Vaccine compositions and methods of use

Abstract

The present disclosure provides a therapy with vaccine compositions including multiepitopic polypeptides, recombinant nucleic acids encoding multiepitopic polypeptides and methods of use thereof. Also provided herein are T-cell receptors (TCRs) that can recognize one or more epitopes of the multiepitopic polypeptides. The therapy provided herein can comprise (i) a TCR, a recombinant nucleic acid encoding the TCR, or cells comprising the TCR or the recombinant nucleic acid encoding the TCR, and (ii) a vaccine composition described herein. The methods and compositions provided herein can be used for the treatment of cancer.

Description

WSGR Docket No.: 50401-787.601 VACCINE COMPOSITIONS AND METHODS OF USE CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 556,258,filed on February 21, 2024, which is incorporated herein by reference in its entirety. BACKGROUND

[0002] Cancer is a leading cause of death worldwide, accounting for nearly one in six deathsglobally. While cell-based immunotherapies have led to advances in treatment options for cancer, they are often limited in their long-term efficacy. There is a need for methods and compositions to improve the efficacy of cell-based immunotherapy. SUMMARY

[0003] Recognized herein is a need to improve the efficacy of cell-based therapies to treatcancer. The methods and compositions provided herein can enhance the efficacy and persistence of cell-based immunotherapies.

[0004] Provided herein is a method of treating a subject with a disease or conditioncomprising administering to the subject a therapy comprising (i) a multiepitopic polypeptide, (ii) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (iii) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide does not comprise a full- length PRAME polypeptide and comprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence and a second PRAME amino acid sequence comprising a second PRAME epitope sequence, wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different, and wherein presentation of the first and / or second PRAME epitope sequence as a peptide:MHC complex by antigen presenting cells (APCs) of the subject administered the therapy is higher than the presentation of the first and / or second PRAME epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

[0005] In some embodiments, the method comprises administering to the subject a T-cellreceptor (TCR) or a recombinant nucleic acid encoding the TCR.

[0006] In some embodiments, the first PRAME epitope sequence and the second PRAMEepitope sequence is separated by a linker.WSGR Docket No.: 50401-787.601

[0007] In some embodiments, the first PRAME amino acid sequence is the first epitopesequence and / or the second PRAME amino acid sequence is the second epitope sequence.

[0008] In some embodiments, the first PRAME amino acid sequence consists of the firstepitope sequence, and / or the second PRAME amino acid sequence consists of the second epitope sequence.

[0009] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.

[0010] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.

[0011] In some embodiments, the first PRAME amino acid sequence and the second PRAMEamino acid sequence is separated by a linker.

[0012] In some embodiments, the first PRAME amino acid sequence comprises the firstPRAME epitope sequence and one or more residues flanking the N-terminus or the C- terminus of the first PRAME epitope sequence from the full-length PRAME polypeptide.

[0013] In some embodiments, the second PRAME amino acid sequence comprises thesecond PRAME epitope sequence and one or more residues flanking the N-terminus or the C- terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

[0014] In some embodiments, the multiepitopic polypeptide does not comprise more than 12or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

[0015] In some embodiments, the TCR recognizes and binds to a peptide:MHC complex, thepeptide:MHC complex comprising (i) the first or the second PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele.

[0016] Also provided herein is a method of treating a subject with a disease or conditioncomprising administering to the subject (a) a PRAME polypeptide, (b) a recombinant nucleic acid encoding the PRAME polypeptide, or (c) a cell comprising the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises a PRAME epitope sequence, wherein the subject has been previously administered a T-cell receptor (TCR) or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHCWSGR Docket No.: 50401-787.601 complex comprising (i) the PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele.

[0017] Also provided herein is a method of treating a subject with a disease or conditioncomprising administering to the subject a T-cell receptor (TCR) or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) a PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele, wherein the subject has been previously administered (a) a PRAME polypeptide, (b) a recombinant nucleic acid encoding the PRAME polypeptide, or (c) a cell comprising the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises the PRAME epitope sequence.

[0018] Also provided herein is a method of treating a subject with a disease or conditioncomprising, (a) administering to the subject (i) a PRAME polypeptide, (ii) a recombinant nucleic acid encoding the PRAME polypeptide, or (iii) a cell comprising the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises a PRAME epitope sequence; and (b) administering to the subject a TCR or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the PRAME peptide sequence, and (ii) a human MHC encoded by an HLA allele.

[0019] In some embodiments, administering in (a) is performed concurrently withadministering in (b).

[0020] In some embodiments, administering in (a) is prior to administering in (b).

[0021] In some embodiments, administering in (a) is subsequent to administering in (b).

[0022] In some embodiments, the PRAME polypeptide or the recombinant nucleic acidencoding the PRAME polypeptide is administered at least 1 day, 2 days, 5 days, 10 days, 20 days, 30 days, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years or more after the subject has been administered the TCR or the recombinant nucleic acid encoding the TCR.

[0023] In some embodiments, the TCR or the recombinant nucleic acid encoding the TCR isadministered at least 1 day, 2 days, 5 days, 10 days, 20 days, 30 days, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years or more after the subject has been administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide.

[0024] In some embodiments, the T-cell receptor (TCR) or the recombinant nucleic acidencoding the TCR is expressed by an immune cell.

[0025] In some embodiments, the TCR is a soluble TCR.WSGR Docket No.: 50401-787.601

[0026] In some embodiments, the method further comprises administering two or moredifferent TCRs or recombinant nucleic acids encoding the two or more different TCRs, and wherein the two or more different TCRs comprise a first TCR and a second TCR.

[0027] In some embodiments, the two or more different TCRs are expressed on surface oftwo different immune cells.

[0028] In some embodiments, the first TCR and the second TCR bind to differentpeptide:MHC complexes, each peptide:MHC complex comprising (i) an epitope sequence and (ii) a human MHC encoded by an HLA allele.

[0029] In some embodiments, the two or more different TCRs or recombinant nucleic acidsencoding the two or more different TCRs are administered separately or co-administered in a same mixture.

[0030] In some embodiments, (a) the first TCR binds to a peptide:MHC complex comprisingan epitope sequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele; (b) the first TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele; or (c) the first TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 79 and an MHC encoded by an HLA- B*07:02 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele.

[0031] In some embodiments, the PRAME polypeptide does not comprise a full-lengthPRAME protein sequence.

[0032] In some embodiments, the PRAME epitope sequence comprises a sequence of SEQID NO: 78.

[0033] In some embodiments, the HLA allele is an HLA-A*02:01 allele.

[0034] In some embodiments, the PRAME epitope sequence comprises a sequence of SEQID NO: 79.

[0035] In some embodiments, the HLA allele is an HLA-B*07:02 allele.

[0036] In some embodiments, the PRAME epitope sequence comprises a sequence of SEQID NO: 80 or 108.

[0037] In some embodiments, the HLA allele is an HLA-A*24:02 allele.WSGR Docket No.: 50401-787.601

[0038] In some embodiments, the PRAME polypeptide comprises a multiepitopicpolypeptide, and wherein the multiepitopic polypeptide does not comprise a full-length PRAME polypeptide and comprises two or more different PRAME epitope sequences.

[0039] In some embodiments, the multiepitopic polypeptide comprises at least 3, 4, 5, ormore different PRAME epitope sequences.

[0040] In some embodiments, the two or more different PRAME epitope sequences areseparated by linker sequences.

[0041] In some embodiments, antigen presenting cells (APCs) of the subject administered thePRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide comprising the multiepitopic polypeptide present more of a PRAME epitope sequence as a peptide:MHC complex compared to the APCs of a subject administered a full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

[0042] In some embodiments, T cells of the subject administered the multiepitopicpolypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide exhibit increased expansion compared to T cells of a subject administered a full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

[0043] In some embodiments, the multiepitopic polypeptide comprises a first PRAME aminoacid sequence comprising a first PRAME epitope sequence and a second PRAME amino acid sequence comprising a second PRAME epitope sequence, and wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different.

[0044] In some embodiments, the first PRAME epitope sequence and the second PRAMEepitope sequence is separated by a linker.

[0045] In some embodiments, the first amino acid sequence is the first epitope sequenceand / or the second amino acid sequence is the second epitope sequence.

[0046] In some embodiments, the first amino acid sequence consists of the first epitopesequence, and / or the second amino acid sequence consists of the second epitope sequence.

[0047] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.

[0048] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.

[0049] In some embodiments, the first amino acid sequence and the second amino acidsequence is separated by a linker.WSGR Docket No.: 50401-787.601

[0050] In some embodiments, the first amino acid sequence comprises the first PRAMEepitope sequence and one or more residues flanking the N-terminus or the C-terminus of the first PRAME epitope sequence from the full-length PRAME polypeptide.

[0051] In some embodiments, the second amino acid sequence comprises the secondPRAME epitope sequence and one or more residues flanking the N-terminus or the C- terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

[0052] In some embodiments, the multiepitopic polypeptide does not comprise more than 12or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

[0053] In some embodiments, the first PRAME epitope sequence and the second PRAMEepitope sequence are presentable by different HLA alleles, are presented by different HLA alleles, bind to different HLA alleles, are predicted to bind to different HLA alleles, or are predicted to be presented by different HLA alleles.

[0054] In some embodiments, a first PRAME epitope sequence (i) binds to or is predicted tobind to a first HLA allele with a KD of less than 100 nM and (ii) to binds to or is predicted to bind to a second HLA allele with a KD of more than 500 nM.

[0055] In some embodiments, the first PRAME epitope sequence is operably linked to thesecond PRAME epitope sequence via a linker.

[0056] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs: 86-96, and 97.

[0057] In some embodiments, the multiepitopic polypeptide comprises a first PRAMEepitope sequence, operably linked to a second PRAME epitope sequence, operably linked to a third PRAME epitope sequence.

[0058] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, (ii) the second PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA- B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02.WSGR Docket No.: 50401-787.601

[0059] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, (ii) the second PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, and (iii) the third PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA- A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele.

[0060] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, (ii) the second PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele.

[0061] In some embodiments, the subject does not express an HLA allele that recognizeseach PRAME epitope sequence of the multiepitopic polypeptide.

[0062] In some embodiments, the subject only expresses HLA alleles that recognize a subsetof PRAME epitope sequences of the multiepitopic polypeptide.

[0063] In some embodiments, the PRAME polypeptide comprises a sequence of SEQ IDNO: 75.

[0064] In some embodiments, the PRAME polypeptide comprises one or more sequencesselected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0065] In some embodiments, the PRAME polypeptide comprises one or more copies of oneor more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0066] In some embodiments, the PRAME polypeptide comprises two, three, four, or fivecopies of one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.WSGR Docket No.: 50401-787.601

[0067] In some embodiments, the PRAME polypeptide comprises two, three, four, or fivecopies of each sequence of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0068] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NO: 78, operably linked to a sequence of SEQ ID NOs: 80 or 108, and operably linked to a sequence of SEQ ID NO: 79.

[0069] In some embodiments, the sequence of SEQ ID NO: 78 is operably linked to thesequence of SEQ ID NOs: 80 or 108 via a linker, and the sequence of SEQ ID NOs: 80 or 108 is operably linked to the sequence of SEQ ID NO: 79 via a linker.

[0070] In some embodiments, the linker is a cleavable linker.

[0071] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs: 86-96 and 97.

[0072] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NOs: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

[0073] In some embodiments, the sequence of SEQ ID NOs: 80 or 108 is operably linked tothe sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 is operably linked to the sequence of SEQ ID NO: 78 via a linker.

[0074] In some embodiments, the linker is a cleavable linker.

[0075] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs: 86-96 and 97.

[0076] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NO: 79, operably linked to a sequence of SEQ ID NO: 78, and operably linked to a sequence of SEQ ID NOs: 80 or 108.

[0077] In some embodiments, the sequence of SEQ ID NO: 79 is operably linked to thesequence of SEQ ID NO: 78 via a linker, and the sequence of SEQ ID NO: 78 is operably linked to a sequence of SEQ ID NOs: 80 or 108 via a linker.

[0078] In some embodiments, the linker is a cleavable linker.

[0079] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs: 86-96 and 97.

[0080] In some embodiments, the PRAME polypeptide comprises at least two copies of amultiepitopic polypeptide, and wherein each copy comprises, from N terminus to C terminus, a sequence of SEQ ID NOs: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.WSGR Docket No.: 50401-787.601

[0081] In some embodiments, the PRAME polypeptide comprises three copies of themultiepitopic polypeptide.

[0082] In some embodiments, the PRAME polypeptide comprises five copies of themultiepitopic polypeptide.

[0083] In some embodiments, the PRAME polypeptide further comprises a secretory domain(Sec) sequence at the N terminus of the multiepitopic polypeptide.

[0084] In some embodiments, the Sec sequence comprises a sequence of SEQ ID NO: 74.

[0085] In some embodiments, the Sec sequence is operably linked to the multiepitopicpolypeptide via a linker.

[0086] In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0087] In some embodiments, the PRAME polypeptide further comprises an MHC class Itrafficking domain (MITD) sequence at the C terminus of the multiepitopic polypeptide.

[0088] In some embodiments, the MITD sequence comprises a sequence of SEQ ID NO: 76.

[0089] In some embodiments, the multiepitopic polypeptide is operably linked to the MITDsequence via a linker.

[0090] In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0091] In some embodiments, the PRAME polypeptide comprises a sequence having at least80% sequence identity to a sequence of SEQ ID NO: 73.

[0092] In some embodiments, the PRAME polypeptide comprises a sequence having at least80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 77, 81, 82, 83, and 84.

[0093] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 4 or 38.

[0094] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0095] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ IDWSGR Docket No.: 50401-787.601 NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0096] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two, three, four, or five copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0097] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two, three, four, or five copies of each sequence of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0098] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.

[0099] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

[0100] In some embodiments, the linker sequence encodes a cleavable linker.

[0101] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54,WSGR Docket No.: 50401-787.601 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0102] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selectedfrom the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, andoperably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

[0103] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the groupconsisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence.

[0104] In some embodiments, the linker sequence encodes a cleavable linker.

[0105] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0106] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequenceselected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140,and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137.

[0107] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence.

[0108] In some embodiments, the linker sequence is a cleavable linker.

[0109] In some embodiments, the linker sequence comprises a sequence of selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54,WSGR Docket No.: 50401-787.601 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0110] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises at least two copies of a string of sequences, and wherein each string of sequences comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, andoperably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59,115, 121, 127, 135, and 140.

[0111] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises three copies of the string of sequences.

[0112] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises five copies of the string of sequences.

[0113] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding a secretory (Sec) sequence at the 5’end of the string of sequences.

[0114] In some embodiments, the sequence encoding the Sec sequence comprises a sequenceselected from the group consisting of SEQ ID NOs: 2, 16, 27, 36, and 144.

[0115] In some embodiments, the sequence encoding the Sec sequence is operably linked tothe string of sequences via a linker sequence.

[0116] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

[0117] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding an MITD sequence at the 3’ end of the string of sequences.

[0118] In some embodiments, the sequence encoding the MITD domain comprises asequence selected from the group consisting of SEQ ID NOs: 6, 23, 34, 40, 51, 62, 72, 128, 142, 143, and 155.

[0119] In some embodiments, the string of sequences is operably linked to the sequenceencoding the MITD sequence via a linker sequence.

[0120] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.WSGR Docket No.: 50401-787.601

[0121] In some embodiments, the recombinant nucleic acid is codon-optimized.

[0122] In some embodiments, the recombinant nucleic acid is an RNA.

[0123] In some embodiments, the recombinant nucleic acid comprises a sequence having atleast 60% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

[0124] In some embodiments, the subject expresses more of the PRAME epitope whenadministered with the codon-optimized recombinant nucleic acid than administered with a wild-type recombinant nucleic acid.

[0125] In some embodiments, the TCR comprises a TCR beta chain construct and a TCRalpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence set forth in SEQ ID NO: 103.

[0126] In some embodiments, the TCR beta chain construct comprises a variable regionhaving an amino acid sequence with at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 106.

[0127] In some embodiments, the TCR beta chain construct comprises a complementaritydetermining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 101 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 102.

[0128] In some embodiments, the TCR alpha chain construct comprises a CDR1, a CDR2,and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 98, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 99, and the CDR3 has an amino acid sequence set forth in SEQ ID NO: 100.

[0129] In some embodiments, the TCR alpha chain construct comprises a variable regionhaving an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 104.

[0130] In some embodiments, the TCR comprises: (a) a beta chain having an amino acidsequence set forth in SEQ ID NO: 107, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 107, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 105, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 105.

[0131] Also provided herein is a method of treating a subject with a disease or conditioncomprising administering to the subject a therapy comprising (a) a multiepitopic polypeptide, (b) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (c) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding theWSGR Docket No.: 50401-787.601 multiepitopic polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence from a cancer protein and a second amino acid sequence comprising a second epitope sequence from the cancer protein, wherein the first epitope sequence and the second epitope sequence are different, wherein the first epitope sequence or the second epitope sequence are linked by a linker, wherein the multiepitopic polypeptide does not comprise the full-length cancer protein, wherein the subject has been previously treated with a TCR or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the first epitope sequence or the second epitope sequence, and (ii) a human MHC encoded by an HLA allele.

[0132] Also provided herein is a method of treating a subject with a disease or conditioncomprising administering to the subject a therapy comprising a TCR or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) an epitope sequence from a cancer protein, and (ii) a human MHC encoded by an HLA allele, wherein the subject has been previously treated with (a) a multiepitopic polypeptide, (b) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (c) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence and a second amino acid sequence comprising a second epitope sequence, wherein the first epitope sequence and the second epitope sequence are different, wherein the first epitope sequence or the second epitope sequence are linked by a linker, wherein the multiepitopic polypeptide does not comprise the full-length cancer protein, and wherein the first epitope sequence or the second epitope sequence is the epitope sequence recognized by the TCR.

[0133] Also provided herein is a method of treating a subject with a disease or conditioncomprising (a) administering to the subject a first therapy comprising (i) a multiepitopic polypeptide, (ii) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (iii) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence and a second amino acid sequence comprising a second epitope sequence, wherein the first epitope sequence and the second epitope sequence are different, wherein the first epitope sequence or the second epitope sequence are linked by a linker, and wherein the multiepitopic polypeptide does not comprise the full-length cancer protein; and (b) administering to the subject a second therapy comprising a TCR or aWSGR Docket No.: 50401-787.601 recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the first epitope sequence or the second epitope sequence, and (ii) a human MHC encoded by an HLA allele.

[0134] In some embodiments, the first therapy is administered prior to, concurrently, orsubsequent to the second therapy.

[0135] In some embodiments, presentation of the first and / or second epitope sequence as apeptide:MHC complex by antigen presenting cells (APCs) of the subject administered the therapy is higher than the presentation of the first and / or second epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

[0136] In some embodiments, the cancer protein is PRAME.

[0137] In some embodiments, the TCR recognizes an epitope derived from the cancerprotein.

[0138] In some embodiments, the method further comprises administering two or moredifferent TCRs or recombinant nucleic acids encoding the two or more different TCRs, and wherein the two or more different TCRs comprise a first TCR and a second TCR.

[0139] In some embodiments, the two or more different TCRs are expressed on surface oftwo different immune cells.

[0140] In some embodiments, the first TCR and the second TCR bind to differentpeptide:MHC complexes, each peptide:MHC complex comprising (i) an epitope sequence and (ii) a human MHC encoded by an HLA allele.

[0141] In some embodiments, the two or more different TCRs or recombinant nucleic acidsencoding the two or more different TCRs are administered separately or co-administered in a same mixture.

[0142] In some embodiments, (a) the first TCR binds to a peptide:MHC complex comprisingan epitope sequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele; (b) the first TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele; or (c) the first TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 79 and an MHC encoded by an HLA- B*07:02 allele and the second TCR binds to a peptide:MHC complex comprising an epitopeWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele.

[0143] In some embodiments, antigen presenting cells (APCs) of the subject administered themultiepitopic polypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide present more of an epitope sequence derived from a cancer protein as a peptide:MHC complex compared to the APCs of a subject administered a full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

[0144] In some embodiments, T cells of the subject administered the multiepitopicpolypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide exhibit increased expansion compared to T cells of a subject administered a full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

[0145] In some embodiments, the cell is an APC.

[0146] In some embodiments, the APC has been incubated with the multiepitopicpolypeptide or the recombinant acid encoding the multiepitopic polypeptide.

[0147] In some embodiments, the multiepitopic polypeptide comprises at least 2, 3, 4, 5, ormore different epitope sequences derived from a cancer protein.

[0148] Also provided herein is a recombinant nucleic acid encoding a TCR comprising: (a) aTCR beta chain construct, and (b) a TCR alpha chain construct; wherein the TCR binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 79, and (ii) a human MHC encoded by the HLA-B*07:02 allele; or (ii) a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 80 or 108, and (ii) a human MHC encoded by the HLA-A*24:02 allele.

[0149] In some embodiments, the peptide:MHC complex comprises the PRAME epitopesequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 79, and (ii) a human MHC encoded by the HLA-B*07:02 allele.

[0150] In some embodiments, the peptide:MHC complex comprises the PRAME epitopesequence having a sequence according to SEQ ID NO: 79.

[0151] In some embodiments, the peptide:MHC complex comprises the PRAME epitopesequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NOs: 80 or 108, and (ii) a human MHC encoded by the HLA-A*24:02 allele.

[0152] In some embodiments, the peptide:MHC complex comprises the PRAME epitopesequence having a sequence according to SEQ ID NOs: 80 or 108.WSGR Docket No.: 50401-787.601

[0153] Also provided herein is a cell comprising the recombinant nucleic acid of anypreceding embodiment.

[0154] In some embodiments, the cell is a T cell.

[0155] In some embodiments, upon binding of the TCR to the peptide:MHC complex, thecell produces a proinflammatory cytokine.

[0156] In some embodiments, the proinflammatory cytokine is IFN- -2, TNF- -6, orIL-17.

[0157] In some embodiments, upon binding of the TCR to the peptide:MHC complex,cytotoxicity of the cell against target cells is increased by 25%, 50%, 100%, 150%, 200%, or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex.

[0158] Also provided herein is a recombinant nucleic acid encoding a PRAME polypeptidecomprising a multiepitopic polypeptide, wherein the multiepitopic polypeptide does not comprise a full-length PRAME polypeptide and comprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence and a second PRAME amino acid sequence comprising a second PRAME epitope sequence, wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different, and wherein the first PRAME amino acid sequence and the second PRAME amino acid sequence are linked via a linker.

[0159] In some embodiments, presentation of the first and / or second PRAME epitopesequence as a peptide:MHC complex by antigen presenting cells (APCs) of the subject administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide is higher than the presentation of the first and / or second PRAME epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

[0160] In some embodiments, the first PRAME amino acid sequence is the first epitopesequence and / or the second PRAME amino acid sequence is the second epitope sequence.

[0161] In some embodiments, the first PRAME amino acid sequence consists of the firstepitope sequence, and / or the second PRAME amino acid sequence consists of the second epitope sequence.

[0162] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.WSGR Docket No.: 50401-787.601

[0163] In some embodiments, the first PRAME epitope sequence and / or the second PRAMEepitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.

[0164] In some embodiments, the first PRAME epitope sequence and the second PRAMEepitope sequence is separated by a linker.

[0165] In some embodiments, the first PRAME amino acid sequence comprises the firstPRAME epitope sequence and one or more residues flanking the N-terminus or the C- terminus of the first PRAME epitope sequence from the full-length PRAME polypeptide.

[0166] In some embodiments, the second PRAME amino acid sequence comprises thesecond PRAME epitope sequence and one or more residues flanking the N-terminus or the C- terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

[0167] In some embodiments, the multiepitopic polypeptide does not comprise more than 12or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

[0168] In some embodiments, the PRAME polypeptide further comprises a Secretory (Sec)sequence at the N terminus of the multiepitopic polypeptide.

[0169] In some embodiments, the Sec sequence comprises a sequence of SEQ ID NO: 74.

[0170] In some embodiments, the Sec sequence is operably linked to the multiepitopicpolypeptide via a linker.

[0171] In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0172] In some embodiments, the PRAME polypeptide further comprises an MHC class Itrafficking signal (MITD) sequence at the C terminus of the multiepitopic polypeptide.

[0173] In some embodiments, the MITD sequence comprises a sequence of SEQ ID NO: 76.

[0174] In some embodiments, the multiepitopic polypeptide is operably linked to the MITDsequence via a linker.

[0175] In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0176] In some embodiments, the multiepitopic polypeptide comprises at least 3, 4, 5, ormore different PRAME epitope sequences.

[0177] In some embodiments, the first PRAME epitope sequence and the second PRAMEepitope sequence are presentable by different HLA alleles, are presented by different HLA alleles, bind to different HLA alleles, are predicted to bind to different HLA alleles, or are predicted to be presented by different HLA alleles.WSGR Docket No.: 50401-787.601

[0178] In some embodiments, a first PRAME epitope sequence (i) binds to or is predicted tobind to a first HLA allele with a KD of less than 100 nM and (ii) to binds to or is predicted to bind to a second HLA allele with a KD of more than 500 nM.

[0179] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs:86-96 and 97.

[0180] In some embodiments, the multiepitopic polypeptide comprises a first PRAMEepitope sequence, operably linked to a second PRAME epitope sequence, operably linked to a third PRAME epitope sequence.

[0181] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, (ii) the second PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA- B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02.

[0182] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, (ii) the second PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, and (iii) the third PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA- A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele.

[0183] In some embodiments, (i) the first PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, (ii) the second PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, bindsWSGR Docket No.: 50401-787.601 to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele.

[0184] In some embodiments, the multiepitopic polypeptide comprises the formula NT seq –(cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2])x-CT seq, where x is an integer from 1 to 10.

[0185] In some embodiments, the multiepitopic polypeptide comprises the formula NT seq –(cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2]-cleavable linker3-[Epitope3])x- CT seq, where x is an integer from 1 to 10.

[0186] In some embodiments, the NT seq comprises a Secretory (Sec) sequence and a N-terminal linker sequence.

[0187] In some embodiments, the CT seq comprises a C-terminal linker and a MITDsequence.

[0188] In some embodiments, the Epitope1 Epitope2, or Epitope3 is selected from the groupconsisting of a PRAME epitope presentable by HLA-A*02:01 allele, a PRAME epitope presentable by HLA-B*07:02 allele, a PRAME epitope presentable by HLA-A*24:02 allele.

[0189] In some embodiments, the cleavable linker1, cleavable linker2, or cleavable linker3 isselected from the group consisting of SEQ ID NOs: 86-96 and 97.

[0190] In some embodiments, the PRAME polypeptide comprises a sequence of SEQ IDNO: 75.

[0191] In some embodiments, the PRAME polypeptide comprises one or more sequencesselected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0192] In some embodiments, the PRAME polypeptide comprises one or more copies of oneor more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0193] In some embodiments, the PRAME polypeptide comprises two, three, four, or fivecopies of one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0194] In some embodiments, the PRAME polypeptide comprises two, three, four, or fivecopies of each sequence of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

[0195] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NO: 78, operably linked to a sequence of SEQ ID NO: 80 or 108, and operably linked to a sequence of SEQ ID NO: 79.WSGR Docket No.: 50401-787.601

[0196] In some embodiments, the sequence of SEQ ID NO: 78 is operably linked to thesequence of SEQ ID NO: 80 or 108 via a linker, and the sequence of SEQ ID NO: 80 or 108 is operably linked to the sequence of SEQ ID NO: 79 via a linker.

[0197] In some embodiments, the linker is a cleavable linker.

[0198] In some embodiments, the linker comprises a sequence of SEQ ID NO: 86-97.

[0199] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NO: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

[0200] In some embodiments, the sequence of SEQ ID NO: 80 or 108 is operably linked tothe sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 is operably linked to the sequence of SEQ ID NO: 78 via a linker.

[0201] In some embodiments, the linker is a cleavable linker.

[0202] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NOs: 86-96 and 97.

[0203] In some embodiments, the PRAME polypeptide comprises, from N terminus to Cterminus, a sequence of SEQ ID NO: 79, operably linked to a sequence of SEQ ID NO: 78, and operably linked to a sequence of SEQ ID NO: 80 or 108.

[0204] In some embodiments, the sequence of SEQ ID NO: 79 is operably linked to thesequence of SEQ ID NO: 78 via a linker, and the sequence of SEQ ID NO: 78 is operably linked to a sequence of SEQ ID NO: 80 or 108 via a linker.

[0205] In some embodiments, the linker is a cleavable linker.

[0206] In some embodiments, the linker comprises a sequence selected from the groupconsisting of SEQ ID NO: 86-96 and 97.

[0207] In some embodiments, the PRAME polypeptide comprises at least two copies of amultiepitopic polypeptide, and wherein each copy comprises, from N terminus to C terminus, a sequence of SEQ ID NO: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

[0208] In some embodiments, the PRAME polypeptide comprises three copies of themultiepitopic polypeptide.

[0209] In some embodiments, the PRAME polypeptide comprises five copies of themultiepitopic polypeptide.

[0210] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises a sequence of SEQ ID NO: 4 or 38.WSGR Docket No.: 50401-787.601

[0211] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0212] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0213] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two, three, four, or five copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0214] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two, three, four, or five copies of each sequence of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

[0215] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.WSGR Docket No.: 50401-787.601

[0216] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

[0217] In some embodiments, the linker sequence encodes a cleavable linker.

[0218] In some embodiments, the linker sequence comprises a sequence of selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0219] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

[0220] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence.

[0221] In some embodiments, the linker sequence encodes a cleavable linker.

[0222] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0223] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137.WSGR Docket No.: 50401-787.601

[0224] In some embodiments, the sequence selected from the group consisting of SEQ IDNOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence.

[0225] In some embodiments, the linker sequence is a cleavable linker.

[0226] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0227] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises at least two copies of a string of sequences, and wherein each string of sequences comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

[0228] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises three copies of the string of sequences.

[0229] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises five copies of the string of sequences.

[0230] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding a Sec sequence at the 5’ end of the string of sequences.

[0231] In some embodiments, the sequence encoding the Sec sequence comprises a sequenceselected from the group consisting of SEQ ID NOs: 2, 16, 27, 36, and 144.

[0232] In some embodiments, the sequence encoding the Sec sequence is operably linked tothe string of sequences via a linker sequence.

[0233] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.WSGR Docket No.: 50401-787.601

[0234] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding an MITD sequence at the 3’ end of the string of sequences.

[0235] In some embodiments, the sequence encoding the MITD sequence comprises asequence selected from the group consisting of SEQ ID NOs: 6, 23, 34, 40, 51, 62, 72, 128, 142, 143, and 155.

[0236] In some embodiments, the string of sequences is operably linked to the sequenceencoding the MITD sequence via a linker sequence.

[0237] In some embodiments, the linker sequence comprises a sequence selected from thegroup consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

[0238] Also provided herein is a recombinant nucleic acid having at least 60% sequenceidentity to a sequence selected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

[0239] Also provided herein is a recombinant polypeptide having at least 80% sequenceidentity to a sequence selected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

[0240] Also provided herein is a polypeptide encoded by the recombinant nucleic acid of anyone of the preceding embodiments.

[0241] Also provided herein is a pharmaceutical composition comprising the recombinantnucleic acid of any one of the preceding embodiments or the polypeptide of any one of the preceding embodiments, and a pharmaceutically acceptable carrier.

[0242] Also provided herein is the recombinant nucleic acid of any one of the precedingembodiments, the polypeptide of any one of the preceding embodiments, or the pharmaceutical composition of any of the preceding embodiments for use in therapy.

[0243] Also provided herein is use of the recombinant nucleic acid of any one of thepreceding embodiments, the polypeptide of any one of the preceding embodiments, or the pharmaceutical composition of any one of the preceding embodiments, in the manufacture of a medicament for the treatment of cancer in a subject in need thereof. INCORPORATION BY REFERENCE

[0244] All publications, patents, and patent applications mentioned in this specification areherein incorporated by reference to the same extent as if each individual publication, patent,WSGR Docket No.: 50401-787.601 or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material. BRIEF DESCRIPTION OF THE DRAWINGS

[0245] The novel features of the invention are set forth with particularity in the appendedclaims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which:

[0246] FIG.1A is an exemplary mRNA construct encoding full length PRAME with linkersequences, flanked by a secretory (Sec) and MHC class I Trafficking Domain (MITD).

[0247] FIG. 1B depicts exemplary mRNA constructs encoding minimal PRAME epitopespresented by HLA-A02:01 (A02), HLA-B07:02 (B07), and HLA-A24:02 (A24) in different orientations (referred to as 1xV1, 1xV2, or 1xV3). Constructs 3xV2 and 5xV2 encode three- and 5-times repeats of the minimal epitopes in the V2 orientation, respectively. Epitope sequences are each flanked by a cleavage linker. Constructs also include GSS linker sequences and a Sec and MITD domain.

[0248] FIG.2 shows results of MITD protein expression, measured by mass spectrometry, ofmRNA constructs expressed in A375 tumor cells. Wild type (WT) and codon optimized (Opt) constructs were compared. The solid line depicts the number of bases in the mRNA construct.

[0249] FIGs.3A-3C depict results of epitope protein expression, measured by targeted massspectrometry, by indicated mRNA constructs expressed in A375 tumor cells engineered to express the HLA allele that presents the epitope as indicated. FIG.3A depicts expression of epitope SLLQHLIGL (SEQ ID NO: 78) presented by HLA-A02:01. FIG.3B depicts expression of epitope LYVDSLFFL (SEQ ID NO: 80) presented by HLA-A24:02. FIG.3C depicts expression of epitope SPSVSQLSVL (SEQ ID NO: 79) presented by HLA-B07:02. Normalized abundance is given, normalized to the most abundant mRNA construct.

[0250] FIGs. 4A-4C depict results quantifying IFN- levels in the supernatant taken from acoculture of human donor monocyte-derived dendritic cells (moDCs) transfected with indicated mRNA constructs and effector T cells expressing a TCR specific for PRAME on either HLA-A02 (FIG.4A), HLA-A24:02 (FIG.4B), or HLA-B07 (FIG.4C).WSGR Docket No.: 50401-787.601

[0251] FIGs. 5A-5C depict flow cytometry data verifying the generation of murine tumorcell lines engineered to express PRAME. FIG.5A depicts representative flow cytometry data for LLC1 lung carcinoma cells expressing PRAME and HLA-A02:01. FIG.5B depicts representative flow cytometry data for 4T1 breast cancer cells expressing PRAME and HLA- A02:01. FIG.5C depicts representative flow cytometry measuring transduction efficiency of murine T cells to express the PRAME TCR.

[0252] FIGs.5D-5E depict results quantifying IFN-coculture of murine tumor cell lines engineered to express human PRAME and chimeric HLA-A02:01 / H2-kb molecule with murine T cells from an HLA-A02:01 / H2-kb transgenic mouse engineered to express the PRAME-specific TCR. Various effector to target ratios were used. Within each effector to target ratio, the left bar graph illustrates results obtained by incubating target cells with the PRAME-TCR T cells and the right bar graph illustrates results obtained by incubating target cells with control non-specific splenocytes. FIG.5D depicts results obtained using LLC1 lung carcinoma cells. FIG.5E depicts results obtained using 4T1 breast cancer cells. DETAILED DESCRIPTION Definitions

[0253] To facilitate an understanding of the present disclosure, a number of terms and phrasesare defined below.

[0254] An antigen is a foreign substance to the body that induces an immune response. A“neoantigen” refers to a class of tumor antigens which arise from tumor-specific changes in proteins. Neoantigens encompass, but are not limited to, tumor antigens which arise from, for example, a substitution in a protein sequence, a frame shift mutation, a fusion polypeptide, an in-frame deletion, an insertion, and expression of an endogenous retroviral polypeptide.

[0255] A “neoepitope” refers to an epitope that is not present in a reference, such as a non-diseased cell, e.g., a non-cancerous cell or a germline cell, but is found in a diseased cell, e.g., a cancer cell. This includes situations where a corresponding epitope is found in a normal non- diseased cell or a germline cell but, due to one or more mutations in a diseased cell, e.g., a cancer cell, the sequence of the epitope is changed so as to result in the neoepitope.

[0256] A “mutation” refers to a change of or a difference in a nucleic acid sequence (e.g., anucleotide substitution, addition or deletion) compared to a reference nucleic acid. A “somatic mutation” can occur in any of the cells of the body except the germ cells (sperm and egg) and are not passed on to children. These alterations can (but do not always) cause cancer or otherWSGR Docket No.: 50401-787.601 diseases. In some embodiments, a mutation is a non-synonymous mutation. A “non- synonymous mutation” refers to a mutation, for (e.g., a nucleotide substitution), which does result in an amino acid change such as an amino acid substitution in the translation product. A “frameshift” occurs when a mutation disrupts the normal phase of a gene’s codon periodicity (also known as “reading frame”), resulting in translation of a non-native protein sequence. It is possible for different mutations in a gene to achieve the same altered reading frame.

[0257] “Antigen processing” or “processing” refers to the degradation of a polypeptide orantigen into procession products, which are fragments of said polypeptide or antigen (e.g., the degradation of a polypeptide into peptides) and the association of one or more of these fragments (e.g., via binding) with MHC molecules for presentation by cells, for example, antigen presenting cells, to specific T cells.

[0258] An “antigen presenting cell” (APC) refers to a cell which presents peptide fragments ofprotein antigens in association with MHC molecules on its cell surface. The term includes professional antigen presenting cells (e.g., B lymphocytes, monocytes, dendritic cells, Langerhans cells) as well as other antigen presenting cells (e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts, oligodendrocytes). In some cases, the APC can be a cancer cell.

[0259] The term “affinity” refers to a measure of the strength of binding between two membersof a binding pair (e.g., a human leukocyte antigen (HLA)-binding peptide and a class I or II HLA, or a peptide-HLA complex and a T cell receptor (TCR)). KDrefers to the dissociation constant between two members of a binding pair and has units of molarity. KArefers to the affinity constant between two members of a binding pair is the inverse of the dissociation constant. Affinity may be determined experimentally, for example by surface plasmon resonance (SPR) using commercially available Biacore SPR units. Koff refers to the off-rateconstant of two members of a binding pair, (e.g., the off-rate constant of an HLA-binding peptide and a class I or II HLA, or a peptide-HLA complex and a TCR). Konrefers to the on- rate constant of two members of a binding pair, (e.g., the on-rate constant of an HLA-binding peptide and a class I or II HLA, or a peptide-HLA complex and a TCR).

[0260] Throughout this disclosure, “binding data” results may be expressed in terms of an“IC50.” Affinity may also be expressed as the inhibitory concentration 50 (IC50), or the concentration at which 50% of a first member of a binding pair (e.g., a peptide) is displaced. Likewise, ln(IC50) refers to the natural log of the IC50. For example, an IC50may be the concentration of a tested peptide in a binding assay at which 50% inhibition of binding of a labeled reference peptide is observed. Given the conditions in which the assays are run (e.g., limiting HLA protein concentrations and / or labeled reference peptide concentrations), theseWSGR Docket No.: 50401-787.601 values can approximate KDvalues. Assays for determining binding are well known in the art and are described in detail, for example, in PCT publications WO 94 / 20127 and WO 94 / 03205, and other publications such Sidney et al., Current Protocols in Immunology 18.3.1 (1998); Sidney, et al., J. Immunol.154:247 (1995); and Sette, et al., Mol. Immunol.31:813 (1994). Alternatively, binding can be expressed relative to binding by a reference standard peptide. Binding can also be determined using other assay systems including those using: live cells (e.g., Ceppellini et al., Nature 339:392 (1989); Christnick et al., Nature 352:67 (1991); Busch et al., Int. Immunol.2:443 (1990); Hill et al., J. Immunol.147:189 (1991); del Guercio et al., J. Immunol.154:685 (1995)), cell free systems using detergent lysates (e.g., Cerundolo et al., J. Immunol.21:2069 (1991)), immobilized purified MHC (e.g., Hill et al., J. Immunol.152, 2890 (1994); Marshall et al., J. Immunol.152:4946 (1994)), ELISA systems (e.g., Reay et al., EMBO J. 11:2829 (1992)), surface plasmon resonance (e.g., Khilko et al., J. Biol. Chem. 268:15425 (1993)); high flux soluble phase assays (Hammer et al., J. Exp. Med.180:2353 (1994)), and measurement of class I MHC stabilization or assembly (e.g., Ljunggren et al., Nature 346:476 (1990); Schumacher et al., Cell 62:563 (1990); Townsend et al., Cell 62:285 (1990); Parker et al., J. Immunol.149:1896 (1992)).

[0261] The term “derived” when used to discuss an epitope is a synonym for “prepared.” Aderived epitope can be isolated from a natural source, or it can be synthesized according to standard protocols in the art. Synthetic epitopes can comprise artificial amino acid residues “amino acid mimetics,” such as D isomers of natural occurring L amino acid residues or non- natural amino acid residues such as cyclohexylalanine. A derived or prepared epitope can be an analog of a native epitope. The term “derived from” refers to the origin or source, and may include naturally occurring, recombinant, unpurified, purified or differentiated molecules or cells. For example, an expanded or induced antigen specific T cell may be derived from a T cell. For example, an expanded or induced antigen specific T cell may be derived from an antigen specific T cell in a biological sample. For example, a matured APC (e.g., a professional APC) may be derived from a non-matured APC (e.g., an immature APC). For example, an APC may be derived from a monocyte (e.g., a CD14+monocyte). For example, a dendritic cell may be derived from a monocyte (e.g., a CD14+monocyte). For example, an APC may be derived from a bone marrow cell.

[0262] An “epitope” is the collective features of a molecule (e.g., a peptide’s charge andprimary, secondary and tertiary structure) that together form a site recognized by another molecule (e.g., an immunoglobulin, T cell receptor, HLA molecule, or chimeric antigen receptor). For example, an epitope can be a set of amino acid residues involved in recognitionWSGR Docket No.: 50401-787.601 by a particular immunoglobulin; a Major Histocompatibility Complex (MHC) receptor; or in the context of T cells, those residues recognized by a T cell receptor protein and / or a chimeric antigen receptor. Epitopes can be prepared by isolation from a natural source, or they can be synthesized according to standard protocols in the art. Synthetic epitopes can comprise artificial amino acid residues, amino acid mimetics, (such as D isomers of naturally-occurring L amino acid residues or non-naturally-occurring amino acid residues). Throughout this disclosure, epitopes may be referred to in some cases as peptides or peptide epitopes. In certain embodiments, there is a limitation on the length of a peptide of the present disclosure. The embodiment that is length-limited occurs when the protein or peptide comprising an epitope described herein comprises a region (i.e., a contiguous series of amino acid residues) having 100% sequence identity with a native sequence. In order to avoid the definition of epitope from reading, e.g., on whole natural molecules, there is a limitation on the length of any region that has 100% sequence identity with a native peptide sequence. Thus, for a peptide comprising an epitope described herein and a region with 100% sequence identity with a native peptide sequence, the region with 100% sequence identity to a native sequence generally has a length of: less than or equal to 600 amino acid residues, less than or equal to 500 amino acid residues, less than or equal to 400 amino acid residues, less than or equal to 250 amino acid residues, less than or equal to 100 amino acid residues, less than or equal to 85 amino acid residues, less than or equal to 75 amino acid residues, less than or equal to 65 amino acid residues, and less than or equal to 50 amino acid residues. In certain embodiments, an “epitope” described herein is comprised by a peptide having a region with less than 51 amino acid residues that has 100% sequence identity to a native peptide sequence, in any increment down to 5 amino acid residues; for example 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues.

[0263] A “T cell epitope” refers to a peptide sequence bound by an MHC molecule in the formof a peptide-MHC (pMHC) complex. A peptide-MHC complex can be recognized and bound by a TCR of a T cell (e.g., a cytotoxic T-lymphocyte or a T-helper cell).

[0264] A “T cell” includes CD4+ T cells and CD8+ T cells. The term T cell also includes bothT helper 1 type T cells and T helper 2 type T cells. T cells may be generated by the method described in the application, for a clinical application. T cells or adoptive T cells referred to here, such as for a clinical application are cells isolated from a biological source, manipulated and cultured ex vivo and prepared into a drug candidate for a specific therapy such as a cancer, e.g., melanoma. When drug candidate cells pass specific qualitative and quantitative criteriaWSGR Docket No.: 50401-787.601 for fitness for a clinical application, the drug candidate may be designated a drug product. In some cases, a drug product is selected from a number of drug candidates. In the context of this application, a drug product is a T cell, more specifically, a population of T cells, or more specifically a population of T cells with heterogeneous characteristics and subtypes. For example, a drug product, as disclosed herein may have a population of T cells comprising CD8+ T cells, CD4+ T cells, with cells at least above a certain exhibiting antigen specificity, a certain percentage of each exhibiting a memory phenotype, among others.

[0265] An “immune cell” refers to a cell that plays a role in the immune response. Immunecells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0266] An “immunogenic” peptide or an “immunogenic” epitope or an “immunogenic”peptide epitope is a peptide that binds to an HLA molecule and induces a cell-mediated or humoral response, for example, a cytotoxic T lymphocyte (CTL) response, a helper T lymphocyte (HTL) response and / or a B lymphocyte response. Immunogenic peptides described herein are capable of binding to an HLA molecule and thereafter induce a cell-mediated or humoral response (e.g., a CTL (cytotoxic) response, or a HTL response) to the peptide.

[0267] A “protective immune response” or “therapeutic immune response” refers to a CTLand / or an HTL response to an antigen derived from a pathogenic antigen (e.g., a tumor antigen), which in some way prevents or at least partially arrests disease symptoms, side effects or progression. The immune response can also include an antibody response which has been facilitated by the stimulation of helper T cells.

[0268] A “T cell receptor” (“TCR”) refers to a molecule, whether natural or partly or whollysynthetically produced, found on the surface of T lymphocytes (T cells) that recognizes an antigen bound to a major histocompatibility complex (MHC) molecule. The ability of a T cells to recognize an antigen associated with various diseases (e.g., cancers) or infectious organisms is conferred by its TCR, which is made up of DNA, which employs a unique mechanism for generating the tremendous diversity of the TCR. This multi-subunit immune recognition receptor associates with the CD3 complex and binds peptides presented by the MHC class I and II proteins on the surface of antigen-presenting cells (APCs). Binding of a TCR to a peptide on an APC is a central event in T cell activation.

[0269] As used herein, a “chimeric antigen receptor” or “CAR” refers to an antigen bindingprotein in that includes an immunoglobulin antigen binding domain (e.g., an immunoglobulinWSGR Docket No.: 50401-787.601 variable domain) and a T cell receptor (TCR) constant domain. As used herein, a “constant domain” of a TCR polypeptide includes a membrane-proximal TCR constant domain, a TCR transmembrane domain and / or a TCR cytoplasmic domain, or fragments thereof. For example, in some embodiments, a CAR is a monomer that includes a polypeptide comprising an embodiments, the CAR is a dimer that includes a first polypeptide comprising an domain and a second polypeptide comprising an immunoglobulin heavy or light chain variable

[0270] “Major Histocompatibility Complex” or “MHC” is a cluster of genes that plays a rolein control of the cellular interactions responsible for physiologic immune responses. The terms “major histocompatibility complex” and the abbreviation “MHC” can include any class of MHC molecule, such as MHC class I and MHC class II molecules, and relate to a complex of genes which occurs in all vertebrates. In humans, the MHC complex is also known as the human leukocyte antigen (HLA) complex. Thus, a “Human Leukocyte Antigen” or “HLA” refers to a human Major Histocompatibility Complex (MHC) protein (see, e.g., Stites, et al., Immunology, 8THEd., Lange Publishing, Los Altos, Calif. (1994). For a detailed description of the MHC and HLA complexes, see, Paul, Fundamental Immunology, 3rdEd., Raven Press, New York (1993).

[0271] The major histocompatibility complex in the genome comprises the genetic regionwhose gene products expressed on the cell surface are important for binding and presenting endogenous and / or foreign antigens and thus for regulating immunological processes. MHC proteins or molecules are important for signaling between lymphocytes and antigen presenting cells or diseased cells in immune reactions. MHC proteins or molecules bind peptides and present them for recognition by T-cell receptors. The proteins encoded by the MHC can be expressed on the surface of cells, and display both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to a T-cell. MHC binding peptides can result from the proteolytic cleavage of protein antigens and represent potential lymphocyte epitopes. (e.g., T cell epitope and B cell epitope). MHCs can transport the peptides to the cell surface and present them there to specific cells, such as cytotoxic T-lymphocytes, T-helper cells, or B cells. The MHC region can be divided into three --microglobulin (not part of the MHC encoded by chromosome 15). They can present antigenfragments to cytotoxic T-cells. MHC class II proteins c - -chains and they canWSGR Docket No.: 50401-787.601 present antigen fragments to T-helper cells. MHC class III region can encode for other immune components, such as complement components and cytokines. The MHC can be both polygenic (there are several MHC class I and MHC class II genes) and polymorphic (there are multiple alleles of each gene).

[0272] A “receptor” refers to a biological molecule or a molecule grouping capable of bindinga ligand. A receptor may serve, to transmit information in a cell, a cell formation or an organism. A receptor comprises at least one receptor unit, for example, where each receptor unit may consist of a protein molecule. A receptor has a structure which complements that of a ligand and may complex the ligand as a binding partner. The information is transmitted in particular by conformational changes of the receptor following complexation of the ligand on the surface of a cell. In some embodiments, a receptor is to be understood as meaning in particular proteins of MHC classes I and II capable of forming a receptor / ligand complex with a ligand, in particular a peptide or peptide fragment of suitable length. A “ligand” refers to a molecule which has a structure complementary to that of a receptor and is capable of forming a complex with this receptor. In some embodiments, a ligand is to be understood as meaning a peptide or peptide fragment which has a suitable length and suitable binding motifs in its amino acid sequence, so that the peptide or peptide fragment is capable of forming a complex with MHC proteins such as MHC class I or MHC class II proteins. In some embodiments, a “receptor / ligand complex” is also to be understood as meaning a “receptor / peptide complex” or “receptor / peptide fragment complex”, including a peptide- or peptide fragment-presenting MHC molecule such as MHC class I or MHC class II molecules.

[0273] A “native” or a “wild type” sequence refers to a sequence found in nature. The term“naturally occurring” as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.

[0274] The terms “peptide” and “peptide epitope” are used interchangeably with“oligopeptide” in the present specification to designate a series of residues connected one to -amino and carboxyl groups of adjacent amino acid residues. A “synthetic peptide” refers to a peptide that is obtained from a non- natural source, e.g., is man-made. Such peptides can be produced using such methods as chemical synthesis or recombinant DNA technology. “Synthetic peptides” include “fusion proteins.”WSGR Docket No.: 50401-787.601

[0275] The term “motif” refers to a pattern of residues in an amino acid sequence of definedlength, for example, a peptide of less than about 15 amino acid residues in length, or less than about 13 amino acid residues in length, for example, from about 8 to about 13 amino acid residues (e.g., 8, 9, 10, 11, 12, or 13) for a class I HLA motif and from about 6 to about 25 amino acid residues (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) for a class II HLA motif, which is recognized by a particular HLA molecule. Motifs are typically different for each HLA protein encoded by a given human HLA allele. These motifs differ in their pattern of the primary and secondary anchor residues. In some embodiments, an MHC class I motif identifies a peptide of 7, 89, 10, 11, 12 or 13 amino acid residues in length. In some embodiments, an MHC class II motif identifies a peptide of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 amino acid residues in length. A “cross-reactive binding” peptide refers to a peptide that binds to more than one member of a class of a binding pair members (e.g., a peptide bound by both a class I HLA molecule and a class II HLA molecule).

[0276] The term “residue” refers to an amino acid residue or amino acid mimetic residueincorporated into a peptide or protein by an amide bond or amide bond mimetic, or that is encoded by a nucleic acid (DNA or RNA). The nomenclature used to describe peptides or proteins follows the conventional practice. The amino group is presented to the left (the amino- or N-terminus) and the carboxyl group to the right (the carboxy- or C-terminus) of each amino acid residue. When amino acid residue positions are referred to in a peptide epitope, they are numbered in an amino to carboxyl direction with the first position being the residue located at the amino terminal end of the epitope, or the peptide or protein of which it can be a part. In the formulae representing selected specific embodiments of the present disclosure, the amino- and carboxyl-terminal groups, although not specifically shown, are in the form they can assume at physiologic pH values, unless otherwise specified. In the amino acid structure formulae, each residue is generally represented by standard three letter or single letter designations. The L- form of an amino acid residue is represented by a capital single letter or a capital first letter of a three-letter symbol, and the D-form for those amino acid residues having D-forms is represented by a lower case single letter or a lower case three letter symbol. However, when three letter symbols or full names are used without capitals, they can refer to L amino acid residues. Glycine has no asymmetric carbon atom and is simply referred to as “Gly” or “G”. The amino acid sequences of peptides set forth herein are generally designated using the standard single letter symbol. (A, Alanine; C, Cysteine; D, Aspartic Acid; E, Glutamic Acid; F, Phenylalanine; G, Glycine; H, Histidine; I, Isoleucine; K, Lysine; L, Leucine; M,WSGR Docket No.: 50401-787.601 Methionine; N, Asparagine; P, Proline; Q, Glutamine; R, Arginine; S, Serine; T, Threonine; V, Valine; W, Tryptophan; and Y, Tyrosine.)

[0277] A “conservative amino acid substitution” is one in which one amino acid residue isreplaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is a conservative substitution. Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate peptide function are well-known in the art.

[0278] “Pharmaceutically acceptable” refers to a generally non-toxic, inert, and / orphysiologically compatible composition or component of a composition. A “pharmaceutical excipient” or “excipient” comprises a material such as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like. A “pharmaceutical excipient” is an excipient which is pharmaceutically acceptable.

[0279] According to the present disclosure, the term “vaccine” relates to a pharmaceuticalpreparation (pharmaceutical composition) or product that upon administration induces an immune response, for example, a cellular or humoral immune response, which recognizes and attacks a pathogen or a diseased cell such as a cancer cell. A vaccine may be used for the prevention or treatment of a disease. The term “individualized cancer vaccine” or “personalized cancer vaccine” “personal cancer vaccine” concerns a particular cancer patient and means that a cancer vaccine is adapted to the needs or special circumstances of an individual cancer patient.

[0280] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein andrefer to polymers of nucleotides of any length, and include DNA and RNA, for example, mRNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. In some embodiments, the polynucleotide and nucleic acid can be in vitro transcribed mRNA. In some embodiments, the polynucleotide that is administered using the methods of the present disclosure is mRNA.WSGR Docket No.: 50401-787.601

[0281] The terms “isolated” or “biologically pure” refer to material which is substantially oressentially free from components which normally accompany the material as it is found in its native state. Thus, isolated peptides described herein do not contain some or all of the materials normally associated with the peptides in their in situ environment. For example, an “isolated” epitope can be an epitope that does not include the whole sequence of the protein from which the epitope was derived. For example, a naturally-occurring polynucleotide or peptide present in a living animal is not isolated, but the same polynucleotide or peptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such a polynucleotide could be part of a vector, and / or such a polynucleotide or peptide could be part of a composition, and still be “isolated” in that such vector or composition is not part of its natural environment. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules described herein, and further include such molecules produced synthetically. In some embodiments, a polypeptide, antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure. The term “substantially pure” as used herein refers to material which is at least 50% pure (i.e., free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.

[0282] The terms “identical” or percent “identity” in the context of two or more nucleic acidsor polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof. In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 40-60 residues, at least about 60-80 residues in length or any integral value there between. In some embodiments, identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over theWSGR Docket No.: 50401-787.601 full length of the sequences being compared, such as an amino acid sequence of a peptide or a coding region of a nucleotide sequence.

[0283] The term “subject” refers to any animal (e.g., a mammal), including, but not limited to,humans, non-human primates, canines, felines, rodents, and the like, which is to be the recipient of a particular treatment. Typically, the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.

[0284] The terms “effective amount” or “therapeutically effective amount” or “therapeuticeffect” refer to an amount of a therapeutic effective to “treat” a disease or disorder in a subject or mammal. The therapeutically effective amount of a drug has a therapeutic effect and as such can prevent the development of a disease or disorder; slow down the development of a disease or disorder; slow down the progression of a disease or disorder; relieve to some extent one or more of the symptoms associated with a disease or disorder; reduce morbidity and mortality; improve quality of life; or a combination of such effects.

[0285] The terms “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” referto both (1) therapeutic measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic condition or disorder and (2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented.

[0286] The term “depleted” when used to describe a cell sample (e.g., a peripheral bloodmononuclear cell (PBMC) sample) refers to a cell sample in which a subpopulation of cells has been removed or depleted. For example, an immune cell sample depleted of CD25 expressing cells refers to an immune cell sample in which CD25 expressing cells have been removed or depleted. For example, one or more binding agents can be used to remove or deplete one or more cells or cell types from a sample. For example, CD14+cells can be depleted or removed from a PBMC sample, such as by using an antibody that binds to CD14.

[0287] The “stimulation” refers to a response induced by binding of a stimulatory moleculewith its cognate ligand thereby mediating a signal transduction event. For example, stimulation of a T cell can refer to binding of a TCR of a T cell to a peptide-MHC complex. For example, stimulation of a T cell can refer to a step within protocol 1 or protocol 2 in which PBMCs are cultured together with peptide loaded APCs.

[0288] The term “enriched” refers to a composition or fraction wherein an object species hasbeen partially purified such that the concentration of the object species is substantially higher than the naturally occurring level of the species in a finished product without enrichment. TheWSGR Docket No.: 50401-787.601 term “induced cell” refers to a cell that has been treated with an inducing compound, cell, or population of cells that affects the cell’s protein expression, gene expression, differentiation status, shape, morphology, viability, and the like.

[0289] A “reference” can be used to correlate and / or compare the results obtained in themethods of the present disclosure from a diseased specimen. Typically, a “reference” may be obtained on the basis of one or more normal specimens, in particular specimens which are not affected by a disease, either obtained from an individual or one or more different individuals (e.g., healthy individuals), such as individuals of the same species. A “reference” can be determined empirically by testing a sufficiently large number of normal specimens.

[0290] As used herein, a tumor unless otherwise mentioned, is a cancerous tumor, and theterms cancer and tumor are used interchangeably throughout the document. While a tumor is a cancer of solid tissue, several of the compositions and methods described herein are in principle applicable to cancers of the blood, leukemia. Overview

[0291] After infusion of T cells (e.g., ex vivo activated T cells, or T-cell receptor engineeredT cells (TCR-T cells)) into a patient with cancer, the cells can circulate until they encounter their cognate epitope, typically on a tumor cell. In the case of solid tumors, this can be challenging because the T cells can infiltrate the tumor and survive the harsh tumor microenvironment. Partly due to this challenge, infused T cell numbers and frequency may decline relatively rapidly after infusion. Additionally, the dose of infused TCR-T cells may be important in clinical response across several studies.

[0292] One strategy to support the engraftment, expansion and persistence of infused T cellsafter infusion can include administering a vaccine that encodes the target antigen. In this case, however, the vaccine design can differ and may be a determinant of the success of this approach. The vaccine may encode for the full-length protein to be presented on the surface of cells. The vaccine can alternatively be designed around the minimal epitope target of the T cells. The vaccine strings designed to lead to optimal cleavage of the target epitopes can lead to more (e.g., 10-100 times more) of the desired epitope being presented on major histocompatibility complex (MHC) molecules encoded by HLA alleles than when the full- length PRAME protein is used. This method can enable the vaccine to induce robust display of the target epitope in a patient and subsequent stimulation of transferred T cells, whereas the dose attainable with the full-length PRAME protein may be insufficient in some cases.

[0293] The vaccine may encode targets epitopes presented by MHC molecules encoded byHLA-A*02:01, HLA-B*07:02, and HLA-A*24:02. Provided herein are vaccine constructs toWSGR Docket No.: 50401-787.601 present at least the target epitope on each of these HLA alleles. There are multiple considerations, including the order of the epitopes, the number of times each epitope is encoded, the codon optimization approach, and the mRNA format. A series of in vitro and in vivo assays have been defined to prioritize and select the best vaccine design, starting by choosing the best codon optimization approach and then selecting the best order of theepitopes. This information can be used to evaluate the approach in vivo. For example, amouse model for this approach can utilize mice expressing human HLA and MHC. HLA- engineered tumor cells can also be utilized to evaluate the approach. PRAME Vaccines

[0294] The present disclosure provides PRAME vaccines comprising PRAME polypeptidesor recombinant nucleic acids encoding PRAME polypeptides that, when expressed, can result in presentation of one or more epitopes of PRAME by one or more MHC molecules encoded by one or more HLA alleles.

[0295] Provided herein is a recombinant nucleic acid encoding a PRAME polypeptidecomprising a multiepitopic polypeptide. In some embodiments, the PRAME polypeptide does not comprise a full-length PRAME polypeptide. In some embodiments, the PRAME polypeptide comprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence. In some embodiments, the PRAME polypeptide comprises a second PRAME amino acid sequence comprising a second PRAME epitope sequence. In some embodiments, the first PRAME epitope sequence and the second PRAME epitope sequence are different. In some embodiments, the first PRAME epitope sequence and the second PRAME epitope sequence are linked via a linker. In some embodiments, presentation of the first and / or second PRAME epitope sequence as a peptide:MHC complex by the antigen presenting cells (APCs) of the subject administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide is higher than the presentation of the first and / or second PRAME epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide. In some embodiments, the first PRAME amino acid sequence is the first epitope sequence. In some embodiments, the second PRAME amino acid sequence is the second epitope sequence. In some embodiments, the first PRAME amino acid sequence is the first epitope sequence and the second PRAME amino acid sequence is the second epitope sequence. In some embodiments, the first PRAME amino acidWSGR Docket No.: 50401-787.601 sequence consists of the first epitope sequence. In some embodiments, the second PRAME amino acid sequence consists of the second epitope sequence. In some embodiments, the first PRAME amino acid sequence consists of the first epitope sequence and the second PRAME amino acid sequence consists of the second epitope sequence. In some cases, each different PRAME epitope sequence is separated by a linker. In some cases, each different PRAME epitope sequence is a minimal epitope sequence.

[0296] In some embodiments, the first PRAME epitope sequence consists of from 5 to 18,from 6 to 17, from 5 to 16, from 7 to 12, or from 8 to 10 consecutive amino acids from the full length PRAME polypeptide. In some embodiments, the second PRAME epitope sequence consists of from 5 to 18, from 6 to 17, from 5 to 16, from 7 to 12, or from 8 to 10 consecutive amino acids from the full length PRAME polypeptide.

[0297] In some embodiments, the first PRAME epitope sequence consists of from 8 to 30,from 9 to 29, from 10 to 28, from 11 to 27, from 12 to 26, from 13 to 25, from 14 to 24, or from 15 to 23 consecutive amino acids from the full length PRAME polypeptide. In some embodiments, the second PRAME epitope sequence consists of from 8 to 30, from 9 to 29, from 10 to 28, from 11 to 27, from 12 to 26, from 13 to 25, from 14 to 24, or from 15 to 23 consecutive amino acids from the full length PRAME polypeptide.

[0298] In some embodiments, the first PRAME amino acid sequence and the second PRAMEamino acid sequence is separated by a linker. In some embodiments, the first PRAME amino acid sequence comprises the first PRAME epitope sequence and one, two, three, four, five or more residues flanking the N-terminus or C-terminus of the first PRAME epitope sequence from the full length PRAME polypeptide. In some embodiments, the second PRAME amino acid sequence comprises the second PRAME epitope sequence and one, two, three, four, five or more residues flanking the N-terminus or C-terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

[0299] In some embodiments the multiepitopic polypeptide does not comprise more than 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive amino acids from the full-length PRAME polypeptide. In some embodiments, the multiepitopic polypeptide does not comprise more than 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive amino acids from the full-length PRAME polypeptide.

[0300] Provided herein is a multiepitopic polypeptide comprising PRAME polypeptide or arecombinant nucleic acid encoding a PRAME polypeptide. The recombinant nucleic acid encoding the PRAME polypeptide can be an RNA sequence, such as a messenger RNA (mRNA) sequence. The RNA sequence encoding the PRAME polypeptide can comprise theWSGR Docket No.: 50401-787.601 corresponding RNA sequence of any one of the DNA sequences described herein. For example, the RNA sequence encoding the PRAME polypeptide can comprise a corresponding RNA sequence of any one of the sequences listed in Table 1. In some embodiments, the PRAME polypeptide comprises a full length PRAME polypeptide. In some embodiments, each sequence of the multiepitopic polypeptide is the same PRAME epitope sequence. In some embodiments, each sequence of the multiepitopic polypeptide is a different PRAME epitope sequence.

[0301] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding a secretory (Sec) sequence. In some embodiments, the Sec sequence is at the N terminus of the multiepitopic polypeptide. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80% , at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 74. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 74. In some embodiments, the Sec sequence is operably linked to the multiepitopic polypeptide via a linker. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 85. In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0302] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding an MHC I Trafficking Domain (MITD) sequence. In some embodiments, the sequence encoding an MITD sequence is at the C terminus of the multiepitopic polypeptide. In some embodiments, the multiepitopic polypeptide is operably linked to the MITD domain. In some embodiments, the multiepitopic polypeptide is operably linked to the MITD domain via a linker sequence. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 85. In some embodiments, the linker comprises a sequence of SEQ ID NO: 85.

[0303] In some embodiments, the multiepitopic polypeptide comprises a PRAMEpolypeptide. In some embodiments, the sequence of the multiepitopic polypeptide is the same PRAME epitope sequence. In some embodiments, the sequence of the multiepitopic polypeptide is a different PRAME epitope sequence. In some embodiments, the multiepitopic polypeptide comprises at least 2 different PRAME epitope sequences. In some embodiments,WSGR Docket No.: 50401-787.601 the multiepitopic polypeptide comprises at least 3 different PRAME epitope sequences. In some embodiments, the multiepitopic polypeptide comprises at least 4 different PRAME epitope sequences. In some embodiments, the multiepitopic polypeptide comprises at least 5 different PRAME epitope sequences. In some embodiments, the multiepitopic polypeptide comprises at least 6 different PRAME epitope sequences. In some embodiments, the multiepitopic polypeptide comprises at least 8 different PRAME epitope sequences. In some embodiments, the multiepitopic polypeptide comprises at least 9 different PRAME epitopesequences. In some embodiments, the multiepitopic polypeptide comprises at least 10 ormore different PRAME epitope sequences.

[0304] In some embodiments, the multiepitopic polypeptide comprises a first PRAMEepitope sequence, operably linked to a second PRAME epitope sequence. In some embodiments, the first PRAME epitope sequence and the second PRAME epitope sequence are the same. In some embodiments, the first PRAME epitope sequence and the second PRAME epitope sequence are different. In some embodiments, the first PRAME epitope sequence and second PRAME epitope sequence are presentable by different HLA alleles. In some embodiments, the first PRAME epitope sequence and second PRAME epitope sequence are presented by different HLA alleles. In some embodiments, the first PRAME epitope sequence and second PRAME epitope sequence are predicted to bind to different HLA alleles. In some embodiments, the first PRAME epitope sequence and second PRAME epitope sequence are predicted to be presented by different HLA alleles.

[0305] In some embodiments, a first PRAME epitope sequence binds to a first HLA allelewith a KDless than 500nM. In some embodiments, a first PRAME epitope sequence binds toa first HLA allele with a KDless than 400nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDless than 300nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele. In some embodiments, a first PRAME epitope sequence is predicted to bind to a first HLA allele. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDless than 200nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDless than 100nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDless than 50nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDless than 1nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele. In some embodiments, a first PRAME epitope sequence is predicted to bind to a second HLA allele. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KD of more than 200nM. In someWSGR Docket No.: 50401-787.601 embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 300nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 500nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 600nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 700nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 800nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 900nM. In some embodiments, a first PRAME epitope sequence binds to a second HLA allele with a KDof more than 1000nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDof less than 1nM and binds to second HLA allele with a KDof more than 200nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDof less than 50nM and binds to second HLA allele with a KDof more than 300nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDof less than 100nM and binds to second HLA allele with a KDof more than 500nM. In some embodiments, a first PRAME epitope sequence binds to a first HLA allele with a KDof less than 200 nM and binds to second HLA allele with a KDof more than 600 nM.

[0306] In some aspects, the first PRAME epitope sequence is operably linked to the secondPRAME epitope sequence. In some aspects, the first PRAME epitope sequence is operably linked to the second PRAME epitope sequence via a linker. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at leastWSGR Docket No.: 50401-787.601 95%, or 100% sequence identity to a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0307] In some embodiments, the multiepitopic polypeptide comprises a first PRAMEepitope sequence, operably linked to a second PRAME epitope sequence, operably linked to a third PRAME epitope sequence.

[0308] In some embodiments, the first PRAME epitope sequence is presentable by an HLA-A allele. In some embodiments, the first PRAME epitope sequence is presentable by HLA- A*02:01 allele. In some embodiments, the first PRAME epitope sequence is presented by HLA-A*02:01 allele. In some embodiments, the first PRAME epitope sequence binds to HLA-A*02:01 allele. In some embodiments, the first PRAME epitope sequence is predictedWSGR Docket No.: 50401-787.601 to bind to HLA-A*02:01 allele. In some embodiments, the first PRAME epitope sequence is predicted to be presented by HLA-A*02:01.

[0309] In some embodiments, the first PRAME epitope sequence is presentable by an HLA-A allele. In some embodiments, the first PRAME epitope sequence is presentable by HLA- A*24:02 allele. In some embodiments, the first PRAME epitope sequence is presented by HLA-A*24:02 allele. In some embodiments, the first PRAME epitope sequence binds to HLA-A*24:02 allele. In some embodiments, the first PRAME epitope sequence is predicted to bind to HLA-A*24:02 allele. In some embodiments, the first PRAME epitope sequence is predicted to be presented by HLA-A*24:02.

[0310] In some embodiments, the first PRAME epitope sequence is presentable by an HLA-B allele. In some embodiments, the first PRAME epitope sequence is presentable by HLA- B*07:02 allele. In some embodiments, the first PRAME epitope sequence is presented by HLA-B*07:02 allele. In some embodiments, the first PRAME epitope sequence binds to HLA-B*07:02 allele. In some embodiments, the first PRAME epitope sequence is predicted to bind to HLA-B*07:02 allele. In some embodiments, the first PRAME epitope sequence is predicted to be presented by HLA-B*07:02.

[0311] In some embodiments, the second PRAME epitope sequence is presentable by anHLA-A allele. In some embodiments, the second PRAME epitope sequence is presentable by HLA-A*02:01 allele. In some embodiments, the second PRAME epitope sequence is presented by HLA-A*02:01 allele. In some embodiments, the second PRAME epitope sequence binds to HLA-A*02:01 allele. In some embodiments, the second PRAME epitope sequence is predicted to bind to HLA-A*02:01 allele. In some embodiments, the second PRAME epitope sequence is predicted to be presented by HLA-A*02:01.

[0312] In some embodiments, the second PRAME epitope sequence is presentable by anHLA-A allele. In some embodiments, the second PRAME epitope sequence is presentable by HLA-A*24:02 allele. In some embodiments, the second PRAME epitope sequence is presented by HLA-A*24:02 allele. In some embodiments, the second PRAME epitope sequence binds to HLA-A*24:02 allele. In some embodiments, the second PRAME epitope sequence is predicted to bind to HLA-A*24:02 allele. In some embodiments, the second PRAME epitope sequence is predicted to be presented by HLA-A*24:02.

[0313] In some embodiments, the second PRAME epitope sequence is presentable by anHLA-B allele. In some embodiments, the second PRAME epitope sequence is presentable by HLA-B*07:02 allele. In some embodiments, the second PRAME epitope sequence is presented by HLA-B*07:02 allele. In some embodiments, the second PRAME epitopeWSGR Docket No.: 50401-787.601 sequence binds to HLA-B*07:02 allele. In some embodiments, the second PRAME epitope sequence is predicted to bind to HLA-B*07:02 allele. In some embodiments, the second PRAME epitope sequence is predicted to be presented by HLA-B*07:02.

[0314] In some embodiments, the third PRAME epitope sequence is presentable by an HLA-A allele. In some embodiments, the third PRAME epitope sequence is presentable by HLA- A*02:01 allele. In some embodiments, the third PRAME epitope sequence is presented by HLA-A*02:01 allele. In some embodiments, the third PRAME epitope sequence binds to HLA-A*02:01 allele. In some embodiments, the third PRAME epitope sequence is predicted to bind to HLA-A*02:01 allele. In some embodiments, the third PRAME epitope sequence is predicted to be presented by HLA-A*02:01.

[0315] In some embodiments, the third PRAME epitope sequence is presentable by an HLA-A allele. In some embodiments, the third PRAME epitope sequence is presentable by HLA- A*24:02 allele. In some embodiments, the third PRAME epitope sequence is presented by HLA-A*24:02 allele. In some embodiments, the third PRAME epitope sequence binds to HLA-A*24:02 allele. In some embodiments, the third PRAME epitope sequence is predicted to bind to HLA-A*24:02 allele. In some embodiments, the third PRAME epitope sequence is predicted to be presented by HLA-A*24:02.

[0316] In some embodiments, the third PRAME epitope sequence is presentable by an HLA-B allele. In some embodiments, the third PRAME epitope sequence is presentable by HLA- B*07:02 allele. In some embodiments, the third PRAME epitope sequence is presented by HLA-B*07:02 allele. In some embodiments, the third PRAME epitope sequence binds to HLA-B*07:02 allele. In some embodiments, the third PRAME epitope sequence is predicted to bind to HLA-B*07:02 allele. In some embodiments, the third PRAME epitope sequence is predicted to be presented by HLA-B*07:02.

[0317] In some cases, the multiepitopic polypeptide comprises the formula NT seq –(cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2])x-CT seq, where x is an integer from 1 to 50. In some cases, the multiepitopic polypeptide comprises the formula NT seq – (cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2])x-CT seq, where x is an integer from 1 to 25. In some cases, the multiepitopic polypeptide comprises the formula NT seq – (cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2])x-CT seq, where x is an integer from 1 to 10.

[0318] In some cases, the multiepitopic polypeptide comprises the formula NT seq –(cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2]-cleavable linker3-[Epitope3])x- CT seq, where x is an integer from 1 to 50. In some cases, the multiepitopic polypeptideWSGR Docket No.: 50401-787.601 comprises the formula NT seq – (cleavable linker1-[Epitope1]-cleavable linker2-[Epitope2]- cleavable linker3-[Epitope3])x-CT seq, where x is an integer from 1 to 25. In some cases, the multiepitopic polypeptide comprises the formula NT seq – (cleavable linker1-[Epitope1]- cleavable linker2-[Epitope2]-cleavable linker3-[Epitope3])x-CT seq, where x is an integer from 1 to 10. In some cases, the NT seq comprises a secretory (Sec) sequence and a N- terminal linker sequence. In some cases, the CT seq comprises a C-terminal linker and a MITD sequence. In some cases, the Epitope1 is a PRAME epitope presentable by HLA- A*02:01 allele. In some cases, the Epitope1 is a PRAME epitope presentable by HLA- B*07:02 allele. In some cases, the Epitope1 is a PRAME epitope presentable by HLA- A*24:02 allele. In some cases, the Epitope2 is a PRAME epitope presentable by HLA- A*02:01 allele. In some cases, the Epitope2 is a PRAME epitope presentable by HLA- B*07:02 allele. In some cases, the Epitope2 is a PRAME epitope presentable by HLA- A*24:02 allele. In some cases, the Epitope3 is a PRAME epitope presentable by HLA- A*02:01 allele. In some cases, the Epitope3 is a PRAME epitope presentable by HLA- B*07:02 allele. In some cases, the Epitope3 is a PRAME epitope presentable by HLA- A*24:02 allele. In some cases, the cleavable linker1, cleavable linker2, or cleavable linker3 comprise a sequence with at least 80% sequence identity to any one of SEQ ID NOs: 86, 89, 90, 91, 92, 93, 94, 95, 96 and 97. In some cases, the cleavable linker1, cleavable linker2, or cleavable linker3 comprise a sequence of any one of SEQ ID NOs: 86, 89, 90, 91, 92, 93, 94, 95, 96 and 97.

[0319] In some embodiments, the PRAME polypeptide comprises a sequence with at least60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 75.

[0320] In some embodiments, the PRAME polypeptide comprises a sequence with at least60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 78.WSGR Docket No.: 50401-787.601

[0321] In some embodiments, the PRAME polypeptide comprises a sequence with at least60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 79.

[0322] In some embodiments, the PRAME polypeptide comprises a sequence with at least60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 80.

[0323] In some embodiments, the PRAME polypeptide comprises a sequence with at least60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 108.

[0324] In some embodiments, the PRAME polypeptide comprises one or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 75.

[0325] In some embodiments, the PRAME polypeptide comprises one or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In someWSGR Docket No.: 50401-787.601 embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 78.

[0326] In some embodiments, the PRAME polypeptide comprises one or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 79.

[0327] In some embodiments, the PRAME polypeptide comprises one or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 80.

[0328] In some embodiments, the PRAME polypeptide comprises one or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 108.

[0329] In some embodiments, the PRAME polypeptide comprises two copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 90% sequence identityWSGR Docket No.: 50401-787.601 to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 75.

[0330] In some embodiments, the PRAME polypeptide comprises two copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 78.

[0331] In some embodiments, the PRAME polypeptide comprises two copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 79.

[0332] In some embodiments, the PRAME polypeptide comprises two copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 80.

[0333] In some embodiments, the PRAME polypeptide comprises two copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises two copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 108.WSGR Docket No.: 50401-787.601

[0334] In some embodiments, the PRAME polypeptide comprises three copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 75.

[0335] In some embodiments, the PRAME polypeptide comprises three copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 78.

[0336] In some embodiments, the PRAME polypeptide comprises three copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 79.

[0337] In some embodiments, the PRAME polypeptide comprises three copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 80.

[0338] In some embodiments, the PRAME polypeptide comprises three copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAMEWSGR Docket No.: 50401-787.601 polypeptide comprises three copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises three copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 108.

[0339] In some embodiments, the PRAME polypeptide comprises four copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 75.

[0340] In some embodiments, the PRAME polypeptide comprises four copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 78.

[0341] In some embodiments, the PRAME polypeptide comprises four copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 79.

[0342] In some embodiments, the PRAME polypeptide comprises four copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises four copies of aWSGR Docket No.: 50401-787.601 sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 80.

[0343] In some embodiments, the PRAME polypeptide comprises four copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises four copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 108.

[0344] In some embodiments, the PRAME polypeptide comprises five copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 75.

[0345] In some embodiments, the PRAME polypeptide comprises five copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 78.

[0346] In some embodiments, the PRAME polypeptide comprises five copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 90% sequence identityWSGR Docket No.: 50401-787.601 to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 79.

[0347] In some embodiments, the PRAME polypeptide comprises five copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 80.

[0348] In some embodiments, the PRAME polypeptide comprises five copies of a sequencewith at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises five copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 108.

[0349] In some embodiments, the PRAME polypeptide comprises six or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 75. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence of SEQ ID NO: 75.

[0350] In some embodiments, the PRAME polypeptide comprises six or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 78. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence of SEQ ID NO: 78.WSGR Docket No.: 50401-787.601

[0351] In some embodiments, the PRAME polypeptide comprises six or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 79. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence of SEQ ID NO: 79.

[0352] In some embodiments, the PRAME polypeptide comprises six or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 80. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence of SEQ ID NO: 80.

[0353] In some embodiments, the PRAME polypeptide comprises six or more copies of asequence with at least 60% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 70% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 80% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence with at least 90% sequence identity to SEQ ID NO: 108. In some embodiments, the PRAME polypeptide comprises six or more copies of a sequence of SEQ ID NO: 108.

[0354] In some embodiments, the PRAME polypeptide comprises two copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.WSGR Docket No.: 50401-787.601

[0355] In some embodiments, the PRAME polypeptide comprises three copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.

[0356] In some embodiments, the PRAME polypeptide comprises four copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.

[0357] In some embodiments, the PRAME polypeptide comprises five copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.

[0358] In some embodiments, the PRAME polypeptide comprises six copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequenceWSGR Docket No.: 50401-787.601 identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.

[0359] In some embodiments, the PRAME polypeptide comprises seven copies of amultiepitopic polypeptide. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments each copy of the multiepitopic polypeptide comprises, from N to C terminus, a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 79, operably linked to a sequence with at least 80% sequence identity to a sequence of SEQ ID NO: 78.

[0360] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 80% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 79. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 79.

[0361] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 80, operably linked to the sequence of SEQ ID NO: 79. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 108, operably linked to the sequence of SEQ ID NO: 79.

[0362] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 80% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 80 via a linker, and the sequence with at least 80% sequence identity to the sequence of SEQ IDWSGR Docket No.: 50401-787.601 NO: 80 operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 79 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 108 via a linker, and the sequence with at least 80% identity operably linked to a sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 79 via a linker.

[0363] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 80 via a linker, and the sequence of SEQ ID NO: 80 operably linked to the sequence of SEQ ID NO: 79 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 108, and the sequence of SEQ ID NO: 108 operably linked to the sequence of SEQ ID NO: 79 via a linker.

[0364] In some cases, the linker is a cleavable linker. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at leastWSGR Docket No.: 50401-787.601 95%, or 100% sequence identity to a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0365] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked toWSGR Docket No.: 50401-787.601 a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78.

[0366] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 80, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 108, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78.

[0367] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker.

[0368] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 80 via a linker, and the sequence of SEQ ID NO: 80 operably linked to the sequence of SEQ ID NO: 79 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO:WSGR Docket No.: 50401-787.601 108 via a linker, and the sequence of SEQ ID NO: 108 operably linked to the sequence of SEQ ID NO: 79 via a linker.

[0369] In some cases, the linker is a cleavable linker. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity toa sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises aWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0370] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78.

[0371] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 80, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 108, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78.

[0372] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%,WSGR Docket No.: 50401-787.601 at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 via a linker, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker.

[0373] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 80 via a linker, and the sequence of SEQ ID NO: 80 is operably linked via a linker to the sequence of SEQ ID NO: 79 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 108 via a linker, and the sequence of SEQ ID NO: 108 operably linked to the sequence of SEQ ID NO: 79 via a linker.

[0374] In some cases, the linker is a cleavable linker. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequenceWSGR Docket No.: 50401-787.601 of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0375] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 60%, at least 65%, atWSGR Docket No.: 50401-787.601 least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108.

[0376] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 80. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78, operably linked to the sequence of SEQ ID NO: 108.

[0377] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 operably to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked toa sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 operably linked to a sequence with at least 60%, at least 65%, atWSGR Docket No.: 50401-787.601 least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108 via a linker.

[0378] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 79, operably linked via a linker to the sequence of SEQ ID NO: 78, operably linked via a linker to the sequence of SEQ ID NO: 80. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 79, operably linked via a linker to the sequence of SEQ ID NO: 78, operably linked via a linker to the sequence of SEQ ID NO: 108.

[0379] In some cases, the linker is a cleavable linker. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 95. In some embodiments, theWSGR Docket No.: 50401-787.601 linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0380] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78.

[0381] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 80, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78. In some cases, the PRAME polypeptideWSGR Docket No.: 50401-787.601 comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 108, operably linked to the sequence of SEQ ID NO: 79, operably linked to the sequence of SEQ ID NO: 78.

[0382] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, asequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 80, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 via a linker, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 108, operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 via a linker, and the sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 79 operably linked to a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to the sequence of SEQ ID NO: 78 via a linker.

[0383] In some cases, the PRAME polypeptide comprises, from N terminus to C terminus,the sequence of SEQ ID NO: 80, operably linked to the sequence of SEQ ID NO: 79, via a linker, and the sequence of SEQ ID NO: 79 operably linked to the sequence of SEQ ID NO: 78 via a linker. In some cases, the PRAME polypeptide comprises, from N terminus to C terminus, the sequence of SEQ ID NO: 108, operably linked to the sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 operably linked to the sequence of SEQ ID NO: 78 via a linker.

[0384] In some cases, the linker is a cleavable linker. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,WSGR Docket No.: 50401-787.601 or 100% sequence identity to a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, atleast 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequenceof SEQ ID NO: 88. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 95. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 97. In some embodiments, the linker comprises a sequence of SEQ ID NO: 86. In some embodiments, the linker comprises a sequence of SEQ ID NO: 87. In some embodiments, the linker comprises a sequence of SEQ ID NO: 88. In some embodiments, the linker comprises a sequence of SEQ ID NO: 89. In some embodiments, the linker comprises a sequence of SEQ ID NO: 90. In some embodiments, the linker comprises a sequence of SEQ ID NO: 91. In some embodiments, the linker comprises a sequence of SEQ ID NO: 92. In some embodiments, the linker comprises a sequence of SEQ ID NO: 93. In some embodiments, the linker comprises a sequence of SEQ ID NO: 94. In some embodiments, the linker comprises a sequence of SEQ ID NO: 95.WSGR Docket No.: 50401-787.601 In some embodiments, the linker comprises a sequence of SEQ ID NO: 96. In some embodiments, the linker comprises a sequence of SEQ ID NO: 97.

[0385] In some embodiments, the PRAME polypeptide further comprises a secretory domain(Sec) sequence. In some embodiments, the Sec sequence is at the N terminus of the multiepitopic polypeptide. In some embodiments, the Sec comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 74. In some embodiments, the Sec sequence comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 74. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 74.

[0386] In some cases, the Sec sequence is operably linked to the multiepitopic polypeptide.In some cases, the Sec sequence is operably linked to the multiepitopic polypeptide via a linker. In some cases, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 85. In some cases, the linker comprises a sequence of SEQ ID NO: 85.

[0387] In some embodiments, the PRAME polypeptide comprises a sequence having at least60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the PRAME polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the PRAME polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 82. In some embodiments, the PRAME polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the PRAME polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 84.

[0388] In some embodiments, the PRAME polypeptide comprises a sequence having at least70% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the PRAME polypeptide comprises a sequence having at least 70% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the PRAME polypeptide comprises a sequenceWSGR Docket No.: 50401-787.601having at least 70% sequence identity to a sequence of SEQ ID NO: 82. In someembodiments, the PRAME polypeptide comprises a sequence having at least 70% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the PRAME polypeptide comprises a sequence having at least 70% sequence identity to a sequence of SEQ ID NO: 84.

[0389] In some embodiments, the PRAME polypeptide comprises a sequence having at least80% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the PRAME polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the PRAME polypeptide comprises a sequencehaving at least 80% sequence identity to a sequence of SEQ ID NO: 82. In someembodiments, the PRAME polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the PRAME polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 84.

[0390] In some embodiments, the PRAME polypeptide comprises a sequence having at least90% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the PRAME polypeptide comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the PRAME polypeptide comprises a sequencehaving at least 90% sequence identity to a sequence of SEQ ID NO: 82. In someembodiments, the PRAME polypeptide comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the PRAME polypeptide comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 84.

[0391] In some embodiments, the PRAME polypeptide comprises a sequence of SEQ IDNO: 77. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 81. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ IDNO: 82. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ IDNO: 83. In some embodiments, the PRAME polypeptide comprises a sequence of SEQ ID NO: 84.

[0392] Also provided herein are recombinant nucleic acids encoding multiepitopicpolypeptides.

[0393] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to aWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 4. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 4. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 70% sequence identity to a sequence of SEQ ID NO: 4. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 4. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 4. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 4.

[0394] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 38. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 38. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 70% sequence identity to a sequence of SEQ ID NO: 38. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 38. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 38. the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 38.

[0395] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more sequences with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one sequence selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%,WSGR Docket No.: 50401-787.601 at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 67.

[0396] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more sequences with at least 90% sequence identity to any one sequence selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 13. In someWSGR Docket No.: 50401-787.601 embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 44. In someembodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises asequence with at least 90% sequence identity to a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 67.

[0397] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more sequences selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 67.WSGR Docket No.: 50401-787.601

[0398] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one sequence selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, atWSGR Docket No.: 50401-787.601 least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 67.

[0399] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences with at least 90% sequence identity to any one sequence selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence with at least 90% sequence identity to a sequence of SEQ ID NO: 67.

[0400] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences selected from the groupWSGR Docket No.: 50401-787.601 consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises one or more copies of a sequence of SEQ ID NO: 67.

[0401] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two copies of one or more sequences selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 55. In some embodiments, theWSGR Docket No.: 50401-787.601 recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises two copies of a sequence of SEQ ID NO: 67.

[0402] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises three copies of one or more sequences selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of a sequence of SEQ ID NO: 67.

[0403] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises four copies of one or more sequences selected from the groupconsisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encodingWSGR Docket No.: 50401-787.601 the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of a sequence of SEQ ID NO: 67.

[0404] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises five copies of one or more sequences selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123, 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of a sequence of SEQ ID NO: 67.

[0405] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises six copies of one or more sequences selected from the group consisting of SEQ ID NOs: 9, 11, 13, 44, 46, 48, 55, 57, 59, 67, 113, 115, 117, 119, 121, 123,WSGR Docket No.: 50401-787.601 125, 127, 131, 133, 135, 137, 139, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 9. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 11. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 13. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 44. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 46. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 48. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 55. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 57. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 59. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of a sequence of SEQ ID NO: 67.

[0406] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.

[0407] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.WSGR Docket No.: 50401-787.601

[0408] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.

[0409] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence and the sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 operably linked to a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, or 67 via a linker sequence.

[0410] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence and the sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

[0411] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence and the sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 operably linked to a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

[0412] In some embodiments, the linker sequence encodes a cleavable linker. In someembodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%WSGR Docket No.: 50401-787.601 sequence identity to a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 12. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%,WSGR Docket No.: 50401-787.601 at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 60. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 70. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 12. In some embodiments, the linker sequenceWSGR Docket No.: 50401-787.601 comprises a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 60. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 70.

[0413] In some embodiments, the linker sequence comprises a sequence having at least 60%,at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of any one of SEQ ID NOs: 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0414] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence a sequence having at least 80% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140.

[0415] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to anyWSGR Docket No.: 50401-787.601 one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140.

[0416] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence of any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140.

[0417] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, via a linker sequence and the sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence.

[0418] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, via a linker sequence and the sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence.

[0419] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, via a linker sequence and the sequence of any one of SEQ IDWSGR Docket No.: 50401-787.601 NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence of any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence.

[0420] In some embodiments, the linker sequence encodes a cleavable linker. In someembodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 12. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at leastWSGR Docket No.: 50401-787.601 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 60. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence having at least 60%, at leastWSGR Docket No.: 50401-787.601 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 70. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 12. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 60. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 70. The linker sequences described herein can be designed computationally based on the adjacent or surrounding nucleotide sequences.

[0421] In some embodiments, the linker sequence comprises a sequence having at least 60%,at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of any one of SEQ ID NOs: 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0422] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%,WSGR Docket No.: 50401-787.601 at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137.

[0423] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137.

[0424] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence of any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence of any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137.

[0425] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence and the sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence.

[0426] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to anyWSGR Docket No.: 50401-787.601 one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence and the sequence having at least 90% sequence identity to any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence.

[0427] In some cases, the recombinant nucleic acid encoding the PRAME polypeptidecomprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence of any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, via a linker sequence and the sequence of any one of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence of any one of SEQ ID NO: 13, 48, 55, 117, 123, 131, and 137, via a linker sequence.

[0428] In some embodiments, the linker sequence encodes a cleavable linker. In someembodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 12. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to aWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at leastWSGR Docket No.: 50401-787.601 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 60. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 70. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 8. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 10. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 12. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 14. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 18. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 19. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 20. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 21. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 22. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 28. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 29. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 30. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 31. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 32. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 43. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 45. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 47. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 49. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 54. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 56. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 58. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 60. In some embodiments, the linker sequenceWSGR Docket No.: 50401-787.601 comprises a sequence of SEQ ID NO: 68. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 69. In some embodiments, the linker sequence comprises a sequence of SEQ ID NO: 70.

[0429] In some embodiments, the linker sequence comprises a sequence having at least 60%,at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of any one of SEQ ID NOs: 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

[0430] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide comprises at least two copies of a string of sequences. In some embodiments, each string of sequences comprises, 5’ end to 3’ end, a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140. In some embodiments, each string of sequences comprises, from 5’ end to 3’ end, a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence a sequence having at least 90% sequence identity to any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140. In some embodiments, each string of sequences comprises, from 5’ end to 3’ end, a sequence of any one of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence of any one of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence of any one of SEQ ID NO: 9, 44, 59, 115, 121, 127, 135, and 140. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises three copies of the string of sequences. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises four copies of the string of sequences. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises five copies of the string of sequences. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises six copies of the string of sequences. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprisesWSGR Docket No.: 50401-787.601 seven copies of the string of sequences. In some embodiments, the recombinant nucleic acid encoding the PRAME polypeptide comprises eight copies of the string of sequences.

[0431] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding a secretory (Sec) sequence. In some embodiments, the Sec sequence is at the 5’ end of the string of sequences. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 2. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 16. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 27. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 36. In some embodiments the Sec sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 144. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 2. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 16. In some embodiments the Sec sequence comprises of SEQ ID NO: 27. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 36. In some embodiments the Sec sequence comprises a sequence of SEQ ID NO: 144.

[0432] In some embodiments, the recombinant nucleic acid encoding the PRAMEpolypeptide further comprises a sequence encoding an MHC I Trafficking Domain (MITD) sequence. In some embodiments, the sequence encoding an MITD sequence is at the 3’ end of the string of sequences. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 6. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 23. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to aWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 34. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 40. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 51. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 62. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 72. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 128. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 142. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 143. In some embodiments the MITD sequence comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 155. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 6. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 23. In some embodiments the MITD sequence comprises of SEQ ID NO: 34. In some embodiments the MITD sequence comprises of SEQ ID NO: 40. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 51. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 62. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 72. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 128. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 142. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 143. In some embodiments the MITD sequence comprises a sequence of SEQ ID NO: 155. In some embodiments, the string of sequences is operably linked to the MITD domain. In some embodiments, the string of sequences is operably linked to the MITD domain via a linkerWSGR Docket No.: 50401-787.601 sequence. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or100% sequence identity to a sequence of SEQ ID NO: 3. In some embodiments, the linkercomprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 5. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 17. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 22. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 28. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 33. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 37. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 39. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 42. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 50. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 53. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 61. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 66. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at leastWSGR Docket No.: 50401-787.601 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 71. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 141. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 145. In some embodiments, the linker comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 154. In some embodiments, the linker comprises a sequence of SEQ ID NO: 3. In some embodiments, the linker comprises a sequence of SEQ ID NO: 5. In some embodiments, the linker comprises a sequence of SEQ ID NO: 17. In some embodiments, the linker comprises a sequence of SEQ ID NO: 22. In some embodiments, the linker comprises a sequence of SEQ ID NO: 28. In some embodiments, the linker comprises a sequence of SEQ ID NO: 33. In some embodiments, the linker comprises a sequence of SEQ ID NO: 37. In some embodiments, the linker comprises a sequence of SEQ ID NO: 39. In some embodiments, the linker comprises a sequence of SEQ ID NO: 42. In some embodiments, the linker comprises a sequence of SEQ ID NO: 50. In some embodiments, the linker comprises a sequence of SEQ ID NO: 53. In some embodiments, the linker comprises a sequence of SEQ ID NO: 61. In some embodiments, the linker comprises a sequence of SEQ ID NO: 66. In some embodiments, the linker comprises a sequence of SEQ ID NO: 71. In some embodiments, the linker comprises a sequence of SEQ ID NO: 141. In some embodiments, the linker comprises a sequence of SEQ ID NO: 145. In some embodiments, the linker comprises a sequence of SEQ ID NO: 154.

[0433] Provided herein is a recombinant nucleic acid comprising a sequence having at least60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 1. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 35. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 7. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, atWSGR Docket No.: 50401-787.601 least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 41. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 15. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 50% sequence identity to a sequence of SEQ ID NO: 52. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 24. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 63. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 64. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 26. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 65.

[0434] In some embodiments, the recombinant nucleic acid comprises a sequence having atleast 60% sequence identity to a sequence of SEQ ID NO: 1. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 35. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 7. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 41. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 15. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 52. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 24.63. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 64. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 26. In someWSGR Docket No.: 50401-787.601 embodiments, the recombinant nucleic acid comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 65.

[0435] In some embodiments, the recombinant nucleic acid comprises a sequence having atleast 80% sequence identity to a sequence of SEQ ID NO: 1. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 35. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 7. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 41. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 15. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 52. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 24. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 63. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 64. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 26. In some embodiments, the recombinant nucleic acid comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 65.

[0436] In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ IDNO: 1. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 35. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 7. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 41. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 15. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 52. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 24. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 63. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 64. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 26. In some embodiments, the recombinant nucleic acid comprises a sequence of SEQ ID NO: 65. Also provided herein is the polypeptide encoded by any of the foregoing recombinant nucleic acids.WSGR Docket No.: 50401-787.601

[0437] Provided herein is a recombinant polypeptide comprising a sequence having at least60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 73. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 82. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence of SEQ ID NO: 84.

[0438] In some embodiments, the recombinant polypeptide comprises a sequence having atleast 60% sequence identity to a sequence of SEQ ID NO: 73. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 82. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the recombinant polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 84.

[0439] In some embodiments, the recombinant polypeptide comprises a sequence having atleast 80% sequence identity to a sequence of SEQ ID NO: 73. In some embodiments, the recombinant polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 77. In some embodiments, the recombinant polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 81. In some embodiments, the recombinant polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 82. In some embodiments, the recombinantWSGR Docket No.: 50401-787.601 polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 83. In some embodiments, the recombinant polypeptide comprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 84.

[0440] In some embodiments, the recombinant polypeptide comprises a sequence of SEQ IDNO: 73. In some embodiments, the recombinant polypeptide comprises a sequence of SEQ ID NO: 77. In some embodiments, the recombinant polypeptide comprises a sequence of SEQ ID NO: 81. In some embodiments, the recombinant polypeptide comprises a sequence of SEQ ID NO: 82. In some embodiments, the recombinant polypeptide comprises asequence of SEQ ID NO: 83. In some embodiments, the recombinant polypeptide comprisesa sequence of SEQ ID NO: 84. Table 1. Recombinant Nucleic Acid Sequences Description Nucleotide Sequence SEQ IDWSGR Docket No.: 50401-787.601 GGACTCTTTATTTTTCCTTAGAGGCCGCCTGGATCWSGR Docket No.: 50401-787.601 TTTGGAAGTGACTTGTACCTGGAAGCTACCCACCWSGR Docket No.: 50401-787.601 HLA- agtctcctgcagcacctcatcgggctg 9WSGR Docket No.: 50401-787.601 Cleavable AGAAACGCG 20WSGR Docket No.: 50401-787.601 CleavableAAGCTCCGG148WSGR Docket No.: 50401-787.601 ACTCCCAGGCCGCGAGCTCGGACTCCGCTCAAGGWSGR Docket No.: 50401-787.601 GTGGACCTGTTCCTGAAAGAAGGCGCCTGCGACGWSGR Docket No.: 50401-787.601 ATGGCCTGGATGTGCTGCTGGCTCAAGAAGTGCGWSGR Docket No.: 50401-787.601 Codon CCTGTTCTTCCTGGTTAAGTACGGCGGTTCTGGCGWSGR Docket No.: 50401-787.601 Sec ATGAGAGTGATGGCCCCTCGGACACTGATCCTGC 36WSGR Docket No.: 50401-787.601 Sec ATGAGAGTGATGGCCCCTCGGACACTGATCCTGC 36WSGR Docket No.: 50401-787.601 HLA- TCTCTGCTGCAACACCTGATCGGGCTC 127WSGR Docket No.: 50401-787.601 HLA-TCTCCATCCGTGTCTCAGCTGTCTGTTCTG 113WSGR Docket No.: 50401-787.601 Cleavable GCTAATGCA 134WSGR Docket No.: 50401-787.601 HLA- TCTCCATCTGTGTCCCAGCTGAGCGTGCTG 67Table 2. PRAME Polypeptide Sequences Description Amino Acid Sequence SEQ ID NO:WSGR Docket No.: 50401-787.601 Secretory (Sec) MRVMAPRTLILLLSGALALTETWAG 74WSGR Docket No.: 50401-787.601 HLA-A24:02 LYVDSLFFL 80Table 3. Peptide Linker Sequences Description Amino Acid Sequence SEQ ID NO:WSGR Docket No.: 50401-787.601 Starting / Ending Linker GGSGGGGSGG 85Immune Cells

[0441] The present disclosure provides immune cells (e.g., T cells) expressing a T cellreceptor (TCR) or a chimeric antigen receptor. T cell receptors can also comprise endogenousT cell receptors that have been activated. Immune cells expressing a TCR can be activated and / or expanded using methods such as NEO-STIM. T cell receptors can comprise receptors encoded by recombinant nucleic acids that are specific for a PRAME polypeptide or fragment thereof.

[0442] Provided herein is a recombinant nucleic acid encoding a TCR. In someembodiments, the TCR comprises a TCR beta chain construct. In some embodiments the TCR comprises a TCR alpha chain construct. In some embodiments, the TCR comprises a TCR beta chain construct and a TCR alpha chain construct. In some embodiments, the TCR binds to a peptide:MHC complex. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 5 consecutive amino acids of a sequence according to SEQ ID NO: 78 and a human MHC encoded by the HLA-A*02:01 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 78 and a human MHC encoded by the HLA-A*02:01 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 5 consecutive amino acids of a sequence according to SEQ ID NO: 79 and a human MHC encoded by the HLA-B*07:02 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 79 and a human MHC encoded by the HLA-B*07:02 allele. In some embodiments,WSGR Docket No.: 50401-787.601 the peptide:MHC complex comprises a PRAME epitope sequence having at least 5 consecutive amino acids of a sequence according to SEQ ID NO: 80 and a human MHC encoded by the HLA-A*24:02 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 80 and a human MHC encoded by the HLA-A*24:02 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 5 consecutive amino acids of a sequence according to SEQ ID NO: 108 and a human MHC encoded by the HLA-A*24:02 allele. In some embodiments, the peptide:MHC complex comprises a PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 108 and a human MHC encoded by the HLA-A*24:02 allele. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 79. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 80. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 108. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 78. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 79. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 80. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 108. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence according to SEQ ID NO: 78. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence according to SEQ ID NO: 79. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence according to SEQ ID NO: 80. In some embodiments the peptide:MHC complex comprises the PRAME epitope sequence having a sequence according to SEQ ID NO: 108.WSGR Docket No.: 50401-787.601

[0443] Also provided herein is a cell comprising the recombinant nucleic acids presentedherein. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a myeloid lineage cell. In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is a B cell. In some embodiments, the cell is a T cell. In some cases, upon binding of the TCR to the peptide:MHC complex, the cell produces a proinflammatory cytokine. In some cases, the proinflammatory cytokine is IFN-cytokine is TNF- cases, the proinflammatory cytokine is IL-12. In some cases, theproinflammatory cytokine is IL-6. In some cases, the proinflammatory cytokine is IL-17. In some embodiments, the proinflammatory cytokine is a chemokine. In some cases, upon binding of the TCR to the peptide:MHC complex, cell division is increased. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 2% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 5% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 10% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 15% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 25% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 50% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 100% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 150% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. InWSGR Docket No.: 50401-787.601 some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 200% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex. In some embodiments, upon binding of the TCR to the peptide:MHC complex, cytotoxicity of the cell against target cell is increased by 500% or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex.

[0444] Also provided herein is a recombinant nucleic acid encoding a TCR comprising aTCR beta chain construct. In some embodiments, the recombinant nucleic acid encoding a TCR comprises a TCR alpha chain construct. In some embodiments, the beta chain construct comprises a complementarity determining region 3 (CDR3). In some embodiments, the beta chain CDR3 comprises a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to an amino acid sequence set forth in SEQ ID NO: 103. In some embodiments, the beta chain CDR3 comprises an amino acid sequence set forth in SEQ ID NO: 103. In some embodiments, the TCR beta chain construct comprises a variable region comprising a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to identity to an amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the TCR beta chain construct comprises a variable region comprising a sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the TCR beta chain construct comprises a variable region comprising an amino acid sequence set forth in SEQ ID NO: 106. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to an amino acid sequence set forth in SEQ ID NO: 101 and a complementarity determining region 2 (CDR2) having an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to an amino acid sequence set forth in SEQ ID NO: 102. In some embodiments, the TCR beta chain construct comprises a complementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 101 and a complementarity determining region 2 (CDR2) having an amino acid set forth in SEQID NO: 102. In some embodiments, the TCR alpha chain construct comprises a CDR1, aCDR2, and a CDR3. In some embodiments, the CDR1 comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, atWSGR Docket No.: 50401-787.601 least 90%, at least 95%, or 100% sequence identity to a sequence set forth in SEQ ID NO: 98, the CDR2 comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to identity toa sequence set forth in SEQ ID NO: 99, and the CDR3 comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to a sequence set forth in SEQ ID NO: 100. In some embodiments, the CDR1 comprises an amino acid sequence set forth in SEQ ID NO: 98, the CDR2 comprises an amino acid sequence set forth in SEQ ID NO: 99,and the CDR3 comprises an amino acid sequence set forth in SEQ ID NO: 100. In someembodiments, the TCR alpha chain construct comprises a variable region comprising a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to identity to an amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the TCR alpha chain construct comprises a variable region comprising a sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the TCR alpha chain construct comprises a variable region comprising an amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the TCR comprises a beta chain having an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 107 and an alpha chain having an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 105. In some embodiments, the TCR comprises a beta chain having an amino acid sequence that is at least 80% identical to SEQ ID NO: 107 and an alpha chain having an amino acid sequence that is at least 80% identical to SEQ ID NO: 105. In some embodiments, the TCR comprises a beta chain having an amino acid sequence set forth in SEQ ID NO: 107 and an alpha chain having an amino acid sequence set forth in SEQ ID NO: 105. Methods of Treatment

[0445] The methods of the disclosure can be used to treat any type of cancer known in theart. Non-limiting examples of cancers to be treated by the methods of the present disclosure can include melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone refractory prostate adenocarcinoma), pancreatic adenocarcinoma, breast cancer, colon cancer, lung cancer (e.g., non-small cell lung cancer), cutaneous melanoma, synovial sarcoma, myxoid and round cell liposarcoma, osteosarcoma,WSGR Docket No.: 50401-787.601and neuroblastoma ,esophageal cancer, squamous cell carcinoma of the head and neck, livercancer, ovarian cancer, cervical cancer, thyroid cancer, glioblastoma, glioma, leukemia, lymphoma, and other neoplastic malignancies.

[0446] Additionally, the disease or condition provided herein includes refractory or recurrentmalignancies whose growth may be inhibited using the methods of treatment of the present disclosure. In some embodiments, a cancer to be treated by the methods of treatment of the present disclosure is selected from the group consisting of carcinoma, squamous carcinoma, adenocarcinoma, sarcomata, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, fallopian tube cancer, primary peritoneal cancer, colon cancer, colorectal cancer, squamous cell carcinoma of the anogenital region, melanoma and renal cell carcinoma.

[0447] Specific examples of cancers that can be prevented and / or treated in accordance withpresent disclosure include, but are not limited to, the following: renal cancer, kidney cancer, glioblastoma multiforme, metastatic breast cancer; breast carcinoma; breast sarcoma; neurofibroma; neurofibromatosis; pediatric tumors; neuroblastoma; malignant melanoma; carcinomas of the epidermis; leukemias such as but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias such as myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia leukemias and myclodysplastic syndrome, chronic leukemias such as but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as but not limited to Hodgkin’s disease, non-Hodgkin’s disease; multiple myelomas such as but not limited to smoldering multiple myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma; Waldenstrom’s macroglobulinemia; monoclonal gammopathy of undetermined significance; benign monoclonal gammopathy; heavy chain disease; bone cancer and connective tissue sarcomas such as but not limited to bone sarcoma, myeloma bone disease, multiple myeloma, cholesteatoma-induced bone osteosarcoma, Paget’s disease of bone, osteosarcoma, chondrosarcoma, Ewing’s sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft-tissue sarcomas, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi’s sarcoma, leiomyosarcoma, liposarcoma, lymphangio sarcoma, neurilemmoma, rhabdomyosarcoma, and synovial sarcoma; brain tumors such as but not limited to, glioma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, nonglial tumor, acoustic neurinoma, craniopharyngioma, medulloblastoma, meningioma, pineocytoma, pineoblastoma, and primary brain lymphoma; breast cancer including but not limited to adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullaryWSGR Docket No.: 50401-787.601 breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget’s disease (including juvenile Paget’s disease) and inflammatory breast cancer; adrenal cancer such as but not limited to pheochromocytom and adrenocortical carcinoma; thyroid cancer such as but not limited to papillary or follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer; pancreatic cancer such as but not limited to, insulinoma, gastrinoma, glucagonoma, vipoma, somatostatin-secreting tumor, and carcinoid or islet cell tumor; pituitary cancers such as but limited to Cushing’s disease, prolactin-secreting tumor, acromegaly, and diabetes insipius; eye cancers such as but not limited to ocular melanoma such as iris melanoma, choroidal melanoma, and cilliary body melanoma, and retinoblastoma; vaginal cancers such as squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancer such as squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget’s disease; cervical cancers such as but not limited to, squamous cell carcinoma, and adenocarcinoma; uterine cancers such as but not limited to endometrial carcinoma and uterine sarcoma; ovarian cancers such as but not limited to, ovarian epithelial carcinoma, borderline tumor, germ cell tumor, and stromal tumor; cervical carcinoma; es...

Claims

WSGR Docket No.: 50401-787.601 CLAIMS WHAT IS CLAIMED IS:

1. A method of treating a subject with a disease or condition comprising administeringto the subject a therapy comprising (i) a multiepitopic polypeptide, (ii) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (iii) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide does not comprise a full-length PRAME polypeptide and comprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence and a second PRAME amino acid sequence comprising a second PRAME epitope sequence, wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different, and wherein presentation of the first and / or second PRAME epitope sequence as a peptide:MHC complex by antigen presenting cells (APCs) of the subject administered the therapy is higher than the presentation of the first and / or second PRAME epitope sequence asthe peptide:MHC complex by the APCs of a subject administered the full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

2. The method of claim 1, further comprising administering to the subject a T-cellreceptor (TCR) or a recombinant nucleic acid encoding the TCR.

3. The method of claim 1 or 2, wherein the first PRAME epitope sequence and thesecond PRAME epitope sequence is separated by a linker.

4. The method of any one of claims 1-3, wherein the first PRAME amino acid sequenceis the first epitope sequence and / or the second PRAME amino acid sequence is the second epitope sequence.

5. The method of any one of claims 1-4, wherein the first PRAME amino acid sequenceconsists of the first epitope sequence, and / or the second PRAME amino acid sequence consists of the second epitope sequence.

6. The method of any one of claims 1-5, wherein the first PRAME epitope sequenceand / or the second PRAME epitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.

7. The method of any one of claims 1-5, wherein the first PRAME epitope sequenceand / or the second PRAME epitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.WSGR Docket No.: 50401-787.6018. The method of any one of claims 1-7, wherein the first PRAME amino acid sequenceand the second PRAME amino acid sequence is separated by a linker.

9. The method of any one of claims 1-8, wherein the first PRAME amino acid sequencecomprises the first PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the first PRAME epitope sequence from the full- length PRAME polypeptide.

10. The method of any one of claims 1-9, wherein the second PRAME amino acidsequence comprises the second PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

11. The method of any one of claims 1-10, wherein the multiepitopic polypeptide doesnot comprise more than 12 or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

12. The method of any one of claims 2-11, wherein the TCR recognizes and binds to apeptide:MHC complex, the peptide:MHC complex comprising (i) the first or the second PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele.

13. A method of treating a subject with a disease or condition comprising administeringto the subject (a) a PRAME polypeptide, (b) a recombinant nucleic acid encoding the PRAME polypeptide, or (c) a cell comprising the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises a PRAME epitope sequence, wherein the subject has been previously administered a T-cell receptor (TCR) or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele.

14. A method of treating a subject with a disease or condition comprising administeringto the subject a T-cell receptor (TCR) or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) a PRAME epitope sequence, and (ii) a human MHC encoded by an HLA allele, wherein the subject has been previously administered (a) a PRAME polypeptide, (b) a recombinant nucleic acid encoding the PRAME polypeptide, or (c) a cell comprising the PRAME polypeptide or theWSGR Docket No.: 50401-787.601 recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises the PRAME epitope sequence.

15. A method of treating a subject with a disease or condition comprising,(a) administering to the subject (i) a PRAME polypeptide, (ii) a recombinantnucleic acid encoding the PRAME polypeptide, or (iii) a cell comprising the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide, wherein the PRAME polypeptide comprises a PRAME epitope sequence; and (b) administering to the subject a TCR or a recombinant nucleic acid encoding theTCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the PRAME peptide sequence, and (ii) a human MHC encoded by an HLA allele.

16. The method of claim 15, wherein administering in (a) is performed concurrently withadministering in (b).

17. The method of claim 15, wherein administering in (a) is prior to administering in (b).

18. The method of claim 15, wherein administering in (a) is subsequent to administeringin (b).

19. The method of any one of claims 13, 15 and 18, wherein the PRAME polypeptide orthe recombinant nucleic acid encoding the PRAME polypeptide is administered at least 1 day, 2 days, 5 days, 10 days, 20 days, 30 days, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years or more after the subject has been administered the TCR or the recombinant nucleic acid encoding the TCR.

20. The method of any one of claims 14, 15 and 17, wherein the TCR or the recombinantnucleic acid encoding the TCR is administered at least 1 day, 2 days, 5 days, 10 days, 20 days, 30 days, 1 month, 2 months, 3 months, 6 months, 1 year, 2 years or more after the subject has been administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide.

21. The method of any one of claims 2-20, wherein the T-cell receptor (TCR) or therecombinant nucleic acid encoding the TCR is expressed by an immune cell.

22. The method of any one of claims 2-18, wherein the TCR is a soluble TCR.

23. The method of any one of claims 2-22, further comprising administering two or moredifferent TCRs or recombinant nucleic acids encoding the two or more differentWSGR Docket No.: 50401-787.601 TCRs, and wherein the two or more different TCRs comprise a first TCR and a second TCR.

24. The method of claim 23, wherein the two or more different TCRs are expressed onsurface of two different immune cells.

25. The method of claim 23 or 24, wherein the first TCR and the second TCR bind todifferent peptide:MHC complexes, each peptide:MHC complex comprising (i) an epitope sequence and (ii) a human MHC encoded by an HLA allele.

26. The method of any one of claims 23-25, wherein the two or more different TCRs orrecombinant nucleic acids encoding the two or more different TCRs are administered separately or co-administered in a same mixture.

27. The method of any one of claims 23-26, wherein(a) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele; (b) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele; or (c) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele.

28. The method of any one of claims 13-27, wherein the PRAME polypeptide does notcomprise a full-length PRAME protein sequence.

29. The method of any one of claims 13-28, wherein the PRAME epitope sequencecomprises a sequence of SEQ ID NO: 78.

30. The method of claim 29, wherein the HLA allele is an HLA-A*02:01 allele.

31. The method of any one of claims 13-28, wherein the PRAME epitope sequencecomprises a sequence of SEQ ID NO: 79.

32. The method of claim 31, wherein the HLA allele is an HLA-B*07:02 allele.WSGR Docket No.: 50401-787.60133. The method of any one of claims 13-28, wherein the PRAME epitope sequencecomprises a sequence of SEQ ID NO: 80 or 108.

34. The method of claim 33, wherein the HLA allele is an HLA-A*24:02 allele.

35. The method of any one of claims 13-34, wherein the PRAME polypeptide comprisesa multiepitopic polypeptide, and wherein the multiepitopic polypeptide does not comprise a full-length PRAME polypeptide and comprises two or more different PRAME epitope sequences.

36. The method of claim 35, wherein the multiepitopic polypeptide comprises at least 3,4, 5, or more different PRAME epitope sequences.

37. The method of claim 35 or 36, wherein the two or more different PRAME epitopesequences are separated by linker sequences.

38. The method of any one of claims 35-37, wherein antigen presenting cells (APCs) ofthe subject administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide comprising the multiepitopic polypeptide present more of a PRAME epitope sequence as a peptide:MHC complex compared to the APCs of a subject administered a full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

39. The method of any one of claims 35-38, wherein T cells of the subject administeredthe multiepitopic polypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide exhibit increased expansion compared to T cells of a subject administered a full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

40. The method of any one of claims 35-39, wherein the multiepitopic polypeptidecomprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence and a second PRAME amino acid sequence comprising a second PRAME epitope sequence, and wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different.

41. The method of claim 40, wherein the first PRAME epitope sequence and the secondPRAME epitope sequence is separated by a linker.

42. The method of claim 40 or 41, wherein the first amino acid sequence is the firstepitope sequence and / or the second amino acid sequence is the second epitope sequence.WSGR Docket No.: 50401-787.60143. The method of any one of claims 40-42, wherein the first amino acid sequenceconsists of the first epitope sequence, and / or the second amino acid sequence consists of the second epitope sequence.

44. The method of any one of claims 40-43, wherein the first PRAME epitope sequenceand / or the second PRAME epitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.

45. The method of any one of claims 40-43, wherein the first PRAME epitope sequenceand / or the second PRAME epitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.

46. The method of any one of claims 40-45, wherein the first amino acid sequence and thesecond amino acid sequence is separated by a linker.

47. The method of any one of claims 40, 41 and 44-46, wherein the first amino acidsequence comprises the first PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the first PRAME epitope sequence from the full-length PRAME polypeptide.

48. The method of any one of claims 40, 41 and 44-47, wherein the second amino acidsequence comprises the second PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.

49. The method of any one of claims 35-48, wherein the multiepitopic polypeptide doesnot comprise more than 12 or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

50. The method of any one of claims 40-49, wherein the first PRAME epitope sequenceand the second PRAME epitope sequence are presentable by different HLA alleles, are presented by different HLA alleles, bind to different HLA alleles, are predicted to bind to different HLA alleles, or are predicted to be presented by different HLA alleles.

51. The method of any one of claims 40-50, wherein a first PRAME epitope sequence (i)binds to or is predicted to bind to a first HLA allele with a KD of less than 100 nM and (ii) to binds to or is predicted to bind to a second HLA allele with a KD of more than 500 nM.

52. The method of any one of claims 40-51, wherein the first PRAME epitope sequence isoperably linked to the second PRAME epitope sequence via a linker.WSGR Docket No.: 50401-787.60153. The method of claim 52, wherein the linker comprises a sequence selected from thegroup consisting of SEQ ID NOs: 86-96, and 97.

54. The method of any one of claims 35-53, wherein the multiepitopic polypeptidecomprises a first PRAME epitope sequence, operably linked to a second PRAME epitope sequence, operably linked to a third PRAME epitope sequence.

55. The method of claim 54, wherein (i) the first PRAME epitope sequence is presentableby HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, (ii) the second PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02.

56. The method of claim 54, wherein (i) the first PRAME epitope sequence is presentableby HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, (ii) the second PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, and (iii) the third PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele.

57. The method of claim 54, wherein (i) the first PRAME epitope sequence is presentableby HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, (ii) the second PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele.WSGR Docket No.: 50401-787.60158. The method of any one of claims 35-57, wherein the subject does not express an HLAallele that recognizes each PRAME epitope sequence of the multiepitopic polypeptide.

59. The method of any one of claims 35-58, wherein the subject only expresses HLAalleles that recognize a subset of PRAME epitope sequences of the multiepitopic polypeptide.

60. The method of any one of claims 14-57, wherein the PRAME polypeptide comprisesa sequence of SEQ ID NO: 75.

61. The method of any one of claims 14-57, wherein the PRAME polypeptide comprisesone or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

62. The method of claim 61, wherein the PRAME polypeptide comprises one or morecopies of one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

63. The method of claim 61, wherein the PRAME polypeptide comprises two, three, four,or five copies of one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

64. The method of claim 61, wherein the PRAME polypeptide comprises two, three, four,or five copies of each sequence of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

65. The method of claim 61, wherein the PRAME polypeptide comprises, from Nterminus to C terminus, a sequence of SEQ ID NO: 78, operably linked to a sequence of SEQ ID NOs: 80 or 108, and operably linked to a sequence of SEQ ID NO: 79.

66. The method of claim 65, wherein the sequence of SEQ ID NO: 78 is operably linkedto the sequence of SEQ ID NOs: 80 or 108 via a linker, and the sequence of SEQ ID NOs: 80 or 108 is operably linked to the sequence of SEQ ID NO: 79 via a linker.

67. The method of claim 66, wherein the linker is a cleavable linker.

68. The method of claim 67, wherein the linker comprises a sequence selected from thegroup consisting of SEQ ID NOs: 86-96 and 97.

69. The method of claim 61, wherein the PRAME polypeptide comprises, from Nterminus to C terminus, a sequence of SEQ ID NOs: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.WSGR Docket No.: 50401-787.60170. The method of claim 69, wherein the sequence of SEQ ID NOs: 80 or 108 is operablylinked to the sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 is operably linked to the sequence of SEQ ID NO: 78 via a linker.

71. The method of claim 70, wherein the linker is a cleavable linker.

72. The method of claim 71, wherein the linker comprises a sequence selected from thegroup consisting of SEQ ID NOs: 86-96 and 97.

73. The method of claim 61, wherein the PRAME polypeptide comprises, from Nterminus to C terminus, a sequence of SEQ ID NO: 79, operably linked to a sequence of SEQ ID NO: 78, and operably linked to a sequence of SEQ ID NOs: 80 or 108.

74. The method of claim 73, wherein the sequence of SEQ ID NO: 79 is operably linkedto the sequence of SEQ ID NO: 78 via a linker, and the sequence of SEQ ID NO: 78 is operably linked to a sequence of SEQ ID NOs: 80 or 108 via a linker.

75. The method of claim 74, wherein the linker is a cleavable linker.

76. The method of claim 75, wherein the linker comprises a sequence selected from thegroup consisting of SEQ ID NOs: 86-96 and 97.

77. The method of claim 13-76, wherein the PRAME polypeptide comprises at least twocopies of a multiepitopic polypeptide, and wherein each copy comprises, from N terminus to C terminus, a sequence of SEQ ID NOs: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

78. The method of claim 77, wherein the PRAME polypeptide comprises three copies ofthe multiepitopic polypeptide.

79. The method of claim 77, wherein the PRAME polypeptide comprises five copies ofthe multiepitopic polypeptide.

80. The method of any one of claims 13-79, wherein the PRAME polypeptide furthercomprises a secretory domain (Sec) sequence at the N terminus of the multiepitopic polypeptide.

81. The method of claim 80, wherein the Sec sequence comprises a sequence of SEQ IDNO: 74.

82. The method of claim 80 or 81, wherein the Sec sequence is operably linked to themultiepitopic polypeptide via a linker.

83. The method of claim 82, wherein the linker comprises a sequence of SEQ ID NO: 85.

84. The method of any one of claims 13-83, wherein the PRAME polypeptide furthercomprises an MHC class I trafficking domain (MITD) sequence at the C terminus of the multiepitopic polypeptide.WSGR Docket No.: 50401-787.60185. The method of claim 84, wherein the MITD sequence comprises a sequence of SEQID NO: 76.

86. The method of claim 84 or 85, wherein the multiepitopic polypeptide is operablylinked to the MITD sequence via a linker.

87. The method of claim 86, wherein the linker comprises a sequence of SEQ ID NO: 85.

88. The method of any one of claims 13-34 and 80-87, wherein the PRAME polypeptidecomprises a sequence having at least 80% sequence identity to a sequence of SEQ ID NO: 73.

89. The method of any one of claims 14-87, wherein the PRAME polypeptide comprisesa sequence having at least 80% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 77, 81, 82, 83, and 84.

90. The method of any one of claims 14-34 and 80-87, wherein the recombinant nucleicacid encoding the PRAME polypeptide comprises a sequence having at least 60% sequence identity to a sequence of SEQ ID NO: 4 or 38.

91. The method of any one of claims 13-87 and 89, wherein the recombinant nucleic acidencoding the PRAME polypeptide comprises one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

92. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises one or more copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

93. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises two, three, four, or five copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO:WSGR Docket No.: 50401-787.601 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

94. The method of any one of claims 91, wherein the recombinant nucleic acid encodingthe PRAME polypeptide comprises two, three, four, or five copies of each sequence of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

95. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.

96. The method of claim 95, wherein the sequence selected from the group consisting ofSEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

97. The method of claim 96, wherein the linker sequence encodes a cleavable linker.

98. The method of claim 97, wherein the linker sequence comprises a sequence selectedfrom the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

99. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119,WSGR Docket No.: 50401-787.601 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

100. The method of claim 99, wherein the sequence selected from the group consisting ofSEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence.

101. The method of claim 100, wherein the linker sequence encodes a cleavable linker.

102. The method of claim 101, wherein the linker sequence comprises a sequence selectedfrom the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

103. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137.

104. The method of claim 103, wherein the sequence selected from the group consisting ofSEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence.

105. The method of claim 104, wherein the linker sequence is a cleavable linker.

106. The method of claim 105, wherein the linker sequence comprises a sequence ofselected from the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

107. The method of claim 91, wherein the recombinant nucleic acid encoding the PRAMEpolypeptide comprises at least two copies of a string of sequences, and wherein eachWSGR Docket No.: 50401-787.601 string of sequences comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

108. The method of claim 107, wherein the recombinant nucleic acid encoding thePRAME polypeptide comprises three copies of the string of sequences.

109. The method of claim 107, wherein the recombinant nucleic acid encoding thePRAME polypeptide comprises five copies of the string of sequences.

110. The method of any one of claims 91-109, wherein the recombinant nucleic acidencoding the PRAME polypeptide further comprises a sequence encoding a secretory (Sec) sequence at the 5’end of the string of sequences.

111. The method of claim 110, wherein the sequence encoding the Sec sequence comprisesa sequence selected from the group consisting of SEQ ID NOs: 2, 16, 27, 36, and 144.

112. The method of claim 110 or 111, wherein the sequence encoding the Sec sequence isoperably linked to the string of sequences via a linker sequence.

113. The method of any one of claims 110-112, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37,39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

114. The method of any one of claims 91-113, wherein the recombinant nucleic acidencoding the PRAME polypeptide further comprises a sequence encoding an MITD sequence at the 3’ end of the string of sequences.

115. The method of claim 114, wherein the sequence encoding the MITD domaincomprises a sequence selected from the group consisting of SEQ ID NOs: 6, 23, 34, 40, 51, 62, 72, 128, 142, 143, and 155.

116. The method of claim 114 or 115, wherein the string of sequences is operably linked tothe sequence encoding the MITD sequence via a linker sequence.

117. The method of any one of claims 114-116, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

118. The method of any one of claims 91-117, wherein the recombinant nucleic acid iscodon-optimized.

119. The method of any one of claims 91-118, wherein the recombinant nucleic acid is anRNA.WSGR Docket No.: 50401-787.601120. The method of any one of claims 91-119, wherein the recombinant nucleic acidcomprises a sequence having at least 60% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

121. The method of any one of claims 118-120, wherein the subject expresses more of thePRAME epitope when administered with the codon-optimized recombinant nucleic acid than administered with a wild-type recombinant nucleic acid.

122. The method of any one of claims 12-121, wherein the TCR comprises a TCR betachain construct and a TCR alpha chain construct, wherein the TCR beta chain construct comprises a complementarity determining region 3 (CDR3) having an amino acid sequence set forth in SEQ ID NO: 103.

123. The method of claim 122, wherein the TCR beta chain construct comprises a variableregion having an amino acid sequence with at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 106.

124. The method of claim 122 or 123, wherein the TCR beta chain construct comprises acomplementarity determining region 1 (CDR1) having an amino acid sequence set forth in SEQ ID NO: 101 and a complementarity determining region 2 (CDR2) having an amino acid sequence set forth in SEQ ID NO: 102.

125. The method of any one of claims 122-124, wherein the TCR alpha chain constructcomprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 has an amino acid sequence set forth in SEQ ID NO: 98, the CDR2 has an amino acid sequence set forth in SEQ ID NO: 99, and the CDR3 has an amino acid sequence set forth in SEQ ID NO: 100.

126. The method of any one of claims 122-125, wherein the TCR alpha chain constructcomprises a variable region having an amino acid sequence having at least 80% sequence identity to an amino acid sequence set forth in SEQ ID NO: 104.

127. The method of any one of claims 122-126, wherein the TCR comprises: (a) a betachain having an amino acid sequence set forth in SEQ ID NO: 107, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 107, and (b) an alpha chain having an amino acid sequence set forth in SEQ ID NO: 105, or an amino acid sequence that is at least 80% identical to SEQ ID NO: 105.

128. A method of treating a subject with a disease or condition comprising administeringto the subject a therapy comprising (a) a multiepitopic polypeptide, (b) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (c) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopicWSGR Docket No.: 50401-787.601 polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence from a cancer protein and a second amino acid sequence comprising a second epitope sequence from the cancer protein, wherein the first epitope sequence and the second epitope sequence are different, wherein the first epitope sequence or the second epitope sequence are linked by a linker, wherein the multiepitopic polypeptide does not comprise the full-length cancer protein, wherein the subject has been previously treated with a TCR or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to apeptide:MHC complex, the peptide:MHC complex comprising (i) the first epitope sequence or the second epitope sequence, and (ii) a human MHC encoded by an HLA allele.

129. A method of treating a subject with a disease or condition comprising administeringto the subject a therapy comprising a TCR or a recombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) an epitope sequence from a cancer protein, and (ii) a human MHC encoded by an HLA allele, wherein the subject has been previously treated with (a) a multiepitopic polypeptide, (b) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (c) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence and a second amino acid sequence comprising a second epitope sequence, wherein the first epitope sequence and the second epitope sequence are different, wherein the first epitope sequence or the second epitope sequence are linked by a linker, wherein the multiepitopic polypeptide does not comprise the full-length cancer protein, and wherein the first epitope sequence or the second epitope sequence is the epitope sequence recognized by the TCR.

130. A method of treating a subject with a disease or condition comprisinga) administering to the subject a first therapy comprising (i) a multiepitopicpolypeptide, (ii) a recombinant nucleic acid encoding the multiepitopic polypeptide, or (iii) a cell comprising the multiepitopic polypeptide or the recombinant nucleic acid encoding the multiepitopic polypeptide, wherein the multiepitopic polypeptide comprises a first amino acid sequence comprising a first epitope sequence and a second amino acid sequence comprising a second epitope sequence, wherein the first epitope sequence and the second epitope sequence are different, wherein the firstWSGR Docket No.: 50401-787.601 epitope sequence or the second epitope sequence are linked by a linker, and wherein the multiepitopic polypeptide does not comprise the full-length cancer protein; and b) administering to the subject a second therapy comprising a TCR or arecombinant nucleic acid encoding the TCR, wherein the TCR recognizes and binds to a peptide:MHC complex, the peptide:MHC complex comprising (i) the first epitope sequence or the second epitope sequence, and (ii) a human MHC encoded by an HLA allele.

131. The method of claim 130, wherein the first therapy is administered prior to,concurrently, or subsequent to the second therapy.

132. The method of any one of claims 128-131, wherein presentation of the first and / orsecond epitope sequence as a peptide:MHC complex by antigen presenting cells (APCs) of the subject administered the therapy is higher than the presentation of the first and / or second epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

133. The method of any one of claims 128-132, wherein the cancer protein is PRAME.

134. The method of any one of claims 128-133, wherein the TCR recognizes an epitopederived from the cancer protein.

135. The method of any one of claims 128-134, further comprising administering two ormore different TCRs or recombinant nucleic acids encoding the two or more different TCRs, and wherein the two or more different TCRs comprise a first TCR and a second TCR.

136. The method of claim 135, wherein the two or more different TCRs are expressed onsurface of two different immune cells.

137. The method of claim 136, wherein the first TCR and the second TCR bind to differentpeptide:MHC complexes, each peptide:MHC complex comprising (i) an epitope sequence and (ii) a human MHC encoded by an HLA allele.

138. The method of any one of claims 135-137, wherein the two or more different TCRs orrecombinant nucleic acids encoding the two or more different TCRs are administered separately or co-administered in a same mixture.

139. The method of any one of claims 135-138, wherein(a) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitopeWSGR Docket No.: 50401-787.601 sequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele; (b) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 78 and an MHC encoded by an HLA-A*02:01 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele; or (c) the first TCR binds to a peptide:MHC complex comprising an epitopesequence of SEQ ID NO: 79 and an MHC encoded by an HLA-B*07:02 allele and the second TCR binds to a peptide:MHC complex comprising an epitope sequence of SEQ ID NO: 80 or SEQ ID NO: 108 and an MHC encoded by an HLA-A*24:02 allele.

140. The method of any one of claims 129-139, wherein antigen presenting cells (APCs) ofthe subject administered the multiepitopic polypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide present more of a epitope sequence derived from the cancer protein as a peptide:MHC complex compared to the APCs of a subject administered a full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

141. The method of any one of claims 128-140, wherein T cells of the subject administeredthe multiepitopic polypeptide or a recombinant nucleic acid encoding the multiepitopic polypeptide exhibit increased expansion compared to T cells of a subject administered a full-length cancer protein or a recombinant nucleic acid encoding the full-length cancer protein.

142. The method of any one of claims 1-141, wherein the cell is an APC.

143. The method of claim 142, wherein the APC has been incubated with the multiepitopicpolypeptide or the recombinant acid encoding the multiepitopic polypeptide.

144. The method of claim 142 or 143, wherein the multiepitopic polypeptide comprises atleast 2, 3, 4, 5, or more different epitope sequences derived from a cancer protein.

145. A recombinant nucleic acid encoding a TCR comprising:(a) a TCR beta chain construct, and (b) a TCR alpha chain construct; wherein the TCR binds to a peptide:MHC complex, the peptide:MHC complex comprisingWSGR Docket No.: 50401-787.601 (i) a PRAME epitope sequence having at least 7 consecutive amino acidsof a sequence according to SEQ ID NO: 79, and (ii) a human MHC encoded by the HLA-B*07:02 allele; or (ii) a PRAME epitope sequence having at least 7 consecutive amino acidsof a sequence according to SEQ ID NO: 80 or 108, and (ii) a human MHC encoded by the HLA-A*24:02 allele.

146. The recombinant nucleic acid of claim 145, wherein the peptide:MHC complexcomprises the PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NO: 79, and (ii) a human MHC encoded by the HLA-B*07:02 allele.

147. The recombinant nucleic acid of claim 146, wherein the peptide:MHC complexcomprises the PRAME epitope sequence having a sequence according to SEQ ID NO: 79.

148. The recombinant nucleic acid of claim 145, wherein the peptide:MHC complexcomprises the PRAME epitope sequence having at least 7 consecutive amino acids of a sequence according to SEQ ID NOs: 80 or 108, and (ii) a human MHC encoded by the HLA-A*24:02 allele.

149. The recombinant nucleic acid of claim 148, wherein the peptide:MHC complexcomprises the PRAME epitope sequence having a sequence according to SEQ ID NOs: 80 or 108.

150. A cell comprising the recombinant nucleic acid of any one of claims 145-149.

151. The cell of claim 150, wherein the cell is a T cell.

152. The cell of claim 150 or 151, wherein, upon binding of the TCR to the peptide:MHCcomplex, the cell produces a proinflammatory cytokine.

153. The cell of claim 152, wherein the proinflammatory cytokine is IFN- -2, TNF-IL-6, or IL-17.

154. The cell of any one of claims 150-152, wherein, upon binding of the TCR to thepeptide:MHC complex, cytotoxicity of the cell against target cells is increased by 25%, 50%, 100%, 150%, 200%, or more compared to an otherwise identical cell not having a TCR specific for the peptide:MHC complex.

155. A recombinant nucleic acid encoding a PRAME polypeptide comprising amultiepitopic polypeptide, wherein the multiepitopic polypeptide does not comprise a full-length PRAME polypeptide and comprises a first PRAME amino acid sequence comprising a first PRAME epitope sequence and a second PRAME amino acidWSGR Docket No.: 50401-787.601 sequence comprising a second PRAME epitope sequence, wherein the first PRAME epitope sequence and the second PRAME epitope sequence are different, and wherein the first PRAME amino acid sequence and the second PRAME amino acid sequence are linked via a linker.

156. The recombinant nucleic acid of claim 155, wherein presentation of the first and / orsecond PRAME epitope sequence as a peptide:MHC complex by antigen presenting cells (APCs) of the subject administered the PRAME polypeptide or the recombinant nucleic acid encoding the PRAME polypeptide is higher than the presentation of the first and / or second PRAME epitope sequence as the peptide:MHC complex by the APCs of a subject administered the full-length PRAME polypeptide or a recombinant nucleic acid encoding the full-length PRAME polypeptide.

157. The recombinant nucleic acid of claim 155 or 156, wherein the first PRAME aminoacid sequence is the first epitope sequence and / or the second PRAME amino acid sequence is the second epitope sequence.

158. The recombinant nucleic acid of any one of claims 155-157, wherein the first PRAMEamino acid sequence consists of the first epitope sequence, and / or the second PRAME amino acid sequence consists of the second epitope sequence.

159. The recombinant nucleic acid of any one of claims 155-158, wherein the first PRAMEepitope sequence and / or the second PRAME epitope sequence consists of from 7 to 12 consecutive amino acids from the full-length PRAME polypeptide.

160. The recombinant nucleic acid of any one of claims 155-158, wherein the first PRAMEepitope sequence and / or the second PRAME epitope sequence consists of from 13 to 25 consecutive amino acids from the full-length PRAME polypeptide.

161. The recombinant nucleic acid of any one of claims 155-160, wherein the first PRAMEepitope sequence and the second PRAME epitope sequence is separated by a linker.

162. The recombinant nucleic acid of any one of claims 155, 156 and 159-161, wherein thefirst PRAME amino acid sequence comprises the first PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the first PRAME epitope sequence from the full-length PRAME polypeptide.

163. The recombinant nucleic acid of any one of claims 155, 156 and 159-162, wherein thesecond PRAME amino acid sequence comprises the second PRAME epitope sequence and one or more residues flanking the N-terminus or the C-terminus of the second PRAME epitope sequence from the full-length PRAME polypeptide.WSGR Docket No.: 50401-787.601164. The recombinant nucleic acid of any one of claims 155-163, wherein themultiepitopic polypeptide does not comprise more than 12 or more consecutive amino acids from the full-length PRAME polypeptide, or the multiepitopic polypeptide does not comprise more than 25 or more consecutive amino acids from the full-length PRAME polypeptide.

165. The recombinant nucleic acid of any one of claims 155-164, wherein the PRAMEpolypeptide further comprises a Secretory (Sec) sequence at the N terminus of the multiepitopic polypeptide.

166. The recombinant nucleic acid of claim 165, wherein the Sec sequence comprises asequence of SEQ ID NO: 74.

167. The recombinant nucleic acid of any one of claims 155-166, wherein the Secsequence is operably linked to the multiepitopic polypeptide via a linker.

168. The recombinant nucleic acid of claim 167, wherein the linker comprises a sequenceof SEQ ID NO: 85.

169. The recombinant nucleic acid of any one of claims 155-168, wherein the PRAMEpolypeptide further comprises an MHC class I trafficking signal (MITD) sequence at the C terminus of the multiepitopic polypeptide.

170. The recombinant nucleic acid of claim 169, wherein the MITD sequence comprises asequence of SEQ ID NO: 76.

171. The recombinant nucleic acid of claim 169, wherein the multiepitopic polypeptide isoperably linked to the MITD sequence via a linker.

172. The recombinant nucleic acid of claim 171, wherein the linker comprises a sequenceof SEQ ID NO: 85.

173. The recombinant nucleic acid of any one of claims 155-172, wherein themultiepitopic polypeptide comprises at least 3, 4, 5, or more different PRAME epitope sequences.

174. The recombinant nucleic acid of any one of claims 155-173, wherein the first PRAMEepitope sequence and the second PRAME epitope sequence are presentable by different HLA alleles, are presented by different HLA alleles, bind to different HLA alleles, are predicted to bind to different HLA alleles, or are predicted to be presented by different HLA alleles.

175. The recombinant nucleic acid of any one of claims 155-174, wherein a first PRAMEepitope sequence (i) binds to or is predicted to bind to a first HLA allele with a KD ofWSGR Docket No.: 50401-787.601 less than 100 nM and (ii) to binds to or is predicted to bind to a second HLA allele with a KD of more than 500 nM.

176. The recombinant nucleic acid of any one of claims 155-175, wherein the linkercomprises a sequence selected from the group consisting of SEQ ID NOs: 86-96 and97.

177. The recombinant nucleic acid of claim 173, wherein the multiepitopic polypeptidecomprises a first PRAME epitope sequence, operably linked to a second PRAME epitope sequence, operably linked to a third PRAME epitope sequence.

178. The recombinant nucleic acid of claim 177, wherein (i) the first PRAME epitopesequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele, (ii) the second PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02.

179. The recombinant nucleic acid of claim 177, wherein (i) the first PRAME epitopesequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele, (ii) the second PRAME epitope sequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, and (iii) the third PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented by HLA-A*02:01 allele.

180. The recombinant nucleic acid of claim 177, wherein (i) the first PRAME epitopesequence is presentable by HLA-B*07:02 allele, is presented by HLA-B*07:02, binds to HLA-B*07:02, is predicted to bind to HLA-B*07:02, or is predicted to be presented by HLA-B*07:02, (ii) the second PRAME epitope sequence is presentable by HLA-A*02:01 allele, is presented by HLA-A*02:01 allele, binds to HLA-A*02:01 allele, is predicted to bind to HLA-A*02:01 allele, or is predicted to be presented byWSGR Docket No.: 50401-787.601 HLA-A*02:01 allele, and (iii) the third PRAME epitope sequence is presentable by HLA-A*24:02 allele, is presented by HLA-A*24:02 allele, binds to HLA-A*24:02 allele, is predicted to bind to HLA-A*24:02 allele, or is predicted to be presented by HLA-A*24:02 allele.

181. The recombinant nucleic acid of any one of claims 155-177, wherein themultiepitopic polypeptide comprises the formula NT seq – (cleavable linker1- [Epitope1]-cleavable linker2-[Epitope2])x-CT seq, where x is an integer from 1 to 10.

182. The recombinant nucleic acid of any one of claims 155-177, wherein themultiepitopic polypeptide comprises the formula NT seq – (cleavable linker1- [Epitope1]-cleavable linker2-[Epitope2]-cleavable linker3-[Epitope3])x-CT seq, where x is an integer from 1 to 10.

183. The recombinant nucleic acid of claim 181 or 182, wherein the NT seq comprises aSecretory (Sec) sequence and a N-terminal linker sequence.

184. The recombinant nucleic acid of any one of claims 181-183, wherein the CT seqcomprises a C-terminal linker and a MITD sequence.

185. The recombinant nucleic acid of any one of claims 181-184, wherein the Epitope1Epitope2, or Epitope3 is selected from the group consisting of a PRAME epitope presentable by HLA-A*02:01 allele, a PRAME epitope presentable by HLA-B*07:02 allele, a PRAME epitope presentable by HLA-A*24:02 allele.

186. The recombinant nucleic acid of any one of claims 181-185, wherein the cleavablelinker1, cleavable linker2, or cleavable linker3 is selected from the group consisting of SEQ ID NOs: 86-96 and 97.

187. The recombinant nucleic acid of any one of claims 155-176, wherein the PRAMEpolypeptide comprises a sequence of SEQ ID NO: 75.

188. The recombinant nucleic acid of any one of claims 155-176, wherein the PRAMEpolypeptide comprises one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

189. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises one or more copies of one or more sequences selected from the group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

190. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises two, three, four, or five copies of one or more sequences selected from theWSGR Docket No.: 50401-787.601 group consisting of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

191. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises two, three, four, or five copies of each sequence of SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, and SEQ ID NO: 108.

192. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises, from N terminus to C terminus, a sequence of SEQ ID NO: 78, operably linked to a sequence of SEQ ID NO: 80 or 108, and operably linked to a sequence of SEQ ID NO: 79.

193. The recombinant nucleic acid of claim 192, wherein the sequence of SEQ ID NO: 78is operably linked to the sequence of SEQ ID NO: 80 or 108 via a linker, and the sequence of SEQ ID NO: 80 or 108 is operably linked to the sequence of SEQ ID NO: 79 via a linker.

194. The recombinant nucleic acid of claim 193, wherein the linker is a cleavable linker.

195. The recombinant nucleic acid of claim 194, wherein the linker comprises a sequenceof any one of SEQ ID NOs: 86-97.

196. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises, from N terminus to C terminus, a sequence of SEQ ID NO: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

197. The recombinant nucleic acid of claim 196, wherein the sequence of SEQ ID NO: 80or 108 is operably linked to the sequence of SEQ ID NO: 79 via a linker, and the sequence of SEQ ID NO: 79 is operably linked to the sequence of SEQ ID NO: 78 via a linker.

198. The recombinant nucleic acid of claim 197, wherein the linker is a cleavable linker.

199. The recombinant nucleic acid of claim 198, wherein the linker comprises a sequenceselected from the group consisting of SEQ ID NOs: 86-96 and 97.

200. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises, from N terminus to C terminus, a sequence of SEQ ID NO: 79, operably linked to a sequence of SEQ ID NO: 78, and operably linked to a sequence of SEQ ID NO: 80 or 108.

201. The recombinant nucleic acid of claim 200, wherein the sequence of SEQ ID NO: 79is operably linked to the sequence of SEQ ID NO: 78 via a linker, and the sequence ofWSGR Docket No.: 50401-787.601 SEQ ID NO: 78 is operably linked to a sequence of SEQ ID NO: 80 or 108 via a linker.

202. The recombinant nucleic acid of claim 201, wherein the linker is a cleavable linker.

203. The recombinant nucleic acid of claim 202, wherein the linker comprises a sequenceselected from the group consisting of SEQ ID NO: 86-96 and 97.

204. The recombinant nucleic acid of claim 188, wherein the PRAME polypeptidecomprises at least two copies of a multiepitopic polypeptide, and wherein each copy comprises, from N terminus to C terminus, a sequence of SEQ ID NO: 80 or 108, operably linked to a sequence of SEQ ID NO: 79, and operably linked to a sequence of SEQ ID NO: 78.

205. The recombinant nucleic acid of claim 204, wherein the PRAME polypeptidecomprises three copies of the multiepitopic polypeptide.

206. The recombinant nucleic acid of claim 204, wherein the PRAME polypeptidecomprises five copies of the multiepitopic polypeptide.

207. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises a sequence of SEQ ID NO: 4 or 38.

208. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

209. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises one or more copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.WSGR Docket No.: 50401-787.601210. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises two, three, four, or five copies of one or more sequences selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

211. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises two, three, four, or five copies of each sequence of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, and SEQ ID NO: 140.

212. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139.

213. The recombinant nucleic acid of claim 212, wherein the sequence selected from thegroup consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence.

214. The recombinant nucleic acid of claim 213, wherein the linker sequence encodes acleavable linker.

215. The recombinant nucleic acid of claim 214, wherein the linker sequence comprises asequence of selected from the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19,WSGR Docket No.: 50401-787.601 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

216. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

217. The recombinant nucleic acid of claim 216, wherein the sequence selected from thegroup consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence.

218. The recombinant nucleic acid of claim 217, wherein the linker sequence encodes acleavable linker.

219. The recombinant nucleic acid of claim 218, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

220. The recombinant nucleic acid of any one of claims 155-176 wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137.

221. The recombinant nucleic acid of claim 220, wherein the sequence selected from thegroup consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139 is operably linked to the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 via a linker sequence, and the sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140 isWSGR Docket No.: 50401-787.601 operably linked to a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137 via a linker sequence.

222. The recombinant nucleic acid of claim 221, wherein the linker sequence is a cleavablelinker.

223. The recombinant nucleic acid of claim 222, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 8, 10, 12, 14, 18, 19, 20, 21, 29, 30, 31, 32, 43, 47, 49, 54, 56, 58, 45, 68, 69, 70, 114, 116, 118, 120, 122, 124, 126, 130, 132, 134, 136, 138, 146, 147, 148, 149, 150, 151, 152, and 153.

224. The recombinant nucleic acid of any one of claims 155-176, wherein the recombinantnucleic acid encoding the PRAME polypeptide comprises at least two copies of a string of sequences, and wherein each string of sequences comprises, from 5’ end to 3’ end, a sequence selected from the group consisting of SEQ ID NOs: 13, 48, 55, 117, 123, 131, and 137, operably linked to a sequence selected from the group consisting of SEQ ID NOs: 11, 46, 57, 67, 113, 119, 125, 133, and 139, and operably linked to a sequence selected from the group consisting of SEQ ID NOs: 9, 44, 59, 115, 121, 127, 135, and 140.

225. The recombinant nucleic acid of claim 224, wherein the recombinant nucleic acidencoding the PRAME polypeptide comprises three copies of the string of sequences.

226. The recombinant nucleic acid of claim 224, wherein the recombinant nucleic acidencoding the PRAME polypeptide comprises five copies of the string of sequences.

227. The recombinant nucleic acid of any one of claims 155-226, wherein the recombinantnucleic acid encoding the PRAME polypeptide further comprises a sequence encoding a Sec sequence at the 5’ end of the string of sequences.

228. The recombinant nucleic acid of claim 227, wherein the sequence encoding the Secsequence comprises a sequence selected from the group consisting of SEQ ID NOs: 2, 16, 27, 36, and 144.

229. The recombinant nucleic acid of claim 228, wherein the sequence encoding the Secsequence is operably linked to the string of sequences via a linker sequence.

230. The recombinant nucleic acid of claim 229, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

231. The recombinant nucleic acid of any one of claims 155-230, wherein the recombinantnucleic acid encoding the PRAME polypeptide further comprises a sequence encoding an MITD sequence at the 3’ end of the string of sequences.WSGR Docket No.: 50401-787.601232. The recombinant nucleic acid of claim 231, wherein the sequence encoding the MITDsequence comprises a sequence selected from the group consisting of SEQ ID NOs: 6, 23, 34, 40, 51, 62, 72, 128, 142, 143, and 155.

233. The recombinant nucleic acid of claim 231, wherein the string of sequences isoperably linked to the sequence encoding the MITD sequence via a linker sequence.

234. The recombinant nucleic acid of claim 233, wherein the linker sequence comprises asequence selected from the group consisting of SEQ ID NOs: 3, 5, 17, 22, 28, 33, 37, 39, 42, 50, 53, 61, 66, 71, 141, 145, and 154.

235. A recombinant nucleic acid having at least 60% sequence identity to a sequenceselected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

236. A recombinant polypeptide having at least 80% sequence identity to a sequenceselected from the group consisting of SEQ ID NOs: 1, 7, 15, 24, 26, 35, 41, 52, 63, 64, and 65.

237. A polypeptide encoded by the recombinant nucleic acid of any one of claims 155-236.

238. A pharmaceutical composition comprising the recombinant nucleic acid of any one ofclaims 155-236 or the polypeptide of claim 237, and a pharmaceutically acceptable carrier.

239. The recombinant nucleic acid of any one of claims 155-236, the polypeptide of claim237, or the pharmaceutical composition of claim 238 for use in therapy.

240. Use of the recombinant nucleic acid of any one of claims 155-236, the polypeptide ofclaim 237, or the pharmaceutical composition of claim 238, in the manufacture of a medicament for the treatment of cancer in a subject in need thereof.

Images