-167, which has specificity of at least 10%. 69. The method of any one of claim 5-68, which has a specificity for assessing tissue or organ damage or toxicity in a subject that is higher than a specificity for assessing tissue or organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. 70. The method of embodiment 69, which has a specificity for assessing tissue damage or toxicity in a subject that is higher than a specificity for assessing tissue damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. 71. The method of embodiment 69, which has a specificity for assessing organ damage or toxicity in a subject that is higher than a specificity for assessing organ damage or toxicity in the subject by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. 72. The method of any one of embodiments 5-71, which is used for assessing tissue or organ damage or toxicity in a subject at a stage when the tissue or organ damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. 73. The method of embodiment 72, which is used for assessing tissue damage or toxicity in a subject at a stage when the tissue damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue damage or toxicity. 74. The method of embodiment 72, which is used for assessing organ damage or toxicity in a subject at a stage when the organ damage or toxicity in the subject cannot be detected by another assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. 75. The method of any one of embodiments 5-71, which is used for assessing damage or toxicity of multiple tissues and / or multiple organs in a subject, e.g., all tissues and / or organs in the subject, in one test. 76. The method of embodiment 75, which is used for assessing damage or toxicity of multiple tissues in a subject, e.g., all tissues in the subject, in one test. 77. The method of embodiment 75, which is used for assessing damage or toxicity of multiple organs in a subject, e.g., all organs in the subject, in one test.P A T E N T Attorney Docket No.: 4552-2000740 78. The method of any one of embodiments 5-77, which further comprises assessing tissue or organ damage or toxicity in a subject by assaying another biomarker, e.g., a gold standard biomarker for assessing the tissue or organ damage or toxicity. 79. The method of any one of embodiments 5-78, which is used for assessing tissue or organ damage or toxicity in an animal subject in an animal test. 80. The method of embodiment 79, which is used for assessing tissue or organ damage or toxicity over time from a single animal. 81. The method of any one of embodiments 5-78, which is used for assessing tissue or organ damage or toxicity in a human subject in a pre-clinical study or in a clinical study. 82. The method of any one of embodiments 5-81, which is used for diagnosis, prognosis, stratification, risk assessment, or treatment monitoring of tissue or organ damage or toxicity in a subject. 83. The method of any one of embodiments 1-82, which is used for assessing liver damage or toxicity in a subject. 84. The method of embodiment 83, wherein the tissue-specific or organ-specific target polynucleotide(s): a) is or are located in one or more gene(s) that is or are specific for liver as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof. 85. The method of any one of embodiments 1-82, which is used for assessing testicle or testes damage or toxicity in a subject. 86. The method of embodiment 85, wherein the tissue-specific or organ-specific target polynucleotide(s): a) is or are located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) is or are located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 12; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof.P A T E N T Attorney Docket No.: 4552-2000740 87. A panel of isolated polynucleotides comprising, consisting of, or consisting essentially of one or more isolated tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof. 88. The panel of embodiment 87, wherein each of the isolated tissue-specific or organ- specific target polynucleotide(s): a) is or are located in one or more gene(s) that is or are specific for liver as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof. 89. The panel of embodiment 87, wherein each of the isolated tissue-specific or organ- specific target polynucleotide(s): a) is or are located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) is or are located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof. 90. The panel of any one of embodiments 87-89, which comprises, consists of, or consists essentially of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more isolated tissue-specific or organ-specific target polynucleotides, e.g., isolated tissue-specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof. 91. The panel of any one of embodiments 87-90, wherein isolated tissue-specific or organ- specific target polynucleotide(s) are DNA molecules, RNA molecules, or a combination thereof. 92. The panel of any one of embodiments 87-91, wherein the isolated polynucleotides are immobilized on a substrate. 93. The panel of embodiment 92, wherein the substrate comprises a solid surface, a porous surface, or a combination thereof. 94. The panel of embodiment 92 or 93, wherein the substrate is a part of a bead, a tube, a microtiter plate, a membrane, a gel, or a glass slide. 95. The panel of any one of embodiments 92-94, wherein the isolated polynucleotide molecules are immobilized spatially apart from each other on a substrate. 96. A kit or system, which comprises a panel of any one of claims 87-95.P A T E N T Attorney Docket No.: 4552-2000740 97. The kit or system of claim 96, which is configured for assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, e.g., configured for in vitro assessing of methylation status of the one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, in one or more sample that comprises cell-free target polynucleotide(s) from a subject. 98. The kit or system of embodiment 97, which is configured for assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more isolated tissue-specific or organ-specific target polynucleotides, e.g., isolated tissue-specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof. 99. The kit or system of any one of embodiments 96-98, wherein the isolated polynucleotides are configured as control polynucleotides. 100. The kit or system of embodiment 99, wherein the isolated polynucleotides have a level of concentration from about 1 femtomolar to about 1 millimolar. 101. A kit or system, which comprises reagents for assessing methylation status of one or more of tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof. 102. The kit or system of embodiment 101, which comprises reagents for assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides, e.g., isolated tissue-specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof. 103. The kit or system of embodiment 101 or 102, wherein the reagents comprise, consist essentially of, or consist of a probe or primer configured for hybridizing with each of the tissue- specific or organ-specific target polynucleotides whose methylation status is to be assessed. 104. The kit or system of embodiment 103, wherein the reagents comprise, consist essentially of, or consist of a single probe or primer configured for hybridizing with each of the tissue- specific or organ-specific target polynucleotides whose methylation status is to be assessed. 105. The kit or system of embodiment 103, wherein the reagents comprise, consist essentially of, or consist of multiple probes or primers configured for hybridizing with each of the tissue- specific or organ-specific target polynucleotides whose methylation status is to be assessed. 106. The kit or system of any one of embodiments 101-105, wherein the one or more primers comprise, consist essentially of, or consist of a sequence set forth in any of SEQ ID NOs:1 - SEQ ID NO:730, a complementary or substantially complementary sequence thereof, or any combination thereof.P A T E N T Attorney Docket No.: 4552-2000740 107. The kit or system of any one of embodiments 101-106, which further comprises a common primer for amplifying each of the targets whose methylation status is to be assessed. 108. The kit or system of embodiment 107, wherein the common primer comprises, consists essentially of, or consists of a sequence set forth in SEQ ID NO:731 (CACTCTTTCCCTACACGACGC), or a complementary or substantially complementary sequence thereof. 109. The kit or system of any one of embodiments 101-108, which further comprises an agent for isolating the tissue-specific or organ-specific target polynucleotide(s) from a sample that comprises cell-free target polynucleotide(s) from a subject, e.g., a blood or plasma sample. 110. The kit or system of any one of embodiments 101-109, which further comprises a reagent for preparing a library of the targets. 111. The kit or system of embodiment 110, wherein the reagent for preparing a library of the targets comprises an enzyme, e.g., a ligase or a single-stranded DNA (ssDNA) ligase. 112. The kit or system of embodiment 111, wherein the ssDNA ligase is T4 RNA ligase I, thermostable 5’ App DNA / RNA ligase, T4 RNA ligase 2, truncated T4 RNA ligase 2, e.g., T4 RNA ligase 2 Truncated, T4 RNA ligase2 Truncated K227Q, T4 RNA ligase2 Truncated KQ, or T4 DNA ligase, a Thermus bacteriophage RNA ligase such as a bacteriophage TS2126 RNA ligase (e.g., CircLigase™ and CircLigase II™), or an archaebacterium RNA ligase such as Methanobacterium thermoautotrophicum RNA ligase 1. 113. The kit or system of any one of embodiments 101-112, which further comprises a reagent for amplifying the tissue-specific or organ-specific target polynucleotide(s) or a library of the tissue-specific or organ-specific target polynucleotide(s). 114. The kit or system of embodiment 113, wherein the reagent for amplifying the targets or a library of the targets comprises an enzyme, e.g., an enzyme to be used in a polynucleotide amplification reaction, such as polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA), ligase chain reaction (LCR), nucleic acid sequence based amplification (NASBA), primer extension, rolling circle amplification (RCA), self-sustained sequence replication (3SR), or loop-mediated isothermal amplification (LAMP). 115. The kit or system of any one of embodiments 101-114, which further comprises an agent for purifying the tissue-specific or organ-specific target polynucleotide(s), a library of the tissue- specific or organ-specific target polynucleotide(s), amplified tissue-specific or organ-specific target polynucleotide(s) or a library of amplified tissue-specific or organ-specific target polynucleotide(s).P A T E N T Attorney Docket No.: 4552-2000740 116. The kit or system of any one of embodiments 101-115, which further comprises a reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s). 117. The kit or system of embodiment 116, wherein the reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) is a reagent to be used in a polynucleotide methylation, e.g., DNA methylation, detecting method such as mass spectrometry, methylation-specific PCR (MSP), bisulphite sequencing, the HpaII tiny fragment Enrichment by ligation-mediated PCR assay (HELP Assay), Glal hydrolysis and ligation adapter dependent PCR assay (GLAD-PCR assay), restriction landmark genomic scanning (RLGS), methylated DNA immunoprecipitation (MeDIP or mDIP), pyrosequencing, molecular break light assay for DNA adenine methyltransferase activity, methyl sensitive Southern blotting and high resolution Melt (HRM) analysis. 118. The kit or system of embodiment 116 or 117, wherein the reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) is a chemical agent, e.g., bisulfite or sodium bisulfite. 119. The kit or system of embodiment 116 or 117, wherein the reagent for assessing methylation status of the tissue-specific or organ-specific target polynucleotide(s) is a biological agent, e.g., a polypeptide or an enzyme. 120. The kit or system of embodiment 119, wherein the enzyme is a methylation-sensitive restriction enzyme (MSRE). 121. The kit or system of embodiment 120, wherein the MSRE selectively cleaves at a residue when it is unmethylated. 122. The kit or system of embodiment 120, wherein the MSRE selectively cleaves at the residue when it is methylated. 123. The kit or system of any one of embodiments 120-122, wherein the MSRE is selected from the group consisting of HpaII, SalI, SalI-HF®, ScrFI, BbeI, NotI, SmaI, XmaI, MboI, BstBI, ClaI, MluI, NaeI, NarI, PvuI, SacII, HhaI, and a combination thereof. 124. The kit or system of embodiment 119, wherein the enzyme is a polynucleotide polymerase. 125. The kit or system of embodiment 124, wherein the polynucleotide polymerase is configured to be used in PCR. 126. The kit or system of embodiment 125, wherein the polynucleotide polymerase is a DNA polymerase, e.g., a DNA polymerase without a 3’ to 5’ exonuclease activity. 127. The kit or system of any one of embodiments 101-126, which further comprises a panel of any one of claims 87-95.P A T E N T Attorney Docket No.: 4552-2000740 128. The kit or system of any one of embodiments 101-127, which further comprises a reference sample and / or information of a control locus. 129. The kit or system of any one of embodiments 101-128, which further comprises separate containers, e.g., vials, for one or more components and / or instructions for using the kit or system. 130. The kit or system of any one of embodiments 101-128, which further comprises a computer readable medium containing executable instructions for obtaining a methylation metric of a sample, e.g., a blood or plasma sample, based on the methylation status assessment. 131. The kit or system of embodiment 130, wherein the computer readable medium is configured for obtaining a methylation metric in the form of average methylation frequency, methylation haplotype load, unmethylation haplotype load, percent discordant reads, or a combination thereof. 132. The kit or system of any one of embodiments 101-128, which is configured for assessing classifying a sample, or is configured for assessing tissue damage or toxicity in the subject. 133. The method of any one of embodiments 1-86, wherein the one or more tissue-specific or organ-specific target polynucleotide(s) comprises, consists of or essentially consists of, at least 4 consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject. 134. The method of embodiment 133, wherein the tissue-specific or organ-specific target gene is selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject. 135. The method of embodiment 133, wherein the tissue-specific or organ-specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject. 136. The panel, kit or system of any one of embodiments 87-132, wherein the one or more tissue-specific or organ-specific target polynucleotide(s) comprises, consists of or essentially consists of, at least 4 consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject. 137. The panel, kit or system of embodiment 136, wherein the tissue-specific or organ- specific target gene is selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject. 138. The panel, kit or system of embodiment 136, wherein the tissue-specific or organ- specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject.P A T E N T Attorney Docket No.: 4552-2000740 G. Examples. Example 1. Detection of Drug-induced Liver Damage in Rats Abstract Background

[0251] Cell-free DNA is already used as a biomarker for cancer detection and prenatal testing. Many methods have been reported to identify the tissue of origin based on DNA methylation information carried mainly by cell-free DNA. In this study, we aimed to verify whether this method, which detects DNA released into blood due to cell death such as necrosis and apoptosis, can also be used to detect tissue damage caused by toxic compound administration. Results

[0252] Male Sprague Dawley rats were used in this study. Organs from normal organs (liver, kidney (medulla was split from cortex), heart, stomach, lungs, testis, small intestine, colon, and gastrocnemius). A methylation database was created, and 485 liver-specific DNA methylation regions (listed in Table 2) were identified. Blood was collected from rats treated with a single oral dose of 45 mg / kg thioacetamide, a typical hepatotoxicant, and plasma cell-free DNA was analyzed to detect liver-derived DNA with high sensitivity. The sensitivity was equivalent or superior to AST and ALT, the gold standard biomarkers of hepatotoxicity. Conclusions

[0253] Using an animal model, we have succeeded in detecting liver-derived DNA that leaks into the blood during hepatotoxicity with high sensitivity. This suggests the possibility of measuring the DNA with much higher sensitivity than existing biomarkers, which may be an effective approach for developing biomarkers for mild tissue damage and organs that have been difficult to detect so far and for which no useful biomarkers are available. Materials and methods Materials

[0254] Thioacetamide (TAA) was purchased from Sigma-Aldrich (Burlington, USA). Methyl-cellulose was purchased from Sigma-Aldrich (St. Louis, USA). Cell Free DNA BCT tube was purchased from Streck (Nebraska, USA). Rat blood was provided by Dr. MathiasP A T E N T Attorney Docket No.: 4552-2000740 Leblanc, The Salk Institute of Biological Studies. Rat liver tissue samples for analyzing tissue background were purchased from Zyagen (California, USA). Animal experiment

[0255] Male Sprague Dawley rats were purchased from Envigo RMS., (Indianapolis, Indiana). Animals were acclimated to the test facility for 3 days prior to the initiation of dosing. At initiation of dosing, animals were approximately 8 weeks old, and their body weights ranged from 245 to 262 g. Animals were group-housed (up to five animals / cage) in racks with solid bottom caging and woodchip bedding. Water was provided ad libitum. Animals were offered Certified Rodent Diet #2104 (Envigo RMS, Inc.) ad libitum, unless fasted for study procedure. Environmental controls were set to maintain the following animal room conditions: a temperature range of 22 and 26℃, a relative humidity range of 30 to 70%, and a 12-hour light / 12-hour dark cycle. Animals were given various cage-enrichment devices, but not dietary enrichment was given. Animals were assigned to the study using a computerized procedure designed to achieve body weight balance with respect to group assignment. Animals were randomized to groups by bodyweight. Rats were assigned to three groups indicated in Table 3. Table 3. Animal study design Group No. of Dose Level Animals (mg / kg) 1: Naïve 5 NA ^ Treatment naïve to develop a rat methylation database ^ 10 frozen tissues from 5 rats: liver, kidney, lung, heart, stomach, gastrocnemius, small intestine, colon, testis ^ 4 mL blood collected in Streck BCT tubes from each rat 2: Vehicle 10 0 ^ 10 rats dosed with a control vehicle (0.5% methyl cellulose) ^ 4 mL blood collected in Streck BCT tubes at either 9 hours or 24 hours ^ Liver tissue collected at same time points 3: 10 45 ^ 10 rats dosed with TAA (45 mg / kg) Thioacetamide ^ 4 mL blood collected in Streck BCT tubes at either 9 hours or 24 hours ^ Liver tissue collected at same time points NA: Not applicable

[0256] Animals in Group 1 were naïve (not dosed). Animals in Group 2 were dosed vehicle [0.5% methylcellulose in purified water (w / v)] as negative control and animals in Group 3 were dosed TAA [45 mg / kg body weight (BW)] known as a hepatotoxic compound via oral gavageP A T E N T Attorney Docket No.: 4552-2000740 once at a volume of 10 mL / kg BW. Doses were based on the most recently recorded scheduled body weight. Blood samples for clinical chemistry were collected via abdominal vein from all animals fasted at necropsy on the day of scheduled sacrifice. All animals were anesthetized with isoflurane and blood samples were collected, followed by necropsy. The first 5 animals in Groups 2 and 3 were necropsied approximately 9 hours post dose on Day 1. The remaining animals in Groups 2 and 3 were necropsied approximately 24 hours post dose on Day 2, and animals in Group 1 were also necropsied at that time.

[0257] A macroscopic examination of the external features of the carcass; external body orifices; abdominal, thoracic, and cranial cavities; organs; and tissues was performed. In Group 1, liver, kidney, heart, stomach, lungs, testis, small intestine, colon, and gastrocnemius were collected from each animal for creating tissue methylation database. Those tissues were snap frozen in liquid nitrogen and stored at -80℃ until analysis. In Group 2 and 3, liver from each animal were collected for histopathological examination. These liver samples were preserved in 10% neutral-buffered formalin, embedded in paraffin, sectioned, and slides were prepared and stained with hematoxylin and eosin. Animal experiment was conducted at Covance Laboratories, which is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). All procedures of the animal experiment were in compliance with applicable animal welfare acts and were approved by the local Institutional Animal Care and Use Committee (IACUC). Generation of DNA libraries for sequencing

[0258] See description in Section E of Detailed Description. Calculation of liver methylation score

[0259] See description in Section E of Detailed Description. Identification of Liver-specific and Testes-specific DNA Methylation Patterns

[0260] Five liver and five testes tissue samples and five bulk healthy plasma samples from male Sprague Dawley rats were purchased from a commercial vendor (Zyagen). DNA extraction was performed using the Qiagen DNEasy extraction kit using 25 mg of tissue or 2 mL of plasma for all 15 samples. All samples were processed using RRBS, and the resultantP A T E N T Attorney Docket No.: 4552-2000740 sequencing data was processed using the Singlera MONOD+ methylation analysis approach (in which methylation haplotype metrics MHL, uMHL, AMF, and PDR are calculated for each methylation haplotype block). Methylation metric values for each sample were combined into a data matrix, with each row corresponding to a methylation haplotype block and each column corresponding to a sample. Blocks showing elevated values in a methylation metric for one tissue type (liver or testes) but suppressed values in the other two sample types (the other respective tissue and plasma) were considered as “liver-specific” or “testes-specific”; this resulted in 311 liver-specific methylation blocks and 245 testes-specific methylation blocks. The average of the methylation metric values across these liver-specific and testes-specific regions were utilized as a “liver methylation score” and “testes methylation score” to measure the level of liver-derived or testes-derived DNA present in the sample Results Summary

[0261] The Methylation Metric used in this study is AMF. The Classification Method used in this study is Logistic Regression. An experimental panel interrogating 485 liver-specific methylation regions listed in Table 2 was developed. Male Sprague Dawley rats were treated with either a vehicle or a single oral dose of thioacetamide, a known hepatotoxicant, and plasma was collected from each rat either at 9 hours post dose or 24 hours post dose. Plasma was processed using the methylation assay, and the AMF metric was computed for each target region to create a data matrix. A Logistic Regression-based classifier was fit to the sum of the average methylation values across all target regions in Python (using the sklearn module). The resultant classifier score was able to successfully detect liver damage in all drug-treated samples, with no false positives in the vehicle samples.

[0262] Comparison to existing liver biomarkers (ALT / AST) Blood samples from each drug-treated or control rat were tested for the presence of ALT and AST using enzymatic methods in a standard liver testing kit. The level of liver enzyme present was compared to the computed methylation scores for each plasma sample and plotted. The methylation signature was able to identify liver damage in all cases where ALT or AST was elevated, and showed a more substantial separation for the 9h treatment case.P A T E N T Attorney Docket No.: 4552-2000740 Animal study

[0263] Animal study design is shown in Table 3. All animals survived until scheduled termination. No significant test article-related changes were observed in body weights. Clinical chemistry data are summarized Table 4. Table 4. Clinical Chemistry -Percent Change from Naïve and / or Control Parameter Necropsy Time Group 2 Compared Group 3 Compared To Point To Group 1 (Naïve) Group 1 (Naïve) Group 2 (Control) Glucose 9 hr NA NA -36.64 Total Cholesterol 9 hr NA NA -16.78 Triglyceride 9 hr NA NA -55.91 24 hr -4.08 -24.72 -21.51 AST 9 hr NA NA 281.27 24 hr 11.20 1452.34 1296.02 ALT 9 hr NA NA 146.50 24 hr 37.40 871.76 607.22 ALP 9 hr NA NA 26.23 24 hr 7.27 27.57 18.93 Creatine Kinase 24 hr 21.25 64.48 35.56 NA: Not applicable

[0264] Glucose, total cholesterol, and triglyceride levels for Group 3 (TAA) were decreased approximately 9 hours postdose when compared to Group1 (naïve) and Group 2 (control). At approximately 24 hours postdose, glucose and cholesterol levels for Group 3 were comparable to Groups 1 and 2; however, triglyceride levels continued to be decreased. AST, ALT, and ALP were increased approximately 9 hours postdose when compared to Group 1 (naïve) and Group 2 (control). AST and ALT continued to increase approximately 24 hours postdose, while ALP maintained 24 hours postdose. Creatine kinase levels were only increased approximately 24 hours postdose. Results of histopathological examination were shown in Table 5. Table 5. Incidence and Severity of Thioacetamide-Related Microscopic Findings in Liver Time after treat 9 hours 24 hours ment Dose Level Control 45 Control 45 (mg / kg) Number 5 5 5 5 ExaminedP A T E N T Attorney Docket No.: 4552-2000740 Apoptosis / necrosis, hepatocyte, Slight 0 5 - - centrilobular Moderate - - 0 5 Inflammation, mononuclear cell, Slight 0 5 - - centrilobular Moderate - - 0 5 Inflammation, neutrophil, bile ducts Minimal 0 5 0 0

[0265] TAA-related findings occurred in the liver of animals administered 45 mg / kg. On Day 1 of the dosing phase (9 hours postdose), findings consisted of slight apoptosis / necrosis of centrilobular hepatocytes with associated slight mononuclear inflammation consisting predominantly of macrophages and lymphocytes, and minimal neutrophilic inflammation centered on bile ducts. On Day 2 of the dosing phase (24 hours postdose), findings progressed to moderate hepatocellular apoptosis / necrosis and mononuclear inflammation, while neutrophilic inflammation was not observed. These microscopic findings were similar to what has previously been reported in TAA-induced liver injury in rats (15). These results indicate hepatotoxicity was successfully induced by TAA treatment.

[0266] Fig.4A shows the liver methylation scores calculated and plotted for liver DNA and cell-free DNA in plasma collected from each animal. The liver of untreated, vehicle-treated, and TAA-treated rats showed a high score of 30-40, while the plasma of untreated animals showed a score close...

Claims

P A T E N T Attorney Docket No.: 4552-2000740 CLAIMS 1. An in vitro method for classifying a sample, which method comprises: a) in vitro assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from said subject; and b) classifying said sample into a category based on said methylation status of said one or more tissue-specific or organ-specific target polynucleotide(s) in said sample obtained in a).

2. The method of claim 1, wherein step 1) comprises in vitro assessing methylation status of one tissue-specific or organ-specific target polynucleotide of a subject in a sample that comprises cell-free target polynucleotide from the subject.

3. The method of claim 1, wherein step 1) comprises in vitro assessing methylation status of two or more tissue-specific or organ-specific target polynucleotides of a subject in a sample that comprises cell-free target polynucleotides from the subject.

4. The method of any one of claims 1-3, wherein step 1) comprises in vitro assessing methylation status of one or more tissue-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject 5. The method of claim 4, which is used for assessing tissue damage or toxicity in the subject.

6. The method of claim 5, wherein the tissue is selected from the group consisting of a connective tissue, an epithelial tissue, a muscle tissue and a nervous tissue.

7. The method of any one of claims 1-3, wherein step 1) comprises in vitro assessing methylation status of one or more organ-specific target polynucleotide(s) of a subject in a sample that comprises cell-free target polynucleotide(s) from the subject.

8. The method of claim 7, which is used for assessing organ damage or toxicity in the subject.

9. The method of claim 8, wherein the organ is an organ of a system that is selected from the group consisting of cardiovascular system, e.g., lung heart, blood and blood vessels; digestive system, e.g., salivary glands, esophagus, stomach, liver, gallbladder, pancreas, intestines, colon, mesentery, rectum and anus; endocrine system, e.g. endocrine glands such as the hypothalamus, pituitary gland, pineal body or pineal gland, thyroid, parathyroids and adrenals, i.e., adrenal glands; excretory system, e.g., kidneys, ureters, bladder and urethra; lymphatic system, e.g., the lymph and the nodes and vessels that transport it including the immune system: defending against disease-causing agents with leukocytes, tonsils, adenoids, thymus and spleen; integumentary system, e.g., skin, hair and nails of a mammal; muscularP A T E N T Attorney Docket No.: 4552-2000740 system, e.g., muscles; nervous system, e.g., brain, spinal cord and nerves; reproductive system, e.g., the sex organs, such as ovaries, oviducts, uterus, vulva, vagina, testicles, vas deferens, seminal vesicles, prostate and penis; respiratory system, e.g., pharynx, larynx, trachea, bronchi, lungs and diaphragm; and skeletal system, e.g., bones, cartilage, ligaments and tendons.

10. The method of claim 8, wherein the organ is selected from the group consisting of liver, kidney, heart, stomach, lungs, testis, small intestine, colon, and gastrocnemius.

11. The method of any one of claims 5-10, wherein the tissue or organ damage or toxicity in the subject is caused by treating the subject with a substance.

12. The method of claim 11, wherein the substance is a drug or a drug candidate.

13. The method of any one of claim 5-12, which is used for assessing tissue or organ damage or toxicity in a human subject in a pre-clinical study or in a clinical study.

14. The method of any one of claim 5-13, which is used for diagnosis, prognosis, stratification, risk assessment, or treatment monitoring of tissue or organ damage or toxicity in a subject.

15. The method of any one of claim 1-14, which is used for assessing liver damage or toxicity in a subject.

16. The method of claim 15, wherein the tissue-specific or organ-specific target polynucleotide(s): a) is or are located in one or more gene(s) that is or are specific for liver as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof.

17. The method of any one of claim 1-14, which is used for assessing testicle or testes damage or toxicity in a subject.

18. The method of claim 17, wherein the tissue-specific or organ-specific target polynucleotide(s): a) is or are located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) is or are located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 12; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof.P A T E N T Attorney Docket No.: 4552-2000740 19. A panel of isolated polynucleotides comprising, consisting of, or consisting essentially of one or more isolated tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof.

20. The panel of claim 19, wherein each of the isolated tissue-specific or organ-specific target polynucleotide(s): a) is or are located in one or more gene(s) that is or are specific for liver as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:246-730, or a complementary or substantially complementary sequence thereof.

21. The panel of claim 19, wherein each of the isolated tissue-specific or organ-specific target polynucleotide(s): a) is or are located in a gene selected from the group consisting of B3galt1, Cacng5, Ccdc162, Cdc23, Cdca2, Ceacam5, Cnot4, Crybg1, Ddr1, Dpysl4, Enc1, Fam69b, Hs6st3, Ins1, Maml2, Midn, Obox5, Pax7, Pdlim4, Rtn4ip1, Siglec15, Slc16a3, Slc22a4, Smim23, Snx33, Syndig1, Tagln, Tcf3, Trpc7 and Ttc8; b) is or are located in one or more gene(s) that is or are specific for testicle or testes as listed in Table 1 or 2; or c) comprises, consists essentially of, or consists of one or more sequences set forth in one or more of SEQ ID NOs:1-245, or a complementary or substantially complementary sequence thereof.

22. A kit or system, which comprises a panel of any one of claims 19-21.

23. The kit or system of claim 22, which is configured for assessing methylation status of one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, e.g., configured for in vitro assessing of methylation status of the one or more tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof, in one or more sample that comprises cell-free target polynucleotide(s) from a subject.

24. The kit or system of claim 22, which is configured for assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more isolated tissue-specific or organ-specific target polynucleotides, e.g., isolated tissue-specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof.

25. A kit or system, which comprises reagents for assessing methylation status of one or more of tissue-specific or organ-specific target polynucleotide(s), or a complementary or substantially complementary sequence thereof.

26. The kit or system of claim 25, which comprises reagents for assessing methylation status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more tissue-specific or organ-specific target polynucleotides, e.g.,P A T E N T Attorney Docket No.: 4552-2000740 isolated tissue-specific or organ-specific target polynucleotides of whole genome of a subject, or a complementary or substantially complementary sequence thereof.

27. The method of any one of claim 1-18, wherein the one or more tissue-specific or organ- specific target polynucleotide(s) comprises, consists of or essentially consists of, at least 4 consecutive polynucleotides of a tissue-specific or organ-specific target gene of a subject that encodes an RNA or a polypeptide that is specific for the tissue or organ in the subject.

28. The method of claim 27, wherein the tissue-specific or organ-specific target gene is selectively or predominantly expressed and / or translated in multiple tissues or organs of the subject.

29. The method of claim 27, wherein the tissue-specific or organ-specific target gene is exclusively expressed and / or translated in a single tissue or organ of the subject.

Images