Methods and agents to study and restore suppressed protein mobility in disease
Therapeutic agents and biosensors are used to restore and profile suppressed protein mobility in chronic and monogenic diseases, addressing reduced mobility caused by pathogenic signaling and improving cellular function.
Patent Information
- Application Number
- PCT/US2025/016895
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-22
- Filing Date
- 2025-02-21
- Publication Date
- 2025-08-28
AI Technical Summary
Chronic diseases associated with pathogenic signaling cause reduced protein mobility, leading to dysregulated cellular processes, and existing methods struggle to effectively address this issue in both chronic and monogenic diseases.
The methods involve administering therapeutic agents that increase protein mobility by reducing the effects of pathogenic stimuli, protecting surface-exposed cysteine residues, and using biosensors to measure and restore protein mobility through techniques like single particle tracking and fluorescence recovery after photobleaching.
These methods effectively restore and profile suppressed protein mobility, diagnosing and treating diseases by identifying and mitigating the effects of pathogenic stimuli, thereby improving cellular function.
Smart Images

Figure US2025016895_28082025_PF_FP_ABST
Abstract
Description
METHODS AND AGENTS TO STUDY AND RESTORE SUPPRESSED PROTEIN MOBILITY IN DISEASE RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application, U.S.S.N.63 / 556,826, filed February 22, 2024, which is incorporated herein by reference in its entirety. REFERENCETOANELECTRONICSEQUENCELISTING
[0002] The contents of the electronic sequence listing (W057170066WO00-SEQ-MOD.xml; Size: 18,607 bytes; and Date of Creation: February 21, 2025) are herein incorporated by reference in its entirety. GOVERNMENTSUPPORT
[0003] This invention was made with government support under GM144283 awarded by National Institutes of Health (NIH); under CA155258 awarded by National Institutes of Health (NIH); PHY2044895 awarded by National Science Foundation (NSF); and KL2TR002542 awarded by National Institutes of Health (NIH). The government has certain rights in this invention. BACKGROUND
[0004] Diseases associated with chronic or pathogenic signaling are a leading cause of morbidity and mortality. For prevalent syndromes such as diabetes and inflammatory disorders, the pathology typically involves a continuous and / or high-level stimulus but not necessarily a known mutation in a specific gene. In contrast with monogenic diseases where the causal link between gene mutation and disease pathology is evident, the cellular processes that have been reported to be dysregulated in each of these syndromes are diverse and include gene regulation, ribosome biosynthesis and metabolic activity. Thus, how to define hypotheses that will inform therapeutic development on the basis of such a breadth of cellular dysfunction has long vexed clinicians and research scientists.
[0005] The billions of protein molecules produced in cells must leave their site of synthesis and arrive at cellular locations where they carry out their specialized functions. In so doing, they will transit through a milieu that is densely packed with biomolecules. Recently, pathogenic signaling in certain chronic diseases was reported to cause reduced movement of receptor molecules into functional protein assemblies.1 / 81 W0571.70066WO0013645924SUMMARY
[0006] The present disclosure describes methods for treating, diagnosing, and profiling pathogenic signaling (also referred to herein as “pathogenic stimuli”) that suppresses the mobility of proteins that play essential roles in cellular functions known to be dysregulated in chronic diseases. In certain embodiments, the present disclosure describes the link between reduced protein mobility to cysteine residues in the affected proteins (e.g., insulin receptor (IR), Mediator subunit (MED1), heterochromatin protein (HP1^), or fibrillarin (FIB1)) and pathogenic signaling-related increases in excess reactive oxygen species. In certain embodiments, the present disclosure describes diverse pathogenic stimuli (e.g., high glucose, high fat, or increased levels of inflammatory cytokines) to model certain conditions (e.g., hyperglycemia, dyslipidemia, and inflammation) which produce similar suppressed (e.g., reduced or “slowed”) protein mobility phenotypes. In certain embodiments, the present disclosure describes methods for profiling suppressed protein mobility as a cellular mechanism that account for various pathogenic features of diverse chronic diseases. In certain embodiments, the present disclosure describes methods of treating a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof. In further embodiments, the present disclosure describes methods of diagnosing a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof.
[0007] The present disclosure describes methods for treating, diagnosing, and profiling of monogenic diseases where reduced protein mobility (also referred to herein as “proteolethargy”) could be operating. For example, the present disclosure describes two classes of monogenic diseases (e.g., Mendelian diseases): the first class is caused by mutations that introduce a surface-exposed cysteine, and the second class is caused by mutations that result in elevated reactive oxygen species (ROS) (Table 5 and 6, FIG.15). A skilled artisan would understand that the methods described herein could be applicable to other classes of Mendelian diseases. Thus, in various aspects, the present disclosure methods for treating, diagnosing, and / or profiling a disease or condition associated with suppressed (e.g., reduced or “slowed”) protein mobility. In certain embodiments, the methods described herein restore the mobility of proteins that has been slowed down in a disease context.
[0008] In one aspect, the present disclosure provides a method of treating a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof, the method comprising administering to the subject a therapeutic agent that increases protein mobility by reducing the effects of a pathogenic stimulus.
[0009] In one aspect, the present disclosure provides a method of treating a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof, the method comprising administering to the subject a therapeutic agent that increases protein mobility by protecting surface exposed cysteine residues on a protein of interest.2 / 81 W0571.70066WO0013645924
[0010] In another aspect, the present disclosure provides a method of restoring suppressed protein mobility of a protein in a cell, the method comprising contacting the cell with an agent (e.g., a therapeutic agent) that increases protein mobility by reducing the effects of a pathogenic stimulus.
[0011] In another aspect, the present disclosure provides a method of restoring suppressed protein mobility of a protein in a cell, the method comprising contacting the cell with an agent (e.g., a therapeutic agent) that increases protein mobility by protecting surface exposed cysteine residues on a protein of interest.
[0012] In another aspect, the present disclosure describes a method of profiling suppressed protein mobility in a cell, the method comprising: a) providing a biosensor to the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
[0013] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0014] In another aspect, the present disclosure describes a method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising: a) providing a biosensor to the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell expressing the biosensor; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and d) administering an agent to the cell, wherein the agent increases protein mobility; wherein the increase in protein mobility is indicated by recovery of protein diffusion rates and migration location of the bulk population of the biosensor in the cell treated with the agent, compared to a cell not treated with the agent, thereby confirming the suppression of protein mobility is an effect of the pathogenic stimulus.
[0015] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0016] In another aspect, the present disclosure describes a method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising:3 / 81 W0571.70066WO0013645924a) providing a biosensor to the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and wherein a decrease in protein mobility in cells subjected to the stimulus as compared to cells not subjected to the stimulus indicates that the stimulus suppresses protein mobility.
[0017] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0018] In another aspect, the present disclosure describes a method of measuring suppressed protein mobility in a cell, the method comprising: a) expressing a biosensor within the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
[0019] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0020] In another aspect, the present disclosure provides a method of diagnosing a disease or condition in a subject, the method comprising: a) providing a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) contacting the biosensor to a cell or tissue sample from the subject; and c) comparing the mobility of the biosensor between the cell or tissue sample from the subject relative to one or more non-diseased cell or tissue samples, wherein a decrease in measurement of protein mobility in the cell or tissue samples from the subject compared to measurement of protein mobility in the one or more non-diseased cell or tissue samples indicates that the subject has the disease or disorder.
[0021] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0022] In another aspect, the present disclosure describes a method of screening for an agent capable of increasing protein mobility, the method comprising:4 / 81 W0571.70066WO0013645924a) contacting a cell or tissue sample that is being treated with or has been treated with an agent with a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; and b) comparing the mobility of the biosensor in the cell or tissue sample to the mobility of the biosensor in a cell or tissue sample not treated with the agent, wherein an increase in measurement of protein mobility in the cell or tissue samples treated with the agent compared to measurement of protein mobility in a cell or tissue sample not treated with the agent indicates that the agent increases protein mobility.
[0023] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0024] In another aspect, the present disclosure describes a method of screening for an agent capable of increasing protein mobility, the method comprising: a) contacting a cell or tissue sample with an agent, wherein the cell or tissue sample expresses a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag to measure the mobility of the protein of interest; and b) comparing the mobility of the biosensor between the cell or tissue sample relative to one or more non-diseased cell or tissue samples, wherein an increase in measurement of protein mobility in the cell or tissue samples in the presence of the agent compared to measurement of protein mobility in the absence of the agent indicates that the agent increases protein mobility.
[0025] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0026] In some embodiments the cell or tissue sample is obtained from a subject suffering from a disease characterized by reduced protein mobility. In some embodiments the cell or tissue sample is subjected to a pathogenic stimulus prior to and / or while being contacted with the agent. In some embodiments the cell or tissue sample is contacted with an agent prior to and / or while being subjected to a pathogenic stimulus.
[0027] In some embodiments, the present disclosure describes an agent identified by a method described herein, capable of increasing protein mobility. In some embodiments, the identified agent may be used to treat a disease or condition in a subject in need thereof. In some embodiments, the identified agent may be used to diagnose a disease or condition in a subject in need thereof. In certain embodiments, the agent may be a therapeutic agent. In certain embodiments, the agent may be a research agent. In certain embodiments, a pharmaceutical composition comprises an agent identified using any method described herein, and a pharmaceutically acceptable carrier.5 / 81 W0571.70066WO0013645924
[0028] In another aspect, the present disclosure describes a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag. In certain embodiments, the biosensor comprises a HaloTag. In certain embodiments, the biosensor comprises a GFP-Tag. In certain embodiments, the HaloTag or GFP-Tag is modified with a linker comprising an array of cysteine residues or serine residues. In certain embodiments, the linker comprises five cysteine residues. In certain embodiments, the linker comprises five serine residues. In certain embodiments, the biosensor is used for identifying agents that restore and / or increase protein mobility of a protein associated with a chronic disease or condition. In certain embodiments, the biosensor is used for identifying agents that restore and / or increase protein mobility of a protein associated with a monogenic disease (Mendelian diseases).
[0029] In another embodiment, the present disclosure describes a biosensor comprising a HaloTag fused with a linker comprising an array of cysteine residues. In certain embodiments, the linker comprises five cysteine residues. In certain embodiments, the biosensor is used for identifying pathological stimuli that effect protein mobility of a protein associated with a chronic disease or condition.
[0030] In some aspects, the disclosure provides a nucleic acid encoding the biosensor described herein. In another aspect, the disclosure provides vectors comprising such nucleic acids. In yet another aspect, the disclosure provides cells (e.g., liver cells) that comprise a nucleic acid described herein, and / or a vector described herein. In certain embodiments, a biosensor described herein is contacted with a cell or tissue sample. In certain embodiments, a biosensor described herein is delivered to a cell or tissue sample.
[0031] In another aspect, the present disclosure describes a modified cell that expresses a biosensor described herein. In some embodiments, the modified cell is produced according to any of the methods described herein. In certain embodiments, the modified cell is a eukaryotic cell.
[0032] The foregoing concepts, and additional concepts discussed below, may be arranged in any suitable combination, as the present disclosure is not limited in this respect. Further, other advantages and novel features of the present disclosure will become apparent from the following detailed description of various non-limiting embodiments when considered in conjunction with the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosure and together with the description, provide non-limiting examples.
[0034] FIG.1A-1G shows mobility of diverse proteins in cells. (FIG.1A) Cellular compartments, biological processes and proteins examined in this study. (FIG.1B, FIG.1C) Live-cell imaging of HepG2 cells expressing HaloTag (FIG.1B) or green fluorescent protein (GFP) -tagged (FIG.1C)6 / 81 W0571.70066WO0013645924versions of the indicated proteins. Dashed lines show outline of nucleus. Scale bars are indicated. (FIG.1D) Representative tracks for movement of individual molecules as determined by single particle tracking (SPT) of HaloTag versions of the indicated proteins. Dashed lines represent outline of plasma membrane. Dashed lines represent outline of the nucleus. (FIG.1E) Complementary cumulative distribution function (CCDF) graphs of apparent diffusion coefficients as determined by SPT of the indicated proteins (n = 294, 1751, 2591, 2855, 5458 molecules for insulin receptor (IR), MED1, HP1^, FIB1, and SRSF2, respectively). (1F) Representative images of FRAP of HepG2 cells expressing GFP-tagged versions of the indicated proteins. Images before (Before), immediately following (Bleach), and after recovery (Post) are shown. Scale bars are indicated. (FIG.1G) Quantification of FRAP experiments of the indicated proteins (n=10, 11, 15, 15, 15 cells for IR, MED1, HP1^, FIB1, SRSF2, respectively). Data shown as mean ± standard error of the mean (SEM).
[0035] FIG.2A-2G shows protein mobility decreases in a model of pathogenic signaling. (FIG.2A, FIG.2B) Model for protein mobility in pathogenic signaling: individual molecules move at fast or slow speeds (FIG.2A), depending on exposure to normal or pathogenic signaling (FIG.2B). (FIG.2C) Schematic representation of cell treatments. (FIG.2D) Representative individual protein tracks as determined by SPT for the indicated proteins and experimental treatments. Scale bars are indicated. (FIG.2E) CCDF graphs of apparent diffusion coefficients as determined by SPT for the indicated proteins and experimental treatments (Normal, n = 1067, 5719, 5199, 153, 5458 molecules for IR, MED1, HP1^, FIB1, and SRSF2, respectively; Pathogenic, n = 1913, 2227, 3529, 146, 7267 molecules for IR MED1, HP1^, FIB1, and SRSF2, respectively). Mann-Whitney test was used for statistical analysis. (FIG.2F) Representative FRAP images for the indicated proteins and experimental treatments. Images before (Before), immediately following (Bleach), and after recovery (Post) are shown. Scale bars are indicated. (FIG.2G) Quantification of FRAP experiments for the indicated proteins and experimental conditions (Normal and Pathogenic, n = 16, 10, 14, 10, 20 cells each condition for IR, MED1, HP1^, FIB1, SRSF2, respectively). Data shown as mean (Normal, “A” line; Pathogenic, “B” line) ± SEM (Normal, “A” line; Pathogenic, “B”line). T-test was used for statistical analysis.
[0036] FIG.3A-3I shows how oxidative environment affects protein mobility. (FIG.3A) Increased reactive oxygen species (ROS) in pathogenic signaling (FIG.3B) Relative ratio of oxidized to reduced glutathione (GSSG / GSH) in cells treated as indicated. Data shown as mean ± SEM. T-test was used for statistical analysis. (FIG.3C) Relative GSSG / GSH ratio in cells treated with different hydrogen peroxide (H2O2) concentrations. Data shown as mean ± SEM. H2O2concentration expected to phenocopy pathogenic signaling is indicated. (FIG.2D, FIG.2G) Schematic representation of cell treatments. (FIG.2E, FIG.2H) Representative FRAP images for the indicated proteins and experimental treatments. Images before (Before), immediately following (Bleach), and after recovery (Post) are shown. (FIG.2F, FIG.2I) Quantification of FRAP experiments for the indicated proteins and experimental conditions. For (FIG.2F), 0mM and 7.5mM, n = 10 cells each condition for each7 / 81 W0571.70066WO0013645924protein. Data shown as mean (0mM, “A” line; 7.5mM, “B” line) ± SEM (0mM, “A” line; 7.5mM, “B” line). For (FIG.2I), (Pathogenic, n = 16, 10, 15, 10, 20 for IR, MED1, HP1^, FIB1, and SRSF2, respectively; Pathogenic + NAC, n = 16, 10, 15, 20, 20 for IR, MED1, HP1^, FIB1, and SRSF2. Data shown as mean (Pathogenic, “B” line; Pathogenic + NAC, “A” line) ± SEM (Pathogenic, “B” line; Pathogenic + NAC, “A” line). T-test was used for statistical analysis (FIG.2F, FIG.2I).
[0037] FIG.4A-4H shows surface-exposed cysteines sensitize proteins to oxidation-driven decrease in protein mobility. (FIG.4A) Representations of indicated proteins showing surface-exposed cysteines (red). (FIG.4B) Cartoon depicting diverse models for decreased protein mobility. Change in: effective protein mass (inter-protein crosslinking increases the effective mass decreasing mobility), protein conformation (changes in conformation that increase protein radius decrease mobility), interaction with immobile protein (interaction with an immobile protein decreases protein mobility); interaction with transporter protein (decreased interaction with a transporter protein decreases protein mobility if the transporter acts to enhance mobility); cellular viscosity (increased viscosity results in more resistance to movement decreasing mobility). (FIG.4C) Predicted normalized diffusion coefficient from simulations of a mixture of proteins with and without surface-exposed cysteines as a function of the ratio of oxidized (GSSG) to reduced (GSH) glutathione. The diffusion coefficient was normalized to the mean of all simulated data points for GSSG / GSH<10-3 (see examples). (FIG.4D, FIG.4E) Top: representation of SRSF2 fusion proteins with 5x serine (4D) (SEQ ID NO: 18) or 5x cysteine-containing regions (4E) (SEQ ID NO: 19). Bottom: quantification of FRAP data for SRSF2 fusion proteins in cells treated with the indicated experimental conditions (SRSF2-Ser, 0mM H2O2, n=13 cells, 7.5mM H2O2, n=12, Normal, n=10 cells, Pathogenic, n=10 cells; SRSF2-Cys, 0mM H2O2, n=13 cells, 7.5mM H2O2, n=13, Normal, n=10 cells, Pathogenic, n=10 cells). Data are plotted as mean ± SEM. (FIG.4F) Representation of wildtype and mutant IR fusion proteins. (FIG.4G) Quantification of FRAP data for wildtype (IR WT, n=15 cells) or Y1361C mutant IR (IR Y1361C, n=15 cells). Data are plotted as mean ± SEM. (FIG.4H) Quantification of FRAP data for Y1361C mutant IR in cells treated with (n=15 cells) or without (n=15 cells) N-acetyl cysteine (NAC). Data are plotted as mean ± SEM. T-test was used for statistical analysis (FIG.4D-4H).
[0038] FIG.5A-5F shows diverse pathogenic factors decrease protein mobility. (FIG.5A) Representations of HaloTag fusion protein (HaloTag-5xCys) (SEQ ID NO: 19). (FIG.5B) Apparent diffusion coefficient of HaloTag-Cys as determined by SPT in cells treated as indicated (n = 245, 316, 428, 560, 305 molecules for 0, 1, 3, 8 or 20mM H2O2, respectively). (FIG.5C) Apparent diffusion coefficient of HaloTag-Cys as determined by SPT in cells treated as indicated (n = 446, 173 molecules for normal and pathogenic, respectively). (FIG.5D) Cartoon depicting pathogenic stimuli. (FIG.5E) ROS quantification in cells treated as indicated. Data are plotted as mean ± SEM. Numbers of cells: normal glucose (77) vs. high glucose (67); BSA (115) vs. high fat (171); BSA (150) vs. TNFa (91); DMSO (152) vs. Etoposide (ETO, 83); control (82) vs. lipopolysaccharide (LPS, 78). (5F) Apparent diffusion coefficient of HaloTag-Cys as determined by SPT in cells treated as indicated.8 / 81 W0571.70066WO0013645924Numbers of molecules: normal glucose (1001) vs. high glucose (582); BSA (126) vs. high fat (101); BSA (265) vs. TNFa (363); DMSO (1718) vs. ETO (1804); control (1456) vs. LPS (1327). Data are plotted as means ± SEM. Mann-Whitney test was used for statistical analysis (FIG.5C, FIG.5F). T- test was used for statistical analysis (FIG.5E).
[0039] FIG.6A-6G shows cell line validation. (FIG.6A) Strategy to endogenously tag IR with HaloTag (left). Immunoblot for IR and beta actin (bActin, middle). Quantification of relative IR amount as compared to beta actin (right). Data are plotted as mean ± SEM (n= 3 biological replicates in each condition). (FIG.6B) Strategy to endogenously tag MED1 with GFP or HaloTag (left). Immunoblot for MED1 and beta actin (bActin, middle). Quantification of relative MED1 amounts as compared to beta actin (right). Data are plotted as mean ± SEM (n= 2 to 3 biological replicates in each condition). (FIG.6C) Same as (B), but for HP1α (n= 3 biological replicates in each condition). (FIG. 6D) Same as (FIG.6C), but for FIB1. (FIG.6E) Same as (FIG.6C), but for SRSF2. (FIG.6F) Viability of WT cells or cells expressing endogenous IR, MED1, HP1α, FIB1 and SRSF2 tagged with HaloTag. Data are plotted as mean ± SEM (n= 3 biological replicates in each condition). (FIG.6G) Immunofluorescence images of IR, MED1, HP1^, FIB1 and SRSF2 (green) in HepG2 cells. Dashed lines represent nuclear outline. Scale bars are indicated.
[0040] FIG.7A-7C shows the evaluation of the comparability between FRAP and SPT. (FIG.7A) logD distribution of individual molecules (histogram) fitted to either two or three gaussian functions (curves A, B, and C indicate individual gaussian functions, and the black curve is each graph is the sum of individual gaussian functions). The number of gaussian functions are decided by counting the number of humps across the logD distribution. (FIG.7B) Immobile fraction of endogenous proteins estimated from SPT dataset vs FRAP dataset. The method used for analyzing the SPT dataset is SpotOn, and the method used for analyzing the FRAP is the curve fitting into a single-exponential recovery equation. Data are plotted as mean ± SEM. (FIG.7C) Residual between the experimental FRAP process and simulated FRAP processes assuming different apparent diffusion coefficients (solid curve). The best fitted simulated FRAP of a GFP molecule (~27kDa) is achieved by assuming the apparent diffusion coefficient to be 6 ^m2 / s. The inferred apparent diffusion coefficient of a HaloTag-Jf646 (~34kDa) based on FRAP would have been 5.5 ^m2 / s. The measured apparent diffusion coefficient of HaloTag-Jf646 based on SPT is 5.3± 0.2 ^m2 / s (AVG: dashed line; SEM: shaded rectangle).
[0041] FIG.8A-8G shows control experiments for single-particle tracking (SPT). (FIG.8A) Distribution of the continuous axial detectable range of a single molecule. The distribution peaked at ~900 nm. (FIG.8B and FIG.8C) The logD distribution of individual HaloTag-alone molecules in fixed sample and live sample, respectively (histogram). The distribution can be well-fitted to a single gaussian function (solid black line). (FIG.8D) Graphical illustration of a premature stop during localization reconnection caused by assuming a too small maximumly-allowed prior apparent9 / 81 W0571.70066WO0013645924diffusion coefficient (Dmax) (left) versus a successful reconnection because of assuming a large enough Dmax(right). (FIG.8E) Graphical illustration of two reasons why the tracking of a protein may stop even if the next localization is within the 2-dimentional range defined by Dmax: (i) photobleach of the dye molecule tagged to the protein and (ii) the protein moving out of focus. (FIG.8F) Graphical illustration of why the localization reconnection may continue by mistakenly joining the trajectories of two proteins together. In this case, the number of jumps per “trajectory” will go beyond normal. (FIG.8G) Average number of jumps per trajectory at different localization density. Beyond certain localization density threshold (vertical line at ~0.01 per ^m2 per frame), the number of jumps per “trajectory” will start to increase due to the reason shown in (FIG.8F), which is associated with significant chance of ambiguous connection. The localization density range of the actual experiments for IR-Halo SPT is marked as the horizontal boxplot, which is safely below the threshold that will cause significant ambiguous connection.
[0042] FIG.9A-9B shows cellular viscosity in a model of pathogenic signaling. (FIG.9A) Quantification of FRAP data for nuclear (left) and cytoplasmic (right) GFP in HepG2 cells that were treated with normal signaling (Normal, “A”) or pathogenic signaling (Pathogenic “B”). Nuclear GFP: Normal n=16 cells, Pathogenic n=17 cells; Cytoplasmic GFP: n=15 cells for each condition. Data are plotted as mean ± SEM. (FIG.9B) Complementary Cumulative Distribution Function (CCDF) graphs of apparent diffusion coefficients as determined by SPT for nuclear (left) and cytoplasmic (right) HaloTag in HepG2 cells that were treated with normal signaling (Normal) or pathogenic signaling (Pathogenic). Nuclear HaloTag: Normal n=771 protein molecules, Pathogenic n=937 protein molecules; Cytoplasmic HaloTag: Normal n=1279 protein molecules, Pathogenic n=625 protein molecules. T-test was used for statistical analysis.
[0043] FIG.10A-10B shows the effect of an oxidative environment on nuclear GFP mobility. (FIG. 10A) Quantification of FRAP data for nuclear GFP in HepG2 cells that were treated with 0mM H2O2 or 7.5mM H2O2 (n=7 cells per condition). Data are plotted as mean ± SEM. (FIG.10B) Quantification of FRAP data for nuclear GFP in HepG2 cells previously treated with pathogenic signaling with (Pathogenic + NAC, n=17 cells) or without (Pathogenic, n=11 cells) N-acetyl cysteine. Data are plotted as mean ± SEM. T-test was used for statistical analysis.
[0044] FIG.11A-11D shows modeling of protein diffusion with increasing ROS. (FIG.11A) Normalized diffusion coefficient from simulations of a mixture of proteins with and without surface- exposed sticky patches (cysteines) as a function of the patch-patch attraction energy ^^^^^. (FIG. 11B) Fraction of surface cysteines which participate in intermolecular bonding as a function of ^^^^^, as calculated from protein dynamics simulations. (FIG.11C) Fraction of surface cysteines which participate in protein-protein disulfide bonding as a function of the steady state ratio of oxidized (GSSG) to reduced (GSH) glutathione, as calculated from a chemical reaction model. Representative GSSG / GSH ratios are reported. (FIG.11D) Fraction of simulated proteins that form a multimer of size m for simulations at three different values of ^^^^^, which correspond to three different10 / 81 W0571.70066WO0013645924GSSG / GSH ratios. All proteins are in monomeric form in a physiological range of GSSG / GSH but start to form dimers and higher order multimers at higher ratios.
[0045] FIG.12A-12D shows validation of protein mobility simulations. (FIG.12A) Attractive potential between sticky patches (surface cysteines) as a function of the inter-patch distance normalized to the patch-patch attraction radius ^^^^^^. The depth of the attractive potential, ^^^^^, controls the propensity for intermolecular disulfide bonding. (FIG.12B) Repulsive potential between protein spheres as a function of the inter-protein distance normalized to the protein diameter ^^^^^. (FIG.12C) Cartoon depicting minimum energy configurations of a trimer of proteins with a single surface cysteine, which represents an undesirable many-to-one bonding event, and a dimer, which represents a one-to-one bonding event. These configurations are determined by the equilibrium patch- patch distance d and protein-cysteine bond extension x which minimize the energy of the trimer or dimer. Simulation parameters are chosen such that trimers are energetically less favorable than dimers. (FIG.12D) Diffusion coefficient and cluster size distributions from simulations of 1000 proteins with one surface-exposed cysteine as a function of ^^^^^, normalized to the mean of the firstfive data points. At ^ ^^^^^ ^^ ^^, all proteins are in a monomeric state, but at E attr^^ ^ ^^^^^^^^ ^^, nearly all proteins form dimers. Notably none form trimers, demonstrating that the choiceof simulation hyperparameters minimizes many-to-one bonding.
[0046] FIG.13A-13C shows gain-of-cysteine mutations. (FIG.13A) Cartoons depicting wildtype (WT) and Y1361C IR. IR is represented as a dimer. Cartoon design was based on both the previously published structure of IR (PDB 6PXV) and the AlphaFold structure of the unresolved region of IR. Tyrosines are represented as blue and cysteines are represented in red. (FIG.13B) Cartoon depicting wild type (IR WT) and mutant IR (IR Y1361C and IR Y1361S; left). Quantification of FRAP data for WT (IR WT, n= 15 cells) and mutant IR (IR Y1361C, n= 16 cells; IR Y1361S, n= 15 cells; right). These experiments were performed on the same day and as a result the IR WT FRAP curves are the same. Data are plotted as mean ± SEM. T-test was used for statistical analysis. (FIG.13C) Measurement of the pathogenicity of all twenty gain-of-amino acid mutations as determined by the ratio of the number of pathogenic mutations to the number of benign mutations for a specific amino acid throughout the proteome.
[0047] FIG.14A-14C shows pathogenic stimuli decrease protein mobility. (FIG.14A) Cartoon depicting drug toxicity. (FIG.14B) Apparent diffusion coefficient as determined by single particle tracking (SPT) of the protein mobility biosensor expressed in HepG2 cells treated with (NAPQI, n=408 protein molecules) and without (DMSO, n=4921 protein molecules) N-acetyl-p-benzoquinone imine (NAPQI). NAPQI is a toxic intermediate in the breakdown of acetaminophen and is one of the main causes of acetaminophen-induced liver injury. Data are plotted as mean ± SEM. (FIG.14C) Apparent diffusion coefficient as determined by single particle tracking (SPT) of the protein mobility biosensor expressed in C2C12 skeletal muscle cells treated with the stimuli reported in the figure. Data are plotted as mean ± SEM. Mann-Whitney test was used for statistical analysis.11 / 81 W0571.70066WO0013645924
[0048] FIG.15 shows reduced protein mobility (also referred to herein as “proteolethargy”) is a pathogenic mechanism in diverse Mendelian diseases, which may comprise, but are not limited to, two specific classes. In one class of Mendelian disease, proteolethargy is a consequence of a protein gaining a cysteine that is sensitive to the oxidative environment of cells. In the second class of Mendelian disease, proteolethargy is a consequence of elevated levels of reactive oxygen species that affect diverse proteins in cells.
[0049] FIG.16 shows the framework for identifying and prioritizing gain-of-surface cysteine mutations.
[0050] FIG.17 shows the experimental approach to generate cell lines for gain-of-cysteine class of mutations and test for proteolethargy (described in Example 5).
[0051] FIG.18A-18C show that mutations introducing surface-exposed cysteines in ASS1 and MeCP2 lead to reduced mobility of the mutant proteins compared to their wild-type counterparts. Mutations in ASS1, an enzyme involved in the urea cycle, result in citrullinemia, and mutations in MeCP2, a transcriptional regulator, result in Rett syndrome. (FIG.18A) FRAP analysis revealed the mobility of ASS1 R86C mutant was decreased relative to wild-type ASS1. (FIG.18B) FRAP analysis revealed the mobility of MeCP2 R306C mutation also decreased compared to wild type. (FIG 18C) shows that treating cells expressing MeCP2 R306C mutant with N-acetyl cysteine, an antioxidant that is used in the clinic to treat liver disease, partially rescued the mobility of the MeCP2 R306C mutant.
[0052] FIG.19 shows the framework for identifying Mendelian diseases associated with elevated levels of reactive oxygen species.
[0053] FIG.20 shows the experimental approach to generate cell lines for ROS class of mutations and test for proteolethargy (described in Example 5).
[0054] FIG.21A-21B describes the HepG2 model system for study of protein mobility. (FIG.21A) shows the engineered endogenous HP1a. (FIG.21B) shows reduction of mobility of HP1a-GFP and HP1a-HaloTag
[0055] FIGs.22A-22B show FDA-approved drug Metformin partially rescues protein mobility in high ROS environments associated with chronic diseases. (FIG.22A) Biosensor. (FIG 22B) Insulin receptor.
[0056] FIGs.23A-23L describe how protein mobility affects function. (FIG.23A–23C) Cartoons depicting relationship between protein mobility, functional output, and collision frequency (FIG. 23A), models and assays used to study IRS phosphorylation (FIG.23B), and the phosphorylation of IRS1 by a kinase (FIG.23C). (FIG.23D) Second-order rate constant from simulations of IRS1 phosphorylation as a function of diffusion coefficient. (FIG.23E) Immunoblot for phosphorylated IRS1 (pIRS1) and IRS1 (left). IRS1 phosphorylation assay was performed in solutions containing 5%, 15%, or 30% glycerol. Quantification of relative pIRS1 amount (right) (n = 3 biological replicates). t test was used for statistical analysis. * represents p value < 0.05. (FIG.23F) Immunoblot for phosphorylated IRS1 (pIRS1) and IRS1 (left). IRS1 phosphorylation assay was performed in solutions12 / 81 W0571.70066WO0013645924containing 0% or 15% glycerol with agitation (1,200 rpm) or without agitation (0 RPM). Quantification of relative pIRS1 amount (right) (n = 2 biological replicates). (FIG.23G) Cartoon depicting biotinylation assay. (FIG.23H) Cartoon depicting high mobility in normal conditions and low mobility in pathogenic conditions. (FIG.23I) Schematic representation of cell treatments. (FIG. 23J) Representative tracks for movement of individual molecules as determined by SPT of the indicated proteins (left). Scale bars are indicated. Apparent diffusion coefficient of the indicated proteins in cells treated with normal or pathogenic insulin (right). Numbers of molecules: BirASNAP normal (1,003) vs. pathogenic (865); AviTag-Halo-Cys normal (1,022) vs. pathogenic (1,067). Mann- Whitney test was used for statistical analysis. ** represents p value < 0.01 and *** represents p value < 0.001. (FIG.23K) Immunoblot for biotinylated and unbiotinylated AviTag-Halo-Cys. t test was used for statistical analysis. * represents p value < 0.05. (FIG.23L) Cartoon depicting function decreases in diseased cells (left). Quantification of relative pIRS1 determined by immunoblotting (t test was used for statistical analysis, ** represents p value < 0.05), log2(fold change) of gene expression for genes whose promoter is occupied or not occupied by MED1, and log2(fold change) of expression of protein-coding genes or repetitive elements.
[0057] FIGs.24A-24D. show proteolethargy (reduced protein mobility) is a pathogenic mechanism in chronic disease. (FIG.24A) Diverse pathogenic factors lead to oxidative stress via multiple cellular pathways and mechanisms. (FIG.24B) Proteins with surface-exposed cysteines suffer reduced mobility in high ROS environments due to their sensitivity to oxidation. (FIG.24C) Alterations in plasma membrane and cytoplasmic fluidity can also occur in high ROS environments. (FIG.24 D) Mobility is decreased in pathogenic signaling, thereby reducing rates of particle collision and leading to reduced functional output for diverse cellular processes. DEFINITIONS
[0058] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed.1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
[0059] The terms “administer,” “administering,” and “administration” refer to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a treatment or therapeutic agent, or a composition of treatments or therapeutic agents, in or on a subject.
[0060] The term “agent” refers to an organic molecule, inorganic molecule, protein, peptide, polynucleotide, targeting agent, an isotopically labeled chemical compound, vaccine, an13 / 81 W0571.70066WO0013645924immunological agent, or an agent useful in bioprocessing. Agents described herein may be therapeutic, prophylactic, diagnostic, cosmetic, or nutraceutical agents. Exemplary agents described herein include, but are not limited to, small molecules, organometallic compounds, polynucleotides, proteins, peptides, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, small molecules linked to proteins, glycoproteins, steroids, nucleotides, oligonucleotides, polynucleotides, nucleosides, antisense oligonucleotides, lipids, hormones, vitamins, cells, metals, targeting agents, isotopically labeled chemical compounds, drugs (e.g., compounds approved for human or veterinary use by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations), vaccines, immunological agents, agents useful in bioprocessing, and mixtures thereof. The targeting agents are described in more detail herein. In certain embodiments, the agents are nutraceutical agents. In certain embodiments, the agents are pharmaceutical agents (e.g., a therapeutic or prophylactic agent). In certain embodiments, the agent is an antibiotic agent (e.g., an anti-bacterial, anti-viral, or anti-fungal agent), anesthetic, steroidal agent, anti-proliferative agent, anti-inflammatory agent, anti-angiogenesis agent, anti- neoplastic agent, anti-cancer agent, anti-diabetic agent, antigen, vaccine, antibody, decongestant, antihypertensive, sedative, birth control agent, progestational agent, anti-cholinergic, analgesic, immunosuppressant, anti-depressant, anti-psychotic, ^-adrenergic blocking agent, diuretic, cardiovascular active agent, vasoactive agent, non-steroidal, nutritional agent, anti-allergic agent, or pain-relieving agent. Vaccines may comprise isolated proteins or peptides, inactivated organisms and viruses, dead organisms and viruses, genetically altered organisms or viruses, polynucleotides (e.g., mRNA), and cell extracts. Therapeutic and prophylactic agents may be combined with interleukins, interferon, cytokines, and adjuvants such as cholera toxin, alum, and Freund’s adjuvant, etc. In certain embodiments, the agent is an antioxidant.
[0061] The terms “composition” and “formulation” are used interchangeably.
[0062] The term “chronic disease” is defined as a condition that last 1 year or more and requires ongoing medical attention or limits activities of daily living or both. In certain embodiments, the chronic disease is heart disease, cancer, inflammatory disorders, neurological disorders, and diabetes.
[0063] The term “biomolecule” or “biological molecule” refers to any substance produced by cells or living organisms and includes carbohydrates, lipids, nucleic acids, proteins, and vitamins.
[0064] The term “cDNA” refers to DNA that is derived from (e.g., by reverse transcription) and complementary to an RNA template (e.g., an mRNA template or an rRNA template).
[0065] The terms “condition,” “disease,” and “disorder” are used interchangeably.
[0066] A “cell,” as used herein, may be present in a population of cells (e.g., in a tissue, a sample, a biopsy, an organ, or an organoid). In some embodiments, a population of cells is composed of a plurality of different cell types. Cells for use in the methods and systems of the present disclosure can be present within an organism, a single cell type derived from an organism, or a mixture of cell types. Included are naturally occurring cells and cell populations, genetically engineered cell lines, cells14 / 81 W0571.70066WO0013645924derived from transgenic animals, cells from a subject, etc. Virtually any cell type and size can be accommodated in the methods and systems described herein. In some embodiments, the cells are mammalian cells (e.g., complex cell populations such as naturally occurring tissues). In some embodiments, the cells are from a human. In certain embodiments, the cells are collected from a subject (e.g., a human) through a medical procedure, such as a biopsy. Alternatively, the cells may be a cultured population (e.g., a culture derived from a complex population or a culture derived from a single cell type where the cells have differentiated into multiple lineages). The cells may also be provided in situ in a tissue sample.
[0067] Cell types contemplated for use in the methods and systems of the present disclosure include, but are not limited to, stem and progenitor cells (e.g., embryonic stem cells, hematopoietic stem cells, mesenchymal stem cells, neural crest cells, etc.), endothelial cells, muscle cells, myocardial cells, smooth and skeletal muscle cells, mesenchymal cells, epithelial cells, hematopoietic cells, lymphocytes such as T-cells (e.g., Thl T cells, Th2 T cells, ThO T cells, cytotoxic T cells) and B cells (e.g., pre-B cells), monocytes, dendritic cells, neutrophils, macrophages, natural killer cells, mast cells, adipocytes, immune cells, neurons, hepatocytes, and cells involved with particular organs (e.g., thymus, endocrine glands, pancreas, brain, neurons, glia, astrocytes, dendrocytes, and genetically modified cells thereof). The cells may also be transformed or neoplastic cells of different types (e.g., carcinomas of different cell origins, lymphomas of different cell types, etc.) or cancerous cells of any kind (e.g., from any of the cancers disclosed herein. In some embodiments, cells of multiple cell types are present within the same sample. In certain embodiments, the cells are from a diseased tissue sample or diseased subject. In certain embodiments, the cells are from a healthy tissue sample or healthy subject. In some embodiments, a cell is from a cell line. Cells of different origins (e.g., ectodermal, mesodermal, and endodermal) are also contemplated for use in the methods and systems of the present disclosure. In some embodiments, the cells are microglia, astrocytes, oligodendrocytes, excitatory neurons, or inhibitory neurons. In some embodiments, the cells are cardiac cells. In some embodiments, the cells are liver cells. In certain embodiments, the cells are HepG2 cells.
[0068] The term “protein mobility” refers to the diffusion of a protein throughout a cell. In some embodiments, fluorescence recovery after photobleaching (FRAP) microscopy is used for studying protein mobility or “diffusion”, which examines the kinetics of protein diffusion by bleaching a small region inside a single cell using a high-intensity laser pulse, and monitoring the return of the fluorescence intensity to a steady-state level; the kinetics can be fit to models that describe the rate of replenishment of fluorescent proteins into the bleached area. Rapid fluorescence recovery shows high protein mobility, whereas incomplete or slow recovery implies the presence of bound molecules either inside or outside the bleached region. The analysis can provide the half-recovery time and if fit to an appropriate model provide an estimate for the apparent diffusion coefficient. The analysis can also capture the approximate fraction of molecules that are immobile. In some embodiments, protein mobility is examined by single-particle tracking (SPT), which tracks of the location of single15 / 81 W0571.70066WO0013645924fluorescent protein molecules over time and generates spatial trajectories. Using the trajectories (or “tracks”), this analysis can identify whether an ensemble of labeled molecules moves in the cell primarily through Brownian motion (“free” or “normal” diffusion) or in non-Brownian fashion (an “anomalous” diffusion), which can result from confined diffusion (diffusion within a compartment), diffusion limited by the presence of barriers or molecular interactions, directed motion (“super- diffusion,” e.g., due to active molecular transport) or combinations thereof. Identifying the diffusion mode can be done using analysis of mean-square displacements (MSD), which recover properties such as diffusion coefficients, confinement or clustering area, velocity of directed motion, and anomalous diffusion exponents.
[0069] The term “prevent,” “preventing,” or “prevention” refers to a prophylactic treatment of a subject who is not and was not with a disease but is at risk of developing the disease or who was with a disease, is not with the disease, but is at risk of regression of the disease. In certain embodiments, the subject is at a higher risk of developing the disease or at a higher risk of regression of the disease than an average healthy member of a population.
[0070] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA and mean any chain of two or more nucleotides. The polynucleotides can be chimeric mixtures or derivatives or modified versions thereof, and single- stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization parameters, etc.
[0071] The term “gene” refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5’ non-coding sequences) and following (3’ non- coding sequences) the coding sequence. “Native gene” refers to a gene as found in nature with its own regulatory sequences. “Chimeric gene” or “chimeric construct” refers to any gene or a construct, not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene or chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. A “foreign” gene refers to a gene not normally found in the host organism, but which is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non- native organism, or chimeric genes. A “transgene” is a gene that has been introduced into the genome by a transformation procedure.
[0072] The term “fusion protein” as used herein refers to a hybrid polypeptide that comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N- terminal) portion of the fusion protein or at the carboxy-terminal (C-terminal) protein, thus forming an16 / 81 W0571.70066WO0013645924“amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively. A protein may comprise different domains. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which is incorporated herein by reference.
[0073] The term “mutation” as used herein, refers to a substitution, insertion, or deletion of a single residue or a combination of residues within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
[0074] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA and mean any chain of two or more nucleotides. The polynucleotides can be chimeric mixtures or derivatives or modified versions thereof, and single- stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization parameters, etc.
[0075] The term “ribonucleotide” refers to a nucleotide containing ribose as its pentose component. It is considered a molecular precursor of nucleic acids. Nucleotides are the basic building blocks of DNA and RNA. Ribonucleotides themselves are basic monomeric building blocks for RNA. In living organisms, the most common bases for ribonucleotides are adenine (A), guanine (G), cytosine (C), or uracil (U).
[0076] The term “linker,” as used herein, refers to a chemical moiety joining together two separate molecules or moieties. The linker can be an amino acid sequence in the case of a linker joining two fusion proteins. The linker can also be a nucleotide sequence in the case of joining two nucleotide sequences together. In other embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated. The present disclosure contemplates biosensors comprising a “rigid” linker. In certain embodiments, the rigid linker has at least one, at least two, at least three, at17 / 81 W0571.70066WO0013645924least four, at least five cystine residues. In certain embodiments, the rigid linker has at least five cysteine residues. In certain embodiments, the rigid linker has at least one, at least two, at least three, at least four, at least five serine residues. In certain embodiments, the rigid linker has at least five serine residues. In certain embodiments, the term “linker” is used to describe a cysteine array (e.g., a peptide consisting of cystine residues.). In certain embodiments, a cystine array comprises a c- terminus of a protein of interest.
[0077] A “protein,” “peptide,” or “polypeptide” comprises a polymer of amino acid residues linked together by peptide bonds. The term refers to proteins, polypeptides, and peptides of any size, structure, or function. Typically, a protein will be at least three amino acids long. A protein may refer to an individual protein or a collection of proteins. Proteins may contain only natural amino acids, although non-natural amino acids (i.e., compounds that do not occur in nature but that can be incorporated into a polypeptide chain) and / or amino acid analogs as are known in the art may alternatively be employed. Also, one or more of the amino acids in a protein may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation or functionalization, or other modification. A protein may also be a single molecule or may be a multi- molecular complex. A protein may be a fragment of a naturally occurring protein or peptide. A protein may be naturally occurring, recombinant, synthetic, or any combination of these. A protein may also be a therapeutic protein administered as a treatment for a disease or disorder (e.g., one that is associated with a change in the RNA expression and / or translation profile of a cell taken from a subject). In certain embodiments, the protein is an antibody, or an antibody variant (including antibody fragments).
[0078] The term “small molecule” refers to molecules, whether naturally-occurring or artificially created (e.g., via chemical synthesis) that have a relatively low molecular weight. Typically, a small molecule is an organic compound (i.e., it contains carbon). The small molecule may contain multiple carbon-carbon bonds, stereocenters, and other functional groups (e.g., amines, hydroxyl, carbonyls, and heterocyclic rings, etc.). In certain embodiments, the molecular weight of a small molecule is not more than about 1,000 g / mol, not more than about 900 g / mol, not more than about 800 g / mol, not more than about 700 g / mol, not more than about 600 g / mol, not more than about 500 g / mol, not more than about 400 g / mol, not more than about 300 g / mol, not more than about 200 g / mol, or not more than about 100 g / mol. In certain embodiments, the molecular weight of a small molecule is at least about 100 g / mol, at least about 200 g / mol, at least about 300 g / mol, at least about 400 g / mol, at least about 500 g / mol, at least about 600 g / mol, at least about 700 g / mol, at least about 800 g / mol, or at least about 900 g / mol, or at least about 1,000 g / mol. Combinations of the above ranges (e.g., at least about 200 g / mol and not more than about 500 g / mol) are also possible. In certain embodiments, the small molecule is a therapeutically active agent such as a drug (e.g., a molecule approved by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations (C.F.R.)). The small18 / 81 W0571.70066WO0013645924molecule may also be complexed with one or more metal atoms and / or metal ions. In this instance, the small molecule is also referred to as a “small organometallic molecule.” Preferred small molecules are biologically active in that they produce a biological effect in animals, preferably mammals, more preferably humans. Small molecules include, but are not limited to, radionuclides and imaging agents. In certain embodiments, the small molecule is a drug. Preferably, though not necessarily, the drug is one that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body. For example, drugs approved for human use are listed by the FDA under 21 C.F.R. §§ 330.5, 331 through 361, and 440 through 460, incorporated herein by reference; drugs for veterinary use are listed by the FDA under 21 C.F.R. §§ 500 through 589, incorporated herein by reference. All listed drugs are considered acceptable for use in accordance with the present disclosure.
[0079] A “transcript” or “RNA transcript” is the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a complementary copy of a DNA sequence, it is referred to as the primary transcript, or it may be an RNA sequence derived from post- transcriptional processing of the primary transcript and is then referred to as the mature RNA. “Messenger RNA (mRNA)” refers to the RNA that is without introns and can be translated into a polypeptide by the cell.
[0080] The term “sample” or “biological sample” refers to any sample including tissue samples (such as tissue sections, surgical biopsies, and needle biopsies of a tissue); cell samples; or cell fractions, fragments, or organelles (such as obtained by lysing cells and separating the components thereof by centrifugation or otherwise). Other examples of biological samples include, but are not limited to, blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied tissue (e.g., obtained by a surgical biopsy or needle biopsy), nipple aspirates, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. In some embodiments, a biological sample is a surgical biopsy taken from a subject, for example, a biopsy of any of the tissues described herein. In certain embodiments, a biological sample is a tumor biopsy. In some embodiments, the sample is brain tissue. In some embodiments, the tissue is cardiac tissue. In some embodiments, the sample is epithelial tissue, connective tissue, muscular tissue, or nervous tissue. In some embodiments, the sample is tissue from the central nervous system (e.g., brain). In some embodiments, the tissues used in the methods described herein come from such a sample or biological sample.
[0081] The term “immunotherapy” refers to a treatment of disease by inducing, enhancing, or suppressing an immune response. Immunotherapies designed to elicit or amplify an immune response are classified as activation immunotherapies, while immunotherapies that reduce or suppress an immune response are classified as suppression immunotherapies. Immunotherapy may encompass treatment with a molecular entity (e.g., immunotherapeutic agent) and / or a non-molecular entity (e.g., adoptive cell transfer).19 / 81 W0571.70066WO0013645924
[0082] The term “macrophage-directed immunotherapy” refers to an immunotherapy that derives its therapeutic effect by stimulating macrophages. Such stimulation can mobilize macrophage and myeloid components to destroy a tumor and its stroma, including the tumor vasculature. Macrophages can be induced to secrete antitumor cytokines and / or to perform phagocytosis, including antibody- dependent cellular phagocytosis.
[0083] The term “immunotherapeutic agent” refers to a molecular entity that induces, enhances, or suppresses an immune response. Immunotherapeutic agents include, but are not limited to, monoclonal antibodies, cytokines, chemokines, vaccines, small molecule inhibitors, and small molecule agonists.
[0084] The terms “biologic,” “biologic drug,” and “biological product” refer to a wide range of products such as vaccines, blood and blood components, allergenics, somatic cells, gene therapy, tissues, nucleic acids, and proteins. Biologics may include sugars, proteins, or nucleic acids, or complex combinations of these substances, or may be living entities such as cells and tissues. Biologics may be isolated from a variety of natural sources (e.g., human, animal, microorganism) and / or may be produced by biotechnological methods and / or other technologies.
[0085] The term “antibody” refers to a functional component of serum and is often referred to either as a collection of molecules (antibodies or immunoglobulins) or as one molecule (the antibody molecule or immunoglobulin molecule). An antibody is capable of binding to or reacting with a specific antigenic determinant (the antigen or the antigenic epitope), which in turn may lead to induction of immunological effector mechanisms. An individual antibody is usually regarded as monospecific, and a composition of antibodies may be monoclonal (i.e., consisting of identical antibody molecules) or polyclonal (i.e., consisting of two or more different antibodies reacting with the same or different epitopes on the same antigen or even on distinct, different antigens). Each antibody has a unique structure that enables it to bind specifically to its corresponding antigen, and all natural antibodies have the same overall basic structure of two identical light chains and two identical heavy chains. Antibodies are also known collectively as immunoglobulins. An antibody may be of human or non-human (for example, rodent such as murine, dog, camel, etc) origin (e.g., may have a sequence originally developed in a human or non-human cell or organism), or may be or comprise a chimeric, humanized, reshaped, or reformatted antibody based, e.g., on a such a human or non-human antibody (or, in some embodiments, on an antigen-binding portion thereof).
[0086] A “subject” to which administration is contemplated refers to a human (i.e., male or female of any age group, e.g., pediatric subject (e.g., infant, child, or adolescent) or adult subject (e.g., young adult, middle-aged adult, or senior adult)) or non-human animal. In some embodiments, the non- human animal is a mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey) or mouse). The term “patient” refers to a subject in need of treatment of a disease. In some embodiments, the subject is human. In some embodiments, the patient is human. The human may be a male or female at any stage of development. A subject or patient “in need” of treatment of a disease or disorder20 / 81 W0571.70066WO0013645924includes, without limitation, those who exhibit any risk factors or symptoms of a disease or disorder. In some embodiments, a subject is a non-human experimental animal (e.g., a mouse, rat, dog, pig, or non-human primate).
[0087] The term “therapeutic agent,” as used herein, refers to any agent that can be used to treat a disease or disorder, or reduce or alleviate the symptoms of a disease or disorder. In some embodiments, the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, or a carbohydrate. In some embodiments, the therapeutic agent is a known drug and / or an FDA- approved drug. In certain embodiments, the protein is an antibody. In certain embodiments, the protein is an antibody variant. In certain embodiments, the protein is a receptor, or a fragment or variant thereof. In certain embodiments, the protein is a cytokine. In certain embodiments, the nucleic acid is an mRNA, an antisense RNA, an miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), or an antisense oligonucleotide (ASO).
[0088] An “effective amount” of a compound described herein refers to an amount sufficient to elicit the desired biological response. An effective amount of a compound described herein may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the condition being treated, the mode of administration, and the age and health of the subject. In certain embodiments, an effective amount is a therapeutically effective amount. In certain embodiments, an effective amount is a prophylactic treatment. In certain embodiments, an effective amount is the amount of a compound described herein in a single dose. In certain embodiments, an effective amount is the combined amounts of a compound described herein in multiple doses.
[0089] A “therapeutically effective amount” of a treatment or therapeutic agent is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to delay or minimize one or more symptoms associated with the condition. A therapeutically effective amount of a treatment or therapeutic agent means an amount of the therapy, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of the condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms, signs, or causes of the condition, and / or enhances the therapeutic efficacy of another therapeutic agent.
[0090] As used herein, a “tissue” is a group of cells and their extracellular matrix from the same origin. Together, the cells carry out a specific function. The association of multiple tissue types together forms an organ. The cells may be of different cell types. In some embodiments, a tissue is an epithelial tissue. Epithelial tissues are formed by cells that cover an organ surface (e.g., the surface of the skin, airways, soft organs, reproductive tract, and inner lining of the digestive tract). Epithelial tissues perform protective functions and are also involved in secretion, excretion, and absorption. Examples of epithelial tissues include, but are not limited to, simple squamous epithelium, stratified squamous epithelium, simple cuboidal epithelium, transitional epithelium, pseudostratified epithelium, columnar epithelium, and glandular epithelium. In some embodiments, a tissue is a connective tissue. Connective tissues are fibrous tissues made up of cells separated by non-living21 / 81 W0571.70066WO0013645924material (e.g., an extracellular matrix). Connective tissues provide shape to organs and hold organs in place. Connective tissues include fibrous connective tissue, skeletal connective tissue, and fluid connective tissue. Examples of connective tissues include, but are not limited to, blood, bone, tendon, ligament, adipose, and areolar tissues. In some embodiments, a tissue is a muscular tissue. Muscular tissue is an active contractile tissue formed from muscle cells. Muscle tissue functions to produce force and cause motion. Muscle tissue includes smooth muscle (e.g., as found in the inner linings of organs), skeletal muscle (e.g., as typically attached to bones), and cardiac muscle (e.g., as found in the heart, where it contracts to pump blood throughout an organism). In some embodiments, a tissue is a nervous tissue. Nervous tissue includes cells comprising the central nervous system and peripheral nervous system. Nervous tissue forms the brain, spinal cord, cranial nerves, and spinal nerves (e.g., motor neurons).
[0091] The terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease described herein. In some embodiments, treatment may be administered after one or more signs or symptoms of the disease have developed or have been observed (e.g., prophylactically or upon suspicion or risk of disease). In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease. For example, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of a history of symptoms in the subject, or family members of the subject). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. In some embodiments, treatment may be administered after using the methods disclosed herein and observing a change in the RNA expression or translation profile in a cell or tissue in comparison to a healthy cell or tissue.
[0092] Throughout the present disclosure, when a range of values is listed, it is intended to encompass each value and sub-range within the range. Where ranges are given, endpoints are included.
[0093] The details of certain embodiments of the invention are set forth in the Detailed Description of Certain Embodiments, as described below. Other features, objects, and advantages of the invention will be apparent from the Definitions, Examples, and Claims. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0094] The aspects described herein are not limited to specific embodiments, methods, uses, or configurations, and as such can, of course, vary. The terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting.
[0095] The present disclosure describes methods for treating, diagnosing, and profiling pathogenic signaling (also referred to herein as “pathogenic stimuli”) that suppresses the mobility of proteins that play essential roles in cellular functions known to be dysregulated in chronic diseases. The present disclosure also provides methods for diagnosing a disease or disorder in a subject. Methods of22 / 81 W0571.70066WO0013645924screening for or testing an agent capable of modulating, increasing and / or restoring protein mobility in a cell or subject are also provided by the present disclosure. The present disclosure also provides methods for treating a disease or disorder in a subject in need thereof. The present disclosure describes different configurations of biosensors, which may be useful for performing the methods described herein.
[0096] In certain embodiments, the present disclosure describes methods for profiling suppressed (e.g., reduced or “slowed”) protein mobility as a pathologic mechanism in monogenic diseases (Mendelian diseases). In certain embodiments, the present disclosure describes methods of treating a monogenic disease associated with suppressed protein mobility in a cell or subject in need thereof. In further embodiments, the present disclosure describes methods of diagnosing a monogenic disease associated with suppressed protein mobility in a subject in need thereof.
[0097] Thus, in various aspects, the present disclosure methods for treating, diagnosing, and / or profiling a disease or condition associated with suppressed (e.g., reduced or “slowed”) protein mobility. In other aspects, the present disclosure methods for screening and measuring condition suppressed (e.g., reduced or “slowed”) protein mobility in a cell or tissue sample. In certain embodiments, the methods described herein restore the mobility of proteins that has been slowed down in a disease context.
[0098] In one aspect, the present disclosure provides methods of treating a disease or condition associated with suppressed (e.g., reduced or “slowed”) protein mobility of a protein in a subject in need thereof, the method comprising administering to the subject a therapeutic agent that increases protein mobility by reducing the effects of a pathogenic stimulus.
[0099] In another aspect, the present disclosure provides methods of treating a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof, the method comprising administering to the subject a therapeutic agent that increases protein mobility by protecting surface exposed cysteine residues.
[0100] In another aspect, the present disclosure provides method of restoring suppressed protein mobility of a protein in a cell, the method comprising contacting the cell with an agent (e.g., a therapeutic agent) that increases protein mobility by reducing the effects of a pathogenic stimulus.
[0101] In another aspect, the present disclosure provides methods of restoring suppressed protein mobility of a protein in a cell, the method comprising contacting the cell with an agent (e.g., a therapeutic agent) that increases protein mobility by protecting surface exposed cysteine residues.
[0102] In certain embodiments, the disease or condition is characterized by having mobility of the protein suppressed (e.g., reduced or “slowed”) by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, as compared to mobility of the protein in a healthy or non-diseased state.
[0103] In certain embodiments, the disease or condition is a chronic disease. In certain embodiments, the disease or condition is a cardiovascular disease, a metabolic disease, an infectious disease, an23 / 81 W0571.70066WO0013645924inflammatory disease, a neurological disease, a neurodegenerative disease, addiction, or aging. In certain embodiments, the disease or condition is obesity, diabetes, repeated exposure to addictive drugs, or premature aging. In other embodiments, treating a subject in need thereof results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, as compared to mobility of the protein in a diseased state.
[0104] In certain embodiments, the pathogenic stimulus is elevated levels of insulin, high glucose, high fat, inflammatory cytokines, genotoxic stress, or drug toxicity. In certain embodiments, the pathogenic stimulus induces hyperglycemia, dyslipidemia, or inflammation. In certain embodiments, the pathogenic stimulus induces oxidative stress. In certain embodiments, the pathogenic stimulus induces oxidative stress by increasing reactive oxygen species (ROS) levels.
[0105] In certain embodiments, the protein (also referred to as “the protein of interest”) comprises one or more surface exposed cysteines. In certain embodiments, the protein comprises at least one missense mutation which results in one or more surface exposed cysteines. In certain embodiments, the pathogenic stimulus induces or promotes inter-protein crosslinking of the protein by disulfide bond formation of the surface exposed cysteine. In certain embodiments, the protein of interest does not comprise any surface exposed cysteines.
[0106] In certain embodiments, the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine, wherein the bond formation induces conformational changes to the protein. In certain embodiments, aggregation or conformation changes of the protein decreases its ability to interact with a transporter protein.
[0107] In certain embodiments, the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine, wherein the bond formation induces aggregation, oligomerization, or conformational changes to the protein. In certain embodiments, aggregation, oligomerization, or conformational changes to the protein decreases the protein’s mobility. In certain embodiments, aggregation, oligomerization, or conformational changes to the protein decreases its ability to interact with a transporter protein.
[0108] In certain embodiments the pathogenic stimulus increases cytoplasmic viscosity. In certain embodiments, increases in cytoplasmic viscosity causes suppressed (e.g., reduced or “slowed”) mobility of proteins that contain surface-exposed cysteines. In certain embodiments, increases in cytoplasmic viscosity causes suppressed (e.g., reduced or “slowed”) mobility of proteins that do not contain surface-exposed cysteines.
[0109] In certain embodiments, the disease or condition is a monogenic disease. In certain embodiments, the monogenic disease is associated with oxidative stress. In certain embodiments, the monogenic disease causes elevated reactive oxygen species (ROS) levels in cells. In certain embodiments, the monogenic disease introduces at least one surface-exposed cysteine on a protein of interest. In certain embodiments, the monogenic disease results from gain-of-cysteine mutations. In24 / 81 W0571.70066WO0013645924certain embodiments, the monogenic disease is selected from the group consisting of Citrullinemia, Rett syndrome, Joubert syndrome, Dysfibrinogenemia, Arginosuccinate lyase deficiency, Coproporphyria, Monogenic obesity-metabolic syndrome, Familial hypercholesterolemia, Methylmalonic acidemia with homocystinuria, Hemophilia A, G6PD deficiency, Insulin resistance with acanthosis nigricans, Genetic amyotrophic lateral sclerosis, Hemochromatosis, MCAD deficiency, Ataxia-telangiectasia, Cockayne syndrome, Fanconi anemia, Combined oxidative phosphorylation deficiency, Dyskeratosis congenita, Wilson’s disease, and Alpha-1 antitrypsin deficiency. In other embodiments, treating a subject in need thereof having a disease or condition associated with reduced protein mobility results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, as compared to mobility of the protein in a diseased state.
[0110] In certain embodiments, the monogenic disease associated with oxidative stress is G6PD deficiency, Insulin resistance with acanthosis nigricans, Genetic amyotrophic lateral sclerosis, Hemochromatosis, MCAD deficiency, Ataxia-telangiectasia, Cockayne syndrome, Fanconi anemia, Combined oxidative phosphorylation deficiency, Dyskeratosis congenita, Wilson’s disease, or Alpha- 1 antitrypsin deficiency.
[0111] In certain embodiments, the monogenic disease resulting from at least one gain-of-cysteine mutation is selected from Citrullinemia, Rett syndrome, Joubert syndrome, Dysfibrinogenemia, Arginosuccinate lyase deficiency, Coproporphyria, Monogenic obesity-metabolic syndrome, Familial hypercholesterolemia, Methylmalonic acidemia with homocystinuria, and Hemophilia A.
[0112] In certain embodiments, the protein of interest is ASS1, MECP2, ARL3, FGA, ASL, CPOX, DYRK1B, LDLR, ABCD4, F8, G6PD, INSR, SOD1, HJV, ACADM, ATM, ERCC6, FANCA, TSFM, RTEL1, ATP7B , or SERPINA1.
[0113] In certain embodiments, the disclosure provides methods wherein the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof. In certain embodiments, the therapeutic agent is a known drug, an FDA-approved drug, or a drug undergoing clinical trials. In certain embodiments, the therapeutic agent is an antioxidant. In certain embodiments, the antioxidant is N-acetyl cysteine. In certain embodiments, the therapeutic agent is a thiol-protector (also referred to as cysteine capping drug), wherein the agent reacts with the thiol group of cysteines preventing inter-cysteine crosslinking.
[0114] In certain embodiments, the agent is the mitochondrial complex I inhibitor metformin. In certain embodiments, the therapeutic agent is metformin.
[0115] In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human experimental animal. In certain embodiments, the subject is a human subject.
[0116] In another aspect, the present disclosure describes a method of restoring suppressed (e.g., reduced or “slowed”) protein mobility of a protein in a cell, the method comprising contacting the cell25 / 81 W0571.70066WO0013645924with a therapeutic agent that increases protein mobility by reducing the effects of a pathogenic stimulus.
[0117] In certain embodiments, contacting the cell with a therapeutic agent results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In certain embodiments, contacting the cell with an agent results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.
[0118] In certain embodiments, the pathogenic stimulus is elevated levels of insulin, high fat, inflammatory cytokines, genotoxic stress, or drug toxicity. In certain embodiments, the pathogenic stimulus induces oxidative stress, hyperglycemia, dyslipidemia, or inflammation. In certain embodiments, the pathogenic stimulus induces hyperglycemia, dyslipidemia, or inflammation. In certain embodiments, the pathogenic stimulus induces oxidative stress. In certain embodiments, the pathogenic stimulus induces oxidative stress by increasing reactive oxygen species (ROS) levels.
[0119] In certain embodiments, the protein comprises one or more surface exposed cysteines. In certain embodiments, the protein comprises at least one missense mutation which results in one or more surface exposed cysteines. In certain embodiments, the pathogenic stimulus induces or promotes inter-protein crosslinking of the protein by disulfide bond formation of the surface exposed cysteine. In certain embodiments, the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine, wherein the bond formation induces conformational changes to the protein. In certain embodiments, aggregation or conformation changes of the protein decreases its ability to interact with a transporter protein.
[0120] In embodiments, the protein comprises one or more surface exposed cysteines. In certain embodiments, the protein comprises at least one missense mutation which results in one or more surface exposed cysteines. In certain embodiments, the pathogenic stimulus induces or promotes inter-protein crosslinking of the protein by disulfide bond formation of the surface exposed cysteine. In certain embodiments, the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine, wherein the bond formation induces aggregation, oligomerization, or conformational changes to the protein. In certain embodiments, aggregation, oligomerization, or conformational changes to the protein decreases the protein’s mobility. In certain embodiments, aggregation, oligomerization, or conformational changes to the protein of interest decreases its ability to interact with a transporter protein.
[0121] In certain embodiments, the present disclosure describes a method of restoring suppressed (e.g., reduced or “slowed”) protein mobility of a protein in a cell, the method comprising contacting the cell with a therapeutic agent, wherein the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof. In some embodiments, the therapeutic agent is a known drug, an FDA-approved drug, or a drug undergoing clinical trials. In certain embodiments, the therapeutic agent is an antioxidant. In certain embodiments, the antioxidant26 / 81 W0571.70066WO0013645924is N-acetyl cysteine. In certain embodiments, the therapeutic agent is a thiol-protector (also referred to as cysteine capping drug), wherein the agent reacts with the thiol group of cysteines preventing inter- cysteine crosslinking.
[0122] In certain embodiments, the agent is the mitochondrial complex I inhibitor metformin. In certain embodiments, the therapeutic agent is metformin.
[0123] In some embodiments, the cell is a non-diseased cell. In some embodiments, the cell is a diseased cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is an engineered cell. In some embodiments, the cell is present within an intact tissue. In some embodiments, the intact tissue is a fixed tissue sample.
[0124] In certain embodiments, the present disclosure describes a protein (sometimes referred to as “a protein of interest”), wherein the protein is insulin receptor (IR), Mediator subunit (MED1), heterochromatin protein (HP1^), fibrillarin (FIB1), or serine and arginine-rich splicing factor 2 (SRSF2).
[0125] In another aspect, the present disclosure describes a method of profiling suppressed protein mobility in a cell, the method comprising: a) providing a biosensor to the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
[0126] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0127] In another aspect, the present disclosure describes a method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising: a) providing a biosensor to a cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and d) administering an agent to the cell, wherein the agent increases protein mobility; wherein the increase in protein mobility is indicated by recovery of protein diffusion rates and migration location of the bulk population of the biosensor in the cell treated with the agent, compared to a cell not treated with the agent, thereby confirming the suppression of protein mobility is an effect of the pathogenic stimulus.27 / 81 W0571.70066WO0013645924
[0128] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0129] In another aspect, the present disclosure describes a method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising: a) providing a biosensor to a cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and wherein a decrease in protein mobility in cells subjected to the stimulus as compared to cells not subjected to the stimulus indicates that the stimulus suppresses protein mobility.
[0130] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0131] In another aspect, the present disclosure describes a method of measuring suppressed protein mobility in a cell, the method comprising: a) expressing a biosensor within the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell expressing the biosensor; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
[0132] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0133] In another aspect, the present disclosure provides a method of diagnosing a disease or condition in a subject, the method comprising: a) providing a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) contacting the biosensor to a cell or tissue sample from the subject; and c) comparing the mobility of the biosensor between the cell or tissue sample from the subject relative to one or more non-diseased cell or tissue samples, wherein a decrease in measurement of protein mobility in the cell or tissue samples from the subject compared to measurement of protein mobility in the one or more non-diseased cell or tissue samples indicates that the subject has the disease or disorder.28 / 81 W0571.70066WO0013645924
[0134] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0135] In certain embodiments, the measurement of protein mobility in one or more non-diseased cells or tissue samples is determined as a control experiment alongside the cell or tissue samples from the subject. In certain embodiments, the measurement of protein mobility in one or more non-diseased cell or tissue samples comprises reference data.
[0136] In another aspect, the present disclosure describes a method of screening for an agent capable of increasing protein mobility, the method comprising: a) contacting a cell or tissue sample that is being treated with or has been treated with an agent with a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; and b) comparing the mobility of the biosensor in the cell or tissue sample to the mobility of the biosensor in a cell or tissue sample not treated with the agent, wherein an increase in measurement of protein mobility in the cell or tissue samples treated with the agent compared to measurement of protein mobility in a cell or tissue sample not treated with the agent indicates that the agent increases protein mobility.
[0137] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0138] In another aspect, the present disclosure describes a method of screening for an agent capable of increasing protein mobility, the method comprising: a) contacting a cell or tissue sample with an agent, wherein the cell or tissue sample expresses a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag to measure the mobility of the protein of interest; and b) comparing the mobility of the biosensor between the cell or tissue sample relative to one or more non-diseased cell or tissue samples, wherein an increase in measurement of protein mobility in the cell or tissue samples in the presence of the agent compared to measurement of protein mobility in the absence of the agent indicates that the agent increases protein mobility.
[0139] In certain embodiments, the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
[0140] In certain embodiments, contacting a cell or tissue sample with a biosensor in any of the methods described herein is accomplished by delivering the biosensor to a cell or tissue sample from a subject. In some embodiments, the contacting occurring under in vitro, ex vivo, or in vivo conditions.29 / 81 W0571.70066WO0013645924
[0141] In some embodiments the cell or tissue sample is obtained from a subject suffering from a disease characterized by reduced protein mobility. In some embodiments the cell or tissue sample is subjected to a pathogenic stimulus prior to and / or while being contacted with the agent. In some embodiments the cell or tissue sample is contacted with an agent prior to and / or while being subjected to a pathogenic stimulus.
[0142] In certain embodiments the cell or tissue sample and the control cell or tissue sample are obtained from a subject suffering from a disease characterized by reduced protein mobility. In some embodiments the cell or tissue sample and the control cell or tissue sample are subjected to a pathogenic stimulus that reduces protein mobility.
[0143] In certain embodiments, the present disclosure describes a method of screening for an agent capable of increasing protein mobility, wherein the agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof. In certain embodiments, the agent is a known drug, an FDA-approved drug, or a drug undergoing clinical trials. In certain embodiments, the agent is a protein, wherein the protein is an antibody or a variant thereof. In certain embodiments, the agent is a nucleic acid, wherein the nucleic acid is an mRNA, an antisense RNA, an miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a DNA vector, or a viral vector.
[0144] In certain embodiments, the present disclosure describes methods for treating, diagnosing, and / or profiling pathogenic signaling that suppresses the mobility of a protein(s). In some embodiments, the protein is a cytoplasmic protein. In certain embodiments, the protein is a nuclear protein. In certain embodiments, the protein is associated with a chronic disease. In certain embodiments, the protein is associated with a monogenic disease.
[0145] In certain embodiments, the methods described herein are used to identify agent. In some embodiments, the present disclosure describes a pharmaceutical composition comprising the agent identified by any one of the methods described herein, and a pharmaceutically acceptable carrier.
[0146] In any of the methods described herein, the biosensor comprises the protein of interest fused with a HaloTag or GFP-Tag. In certain embodiments, the tag comprises a linker having a plurality of cysteine residues. In certain embodiments, the tag comprises a linker having a plurality of serine residues. In certain embodiments, the linker comprises an array of 3-10 cysteine or serine residues (e.g., 4-8, 4-6, or 5-7 cysteine or serine residues). In certain embodiments, the linker comprises an array of 5 cysteine or serine residues. In certain embodiments, the cysteine or serine residues are contiguous. In certain embodiments, the cysteine or serine residues are spaced by a rigid linker (EAAAKEAAAKA) (SEQ ID NO: 1).
[0147] In any of the methods described herein, the biosensor comprises a HaloTag fused with a linker comprising an array of cysteine or serine residues, wherein the number of cysteine or serine residues may range between 3-10 residues (e.g., 4-8, 4-6, 5-7, or 5). In any of the methods described herein, the biosensor comprises a GFP-tag fused with a linker comprising an array of cysteine or30 / 81 W0571.70066WO0013645924serine residues, wherein the number of cysteine or serine residues may range between 3-10 residues (e.g., 4-8, 4-6, 5-7, or 5). In certain embodiments, the cysteine or serine residues are spaced by a rigid linker (EAAAKEAAAKA) (SEQ ID NO: 1). In any of the methods described herein, the biosensor comprises a HaloTag fused with a linker comprising an array of 5 cysteine or serine residues, wherein the biosensor does not comprise the protein of interest. In any of the embodiments described herein, the biosensor comprises GFP-tag fused with a linker comprising an array of 5 cysteine or serine residues, wherein the biosensor does not comprise the protein of interest. In certain embodiments, the cysteine or serine residues are contiguous.
[0148] In another aspect, the present disclosure describes a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag. In certain embodiments, the biosensor comprises the protein of interest is fused with a HaloTag or a GFP-Tag. In certain embodiments, the HaloTag is fused to a linker comprising 3-10 cysteine residues or serine residues (e.g., 4-8, 4-6, or 5-7 cysteine or serine residues). In certain embodiments, the GFP- Tag is fused to a linker comprising 3-10 cysteine residues or serine residues (e.g., 4-8, 4-6, or 5-7 cysteine or serine residues). In certain embodiments, the HaloTag is fused to a linker comprising 5 cysteine residues or 5 serine residues. In certain embodiments, the GFP-Tag is fused to a linker comprising 5 cysteine residues or 5 serine residues. In certain embodiments, the cysteine or serine residues are contiguous. In certain embodiments, the cysteine or serine residues are spaced by a rigid linker (EAAAKEAAAKA) (SEQ ID NO: 1).
[0149] In another aspect, the present disclosure describes a biosensor comprising a HaloTag fused with a linker comprising an array of 3-10 cysteine residues or serine residues (e.g., 4-8, 4-6, or 5-7 cysteine or serine residues). In another aspect, the present disclosure describes a biosensor comprising a HaloTag fused with a linker comprising an array of 5 cysteine or serine residues. In another aspect, the present disclosure describes a biosensor comprising a GFP-Tag fused with a linker comprising an array of 5 cysteine or serine residues. In certain embodiments, the cysteine or serine residues are contiguous. In certain embodiments, the cysteine or serine residues are spaced by a rigid linker (EAAAKEAAAKA) (SEQ ID NO: 1).
[0150] In some aspects, the disclosure provides a nucleic acid encoding the biosensor described herein. In another aspect, the disclosure provides vectors comprising such nucleic acids. In yet another aspect, the disclosure provides cells (e.g., HepG2 cells) that comprise a nucleic acid described herein, and / or a vector described herein.
[0151] In some embodiments, a biosensor as described herein is delivered (e.g., contacted) to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding the biosensor to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic31 / 81 W0571.70066WO0013645924acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
[0152] In another aspect, the present disclosure describes a modified cell (e.g., a HepG2 cell) that expresses a biosensor described herein. In some embodiments, the modified cell is produced according to any of the methods described herein (see Example 2). In certain embodiments, the modified cell is a eukaryotic cell. In certain embodiments, the modified cell is a mammalian cell. In certain embodiments, the modified cell is a human cell. In certain embodiments, the modified cell is a diseased cell. EXAMPLES Example 1: Suppressed protein mobility is associated with disease pathology Protein mobility in cells
[0153] The present disclosure describes methods that measure the mobility of multiple proteins with diverse functions in cells subjected to normal and pathogenic signaling. Single particle tracking (SPT) and fluorescence recovery after photobleaching (FRAP) allow measurement of the kinetics of protein mobility in living cells, and proteins studied with these methods have been reported to have apparent diffusion coefficients that vary between 0.01 µm2 / s and 30 µm2 / s. This variation is thought to reflect that protein mobility is influenced by diverse factors, ranging from protein size to interaction with various biomolecules. The present disclosure selected proteins whose functions are key to cellular processes known to be dysregulated in prevalent syndromes: a plasma membrane receptor (insulin receptor, IR), a transcriptional cofactor present at actively transcribed genes (Mediator subunit MED1), a regulator of silent genes in heterochromatin (heterochromatin protein HP1^), a component of the nucleolus involved in ribosome biosynthesis (fibrillarin, FIB1) and a subunit of the mRNA splicing apparatus (serine and arginine-rich splicing factor 2, SRSF2) (FIG.1A). HepG2 cells acted as a cell model, as they provide a well-established model system representative of human liver cells in healthy and disease states. To monitor the mobility of each of these proteins, HepG2 liver cells were engineered to encode the endogenous protein fused with HaloTag or monomeric enhanced green fluorescence protein (GFP) and validated that each fusion protein was produced at normal levels and migrated to the compartment where it is known to function (FIG.1B, C and 6).
[0154] The apparent diffusion coefficients of IR, MED1, HP1^, FIB1 and SRSF2 were determined by SPT based on the mean-squared displacement of each individual protein molecule’s trajectory. For each protein, we measured at least 200 protein trajectories and plotted the distribution of apparent diffusion coefficients (FIG.1D,E). As expected, most SPT protein trajectories for IR were contained within the plasma membrane and most SPT protein trajectories for MED1, HP1^, FIB1 and SRSF2 were contained within the nucleus (FIG.1D). The apparent diffusion coefficients ranged from 0.0132 / 81 W0571.70066WO0013645924µm2 / s to 31 um2 / s (FIG.1E), with SRSF2 having the highest average mobility and FIB1 the lowest (FIG.1E, FIG.7, FIG.8).
[0155] FRAP was used to measure the mobility of proteins in HepG2 cells engineered to express the endogenous protein fused to GFP. Specifically, a selected region in the cell was bleached with a focused laser beam and measured the rate at which the fluorescence intensity recovered at the photobleached region. This fluorescence recovery reflects the average mobility of the bulk population of fluorescent proteins . For all proteins under study, the fluorescence intensity recovered on a time scale of seconds (FIG.1F,G) and the relative mobilities of the proteins were in line with those determined using SPT (FIG.7). The mobility of all the proteins measured in these studies was within the range determined previously for other proteins in living cells. Reduced protein mobility with pathogenic signaling
[0156] As an initial test of the hypothesis that protein mobility might be affected in a chronic disease, insulin signaling was selected, since it is dysregulated in prevalent syndromes such as diabetes (FIG. 2A), known to be characterized by a range of affected cellular processes, including dysregulated intracellular signaling, gene activity, RNA splicing and ribosome biosynthesis, among others. In fasting healthy individuals, liver cells are normally exposed to low concentrations of insulin (~ 0.1 nM), whereas after a meal, insulin transiently increases and activates the insulin signaling pathway. In fasting patients with insulin resistance, liver cells are subject to continuous high concentrations of insulin (~3 nM), and this chronic high level of insulin no longer fully activates the signaling response. Thus, normal and pathogenic insulin signaling can be modeled in cell culture by treating liver-derived cells with normal or elevated (pathogenic) concentrations of insulin for prolonged periods of time (FIG.2B).
[0157] To test the possibility that pathogenic insulin signaling may alter protein mobility, HepG2 cells were treated with normal or pathogenic concentrations of insulin (FIG.2C). SPT analysis revealed that the mobility of IR, MED1, HP1^, and FIB1 was reduced in cells that were treated with pathogenic levels of insulin, whereas that of SRSF2 was unaffected (FIG.2D, E). For example, 50% of IR molecules had an apparent diffusion coefficient equal or greater to 0.4 um2 / s when cells were treated with normal concentrations of insulin, and the apparent diffusion coefficient decreased by ~20% when cells were treated with pathogenic insulin concentrations (FIG.2D,E). FRAP analysis of these proteins indicated a similar effect on this set of proteins; there was a reduction in the recovery of all proteins except SRSF2 (FIG.2F,G). Taken together, these results suggest that pathogenic insulin signaling leads to a reduction in the mobility of many, but not all proteins. Oxidative environment affects protein mobility
[0158] Given the broad range of proteins whose mobility was affected by pathogenic insulin signaling, changes in cellular viscosity or in the chemical environment might also be responsible for the observed changes in protein mobility. To test the effect of pathogenic signaling on cellular33 / 81 W0571.70066WO0013645924viscosity, the mobility of GFP was monitored (not fused to any other protein) by FRAP, which is an established method for such studies, and the mobility of HaloTag (not fused to any other protein) by SPT (FIG.9). No change in nuclear viscosity was detected and a change in cytoplasmic viscosity was detected (FIG.9). These results suggest that altered viscosity could contribute to the mobility phenotype for IR in the plasma membrane but is unlikely to significantly impact on the diverse nuclear proteins studied here.
[0159] Substantial changes in the chemical environment are known features of chronic diseases such as insulin resistance due to high levels of reactive oxygen species (ROS) (FIG.3A, B). The present disclosure hypothesized that if an oxidative environment leads to changes in protein mobility, then treating cells with pathologically-relevant concentrations of the oxidizing agent H2O2 should phenocopy the effects observed in cells treated with pathogenic insulin signaling (FIG.3B,C). FRAP analysis showed that treatment of cells with H2O2 caused reduced mobility of IR, MED1, HP1^, and FIB1 but not SRSF2 or nuclear GFP (FIG.3D-F, Fig.10A).
[0160] Similarly, if high levels of ROS lead to reductions in protein mobility, then treatment with the antioxidant N-acetyl cysteine (NAC) should restore some degree of protein mobility in cells exposed to pathogenic levels of insulin. As expected, FRAP revealed that treating insulin-resistant cells with 1 mM NAC partially rescued the mobility of IR, MED1, HP1^ and FIB1, but had little effect on the mobility of SRSF2 and nuclear GFP (FIG.3G-I, Fig.10B). These results are consistent with the possibility that elevated levels of ROS cause a decrease in the mobility of certain proteins, and suggest that the change in protein behavior is caused by an alteration in the chemical environment. Mobility of proteins with exposed cysteines
[0161] The sensitivity of proteins to the oxidative environment suggests that oxidation-sensitive amino acids might influence protein mobility. Analysis of amino acid content showed that the proteins whose mobility was affected by pathogenic insulin signaling and H2O2 have cysteines with surface- exposed side chains, whereas this was not the case for the proteins whose mobility was not affected by those pathogenic factors (FIG.4A). Surface cysteines create the potential for cross-linking through disulfide bonds, which might reduce the rate of diffusion by diverse mechanisms, including increasing effective protein size, altering protein conformation, promoting binding to immobile proteins, and increasing cellular viscosity (FIG.4B).
[0162] To explore how different oxidative states of the cellular environment might be expected to influence diffusion of proteins with and without cysteines, a physics-based model was developed (FIG.4C, 11, 12, see methods). In this model, proteins are simulated as spherical particles, half of which have sticky patches on their surface, representing surface-exposed cysteine residues, and half of which do not have sticky patches. As the oxidative state of the cellular environment increases, the propensity of interaction between the patches increases, leading to protein crosslinking and formation of protein dimers and multimers (FIG.12B-D). Proteins without surface-exposed cysteines remain in34 / 81 W0571.70066WO0013645924a monomeric state even at higher levels of ROS. As a result, the average diffusion coefficient of proteins containing surface-exposed cysteine decreased more than that of proteins lacking surface- exposed cysteines, because of dimer and multimer formation (FIG.4C, FIG.12B-D). The mobility of proteins lacking cysteines slightly decreases at higher levels of ROS, due to the increase in effective viscosity caused by the crosslinking of the proteins containing cysteines present in the environment (FIG.4C). This model predicts that increased ROS-driven intermolecular disulfide bond formation will reduce protein mobility due to the increased frequency and lifetime of these bonds.
[0163] To further test the model that surface cysteines contribute to reduced protein mobility in an oxidative environment, cysteines were added to the surface of SRSF2, which normally lacks these residues, which would likely cause reduced mobility of the modified SRSF2 protein in a high ROS environment. To answer this question, HepG2 cells were engineered to express endogenous SRSF2 fused to a rigid linker (to ensure surface exposure) containing multiple cysteine residues (SRSF2-Cys) or, as a control, the same number of serine residues (SRSF2-Ser)(FIG.4D, FIG.4E). Treating HepG2 cells with H2O2 or pathogenic insulin concentrations did not affect the mobility of the SRSF2-Ser protein, but decreased the mobility of SRSF2-Cys protein (FIG.4D, FIG.4E). Taken together, these results indicate that surface-exposed cysteines can affect protein mobility when cells are exposed to oxidative stress and pathogenic signaling.
[0164] Next, proteins having missense mutations resulting in gaining a cysteine were studied in order to determine whether these mutations might affect protein mobility. A tyrosine to cysteine mutation (Y1361C) was reported in the insulin receptor. This mutation occurs outside of the structured domain and does not appear to alter protein structure or stability. Modeling indicates that the cysteine gained through this mutation is surface exposed (FIG.13A). The mutation was introduced into the insulin receptor-GFP fusion protein (IR Y1361C-GFP) in both alleles in HepG2 cells. By performing FRAP, it was found that the gain-of-cysteine mutation caused a reduction in IR protein mobility in HepG2 cells under normal redox conditions (FIG.4F,FIG.4G) and that treating cells expressing IR Y1361C- GFP with NAC enhanced IR Y1361C protein mobility (Fig.4H). Mutating the same amino acid to serine had little to no effect on insulin receptor protein mobility (FIG.13B). These results indicate that mutations that add surface cysteines reduce the mobility of the insulin receptor under normal redox conditions, and that addition of an antioxidant can enhance this receptor’s mobility. Gain-of- cysteine mutations are among the most pathogenic missense mutations (FIG.13C) and their effect on protein mobility may not be limited to IR, but may extend to other disease-relevant proteins. Diverse pathogenic factors decrease protein mobility
[0165] The pathogenic stimuli that are associated with diverse diseases are thought to commonly induce oxidative stress. The present disclosure describes a mobility biosensor assay to investigate relationships between surface-exposed cysteines and protein mobility under oxidative conditions, and to investigate whether diverse pathogenic stimuli produce similar mobility phenotypes in liver cells35 / 81 W0571.70066WO0013645924and in other disease-relevant cell types. A non-limiting example includes a protein mobility sensor constructed by adding a rigid linker containing 5 cysteine residues to the Halo-tag protein (HaloTag- Cys) (Fig.5A). This biosensor was appropriately sensitive to pathogenic levels of H2O2, as evidenced by the mobility of HaloTag-Cys decreasing upon H2O2treatment in a dose-dependent fashion (Fig. 5B). Similarly, treatment of cells containing the biosensor with pathogenic insulin concentrations led to reduced protein mobility (FIG.5C).
[0166] Pathogenic stimuli that induce oxidative stress include hyperglycemia, high fat, inflammation, genotoxic stress, endotoxin and drug toxicity (FIG.5D, 14A). Treating cells with these pathogenic stimuli led to elevated levels of ROS (FIG.5E), confirming previous results. These treatments also reduced the mobility of the HaloTag-5Cys protein in liver cells (FIG.5F, 14B). Similar results were obtained in skeletal muscle cells, another disease-relevant cell type (FIG.14C). Taken together, these results are consistent with a model in which diverse pathogenic stimuli known to induce oxidative stress cause suppressed (e.g., reduced or “slowed”) protein mobility in multiple disease-relevant cell types. Discussion
[0167] Pathogenic signaling contributes to prevalent diseases characterized by dysregulation of remarkably diverse cellular processes. Consequently, equally diverse pathogenic mechanisms are assumed to cause these phenotypes. However, the findings on protein mobility in healthy and dysregulated cells described here suggest an alternative explanation; namely, that a common mechanism - suppressed mobility - contributes to dysregulation of a range of cellular processes in the setting of diverse pathogenic stimuli.
[0168] In healthy cells, proteins with prominent roles in diverse cellular processes are highly mobile, and thus able to transit a space equivalent to the diameter of a cell in 2-10 seconds. However, pathogenic stimuli reduced the mobility of most proteins studied here by 20-35%. This reduction would be expected to reduce functional outputs, in part because many biochemical reactions are collision-limited.
[0169] There is limited information on the mobility of a range of proteins with diverse functions in human cells, and even less information on the effects of pathogenic stimuli on protein mobility. This paucity of knowledge may explain why a general reduction in protein mobility has previously not been considered as a potential pathogenic mechanism for chronic diseases. The cellular processes that have been reported to be dysregulated in chronic syndromes such as diabetes and inflammatory disorders are diverse and include gene regulation, ribosome biosynthesis and metabolic activity . Results described herein are consistent with proteins playing prominent roles in each of these cellular functions and having altered mobility in disease settings. This demonstrates that a general suppression of protein mobility may account for the diversity of dysregulated cellular functions noted for these diseases.36 / 81 W0571.70066WO0013645924
[0170] The reduction in protein mobility in cells exposed to pathogenic stimuli could be attributed to increased ROS levels and the effects of an elevated oxidative environment on proteins with surface cysteines. The experimental and modeling data described herein, jointly support a model in which proteins with surface-exposed cysteines, upon transiting through a milieu that is densely packed with biomolecules, have the potential to form transient disulfide crosslinks with other proteins. Consistent with this model, an elevated oxidative environment would then increase the lifetime of the inter- molecular crosslinks, effectively increasing the molecular mass and thereby decreasing protein mobility. Variations of this model are possible, where changes in the lifetime of inter-molecular or intra-molecular disulfide bonds have additional influences on protein mobility through changes in conformation or, more globally, cellular viscosity.
[0171] The model described here for suppressed (e.g., reduced or “slowed”) protein mobility in disease has implications for the development of novel therapeutics for certain chronic diseases. Restoring protein mobility might be considered among the therapeutic hypotheses for these chronic diseases. Protein mobility biosensors, such as those described herein, may prove to be valuable for high throughput screening for drugs that restore normal protein mobility under pathogenic signaling conditions. The rescue of protein mobility with NAC treatment, as described here, is a proof of principle for this concept. Example 2: Materials and Methods Constructs and construct generation
[0172] For tagging endogenous protein (MED1, HP1^, SRSF2, FIB1, and IR) with GFP, HaloTag, or GFP-5xSer / Cys, the homology directed repair (HDR) strategy of CRISPR was adopted. For this strategy, three components are needed: 1) Cas9 protein to cut the DNA, 2) sgRNA to guide Cas9 to the right target to make the cut, and 3) a DNA repair template that contains the desired edit as well as 800 bp homologous sequence immediately upstream and downstream of the target. The sgRNA and Cas9 sequences to be transiently expressed in cells were integrated in the same plasmid (which was refer to as “sgRNA-Cas9 plasmid”), while the repair templates were integrated into a second plasmid. For doxycycline inducible expression of GFP or HaloTag, a single PiggyBac compatible vector was adopted to make the GFP or HaloTag containing construct.
[0173] sgRNA-Cas9 plasmids.20 bp of target sequences were cloned into a plasmid containing sgRNA backbone, a codon-optimized version of Cas9 and mCherry. The mCherry will be used for the FACS sorting purpose. Constructs for the generation of MED1-GFP, HP1^-GFP, SRSF2-GFP, FIB1- GFP, and insulin receptor-GFP (IR-GFP) cell lines were described in previous publications (1, 2). To generate the IR-Y1361C-GFP cell line, the following sgRNA sequences with PAM sequence in parentheses were used for CRISPR / Cas9 editing:37 / 81 W0571.70066WO0013645924sgRNA_IR_C-term_1: CACGGTAGGCACTGTTAGGA(AGG) (SEQ ID NO: 2) sgRNA_IR_C-term_2: TAGGCACTGTTAGGAAGGAT(TGG) (SEQ ID NO: 3) sgRNA_IR_C-term_3: CCTCCGTTCATGTGTGTGTA(AGG) (SEQ ID NO: 4) The other sgRNA sequences are reported in previous publications (1, 2). Cloning was performed using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S) according to manufacturer’s specifications.
[0174] Repair templates for GFP tagging. Around 800bp of Homo sapiens genomic DNA sequences flanking the Cas9 cutting sites were cloned into the pUC19 vector using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S), with in-frame mEGFP sequence being inserted together with a flexible 10-animo acid linker sequence to space the fluorophore and the protein of interest. Constructs for MED1-GFP, HP1^-GFP, SRSF2-GFP, FIB1-GFP, and IR-GFP cell line generations are described in previous publications (1, 2). For the IR-Y1361C-GFP cell line generation, the homology repair template consists of INSR exon 22 containing the Y1361C missense mutation in frame with GFP flanked on either side by 800-bp homology arms amplified from HepG2 genomic DNA using PCR. For SRSF2-GFP-5xSer / Cys cell line generation, the SRSF2-GFP repair template was modified to fuse SRSF2-GFP to a flexible linker followed by either a 5xSer array or a 5xCys array. The 5xSer array contains 5 serines spaced by a rigid linker (AEAAAKEAAAKA) (SEQ ID NO: 5) (3), while the 5xCys array contains 5 cysteines spaced by the same rigid linker (3). These constructs were cloned using NEBuilder HiFi DNA Assembly Master Mix.
[0175] Repair templates for HaloTag tagging. Constructs for MED1-HaloTag, HP1^-HaloTag, SRSF2-HaloTag, FIB1-HaloTag, and IR-HaloTag were generated by replacing the mEGFP with HaloTag in the repair templates using NEBuilder HiFi DNA Assembly Master Mix.
[0176] Doxycycline inducible expression of GFP or HaloTag. Sequences of SiriusGFP or HaloTag were cloned using NEBuilder HiFi DNA Assembly Master Mix into a doxycycline-inducible, PiggyBac compatible vector, previously described (4).
[0177] Doxycycline inducible expression of HaloTag-5xSer / Cys arrays. HaloTag-5xSer (SEQ ID NO: 18) and HaloTag-5xCys (SEQ ID NO: 19) constructs encode a doxycycline-inducible HaloTag protein whose C-terminal is fused to a flexible linker (GAPGSAGSAAGGSGA) (SEQ ID NO: 6) (5) and to an array containing either 5 serines or 5 cysteines which are separated by a rigid linker (AEAAAKEAAAKA) (SEQ ID NO: 5) (3). Constructs were made using NEBuilder HiFi DNA Assembly Master Mix. Cell culture
[0178] HepG2 cells were acquired from ATCC (ATCC, HB-8065TM) and cultured in 150 mm cell culture grade dishes with EMEM media (ATCC, 30-2003) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich, F4135) without antibiotic and kept in a humid incubator at 37°C with 5% CO2. These cells were chosen because they are widely used to study diverse pathologies and because they38 / 81 W0571.70066WO0013645924are able to be genetically modified. To passage the cells, 20 ml of room-temperature phosphate buffered saline solution (Gibco, 10010-023) was added to the dish, aspirated off, then 3 ml of TrypLE Express Enzyme (Life Technologies, 12604021) was added to help dissociate cells from the dish and one another. The dish was then incubated at 37°C with humidity and 5% CO2for 5 minutes. After 5 minutes, cells were mechanically dissociated by pipetting them up and down 7 times using with a 10ml serological pipette fitted with an unfiltered p200 tip. To quench the TrypLE, 7 ml of EMEM- FBS was added to the dish.1 ml of the cell suspension was left on the dish and 20 ml of EMEM-FBS was added on top. For optimal proliferation HepG2 cells were cultured in the same 150 mm dish and split 1:10 when the dish became confluent for an entire month. To prevent contamination, after one month, the cells were subcultured on a new plate, being seeded in a 1:2 split. Cell treatments for HEpG2
[0179] Insulin treatment. The cell plating and insulin treatment regime used in this study is the same as the one previously published (2). Cells were seeded at a density of 32,000 cells / cm2 onto 35-mm glass bottom dishes (MatTek Corporation, P35G-1.5-20-C). Starting the day after plating, cells were serum-starved for two days by washing the plates twice with EMEM media without FBS (EMEM) and maintaining the cells in EMEM for 48 hours. Then cells were treated with EMEM supplemented with 0.125% fatty acid-free BSA (Sigma Aldrich, I9278-5ML) (“EMEM-BSA”) that contained either 1) 0.1 nM insulin (Sigma Aldrich, I9278-5ML) or 2) 3nM insulin, which are the concentrations of insulin in the portal vein of healthy and insulin resistant patients. The media was changed twice per day (every ~12 hours) for 3 days. This treatment regime produced either a baseline “healthy” signaling state or a “pathologic” elevated signaling state (2). To ensure that the protein mobility was due to the cellular state and not due to differences in the concentration of insulin, insulin was washed out by extensively washing cells with EMEM. The cells were washed six times with 2mL of EMEM, including three quick washes, two 5 min washes, and a 15 min wash at 37 °C. Cells were then acutely treated with 3 nM insulin for 5 minutes in EMEM-BSA at 37 °C with 5% CO2 in a humidified incubator and then subjected to the desired assay.
[0180] H2O2treatment. For experiments in FIG.1-4, cells were seeded at a density of 32,000 cells / cm2, serum-starved for two days as described above. Then cells were treated with EMEM-BSA containing 0.1 nM insulin for three days changing the media twice per day (every ~12 hours). Following a quick wash in EMEM, cells were treated with 0 mM or 7.5 mM H2O2(Sigma Aldrich, H1009) in EMEM for 5 minutes. Cells were then subjected to the desired assay. For the H2O2titration experiment in FIG.5, cells were seeded at a density of 100,000 cells / cm2, serum-starved for two days, followed by treating with 0, 1, 3, 8, or 20 mM H2O2in EMEM for 5 minutes before proceeding to imaging.
[0181] N-acetyl cysteine (NAC) treatment. Cells were seeded at a density of 32,000 cells / cm2, serum-starved for two days as described above. Following serum starvation, the cells were treated39 / 81 W0571.70066WO0013645924with 1) EMEM-BSA containing 3 nM insulin for two days and then with 2) EMEM-BSA containing 3 nM insulin and 1 mM NAC (Sigma Aldrich, A9165-25G) for one day, changing the media twice per day (every ~12 hours). Insulin washouts and final stimulation was performed as described above. For NAC treatments of cells expressing IR-Y1361C mutant protein, cells were seeded at a density of 32,000 cells / cm2 in 35mm glass-bottom dishes, serum-starved for 16 hours and treated with EMEM- BSA containing 0.1 nM insulin and 1 mM NAC for two days changing the media twice per day (every ~12 hours). Insulin washouts and final stimulation was performed as described above and cells were then subjected to the desired assay.
[0182] Tumor necrosis factor alpha (TNF^) treatments. Cells were seeded at a density of 32,000 cells / cm2, and then serum-starved for two days starting as described above. Cells were then treated with EMEM-BSA media with / without 10 ng / ml Human TNF-^ Recombinant Protein (Thermo Fisher Scientific, PHC3016) for two days, changing the media twice per day (every ~12 hours). The cells were then subjected to the desired assay.
[0183] High glucose treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum- starved for 16 hours. Cells were then cultured in media containing high glucose concentrations (EMEM with 33 mM of glucose, Sigma Aldrich, G8270) or in media containing physiological concentrations of glucose (EMEM with 33mM of mannitol, Sigma Aldrich, M1902) for 12 hours. Mannitol was used to ensure cells are under similar osmolarity conditions. Cells were then subjected to the desired assay.
[0184] Lipopolysaccharide (LPS) treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum-starved for 16 hours. Cells were then cultured in EMEM containing 1 ^g / ml of LPS (Sigma Aldrich, L2630) for 24 hours. Cells were then subjected to the desired assay.
[0185] Etoposide treatment. Cells were treated with EMEM-FBS media containing 1) 1.5^M etoposide (Thermo Scientific Chemicals, J63651, reconstituted as 10mM in DMSO) or 2) the same volume of DMSO (Sigma Aldrich, D2438) as a DMSO control. After 3 days, cells were treated again with 1.5^M etoposide or DMSO control for 3 more days. Because etoposide blocks cell proliferation, cells were seeded at a density of 100,000 cells / cm2 for etoposide treatment and 10,000 cells / cm2 for DMSO control. These seeding densities resulted in similar cell confluency at the end of the cell treatments. Cells were then subjected to the desired assay.
[0186] High fat treatment. Cells were seeded at a density of 32,000 cells / cm2, and then serum- starved for two days starting as described above. Cells were then cultured with EMEM-BSA supplemented with 45 µM oleic acid (Sigma Aldrich, O7501) and 30 µM palmitic acid (Sigma Aldrich, P9767) or with EMEM-BSA for two days. Media was changed twice a day (every ~12 hours). Cells were then subjected to the desired assay.
[0187] N-acetyl-p-benzoquinone imine (NAPQI) treatment. Cells were seeded at a density of 32,000 cells / cm2, and then serum-starved for 2 days. Cells were then treated with EMEM media containing40 / 81 W0571.70066WO0013645924150 µM NAPQI (Sigma-Aldrich, A7300-1mg) in DMSO or DMSO as a control for 15 minutes. Cells were then subjected to the desired assay. Cell treatments for C2Cl2
[0188] Insulin treatment. Cells were seeded at a density of 100,000 cells / cm2 onto 35-mm glass bottom dishes (MatTek Corporation, P35G-1.5-20-C). Starting the day after plating, cells were serum- starved for two days by washing the plates twice with DMEM media without FBS (DMEM) and maintaining the cells in DMEM for 48 hours. Then cells were treated with DMEM supplemented with 0.125% fatty acid-free BSA (Sigma Aldrich, I9278-5ML) (“DMEM-BSA”) that contained either 1) 0.1 nM insulin (Sigma Aldrich, I9278-5ML) or 2) 3nM insulin, which are the concentrations of insulin in the portal vein of healthy and insulin resistant patients. The media was changed twice per day (every ~12 hours) for two days. This treatment regime produced either a baseline “healthy” signaling state or a “pathologic” elevated signaling state (2). Right before imaging, the cells were washed six times with 2mL of DMEM, including three quick washes, two 5 min washes, and a 15 min wash at 37 °C. Cells were then acutely treated with 3 nM insulin for 5 minutes in DMEM-BSA at 37 °C with 5% CO2 in a humidified incubator and then subjected to the desired assay.
[0189] Tumor necrosis factor alpha (TNF^) treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum-starved for two days starting as described above. Cells were then treated with DMEM-BSA media with / without 10 ng / ml Human TNF-^ Recombinant Protein (Thermo Fisher Scientific, PHC3016) for two days, changing the media twice per day (every ~12 hours). The cells were then subjected to the desired assay.
[0190] High glucose treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum- starved for 16 hours. Cells were then cultured in media containing high glucose concentrations (DMEM with 33 mM of glucose, Sigma Aldrich, G8270) or in media containing physiological concentrations of glucose (DMEM with 33mM of mannitol, Sigma Aldrich, M1902) for 12 hours. Mannitol was used to ensure cells are under similar osmolarity conditions. Cells were then subjected to the desired assay.
[0191] Lipopolysaccharide (LPS) treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum-starved for 16 hours. Cells were then cultured in DMEM containing 1 ^g / ml of LPS (Sigma Aldrich, L2630) for 24 hours. Cells were then subjected to the desired assay.
[0192] Etoposide treatment. Cells were seeded at a density of 100,000 cells / cm2 for etoposide treatment and 1,000 cells / cm2 for DMSO control. Cells were treated with DMEM-FBS media containing 1) 1.5^M etoposide (Thermo Scientific Chemicals, J63651, reconstituted as 10mM in DMSO) or 2) the same volume of DMSO (Sigma Aldrich, D2438) as a DMSO control. After 3 days, cells were treated again with 1.5^M etoposide or DMSO control for 3 more days. Cell confluency should be similar at the end of the treatments. Cells were then subjected to the desired assay.41 / 81 W0571.70066WO0013645924
[0193] High fat treatment. Cells were seeded at a density of 100,000 cells / cm2. After one day, cells were then cultured with DMEM-FBS supplemented with 200 ^M palmitic acid (Sigma Aldrich, P9767) or with DMEM-FBS supplemented with 200 ^M BSA for one day. Cells were then subjected to the desired assay.
[0194] N-acetyl-p-benzoquinone imine (NAPQI) treatment. Cells were seeded at a density of 100,000 cells / cm2, and then serum-starved for 2 days. Cells were then treated with DMEM media containing 150 ^M NAPQI (Sigma-Aldrich, A7300-1mg) in DMSO or DMSO as a control for 15 minutes. Cells were then subjected to the desired assay. Cell editing
[0195] Endogenously tagged cell line generation. A CRISPR / Cas9 system is used to generate genetically modified HepG2 cell lines as previously performed (2).1 × 106 cells were transfected with sgRNA-Cas9 plasmid and of homology repair template using Lipofectamine 3000 (Invitrogen, L3000).24 hours post-transfection, transfection media was replaced with fresh cell culture media (EMEM-FBS). To enrich for transfected cells, cells were sorted 72 hours after transfection based on the expression of mCherry fluorescent protein encoded from the sgRNA-Cas9 plasmid. This population of cells was expanded for 1.5 to 2 weeks before sorting the cells for the expression of mEGFP or HaloTag. To sort based on HaloTag expression, cells were cultured for 15 minutes with Janelia Fluor 585 (generous gift of the Lavis Laboratory) prior to sorting. Cells were then expanded and the cell lines were validated by western-blot, PCR genotyping using Phusion polymerase (Thermo Scientific, F531S) and imaging experiments. Experiments were performed using bulk cell lines containing homozygous and heterozygous cells or using homozygous clonal cell lines.
[0196] To generate clonal cell lines, after the second sort, single cells were plated into individual wells of a 96-well plate. The single cells were cultured for 1–1.5 months in conditioned media. To make conditioned media, HepG2 cells were cultured in fresh media (EMEM-FBS) for 3 days and the old media was saved (old media). Conditioned media was made by mixing 1:1 fresh media (EMEM- FBS) with old media. The conditioned media was filter sterilized prior to use. Genotyping PCR was performed according to the manufacturer’s specifications, using the following primers: IR_fwd: GGAGAATGTGCCCCTGGAC (SEQ ID NO: 7) IR_rev: TTGGTAACCAAACGAGTCCACCT (SEQ ID NO: 8) MED1_fwd: CGAGCACCCTTCTCTTCTTG (SEQ ID NO: 9) MED1_rev: GAAGTTGAGAGTCCCCATCG (SEQ ID NO: 10) HP1^_fwd: CCAAGGTGAGGAGGAAATCA (SEQ ID NO: 11) HP1^_rev: CACAGGGAAGCAGAAGGAAG (SEQ ID NO: 12) SRSF2_fwd: CAAGTCTCCTGAAGAGGAAGGA (SEQ ID NO: 13) SRSF2_rev: AAGGGCTGTATCCAAACAAAAAC (SEQ ID NO: 14) FIB1_fwd: CCTTTTAATCAGCAACCCACTC (SEQ ID NO: 15)42 / 81 W0571.70066WO0013645924FIB1_rev: GTGACCGAGTGAGAATTTACCC (SEQ ID NO: 16)
[0197] Doxycycline inducible expression cell line generation. A PiggyBac transposon system (Systems Biosciences) was used for stable integration.1 × 106 wildtype HepG2 cells were plated in a 6-well plate and simultaneously transfected with 0.5 ^g of the PiggyBac expression vector and 0.2 ^g of the PiggyBac transposase (gift of Jaenisch lab) using Lipofectamine 3000 (Invitrogen, L3000).24 hours post-transfection, transfection media was replaced with fresh media, EMEM with 10% FBS.72 hours post-transfection, the cells were treated with media containing 150 ^g / mL hygromycin (ThermoFisher). Selection media was changed every 3 days and untransfected cells were also treated with hygromycin as a positive control, confirming the efficiency of selection. Typically, 7-10 days were required for the hygromycin to kill all the non-transfected HepG2 cells. Cell viability
[0198] Cell viability was measured by mixing 1:1TrypanBlue (Invitrogen T10282) with single cell suspension after dissociation and quenching, then 10 ^l of the TrypanBlue / cell mixture was loaded into Countess cell counting chamber slides (Invitrogen 100078809) and viability was measured using the Countess 3 FL (Invitrogen). All samples were prepared in triplicate. ROS stain and imaging
[0199] Following cell treatment, media was removed and cells were incubated with 5 µM CellROX Deep Red Reagent (Thermo Fisher Scientific, C10422) diluted in EMEM for 30 minutes. Cells were then fixed with 4% paraformaldehyde in PBS (BTC Beantown Chemical, 140770-10x10ML) for 10 minutes. Cells were washed with PBS three times and imaged using the RPI Spinning disk confocal microscope, 63x objective. ROS signal intensity was measured using the “measure tool” on Fiji / ImageJ v2.1.0 / 153c. A two-tailed student's t-test was used to generate p-values. Statistical analysis was performed using Prism Version 9.4.0 (GraphPad, La Jolla, CA). All ROS imaging experiments were performed twice using 4 biologically independent samples. Immunofluorescence
[0200] Cells were fixed with 4% paraformaldehyde in PBS for 10 minutes at RT, washed three times with PBS for 5 minutes at RT, permeabilized with 4% BSA (Jackson Immunoresearch Laboratories - 001-000-162) in PBS for 1 hour at RT and washed again three times with PBS for 5 minutes at RT. Cells were incubated with primary antibodies diluted 1:500 in 4% BSA in PBS O / N at 4°C. Cells were washed three times with PBS for 5 minutes at RT and incubated with secondary antibodies Goat anti-Rabbit IgG Alexa Fluor 488 (Life Technologies, A11008) diluted 1:500 in 4% BSA in PBS for 1 hour at RT. Cells were then washed in PBS three times for 5 minutes. DNA was stained with Hoechst (Thermo Fischer Scientific, 3258) diluted 1:500 in PBS for 5 minutes at RT and excess Hoechst was removed by washing cells 3 times for 5 minutes with PBS. Cells were stored at 4°C in PBS and imaged using the ZEISS LSM 980 with Airyscan detector using 63x objective. Raw image series were43 / 81 W0571.70066WO0013645924processed via ZEN Blue (2D Airyscan processing). Images were converted in JPEG format using Fiji / ImageJ v2.1.0 / 153c.
[0201] Primary antibodies for immunofluorescence: Anti-insulin receptor (Cell Signaling, 23413) Anti-MED1 (Abcam, ab64965) Anti-HP1^ (Abcam, ab109028) Anti-FIB1 (Abcam, ab582) Anti-SRSF2 (Abcam, ab11826) Metabolite isolation for quantification of GSSG and GSH ratio
[0202] Cells were treated according to the specified treatment protocol in 6-well culture plates, then the media was removed and cells were washed twice with ice-cold PBS (Gibco, 10010-023) on ice. The PBS was then removed and 500 ^l of ice-cold 80% methanol, 20% water solution with isotope- labeled amino acid mass-spec internal standards (provided by the Whitehead Institute Metabolomics Core) was added to each well on dry ice. The plate was chilled at -80°C for a minimum of 15 minutes, then the cells were scraped for 30 seconds with a plastic cell scraper (Corning, 3008). The methanol- cell mixture was transferred to a 1.5 ml eppendorf tube (Eppendorf, 0223641). The well was washed again with 300 ^l of the ice-cold methanol solution to extract all remaining cells from the well, which was added to the same 1.5 ml eppendorf tube. The mixture was vortexed on high for 10 minutes at 4°C, then centrifuged on a table top centrifuge on max speed for 10 minutes at 4°C.600 ^l of supernatant were removed from the tube and transferred to a fresh tube on dry ice. The supernatant was dried for 5 hours at 4°C using a speed vac (Labconco 7310020), then resuspended in 1 / 10th of the volume of the original supernatant in LC-MS grade water (provided by the Whitehead Institute Metabolomics Core) on ice. The resuspended metabolites were vortexed on high for 10 minutes at 4°C, then centrifuged on a table top centrifuge on max speed for 10 minutes at 4°C. The supernatant containing the endogenous metabolites and internal standards were transferred to LC-MS vials and liquid chromatography and mass spec was carried out by the Whitehead Institute Metabolomics Core. Metabolomics Analysis for quantification of GSSG and GSH ratio
[0203] FreeStyle (Thermo Scientific, Version 1.3 ) was used to check quality, mass shift, and retention time drift for each metabolite. The MS2 spectra for each metabolite was also verified in FreeStyle. TraceFinder (Thermo Fisher Scientific, Version 4.1) was used to call metabolite peaks and determine raw peak areas. The peak detection defaults were as follows - Mass tolerance: 5 ppm, Retention time window: 30 sec, Ion Ratio Window type: relative + / - 20%, Ion coelution (min) 0.100, Detection algorithm: ICIS (Area noise factor: 5, Peak noise factor: 10, Baseline window: 40, Noise method: repetitive, Min peak width: 3, Multiplet resolution: 10, Area tail extension: 5). Each peak was manually verified to have the correct shape, retention time, and m / z.44 / 81 W0571.70066WO0013645924
[0204] Peak area ratios were determined by normalizing the raw peak area for each metabolite by the raw peak area of the appropriate internal standard.
[0205] During the mass spec run, a pooled sample made from pooling 5 ^l of each sample was run 4- 6 times as technical replicates to measure the reliability of detection for each metabolite—a coefficient of variation < 0.30 was used as a cutoff for metabolites to be measured reliably. Similarly, a dilution series of the pool was also run to determine whether each metabolite was in the linear range of detection—A correlation coefficient R < 0.95 was used as a cutoff.
[0206] Two-tailed student's t-test was used to generate p-values. Statistical analysis was performed using Prism Version 9.4.0 (GraphPad, La Jolla, CA). Western Blotting
[0207] Cells were treated according to the specified treatment protocol, then the media was aspirated off and cells were washed once with ice-cold PBS (Gibco, 10010-023) on ice. The PBS was then removed and Cell Lytic M (Sigma-Aldrich, C2978) supplemented with protease and phosphatase inhibitors (Sigma-Aldrich, 11873580001 and 4906837001) was added to each well to lyse the cells. The cells were scraped with a plastic cell scraper, and the lysates were transferred to a 1.5 ml eppendorf tube and allowed to rotate on a rotator for 15 minutes at 4°C. The lysates were sonicated on ice water (15 seconds on, 20 seconds off, 30% amplitude, for 3 cycles, Fisher Scientific, FB120 Model CL-18) and then centrifuged at 12,000 x g for 15 minutes. The supernatant was transferred to a fresh 1.5 ml tube and the protein concentration was quantified using a BCA Protein Assay Kit (Life Technologies, 23250) according to the manufacturer’s instructions. Dithiothreitol (DTT) and XT Sample Buffer 4x (BioRad, 1610791) were added to the protein lysate to a final concentration of 100mM and 1x, respectively.5-35^µg of proteins were separated on 10% Criterion™ XT Bis-Tris Protein Gel (BioRad, 3450112) in XT MOPS running buffer (Bio-Rad Laboratories, 1610788) at 100^V. Proteins were transferred to a 0.45-µm PVDF membrane (Millipore, IPVH00010) in ice-cold transfer buffer (25^mM Tris, 192^mM glycine, 20% methanol) at 300^mA for 2^hours at 4^°C. Membranes were blocked in either 5% nonfat milk (LabScientific, M0842) dissolved in TBST (2% Tris-HCl pH 8.0, 1.3% 5^M NaCl, 0.05% Tween 20) or 5% BSA (VWR, 102643-516) in TBST for 1^hours at room temperature. Membranes were then incubated overnight at 4^°C with primary antibodies (list below) diluted in 5% nonfat milk in TBST or 5% BSA in TBST. Membranes were then washed three times in TBST for 5^minutes at room temperature and then incubated with donkey anti-rabbit IgG (Cytiva Life Sciences, NA934-1ML, 1:10,000 dilution) or sheep anti-mouse IgG (Cytiva Life Sciences, NXA931V, 1:10,000 dilution) diluted in 5% nonfat milk in TBST for 1^hours at room temperature. Membranes were washed three times for 10 minutes in TBST. Membranes were developed with ECL substrate (Millipore, WBKL20500) and imaged using a CCD camera (BIO RAD, 1708265). The “analyze gel” tool on Fiji / ImageJ v2.1.0 / 153c was used to quantify immunoblot45 / 81 W0571.70066WO0013645924signal. A two-tailed student's t-test was used to generate p-values. Statistical analysis was performed using Prism Version 9.4.0 (GraphPad, La Jolla, CA). Primary antibodies for Western blotting: Anti-insulin receptor (Cell Signaling, 3025, dilution 1:1000) Anti-MED1 (Bethyl, A300-793A, dilution 1:1000) Anti-HP1^ (Abcam, ab109028, dilution 1:1000) Anti-FIB1 (Abcam, ab5821, dilution 1:1000) Anti-SRSF2 (Thermo Fisher, PA5-12402, dilution 1:1000) Anti-b-actin (Sigma Aldrich, A5441, dilution 1:10,000) Anti-phosphorylated IRS1 (Cell Signaling, 3070, dilution 1:1000) Anti-pIRS1 (Cell Signaling, 3070, dilution 1:1000) Anti-IRS1 (Cell Signaling, 2382, dilution 1:1000) Anti-H3 (Cell Signaling, 4499, dilution 1:1000) Live-cell imaging experiments
[0208] General imaging condition. Cells were plated on 35-mm glass bottom dishes (MatTek Corporation, P35G-1.5-20-C). For imaging doxycycline inducible proteins, 0.1 ^g / ml of doxycycline was supplemented to the media 8-12 hours prior to imaging. Cells were imaged for maximum 10 minutes inside an incubation chamber supplemented with warmed (37°C) humidified air and with 5% CO2.
[0209] Live-cell super-resolution microscopy. ZEISS LSM 980 with Airyscan 2 was used to acquire the super-resolution images of GFP- / HaloTag-tagged proteins. Cells were imaged with a ZEISS incubation system that stably maintained the samples at 37°C with 5% CO2 and humidified air.63X objective with oil immersion was used. For GFP-tagged proteins, 488 nm laser was used. For Halo- tagged proteins, cells were first incubated with media containing 100 nM Janelia Fluor 549 (Halo- JF549, Promega, GA1110) for 15 minutes. Following incubation, the cells were washed with fresh media and then cultured at 37°C with 5% CO2 for 10 minutes before imaging with 561 nm laser excitation and the mCherry filter for emission. Due to the various expression levels of different proteins, the laser power was adjusted for each protein, such that the top bright pixels were about to saturate the detection range (maximum brightness = 255 for 8-bit images). Following raw image acquisition, Airyscan super-resolution processing was performed via ZEN Blue.
[0210] Fluorescence recovery after photobleaching (FRAP). ZEISS LSM 980 with 63X objective, oil immersion was used to perform FRAP experiments on GFP-tagged proteins in live cells. Detailed configurations for different protein targets are summarized in Table 1. Basically, minimal 488 nm laser excitation was applied to minimize laser-induced photodamage to the sample (Table 1). For each single FRAP experiment, several initial frames were recorded first, followed by photobleaching with 100% laser power of a 2^m-by-2^m square region. For insulin receptor, this squared region contained46 / 81 W0571.70066WO0013645924a portion of the plasma membrane. For MED1, HP1^, FIB1, and SRSF2, this region contained at least a nuclear condensate. For GFP, this region was randomly located in the nucleus or in the cytoplasm. The number of bleaching cycles is reported in Table 1. After photobleaching, fluorescence recovery was recorded over time. Raw image series were processed via ZEN Blue (2D Airyscan processing), followed by drift correction using a cross-correlation algorithm. Averaged intensity measurements from an unbleached region were used to correct for the photobleaching occurring during the time lapse image acquisition. For insulin receptor, the fluorescence signal analysis was limited to the plasma membrane and was manually selected in ZEN Blue. For MED1, HP1^, FIB1 and SRSF2, the fluorescence signal analysis was limited to the nuclear condensate which was automatically selected by custom code in MATLAB (by fitting the cumulative distribution of pixel-wise intensities of each FRAP region to a two-step function, with the first step capturing the background pixels and the second step capturing the bright pixels with enriched fluorescent signal). For GFP, the fluorescence signal analysis was the entire 2^m-by-2^m square region. The intensities from different frames were further normalized through the following linear transformation: the averaged intensity of pre- photobleaching frames was mapped to 1, while the intensity right after photobleaching was mapped to 0. Multiple normalized FRAP curves under the same condition were combined together to obtain the MEAN and SEM of each frame. A two-tailed student's t-test was used to generate p-values comparing the last time points. All FRAP experiments were performed twice using 4 biologically independent samples.
[0211] Single particle tracking (SPT). ZEISS Elyra 7 with 63X objective, oil immersion was used to perform SPT experiments on Halo-tagged proteins in live cells. The detailed sample preparations and configurations of SPT for different proteins are summarized in Table 2. Basically, cells were stained with both Halo-(PA)JF549 (generous gift of the Lavis Laboratory) and Halo-JF646 (Promega, GA1120) for labeling HaloTag-tagged proteins (see Table 2 for Halo dye concentration used). One dye was used to locate the bulk distribution of the proteins and the second dye was used for tracking single molecules. After staining, dyes were washed by incubating with fresh EMEM for at least 10 minutes. For Insulin receptor and HaloTag alone, the cells were incubated with EMEM containing Hoechst 33342 (Thermo Scientific™, 62249) for 10 minutes to stain the nuclei. Following nuclear staining, the cells were washed with EMEM and directly imaged. HILO illumination was used during the tracking. There are five major steps in the SPT analysis: pixelwise peak detection, subpixel localization of the peaks, reconnection of the peaks (to construct trajectories), validation of trajectories, and mobility estimation based on trajectories. For the first three steps, point spread functions (PSFs) from single molecules were detected, subpixel-localized and reconnected with custom code in MATLAB based on the published multiple-target tracing (MTT) tool (6). During the detection step, for each pixel, two hypotheses H0and H1were compared based on a generalized likelihood ratio test, where H0defines the non-presence of particles and H1the presence of a particle at the center of the pixel. Valid peaks were identified with a constant false alarm rate (≈1.5×10-6).47 / 81 W0571.70066WO0013645924Additional peaks were identified with a B-spline wavelet filter (7). The subpixel localization of the peaks was performed by maximizing the likelihood of the PSF to match the local intensity distribution of a 7x7 pixel area using Gauss-Newton regression. The construction of the trajectories was performed based on the multiple-target reconnection as described in MTT (6), with the prior maximum diffusion coefficients, the disappearance probability for blinking and maximum number of disappearance frames summarized in Table 2. Using bulk distribution or nuclear stain as a reference, only trajectories within the desired regions were validated for analysis. For insulin receptors, the plasma membranes were manually selected by drawing polygons via MATLAB; for other proteins of interest, nuclei or nucleoli regions were labeled by a deep learning based algorithm Cellpose (8).
[0212] Mobility quantification of SPT trajectories. The underlying modes of motion of a protein particle can be directional motion, diffusive motion (including normal diffusion and sub-diffusion), or a combination of directional and diffusive motions, and the apparent mode of motion can vary depending on the duration of tracking as well as the temporal and spatial resolution of the measurements. In this work, the duration of tracking mostly ranges from 0.02s-0.1s, with a temporal resolution of 4ms-10ms, and spatial resolution of 30nm-80nm. Under these configurations, we do not expect to capture the rapid interdomain protein dynamics, neither do we expect to capture the directional motion due to slow deformation of plasma membrane nor large-scale chromatin movements. We expect to capture most mesoscale (0.1^m-1^m) diffusive behaviors of proteins in plasma membrane or in nucleus. Although the diffusive motion includes both normal diffusion and sub-diffusion, we will not be able to distinguish them well given the limited spatial resolution (as large as 80nm) as well as the limited number of frames of each single protein molecule we can track (mostly within 5-10 frames). Therefore, to quantify the mobility of a given SPT trajectory, we began with the most naïve measurement: the slope between MSD and timelag, which is proportional to the apparent diffusion coefficient (D) (slope = 4D). We define a jump as a change in position between two consecutive frames of a trajectory. Only trajectories with at least 5 jumps were selected. For trajectories with more than 20 jumps, only the first 20 jumps were used for estimating the D. A linear regression between MSD and timelag with an additional zero-order term (localization error due to limited spatial resolution) was used to estimate the apparent diffusion coefficient in 2D. Only mobile molecules (D^0.01 ^m2 / s for endogenous proteins and D^0.1 ^m2 / s for exogenous HaloTag) were selected for the analysis. Mann-Whitney test was used to evaluate the statistical significance between different conditions. All SPT experiments were performed twice using 4 biologically independent samples.
[0213] Table 1. FRAP configurations for GFP-tagged POIs.48 / 81 W0571.70066WO001364592449 / 81 W0571.70066WO0013645924
[0214] Table 2. SPT configurations for Halo-tagged POIs50 / 81 W0571.70066WO0013645924Variant annotation
[0215] Variants and their genomic coordinates (hg38) were obtained from ClinVar (ftp.ncbi.nlm.nih.gov / pub / clinvar / vcf_GRCh38 / clinvar_20230903.vcf.gz, ftp.ncbi.nlm.nih.gov / pub / clinvar / tab_delimited / variant_summary.txt.gz). Only germline missense variants were considered. We only considered variants with at least one clinical significance annotation as Pathogenic or Benign. The number of missense variants considered in ClinVar is 52,188.
[0216] When needed, variants were annotated with impact on protein sequence and other measures of computationally predicted pathogenicity (SIFT, PolyPhen, CADD etc) using Ensembl VEP 110. Gene-level and 1kb-window constraint metrics were obtained from gnomAD v4 and v3, respectively.
[0217] For all downstream analyses, variants were counted as protein variants—i.e., DNA variants resulting in the same protein-coding alteration, regardless of their similarity or differences at the DNA level, were counted as the same variant. Variants were mapped to gene, then mapped to proteins using mapping from Uniprot Swiss-Prot (ftp.uniprot.org / pub / databases / uniprot / current_release / knowledgebase / idmapping / by _organism / HUMAN_9606_idmapping_selected.tab.gz, ftp.uniprot.org / pub / databases / uniprot / current_release / knowledgebase / idmapping / by _organism / HUMAN_9606_idmapping.dat.gz), using the gene’s HGNC ID to Uniprot-KB Accession ID of the canonical isoform.51 / 81 W0571.70066WO0013645924Simulations of proteins with surface-exposed cysteines
[0218] Brownian dynamics simulations of proteins with surface cysteines (available at github.com / kannandeepti / protein_mobility) were performed by adapting the polychrom software package (doi.org / 10.5281 / zenodo.3579473), a thin wrapper around OpenMM (9). We model proteinsas self-avoiding, spherical particles of diameter ^^^^ ^ ^^^ which interact through a repulsivepotential,represents a finite energy barrier to allow particle overlaps when ^^^ 0 ^^+^^^^ (FIG. 12B). Based onour estimates, the average number of surface-exposed cysteines on proteins that have surface-exposed cysteines is two (see Supplementary Text). Thus, simulated protein spheres are bonded to two surface“cysteines” via the harmonic potential ^^.^^^^^ " ^^.^ , where ^ is chosen such that the averageextension of the bond is 0.01 when the bond energy is equal to ^ / ^. A harmonic angle potential of theform ^^.123 " ^4^56 with 1 ^ ^^^ / ^^enforces that the two cysteines are on opposite sides of theprotein sphere. Cysteines on separate proteins can form intermolecular disulfide bridges, which are modeled via a short-ranged attractive potential of the same form as Eq.1 (FIG.12A). In this case,^ ^^"^788^ is the depth of the attractive potential and ^^^the cysteine-attraction radius is set to ^788^ ^ ^^^^ These parameters were chosen to minimize many-to-onebonding of cysteines, i.e. such that proteins with only 1 surface cysteine predominantly form dimers instead of higher order multimers (FIG.11D). We simulate 1000 proteins with periodic boundary conditions in a cube whose side length is chosen such that the proteins occupy 30% of the cube volume. Consistent with estimates of the fraction of proteins with surface-exposed cysteines in the cell (see Supplementary Text). 50% of the simulated proteins have two surface cysteines which can form disulfide bonds according to the value of ^788^, and the surface patches of the other 50% do not participate in disulfide bonding. As seen in FIG.4C, the proteins without surface-exposed cysteines diffuse more slowly at high ^<^^^^ since they are diffusing through a mesh of crosslinked proteins. However, this mobility reduction is far less pronounced than that of the proteins with surface exposed cysteines, which form dimers and multimers at high ^<^^^^ (FIG.11C).
[0219] For each value of ^788^, the diffusion coefficient is quantified as the slope of the protein’s mean squared displacement over time. We normalize the diffusion coefficient to the mean of all datapoints for ^788^ ^= ^^^^^.^ / ^ and fit the resulting data to a decreasing S-curve of the form(solid line in FIG. 11A).each simulation, we also calculate the fraction of cysteines that participate in intermolecular disulfide bonding, i.e. the fraction of sticky patches which are within ^788^of a neighboring patch (FIG.11B).This data is fit to an increasing S-curve of the form H2^ 6 ^^ ^to obtainsolid line in FIG.11. The fraction of bonded cysteines can be mapped to the oxidative state of a cell as measured by the ratio of oxidized to reduced glutathione (GSSG / GSH) using a chemical reaction52 / 81 W0571.70066WO0013645924model (next section). For a given value of ^788^, we use H2^788^6 to compute the fraction of bonded cysteines as obtained from the simulations. FIG.11C then allows us to read off the corresponding value of GSSG / GSH. Thus, we relate ^788^to the oxidative state of the cell. This in turn allows us to graph the diffusion coefficient as a function of the oxidative state in FIG.4C, where the solid lines represent the fit relationships in FIG.11A-C and points show raw simulation data. Chemical reaction model for coupling protein-protein disulfide bonding to redox state
[0220] To investigate the coupling between cellular redox and the propensity for proteins with surface exposed cysteines to form disulfide bonds, we develop a minimal chemical reaction model. In this model, we assume the level of oxidative stress is represented by a fixed concentration of hydrogen peroxide BI J G , which is the predominant reactive oxygen species (ROS) in the cell (9). We also assume that glutathione is the primary species responsible for regulating ROS, given that it is the most abundant non-protein antioxidant in the cell (10). Glutathione (GSH) and proteins with surface exposed thiol groups (PSH) are oxidized in the presence of I J and can form disulfide bridges via the following set of reactions:
[0221] The second-order rate constant of the oxidation of the thiol of a glutathione is ^TU= 0.42 M-1s-1(11) and the rate constant for the oxidation of the thiol of a protein is2.3 M-1s-1(based on the oxidation of Cys-34 in BSA) (11). GSOH and PSOH are highly reactive intermediate productswhich then undergo a much faster disulfide bridging process (^ VWW X ^TU; ^TU ) with another thiol(12). We set kSS = 50 ^TUV. We assume that proteins can form disulfide bonds with other proteins (PSSP) or with glutathione (PSSG) at equal rates.
[0222] Intramolecular disulfide bonds of proteins are removed by a thiol group interchange reaction with GSH (13). We reason that removal of intermolecular disulfide bonds could be achieved by a similar mechanism,53 / 81 W0571.70066WO0013645924where we take ^^[\ 0.15 M-1s-1(estimated from the disulfide interchange between GSSG and 2- Mercaptoethanol at pH=7) (14). Ultimately, GSSG is reduced by NADPH, DKLLKO]bb^b_b`Pa^^KLI,while the total concentration of glutathione (15) and surface-exposed protein cysteines (see Supplementary Text for estimation of [Cys]) are conserved at 1mM: K8T8 ^ BKLIG ^^BKLJIG ^ BQLLKG ^ ^BKLLKG ^^ 1mMQ8T8 ^ BQLIG ^^BQLJIG ^ BQLLKG ^ ^BQLLQG ^^ 1mM.We simulate the ordinary differential equations (see Supplementary Text) associated with the above chemical reactions for the dynamics of [GSOH], [PSOH], [GSSG], [PSSG], and [PSSP] usingMATLAB with ode45. The rate of glutathione reduction ^cdefg ^ ^^-^ h ^^Cis-1 is chosen suchthat when the steady state [GSSG] / [GSH] ratio is 0.01 (physiological redox ratio (16)), BI J G is 10nM (physiological hydrogen peroxide concentration (9)).
[0223] We then determine the fraction of surface-exposed cysteines that participate in protein-protein disulfide bonding, ^BQLLQG,Q8T8, as a function of the steady state ratio [GSSG] / [GSH] (FIG. 11C). Note that even at high ROS, this fraction is capped at 0.62 since surface-exposed cysteines are equally likely to bind to a thiol on a neighboring protein or the thiol of glutathione. Our protein simulations do not include glutathione. Thus, the fraction of bonded cysteines as computed from simulations, which can go up to 1.0 (FIG. 11B), corresponds to the fraction of cysteines participating in inter-protein disulfide bridges in our chemical reaction model. To map ^788^to GSSG / GSH, we only consider simulation data for which the fraction of bonded cysteines is less than 0.62. Statistics
[0224] The test used for statistical analysis is reported in the figure legend. * represents p < 0.05, ** represents p < 0.01 and *** represents p < 0.001. Illustrations
[0225] PyMOL (17) was used for protein illustrations in FIG. 4A. Cartoon illustrations were made using BioRender (BioRender.com). Figures were generated using Adobe Illustrator v27.0.1 Example 3: Supplementary Text Evaluation of the comparability between FRAP and SPT
[0226] There are two biophysical parameters inferred from either method that can be compared to address this evaluation: (1) fraction of immobile molecules; (2) apparent diffusion coefficient of mobile molecules. For (1), we used five endogenously tagged proteins (IR, MED1, HP1^, FIB1, and SRSF2) which are known to have a “bound state” as examples; for (2), we used exogenously expressed GFP vs HaloTag which are roughly homogenously diffusive across nucleoplasm as examples.54 / 81 W0571.70066WO0013645924
[0227] Evaluation via the fraction of immobile molecules. For the SPT dataset, we firstly determined the total number of diffusivity states by counting the minimum gaussian functions needed to fit the logD distribution of individual molecules (FIG.7A) (11). We found MED1 can be well-fitted by 2 states, and other targets are well fitted by three states. Using the total number of diffusivity states as a prior parameter, we then applied SpotOn (12) to estimate the fraction of molecules in the immobile state. For FRAP dataset, we fitted the normalized recovery curve to the following equation:Where ^ " H would be the immobile fraction. The fraction of immobile molecules estimated via twomethods are indeed comparable (FIG.7B): FIB1 always have the highest immobile fraction; IR, HP1^, and SRSF2 in both SPT and FRAP showed relatively lower immobile fractions. The immobile fractions estimated by FRAP were a bit lower compared to the same protein target estimated by SPT. Given that SPT can capture not only the stable immobile events, but also those transient immobile events in a timescale as short as ~10-2s, while FRAP is only sensitive to intermediate / long-term immobile events in a timescale of ~101s, this could explain why the immobile fractions estimated by FRAP is always a little bit lower.
[0228] Evaluation via the apparent diffusion coefficient of mobile molecules. The HaloTag tagged with a JF646 molecule (~34kDa in total) and GFP (~27kDa) have comparable protein size, we thus expect that the intrinsic diffusion coefficients of these two proteins should be similar. For SPT, we estimated the apparent diffusion coefficient of HaloTag by calculating the averaged apparent diffusion coefficient of mobile molecules (selecting trajectories with D>0.1 µm2 / s). For FRAP, we estimated the apparent diffusion coefficient of GFP by minimizing the difference between the experimental FRAP process and a theoretical diffusion process of photobleached molecules. We modeled the theoreticaldiffusion process of a photobleached region (m h m) as the following partial derivative equation (PDE)problem: 0q 0 m; ^ 0 r 0 m; ^ t ^;ou[v^ ^ ^; ^ou[vw ^ ^;^^^^^^^^^^ = r = m; ^ x ^;ouyv^ ^ ^; ^ouyvw ^ ^;^^^^^^^^^^ = q = m; ^ x ^;ou8v^ ^ ^ " z2q; r6;^^^^^ = q = m; ^ = r = m^
[0229] In this PDE problem, o2q; r; ^6 is the normalized density of photobleached molecules of acertain pixel 2q; r6 at certain time ^. q; r ^ ^^{^^m are boundaries. z2q; r6 is the normalized pixelwiseintensity (i.e., normalized density of intact molecules) right after photobleach (^ ^ ^), thus ^ " z is thedensity of photobleached molecules at ^ ^ ^ (the total normalized intact molecules plus photobleachedmolecules always equals 1 within each pixel). In the spirit of separation of variables, one general analytical solution that satisfied the boundary conditions was derived as:55 / 81 W0571.70066WO0013645924^ Where the coefficients of different modes were computed as: ^^^?^ rm
[0230] The > is determined when the 2-norm residual of the o2q; r; ^6 throughout the whole FRAPprocess between the experimental measurement and the theoretical prediction are minimized. The calculations were done by custom MATLAB code. The diffusion coefficient of HaloTag estimated from SPT is 5.3±0.2 ^m2 / s, and the diffusion coefficient of GFP estimated from FRAP is ~6 ^m2 / s (FIG.7C). Given that the relation between the molecular weight (M) and diffusion coefficient is D ^ M−0.33(13), the diffusion coefficient of a “weighted GFP” (~34kDa) estimated from FRAP would have been ~5.5 ^m2 / s. Therefore, the apparent diffusion coefficient estimated via two methods are comparable indeed. Estimation of the axial detection range
[0231] In a fixed sample with sparsely labeled PAJF549 molecules, the exact laser / filter / camera settings used for live-cell tracking of IR were adopted followed by performing a z-stack scanning. Through this manner, we are able to estimate the average axial range that allows the same molecule to be consecutively tracked. We concluded that dz peaked at ~900nm for our specific setup (FIG.8A). This value is used in SpotOn for corrected estimation of the fraction of immobile molecules. Estimation of the false positive identifications of trajectories in SPT
[0232] The sources of false positive identifications of proteins in SPT include pixel noise, auto- fluorescence, and non-specific dye staining (restricted to PAJF549). The control experiments are summarized in Table 3. The overall rate of false positive identification of trajectories is either ~5% (for JF646 staining) and ~12% (for PAJF549 staining) at maximum. Therefore, we concluded that the SPT dataset of the actual experiments are dominated by trajectories from real proteins of interest.
[0233] Table 3. Sources of false positive identifications of proteins in SPT56 / 81 W0571.70066WO0013645924Estimation of the localization uncertainty
[0234] In a fixed sample with sparsely labeled HaloTag-PAJF549 molecules, the exact experimental settings and analyzing pipeline used for live-cell tracking of IR were adopted for the fixed-cell SPT. The distribution of apparent diffusion coefficient fitted from individual molecules in fixed sample centered around D~0.01 ^m2 / s (FIG.7B), and this pseudo diffusivity is due to the localization uncertainty of single molecules at each frame. Therefore, we used 0.01 ^m2 / s as the lower bound cutoff when filtering for truly mobile molecules for endogenous protein targets based on the limitation of the localization uncertainty. As for exogenously expressed HaloTag alone, because most molecules are diffusive indeed, we can apply a higher cutoff (D>0.1 ^m2 / s) to select mobile molecules in order to eliminate any false positive mobile molecules without increasing the chance of false negative elimination (FIG.7C). Validation of reconnecting during trajectory reconstruction
[0235] If the prior maximum allowed diffusion coefficientduring reconnection is smaller than the typical diffusivity of the protein of interest, it will result in early stop of reconnecting the localizations of the same molecule (FIG.7D), and the estimated apparent diffusion coefficient will be close to the Dmax. The Dmax we chose when reconnecting sequential localizations (Table 2) turned out to be much larger than the apparent diffusion coefficients estimated from the final trajectories (FIG. 1E). This observation suggests that the prior Dmax is large enough in terms of guaranteeing a high successful rate of reconnecting the localizations from the same molecule in sequential frames together. However, even if the Dmax is large enough, the tracking process will still stop at some point, mainly due to either the photobleach of the dye molecule, or the molecule moving out of the focus (FIG.8E). However, when the localization density per frame reaches certain threshold, there will be an increased likelihood that the trajectories of two different molecules will be entangled together (or say, the “ambiguous connection”). In this situation, we expect to see an increase in the average number of jumps per trajectory (FIG 8F). Here, we use IR-Halo tracking as an illustration. We generated IR-Halo SPT data with different localization density per frame, followed by reconnecting the localizations with the prior Dmax=6 ^m2 / s. We found that the average number of jumps per trajectory start to increase with localization density when the localization density is above 0.01 ^m2 / frame, and we confirmed that the localization densities of our actual experiments are always below this threshold density (FIG.7G). Therefore, we concluded that the prior Dmaxchosen for reconnecting are large enough to not miss the right connections within the same molecule, and the localization densities of our actual experiments are low enough to avoid significant “ambiguous connection” given the prior Dmax.57 / 81 W0571.70066WO0013645924Estimation of the average number of surface cysteine per protein and the concentration of surface cysteine
[0236] We used iCysMod (18) to estimate the average number of surface cysteines per protein across the whole proteome. There are 18,350 proteins in the proteome, among which we tried two commonly used relative solvent accessibility (RSA) cutoffs to evaluate the cysteine surface exposure as summarized in Table 4. Based on the calculation in Table 4, a coarse estimation of the average number of surface cysteines per protein among proteins with at least one surface cysteine would be around 2. The total number of protein molecules per cubic micron in the cell is 2-4 million (19), which yields 3.3-6.6 mM of proteins. Even though some measured values of cellular protein concentration can be 3 times lower (19), the protein concentration should still be at least on the order of 1 mM. Given that around 50% of the proteins have at least one surface cysteine, among which each protein has 2 surface cysteines on average, the final surface cysteine concentration should be at least 1mM*50%*2 = 1mM.
[0237] Table 4. Estimation of surface cysteine exposure.Simulation hyperparamater tuning and validation
[0238] Since disulfide bonding is modeled via a pairwise attractive potential between surface- exposed cysteines, it is possible for one cysteine to attract more than one binding partner on neighboring proteins. Such many-to-one bonding events can be minimized by tuning the following simulation hyperparameters: the cysteine-cysteine attraction radius, ^788^(FIG.12A), the protein- protein repulsion radius, ^^^^, the protein-protein repulsion energy ^^^^(FIG.12B), and the spring constant ^ for the harmonic bonds connecting each protein to each of the cysteines on its surface.
[0239] For a given set of parameters (^788^; ^^^^; ^^^^^; ^), we calculate the equilibrium cysteine-cysteine distance ^^^and bond extension q^^^that minimizes the energy of a trimer of proteins withjust one surface cysteine, ^8^^~^^2^; q6 ^^ ^^^788^2^6 ^^ ^^^^^^2^ ^ ^^2^^.^ ^ ^q66 ^^ ^^,^^q(FIG.12C). Analogously, we compute the values of ^^and q^^that minimize the energy of a dimer,
[0240] We then choose a parameter set where ^8^^~^^2^ ^^ ; q ^^ 6 t ^ t ^^^~^^2^ ^; q ^6 for allvalues of ^788^ ^ ^ B^; ^^G^^ / ^. From this approach, we identified that the choice of ^788^ ^ ^^^; ^^^^ ^58 / 81 W0571.70066WO0013645924^^^; ^^^^ ^ .^^ / ^; ^ ^ ^^ / ^,2^^^^6 ensured that trimers are always less energetically favorablethan dimers. In FIG.12D, we confirm that using these parameters, proteins with one surface cysteine only form dimers even at high values of ^788^. ODEs of the chemical reaction model for coupling protein-protein disulfide bonding to redox stateBQLIG ^ Q8T8 " BQLJIG " BQLLKG " ^BQLLQG^where BKLIG ^ K8T8 and BQLIG ^ Q8T8 at t = 0. BI J G is a constant value for each simulationranging from ^^ " ^ uM to 10 uM.Example 4: Protein mobility and functional activity
[0241] Diverse biochemical reactions are collision limited, and reduced rates of protein diffusion would be expected to reduce functional outputs (FIG.23A). A mathematical model was produced, and tests were conducted in vitro in cells designed to confirm that reduced protein mobility confers reduced enzymatic activity with the IR (FIG.23B). Phosphorylation of substrates by protein kinases such as the IR (FIG.23C), which would be expected to be collision limited, should be reduced when protein mobility is decreased. Mathematical modeling of phosphorylation of substrates by protein kinases showed that reaction outputs are reduced when protein mobility is decreased (FIG.23D). IR and an IR substrate protein, IRS1, were purified and subjected to environments that would slow or accelerate the mobility of proteins in vitro. When the mobility of proteins was reduced in vitro by increasing glycerol concentration, and thus viscosity, reduced phosphorylation of IRS1 by IR was observed (FIG.23E). Agitation of solutions can increase protein mobility and thus the collision rate of molecules, and agitation was found to partially rescue the reduction in phosphorylation with elevated viscosity (FIG.23F). These results support the expectation that reduced protein mobility reduces the kinase activity of IR.59 / 81 W0571.70066WO0013645924
[0242] To further probe the relationship between protein mobility and functional output in cells, the BirA / AviTag system was used, which was previously shown to exhibit collision-limited activity. In this system, where the biotin ligase BirA biotinylates its substrate AviTag, fusion of BirA with SNAP- tag (BirA-SNAP) and fusion of the AviTag to the protein mobility biosensor HaloTag-Cys allowed for both protein mobility and BirA activity to be monitored (FIGs 23G and 23H) in HepG2 cells. Under conditions of pathogenic signaling in cells, the reduction in protein mobility correlated with reduced biotinylation (FIGs.23I–23K). These results support the concept that reduced protein mobility leads to reduced functional activity.
[0243] The cellular processes that have been reported to be dysregulated in chronic syndromes include reduced phosphorylation of substrates, altered gene regulation, and repression of heterochromatic repeats, among others. To confirm that these processes are indeed dysregulated in cells under the conditions studied here, assays were conducted in cells that were treated with normal and with pathogenic insulin. The results showed evidence of dysregulated features noted previously in chronic syndromes (FIG.23L). Phosphorylation of IRS1 was reduced, genes occupied by the mediator coactivator subunit MED1 were expressed at lower levels, and there was elevated expression of heterochromatic repeats. These results are consistent with a model where reduced protein mobility can contribute to the diversity of dysregulated processes that are evident in chronic disease. Methods PiggyBac vectors for doxycycline-inducible expression of GFP, HaloTag or SNAP
[0244] Sequences of SiriusGFP, HaloTag, or SNAP-tag were cloned using NEBuilder HiFi DNA Assembly Master Mix into a doxycycline- inducible, PiggyBac vector, which was described in our previous publication (Dall'Agenese et al 2022). PiggyBac vectors for doxycycline inducible expression of AviTag-HaloTag-Cys and BirA
[0245] Constructs for doxycycline-inducible HaloTag-Ser and HaloTag-Cys were generated by inserting coding sequences for the constructs into PiggyBac vectors. The AviTag-Halo-Cys construct encodes the coding sequence for HaloTag-Cys construct described above with the AviTag peptide (GLNDIFEAQKIEWHE) (SEQ ID NO: 17) with FLAG and HA tags all separated by flexible linkers (PGGSG) (SEQ ID NO: 20) fused to the N-terminus. The BirA construct encodes a coding sequence for a human codon-optimized version of BirA with a C-ter- minal flexible linker (GAPGSAGSAAGGSGA) (SEQ ID NO: 6) followed by a SNAP-tag and HA-tag. Constructs were made using NEBuilder HiFi DNA Assembly Master Mix. Doxycycline inducible expression cell line generation
[0246] A PiggyBac transposon system (Systems Biosciences) was used for stable integration.1x10^6 wildtype HepG2 cells were plated in a 6-well plate and simultaneously transfected with 0.5 mg of the PiggyBac expression vector and 0.2 mg of a plasmid encoding PiggyBac transposase (gift of Jaenisch60 / 81 W0571.70066WO0013645924lab) using Lipofectamine 3000 (Invitrogen, L3000).24 hours post-transfection, transfection media was replaced with fresh media, EMEM with 10% FBS.72 hours post-transfection, the cells were treated with media containing 150 mg / mL hygromycin (Thermo Fisher Scientific, 10687-010) (for cells edited to express AviTag- Halo-Cys) or 2 mg / mL puromycin (Millipore, P4512-1MLX10) (for cells edited to express BirA-SNAP). Selection media was refreshed every 3 days and un-transfected cells were also treated with hygromycin as a positive control, confirming the efficiency of selection. Typically, 7-10 days were required for the hygromycin to kill all the non-transfected HepG2 cells. For cells with doxycycline-inducible co-expression of AviTag-Halo-Cys and BirA-SNAP, additional sorting was applied to get cells with low expression of both proteins and minimized cell-to-cell expression variability when performing doxycycline induction: cells were treated with 10 ng / mL doxycy- cline overnight, followed by co-staining with 50 nM of Halo-JF549 and 50 nM SNAP-JF646 for 20 minutes and proceeding to FACS sorting. Cell treatments for HepG2 Insulin treatment
[0247] The cell plating and insulin treatment regime used in this study is the same as the one previously published (Dall’Agenese et al.2022) Cells were seeded at a density of 32,000 cells / cm2 onto 35-mm glass bottom dishes (MatTek Corporation, P35G-1.5-20-C). Starting the day after plating, cells were serum-starved for two days by washing the plates twice with EMEM media without FBS (EMEM) and maintaining the cells in EMEM for 48 hours. Then cells were treated with EMEM supplemented with 0.125% fatty acid-free BSA (Sigma-Aldrich, A8806-5G) (‘‘EMEM- BSA’’) that contained either 1) 0.1 nM insulin (Sigma-Aldrich, I9278-5ML) or 2) 3nM insulin, which are the concentrations of insulin in the portal vein of healthy and insulin resistant patients. The media was refreshed twice per day (every ~12 hours) for 3 days. This treatment regime produced either a baseline ‘‘normal’’ signaling state or a ‘‘pathogenic’’ elevated signaling state. To ensure that the protein mobility was due to the cellular state and not due to differences in the concentration of insulin, insulin wash-outs were performed. Insulin wash-outs were performed by extensively washing cells with EMEM: the cells were washed six times each with 2mL of EMEM, including three quick washes, two 5 min washes, and a 15 min wash at 37°C. Cells were then acutely treated with 3 nM insulin for 5 minutes in EMEM-BSA at 37°C with 5% CO2 in a humidified incubator and then subjected to the desired assay. BirA / Avi Assay
[0248] Cells were treated with the insulin treatment described above. For each treatment with insulin besides the acute stimulation, 1 ng / ml doxycycline was added.10 mM biotin (Millipore, B4501) was added to the acute insulin treatment and cells were incubated at 37°C 5% CO2 for 5 minutes and subjected to the desired assay.61 / 81 W0571.70066WO0013645924
[0249] SPT imaging and analysis are the same as described in the Live-cell imaging experiments section regarding SPT (see Example 2). Western Blotting Protein preparation
[0250] HepG2 cells were treated according to the specified treatment protocol, then the media was aspirated off and cells were washed once with ice-cold PBS (Gibco, 10010-023) on ice. The PBS was then removed and Cell Lytic M (Sigma-Aldrich, C2978) supple- mented with protease and phosphatase inhibitors (Sigma-Aldrich, 11873580001 and 4906837001) was added to each well to lyse the cells. The cells were scraped with a plastic cell scraper, and the lysates were transferred to a 1.5 ml eppendorf tube and allowed to rotate on a rotator for 15 minutes at 4°C, then centrifuged at 12,000 x g for 15 minutes. The supernatant was transferred to a fresh 1.5 ml tube and the protein concentration was quantified using a BCA Protein Assay Kit (Life Technologies, 23250) according to the manufacturer’s instructions. Preparations of western blot samples
[0251] 2-mercaptoethanol and Native Sample Buffer (BioRad, 1610738) were added to the protein lysate to final concentrations of 2.5% and 1x, respectively, boiled for 5 minutes at 95° C and allowed to cool completely before addition of streptavidin (Invitrogen, 43-430-2) to a final concentration of 10mM to cause a shift in molecular weight of proteins that were biotinylated by BirA. Running western blot samples
[0252] 5-35 mg of proteins were separated on 10% or 4-12% Criterion XT Bis-Tris Protein Gel (BioRad, 3450112, 3450125) in XT MOPS running buffer (Bio-Rad Laboratories, 1610788) at 100 V. Proteins were transferred to a 0.45-mm PVDF membrane (Millipore, IPVH00010) in ice-cold transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol) at 300 mA for 2 hours at 4 °C. Membranes were blocked in either 5% nonfat milk (LabScientific, M0842) dissolved in TBST (2% Tris-HCl pH 8.0, 1.3% 5 M NaCl, 0.05% Tween 20) or 5% BSA (VWR, 102643-516) in TBST for 1 hours at room temperature. Membranes were then incubated overnight at 4°C with primary antibodies (list below) diluted in 5% nonfat milk in TBST or 5% BSA in TBST. Membranes were then washed three times in TBST for 5 minutes at room temperature and then incubated with donkey anti-rabbit IgG (Cytiva Life Sciences, NA934-1ML, 1:10,000 dilution) or sheep anti-mouse IgG (Cytiva Life Sciences, NXA931V, 1:10,000 dilution) diluted in 5% nonfat milk in TBST for 1 hours at room temperature. Membranes were washed three times for 10 minutes in TBST. Membranes were developed with ECL substrate (Millipore, WBKL20500) and imaged using a CCD camera (BIO RAD, 1708265). The ‘‘analyze gel’’ tool on Fiji / ImageJ v2.1.0 / 153c was used to quantify immunoblot signal. A two-tailed student’s t-test was used to generate p-values. Statistical analysis was performed using Prism Version 9.4.0 (GraphPad, La Jolla, CA).62 / 81 W0571.70066WO0013645924Primary antibodies for Western blotting: Anti-HA (Cell Signaling, 3724, dilution 1:1000) Anti-pIRS1 (Cell Signaling, 3070, dilution 1:1000) Anti-IRS1 (Cell Signaling, 2382, dilution 1:1000) Modeling of the diffusion-limited tyrosine kinase receptor phosphorylationv
[0253] For a generic reaction } ^ ^ ^ ^^ at the molecular level, two basic steps are needed toaccomplish this reaction: (i) molecules A and B need to “find” each other, and (ii) they transform into an activated complex ^^. The first basic step is called “collision” and the second basic step is called “activation”. Accordingly, there are two fundamental rate constants that defines the overall reaction rate: the diffusion limited rate constant ^^describes the rate of collision through the diffusion process, and the inherent reaction constant ^^describes the rate of activation. While ^^is determined by theintrinsic chemical property, ^^ ^^2>¡ ^ > / 6¢ largely depends on the diffusion coefficients ofmolecule A and B, which are >¡and > / , respectively. ¢ is the characteristic length-scale, defined below.
[0254] The exact relation between the overall reaction rate and the two fundamental rate constants is:
[0255] In this equation,is the center-to-center distance when spherical molecules A and B touch, U(r) is the potential between molecules A and B when spaced by a center-to-center distance r, ^ / ^ has the dimension of energy as the product of Boltzmann constant and temperature.
[0256] We then use the receptor tyrosine kinase phosphorylation reaction in the collision-limited realm as an example to quantify the relation between protein mobility (D) and protein functional activity (k) in cell:
[0257] Equal diffusion coefficients (D) and protein sizes (R) for substrate and enzyme were assumed for simplicity. To draw the k-D relation, additional parameters / functions need to be determined, including R, ^2^6, ^ / ^, ¢, and ^^. • The radius of receptor tyrosine kinases is estimated to be R=3 nm. • For ^2^6, we adapted a 10-5 Lennard-Jones potential in the colloid-type spherical model to describe the interactions between substrate and enzyme: ^2^6common value of ^ = 4.0 kJ / mol was used. Lennard-Jones parameters ª were obtained from the protein radius: ª ^¨,i£ = 5.35 nm.• ^ / ^ is set to the value that represents 37°C: ^ / ^ = 2.5 kJ / mol.63 / 81 W0571.70066WO0013645924• ¢^is a characteristic length-scale defined ^ ,^ , which iscomputed as 7.60 nm in this case (note that £d¤=2R). • To estimate the inherent reaction constant ^^, the apparent receptor tyrosine phosphorylation rate of EGFR in vitro is adopted: ^ = 5.5×107M-1s-1. Therefore, the ^^can be reversely solved in a dilute solution scenarioTo back-calculate ^^, we also need an estimation of the in vitro diffusion coefficient of receptor tyrosine kinases. The diffusion coefficient of insulin receptor measured in our paper in live cells (Dcell ~ 1 ^m2 / s) is adopted given the comparable molecular weights among insulin receptor, IRS1, and EGFR. It is also known that the diffusion coefficient in vitro is around 3 times higher than in cell, thus the effective diffusion coefficient of EGFR in the referred in vitro work is estimated to be Dvitro ~ 3 ^m2 / s. Hence, ^ ´ -1 -1^ ^ +^. h ^^ M s .
[0258] With those parameters / functions in hand, k-D relation is generated as plotted in Figure 23D. In vitro IRS1 phosphorylation
[0259] Purified active recombinant human insulin receptor (IR) (Millipore, 14-466) and purified recombinant insulin responsive substrate 1 (IRS1) (Abcam, ab70538) were incubated in freshly prepared reaction buffer consisting of 50 mM Tris pH 7.5, 0.1 mM EGTA, 0.1 mM Na3VO4, 0.1 mM 2-mercaptoethanol, 10 mM MnCl2 and 0.01 mg / ml bovine serum albumin with the indicated concentrations of glycerol (Invitrogen, 15514011) for 5 minutes at 30°C immediately after the addition of 50 ^M ATP in 5 mM magnesium acetate. All samples were prepared with 75 ng of IR and 240 ng of IRS1. These amounts and ratios were chosen because they fell within the linear range of IRS1 phosphorylation by IR and they provided equivalent moles of IR and IRS1. For samples that were agitated, tubes were subjected to orbital mixing at 1200 rpm using a Thermomixer (Eppendorf, ThermoMixer C, EP5382000023) during the entire incubation. After 5 minutes, reactions were immediately quenched with dithiothreitol (DTT) and XT Sample Buffer 4x (BioRad, 1610791) to a final concentration of 100mM and 1x, respectively and incubated at 95°C for 5 minutes, then ran on Western blot or frozen at -80°C until subjected to western blot. RNA-seq
[0260] Cells were treated with normal or pathogenic insulin concentrations for three days and washed with EMEM as described above and cultured in EMEM solo for 4 hours. RNA was then purified using TRIzolTMreagent (Thermo Fisher Scientific, 15596026) following manufacturer’s instructions. RNA-seq libraries were prepared using KAPAHyperRiboErase (Roche, KK8561) and were sequenced on Illumina NovaSeq 6000, generating at least 200 million paired-ended 150-bp reads per sample. Reads were mapped to the human genome GRCh38 using STAR aligner105(v2.7.1a),64 / 81 W0571.70066WO0013645924allowing up to 100 multiple alignments and up to 200 loci anchors (--outFilterMultimapNmax 100 -- winAnchorMultimapNmax 200). Differential expression analysis of genes and transposable elements comparing triplicates of samples treated with normal or pathogenic concentrations of insulin was performed using TEtranscripts106(v2.2.3). The list of protein coding genes was downloaded from ENSEMBL BioMart (ensembl.org / biomart / martview / 6e82036bfd2b9ca0c5044d2c7449824d). ChIP-seq
[0261] Published MED1 ChIP-seq data (GSM2040029) and input (GSM2864933) were used in this study. ChIP-seq bioinformatics analysis was performed on the Whitehead High-Performance Computing Facility using the nf-core ChIP-seq pipeline v1.2.1112 with Nextflow v20.04.1. Quality control of fastq files was performed with FastQC v0.11.9. Trim Galore! v0.6.4_dev was used to trim low-quality reads. Alignment was performed against the hg19 genome assembly using BWA v0.7.17- r1188107. Peak calling was performed using MACS2108v2.2.7.1 with q value of 0.01. For the identification of genes whose promoter (transcription start site, TSS, + / - 1kb) were occupied by MED1, the same hg38 gene list used for the RNA-seq analysis was used. The coordinates of the promoters were converted from hg38 to hg19 using LiftOver (genome.ucsc.edu / cgi-bin / hgLiftOver). Bedtools109v2.29.2 was used to measure the distance between MED1 peaks and gene promoters (bedtools closest -d). A gene was considered occupied by MED1 the distance between MED1 peak and the promoter was 0. The changes in gene expression measured by RNA-seq were matched to each MED1-occupied and non-occupied gene using the VLOOKUP tool in Excel v16.78.3. Illustrations
[0262] Cartoon illustrations were created with BioRender.com. Figures were generated using Adobe Illustrator v27.0.1. Example 5: Proteolethargy is a pathology in diverse Mendelian diseases
[0263] As described above, reduced protein mobility (referred to herein as “proteolethargy”), may act as a pathological mechanism that is linked to elevated reactive oxygen species (ROS), which in turn affects proteins with surface-exposed cysteine residues. In addition to chronic diseases, the present disclosure also describes proteolethargy as a potential pathogenic mechanism in diverse Mendelian diseases, including, but not limited to, those causing elevated ROS and those introducing surface-exposed cysteines.
[0264] The present disclosure further contemplates the use therapeutic agents as treatments for certain of these diseases.
[0265] Approximately 280 million people worldwide suffer from over 7,000 rare genetic disorders, and causative mutations have been identified for over 4,000 Mendelian diseases. Although the proteins affected by these mutations are known, the effect of the mutation on protein function is not65 / 81 W0571.70066WO0013645924always established. Identifying the pathological mechanism is important because it can lead to therapeutic hypotheses that may ultimately benefit patients (FIG.15).
[0266] The present disclosure describes two classes of Mendelian diseases: the first class caused by mutations that introduce a surface-exposed cysteine, and the second class caused by mutations that result in elevated ROS (FIG.15).
[0267] Expression of the first class of genetic lesions resulted in proteolethargy of the mutated protein for the proteins tested. Introduction of the second class of genetic lesions was expected by the Applicants to result in both an accumulation of reactive oxygen species and proteolethargy of a representative endogenous protein biosensor. Applicant expected that proteolethargy would be reversible in both classes by treatment with the antioxidant N-acetyl cysteine and the mitochondrial complex I inhibitor metformin. Mendelian diseases resulting from gain of surface-exposed cysteines promote proteolethargy by sensitizing mutant protein to cellular redox environment
[0268] It was observed that gaining surface-exposed cysteines resulted in proteolethargy, either through appending a cysteine-containing sequence onto a protein or engineering a missense gain of surface-exposed cysteine (see Examples 1-3). To test whether proteolethargy could be operating in a class of Mendelian diseases that result in gaining surface-exposed cysteines, missense gain-of- cysteine mutations were identified that were predicted to result in proteolethargy (FIG.16).
[0269] To identify missense gain-of-cysteine mutations, the database ClinVar was first queried for pathogenic missense gain-of-cysteine variants, yielding 2,283 pathogenic variants. These variants were mapped to protein isoforms using UniProt and filtered to include only isoforms with high confidence of accurate mapping resulting in 2,167 variants. To include only variants associated with Mendelian diseases, this list was filtered to include only variants with Online Mendelian Inheritance in Man (OMIM) identifications, resulting in 1,687 variants. It was reasoned that a surface-exposed protein could occur on the surface of a structured region or in a disordered region. Therefore NetSurfP-3.0 was used to determine relative surface accessibility (RSA) and MetaPredict to determine occurrence in a disordered region, classifying residues with RSA > 0.4 or MetaPredict disorder score > 0.4 as exposed. A final list of 517 pathogenic surface-exposed gain-of-cysteine variants was generated, and 10 variants, including ASS1 and MeCP2, that cause diseases with well-established liver involvement were prioritized for study in HepG2 cells after manual confirmation of surface exposure using AlphaFold (Table 5 and FIG.17).
[0270] Table 5. Exemplary Mendelian diseases resulting from gain-of-cysteine mutations.66 / 81 W0571.70066WO0013645924
[0271] A skilled artisan would understand that differences in isoforms affect the position of the amino acid change.
[0272] As a framework to study proteolethargy, HepG2 cells were chosen as a cell model because they provide a well-established model system representative of human liver cells in healthy and disease states and because this cell line was used previously to study proteolethargy (see Examples 1- 3). The cells were engineered to stably express a Halo-tagged version of the wild-type or mutant protein (FIG.17).
[0273] To test the possibility that pathogenic gain of surface-exposed cysteines promote proteolethargy, the mobility of wild-type or mutant Halo-tagged versions of the proteins was compared. Two proteins were selected for evaluation: ASS1 and MeCP2. Mutations in ASS1, an enzyme involved in the urea cycle, result in citrullinemia, and mutations in MeCP2, a transcriptional regulator, result in Rett syndrome. FRAP analysis revealed the mobility of ASS1 R86C mutant was decreased relative to wild-type ASS1 (FIG.18A). Similarly, it was observed the mobility of MeCP2 R306C mutation also decreased compared to wild type (FIG.18B). These data show that mutations introducing surface-exposed cysteines in ASS1 and MeCP2 lead to reduced mobility of the mutant proteins compared to their wild-type counterparts.
[0274] To test if the gained surface-exposed cysteines promote proteolethargy by sensitizing the mutant protein to the cellular redox environment, the cells expressing the mutant protein were treated with an antioxidant to improve the mobility of the mutant protein. Indeed, treating cells with N-acetyl cysteine, an antioxidant that is used in the clinic to treat liver disease, partially rescued the mobility of the R306C MeCP2 mutant (FIG.18C). Mendelian diseases resulting in elevated ROS promote proteolethargy by altering the cellular redox environment
[0275] Given the observation that the slowing of protein molecules occurs in the context of oxidative stress (see Examples 1-3), it was suspected that proteolethargy could be observed in a class of67 / 81 W0571.70066WO0013645924Mendelian diseases that result in elevated ROS. To explore this, a framework was developed to identify diseases and corresponding mutations that may belong to this class (FIG.19)
[0276] To identify Mendelian diseases and corresponding mutations that result in elevated ROS, an automated literature search was performed in PubMed for associations between Mendelian diseases cataloged in the database Online Mendelian Inheritance in Man (OMIM) and ROS. Mendelian diseases were ranked based on the ratio of ROS-related publications to total disease-related publications, applying a cutoff of 25 publications for the extent of prior study relating the disease to ROS. These Mendelian diseases were mapped to their respective genetic loci in OMIM, and those associated with liver dysfunction were manually selected. Finally, the most observed pathogenic mutations were selected as candidates for further investigation. This approach identified potential candidate diseases and corresponding mutations that may belong to a class of Mendelian diseases resulting in elevated cellular ROS (Table 6 and FIG.20).
[0277] Table 6. Selected Mendelian diseases associated with oxidative stress.‘*’, represents termination (introduction of a premature stop codon).
[0278] To study proteolethargy in the context of Mendelian diseases that promote ROS, the well- established liver cell model, HepG2, was selected as it is both a suitable system for studying proteolethargy and relevant given the liver's susceptibility to oxidative stress. HepG2 cells were engineered to harbor either disease-associated mutations or wild-type sequences at their endogenous loci. Because these Mendelian diseases were predicted to create an environment of elevated ROS, a68 / 81 W0571.70066WO0013645924biosensor designed to detect changes in protein mobility under high ROS conditions was introduced into the endogenous locus (FIG.212A and FIG.21B). Specifically, HP1^ endogenously-tagged with the HaloTag protein (HP1^-Halo) as the mobility biosensor was utilized, as it has been shown to exhibit proteolethargy under altered cellular redox states (see Examples 1-3).
[0279] Further, it was demonstrated that metformin can partially rescue protein mobility of the biosensor and of the insulin receptor in a high ROS environment resulting from pathogenic insulin concentrations (FIG.22A and FIG.22B). REFERENCES 1. I. A. Klein et al., Partitioning of cancer therapeutics in nuclear condensates. Science 368, 1386-1392 (2020). 2. A. Dall'Agnese et al., The dynamic clustering of insulin receptor underlies its signaling and is disrupted in insulin resistance. Nat Commun 13, 7522 (2022). 3. X. Chen, J. L. Zaro, W. C. Shen, Fusion protein linkers: property, design and functionality. Adv Drug Deliv Rev 65, 1357-1369 (2013). 4. S. F. Banani et al., Genetic variation associated with condensate dysregulation in disease. Dev Cell 57, 1776-1788 e1778 (2022). 5. C. H. Li et al., MeCP2 links heterochromatin condensates and neurodevelopmental disease. Nature 586, 440-444 (2020). 6. A. Serge, N. Bertaux, H. Rigneault, D. Marguet, Dynamic multiple-target tracing to probe spatiotemporal cartography of cell membranes. Nat Methods 5, 687-694 (2008). 7. M. Ovesny, P. Krizek, J. Borkovec, Z. Svindrych, G. M. Hagen, ThunderSTORM: a comprehensive ImageJ plug-in for PALM and STORM data analysis and super-resolution imaging. Bioinformatics 30, 2389-2390 (2014). 8. C. Stringer, T. Wang, M. Michaelos, M. Pachitariu, Cellpose: a generalist algorithm for cellular segmentation. Nat Methods 18, 100-106 (2021). 9. H. Sies, Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: Oxidative eustress. Redox Biol 11, 613-619 (2017). 10. H. Zhang, H. J. Forman, Glutathione synthesis and its role in redox signaling. Semin Cell Dev Biol 23, 722-728 (2012). 11. M. J. Davies, Protein oxidation and peroxidation. Biochem J 473, 805-825 (2016). 12. C. C. Winterbourn, D. Metodiewa, Reactivity of biologically important thiol compounds with superoxide and hydrogen peroxide. Free Radic Biol Med 27, 322-328 (1999). 13. A. Fra, E. D. Yoboue, R. Sitia, Cysteines as Redox Molecular Switches and Targets of Disease. Front Mol Neurosci 10, 167 (2017). 14. R. P. W. Szajewski, G.W., Rate constants and equilibrium constants for thiol-disulfide interchange reactions involving oxidized glutathione. JCIM 102, 2011-2026 (1980). 15. H. J. Forman, H. Zhang, A. Rinna, Glutathione: overview of its protective roles, measurement, and biosynthesis. Mol Aspects Med 30, 1-12 (2009). 16. O. Zitka et al., Redox status expressed as GSH:GSSG ratio as a marker for oxidative stress in paediatric tumour patients. Oncol Lett 4, 1247-1253 (2012). 17. L. D. Schrödinger, W., PyMOL. Available at: http: / / www.pymol.org / pymol, (2020). 18. P. Wang et al., iCysMod: an integrative database for protein cysteine modifications in eukaryotes. Brief Bioinform 22, (2021). 19. R. Milo, What is the total number of protein molecules per cell volume? A call to rethink some published values. Bioessays 35, 1050-1055 (2013).69 / 81 W0571.70066WO0013645924EQUIVALENTS AND SCOPE
[0280] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0281] Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is / are referred to as comprising particular elements and / or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and / or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein.
[0282] It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0283] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.
[0284] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but70 / 81 W0571.70066WO0013645924rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.71 / 81 W0571.70066WO0013645924
Claims
CLAIMS What is claimed is:
1. A method of treating a disease or condition associated with suppressed protein mobility of a protein in a subject in need thereof, the method comprising administering to the subject a therapeutic agent that increases protein mobility by reducing the effects of a pathogenic stimulus and / or protecting surface exposed cysteines.
2. The method of claim 1, wherein the disease or condition is characterized by having mobility of the protein suppressed by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, as compared to mobility of the protein in a healthy or non-diseased state.
3. The method of claim 1 or 2, wherein the disease or condition is a chronic disease.
4. The method of any one of claims 1-3, wherein the disease or condition is a cardiovascular disease, a metabolic disease, an infectious disease, an inflammatory disease, a neurological disease, a neurodegenerative disease, addiction, or aging.
5. The method of any one of claims 1-4, wherein the disease or condition is obesity, diabetes, repeated exposure to addictive drugs, or premature aging.
6. The method of claim 1 or 2, wherein the disease is a monogenic disease.
7. The method of claim 6, wherein the monogenic disease is selected from the group consisting of Citrullinemia, Rett syndrome, Joubert syndrome, Dysfibrnogenemia, Arginosuccinate lyase deficiency, Coproporphyria, Monogenic obesity-metabolic syndrome, Familial hypercholesterolemia, Methylmalonic acidemia with homocystinuria, Hemophilia A, G6PD deficiency, Insulin resistance with acanthosis nigricans, Genetic amyotrophic lateral sclerosis, Hemochromatosis, MCAD deficiency, Ataxia-telangiectasia, Cockayne syndrome, Fanconi anemia, Combined oxidative phosphorylation deficiency, Dyskeratosis congenita, Wilson’s disease, and Alpha-1 antitrypsin deficiency.
8. The method of any one of claims 1-7, wherein the treating results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, as compared to mobility of the protein in a diseased state.72 / 81 W0571.70066WO00136459249. The method of any one of claims 1-8, wherein the pathogenic stimulus is elevated levels of insulin, high glucose, high fat, inflammatory cytokines, genotoxic stress, or drug toxicity.
10. The method of any one of claims 1-9, wherein the pathogenic stimulus induces oxidative stress, hyperglycemia, dyslipidemia, or inflammation.
11. The method of any one of claims 1-10, wherein the pathogenic stimulus induces oxidative stress by increasing reactive oxygen species (ROS) levels.
12. The method of any one of claims 1-11, wherein the protein comprises one or more surface exposed cysteines.
13. The method of any one of claims 1-12, wherein the protein comprises at least one missense mutation which results in one or more surface exposed cysteines.
14. The method of claim 12 or 13, wherein the pathogenic stimulus induces or promotes inter- protein crosslinking of the protein by disulfide bond formation of the surface exposed cysteine.
15. The method of any one of claims 12-14, wherein the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine, wherein the bond formation induces aggregation, oligomerization, or conformational changes of the protein.
16. The method of claim 14 or 15, wherein aggregation, oligomerization, or conformation changes of the protein decreases its ability to interact with a transporter protein.
17. The method of any one of claims 1-16, wherein the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof.
18. The method of any one of claims 1-17, wherein the therapeutic agent is a known drug, an FDA-approved drug, or a drug undergoing clinical trials.
19. The method of any one of claims 1-18, wherein the therapeutic agent is an antioxidant.
20. The method of claim 19, where in the antioxidant is N-acetyl cysteine.
21. The method of claim 18, where in the therapeutic agent is metformin.73 / 81 W0571.70066WO001364592422. The method of any one of claims 1-21, wherein the subject is a mammal.
23. The method of any one of claims 1-22, wherein the subject is a non-human experimental animal.
24. The method of any one of claims 1-22, wherein the subject is a human subject.
25. A method of restoring suppressed protein mobility of a protein in a cell, the method comprising contacting the cell with a therapeutic agent that increases protein mobility by reducing the effects of a pathogenic stimulus and / or protecting surface exposed cysteines.
26. The method of claim 25, wherein the contacting results in protein mobility being increased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.
27. The method of any claim 25 or 26, wherein the pathogenic stimulus is elevated levels of insulin, high fat, inflammatory cytokines, genotoxic stress, or drug toxicity.
28. The method of any one of claims 25-27, wherein the pathogenic stimulus induces oxidative stress, hyperglycemia, dyslipidemia, or inflammation.
29. The method of any one of claims 25-28, wherein the pathogenic stimulus induces oxidative stress by increasing reactive oxygen species (ROS) levels.
30. The method of any one of claims 25-29, wherein the protein comprises one or more surface exposed cysteines.
31. The method of any one of claims 25-30, wherein the protein comprises at least one missense mutation which results in one or more surface exposed cysteines.
32. The method of claim 30 or 31, wherein the pathogenic stimulus induces or promotes inter- protein crosslinking of the protein by disulfide bond formation of the surface exposed cysteine.
33. The method of any one of claims 30-32, wherein the pathogenic stimulus induces or promotes the formation of inter- and / or intra-molecular disulfide bonds with the surface exposed cysteine,74 / 81 W0571.70066WO0013645924wherein the bond formation induces aggregation, oligomerization, or conformational changes of the protein.
34. The method of claim 32 or 33, wherein aggregation, oligomerization, or conformation changes of the protein of interest decreases its ability to interact with a transporter protein.
35. The method of any one of claims 25-34, wherein the therapeutic agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof.
36. The method of any one of claims 25-35, wherein the therapeutic agent is a known drug, an FDA-approved drug, or a drug undergoing clinical trials.
37. The method of any one of claims 25-36, wherein the therapeutic agent is an antioxidant.
38. The method of claim 37, wherein the antioxidant is N-acetyl cysteine.
39. The method of claim 36, where in the therapeutic agent is metformin.
40. The method of any one of claims 25-39, wherein the cell is a non-diseased cell.
41. The method of any one of claims 25-40, wherein the cell is a diseased cell.
42. The method of any one of claims 25-41, wherein the cell is a mammalian cell.
43. The method of any one of claims 25-42, wherein the cell is a human cell.
44. The method of any one of claims 25-43, wherein the cell is an engineered cell.
45. The method of any one of claims 25-44, wherein the cell is present within an intact tissue.
46. The method of any one of claims 25-45, wherein the intact tissue is a fixed tissue sample.
47. The method of any one of claims 1-46, wherein the protein is insulin receptor (IR), Mediator subunit (MED1), heterochromatin protein (HP1^), fibrillarin (FIB1), or serine and arginine-rich splicing factor 2 (SRSF2).75 / 81 W0571.70066WO001364592448. The method of any one of claims 1-46, wherein the protein of interest is ASS1, MECP2, ARL3, FGA, ASL, CPOX, DYRK1B, LDLR, ABCD4, F8, G6PD, INSR, SOD1, HJV, ACADM, ATM, ERCC6, FANCA, TSFM, RTEL1, ATP7B , or SERINA1.
49. A method of profiling suppressed protein mobility in a cell, the method comprising: a) providing a biosensor to the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
50. A method of measuring suppressed protein mobility in a cell, the method comprising: a) expressing a biosensor within the cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell expressing the biosensor; and c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population.
51. A method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising: a) providing a biosensor to a cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and d) administering an agent to the cell, wherein the agent increases protein mobility; wherein the increase in protein mobility is indicated by recovery of protein diffusion rates and migration location of the bulk population of the biosensor in the cell treated with the agent, compared to a cell not treated with the agent, thereby confirming the suppression of protein mobility is an effect of the pathogenic stimulus.
52. A method of identifying a pathogenic stimulus that suppresses protein mobility, the method comprising:76 / 81 W0571.70066WO0013645924a) providing a biosensor to a cell, wherein the biosensor comprises a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) applying a pathogenic stimulus to the cell; c) comparing the mobility of the biosensor between cells subjected to normal conditions and pathogenic stimulus, wherein protein mobility is expressed in terms of apparent diffusion coefficients or degree of migration of a bulk population; and wherein a decrease in protein mobility in cells subjected to the stimulus as compared to cells not subjected to the stimulus indicates that the stimulus suppresses protein mobility.
53. A method of diagnosing a disease or condition in a subject, the method comprising: a) providing a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; b) contacting the biosensor to a cell or tissue sample from the subject; and c) comparing the mobility of the biosensor between the cell or tissue sample from the subject relative to one or more non-diseased cell or tissue samples, wherein a decrease in measurement of protein mobility in the cell or tissue samples from the subject compared to measurement of protein mobility in the one or more non-diseased cell or tissue samples indicates that the subject has the disease or disorder.
54. The method of claim 53, wherein the measurement of protein mobility in one or more non- diseased cells or tissue samples is determined as a control experiment alongside the cell or tissue samples from the subject.
55. The method of claim 53 or 54, wherein the measurement of protein mobility in one or more non-diseased cell or tissue samples comprises reference data.
56. A method of screening for an agent capable of increasing protein mobility, the method comprising: a) contacting a cell or tissue sample that is being treated with or has been treated with an agent with a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag; and b) comparing the mobility of the biosensor in the cell or tissue sample to the mobility of the biosensor in a cell or tissue sample not treated with the agent, wherein an increase in measurement of protein mobility in the cell or tissue samples treated with the agent compared to measurement of protein mobility in a cell or tissue sample not treated with the agent indicates that the agent increases protein mobility.77 / 81 W0571.70066WO001364592457. A method of screening for an agent capable of increasing protein mobility, the method comprising: a) contacting a cell or tissue sample with an agent, wherein the cell or tissue sample expresses a biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag to measure the mobility of the protein of interest; and b) comparing the mobility of the biosensor between the cell or tissue sample relative to one or more non-diseased cell or tissue samples, wherein an increase in measurement of protein mobility in the cell or tissue samples in the presence of the agent compared to measurement of protein mobility in the absence of the agent indicates that the agent increases protein mobility.
58. The method of any one of claims 49-57, wherein the biosensor comprises the protein of interest fused with a HaloTag or GFP-Tag.
59. The method of any one of claims 49-58, wherein the tag comprises a linker having a plurality of cysteine residues.
60. The method of claim 59, wherein the linker has 5 cysteine residues.
61. The method of any one of claims 56-60, wherein the agent is a small molecule, a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof.
62. The method of any one of claims 56-61, wherein the agent is a known drug, an FDA- approved drug, or a drug undergoing clinical trials.
63. The method of claim 61 or 62, wherein the protein is an antibody or a variant thereof.
64. The method of claim 61 or 62, wherein the nucleic acid is an mRNA, an antisense RNA, an miRNA, an siRNA, an RNA aptamer, a double stranded RNA (dsRNA), a short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a DNA vector, or a viral vector.
65. The method of any one of claims 1-64, wherein the protein is a cytoplasmic protein.
66. The method of any one of claims 1-64, wherein the protein is a nuclear protein.
67. The method of any one of claims 1-66, wherein the protein is associated with a chronic disease or monogenic disease.78 / 81 W0571.70066WO001364592468. The method of any one of claims 49-67, wherein the biosensor allows for the mobility of the protein of interest to be measured by single particle tracking (SPT) and / or fluorescence recovery after photobleaching (FRAP) analysis.
69. The method of any one of claims 49-68, wherein the cell or tissue sample is obtained from a subject.
70. An agent identified by the method of any one of claims 56-64.
71. A pharmaceutical composition comprising the agent of claim 70 and a pharmaceutically acceptable carrier.
72. A biosensor comprising a protein of interest fused to either 1) an extrinsically fluorescent protein tag or 2) an intrinsically fluorescent protein tag.
73. The biosensor of claim 72, wherein the protein of interest is fused with a HaloTag or a GFP- Tag.
74. The biosensor of claim 73, wherein the HaloTag is fused to a linker comprising an array of 5 cysteine residues or 5 serine residues.
75. The biosensor of claim 73, wherein the GFP-Tag is fused to a linker comprising an array of 5 cysteine residues or 5 serine residues.
76. A biosensor comprising a HaloTag fused with a linker comprising an array of 5 cysteine residues or serine residues. . A nucleic acid encoding the biosensor of any one of claims 72-76.
78. A vector comprising the nucleic acid of claim 77.
79. A cell comprising the nucleic acid of claim 77 and / or the vector of claim 78.
80. A modified cell that expresses the biosensor of any one of claims 72-76.
81. The modified cell of claim 80, wherein the modified cell is a eukaryotic cell.79 / 81 W0571.70066WO001364592482. The modified cell of claim 80 or 81, wherein the modified cell is a mammalian cell.
83. The modified cell of any one of claims claim 80-82, wherein the mammalian cell is a human .
84. The modified cell of any one of claims claim 80-83, wherein the modified cell is a diseased .80 / 81 W0571.70066WO0013645924
Citation Information
Patent Citations
Compositions and Methods for Treating Diabetes
US20090048154A1
Use of metformin and analogs thereof to reduce ran protein levels in the treatment of neurological disorders
US20200268691A1
Modular platform for programmable spatiotemporal biomolecule clustering with applications including enhanced metabolic yield
US20230295638A1
Cited By
Use of sulfur-containing amino acids or metabolites thereof for the preparation of a medicament for the treatment of wilson's disease or for the improvement of hepatic copper accumulation
CN122376573A