Methods and compositions for the analysis of circulating nucleic acids
The method of using self-consistent capture probes to deplete leukocyte-derived cfDNA from chromatin regions and mitochondrial DNA enriches for peripheral tissue-derived cfDNA, addressing the confounding effects of leukocytes and improving the sensitivity of liquid biopsies for early cancer detection.
Patent Information
- Application Number
- PCT/US2025/017066
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-01
- Filing Date
- 2025-02-24
- Publication Date
- 2025-10-02
AI Technical Summary
Current methods for analyzing cell-free DNA (cfDNA) in bodily fluids, particularly blood, are hindered by the confounding effects of leukocyte-derived DNA, which masks mutations and hampers the detection of tumor-specific mutations in peripheral tissues, especially in early-stage cancers, due to low concentration and heterogeneity.
A method involving the use of self-consistent capture probes to deplete leukocyte-derived cfDNA by isolating nucleic acids from nucleosome-protected, nucleosome-depleted, and nucleosome-transient regions of chromatin, along with mitochondrial DNA, to enrich for cfDNA originating from peripheral tissues, followed by sequencing and analysis.
This approach enhances the detection and monitoring of peripheral tissue-derived mutations by reducing leukocyte interference, improving the sensitivity and accuracy of liquid biopsies for early cancer detection.
Smart Images

Figure 00000059_0000 
Figure 00000060_0000 
Figure 00000061_0000
Abstract
Description
METHODS AND COMPOSITIONS FOR THE ANALYSIS OF CIRCULATINGNUCLEIC ACIDSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims priority benefit of U.S. Provisional Application Nos. 63 / 557,558, filed on February 25, 2024, and 63 / 678,442, filed on August 1, 2024, the contents of each of which are hereby incorporated herein by reference in their entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The content of the electronic sequence listing (330452000140seqlist.xml; Size: 2,828 bytes; and Date of Creation: February 20, 2025) is herein incorporated by reference in its entirety.TECHNICAL FIELD
[0003] This application, in certain aspects, is directed to methods of obtaining a circulating nucleic acid (circNA) component from a sample from an individual, the method comprising use of self-consistent capture probes. In other aspects, this application is directed to methods of use, such as methods of analyzing a circNA, compositions comprising a circNA, separation media comprising self-consistent capture probes, libraries of self-consistent captures probes, and methods of constructing the same.BACKGROUND
[0004] Cell-free DNA (cfDNA) in bodily fluids, particularly blood, has been shown to be a valuable repository of genetic information that can be interrogated to assess health and disease. Sampling and analysis of this material (aka “liquid biopsy”) continues to show promise as a minimally invasive strategy for detecting genetic alterations associated with cancers in peripheral tissue and as well as monitoring residual disease following treatment.
[0005] However, the low concentration and heterogeneity of cfDNA poses challenges in developing accurate and sensitive methods for analyzing this material. While significant strides have been made in developing methods and algorithms to comprehensively interrogate and understand sequence features of cfDNA and their correlation to peripheral diseases such as cancer, these studies have also underlined that the blood itself is a major confounding factor in cfDNA analysis. First, clonal hematopoiesis of indeterminate potential (CHIP) can mimick and therefore mask mutations that would normally be considered drivers of tumorigenesis, and canlead to “false positive” observations of genetic alterations in cfDNA. Second, with the realization that cfDNA bears footprints of nucleosomes and their tissue of origin, studies have revealed that a large majority (> 90%) of cfDNA originates from the local leukocyte population, masking those originating from peripheral tissue.
[0006] Although it is possible to identify bioinformatically sequence features in cfDNA which help disambiguate cfDNA from normal leukocytic and peripheral tissues, including methylation status, fragment size distribution and end composition, as well as nucleosome footprint, these relationships are still under investigation. Indeed, composite measurements across all of these features are unable to reliably and unambiguously distinguish cancers except at their latest stages. Unfortunately, these composite approaches also require extensive sequencing and robust computational capabilities, further limiting its value as part of a commercially viable clinically oriented test.
[0007] Fundamentally then, in the absence of any alternative approaches, leukocyte originating cfDNA will continue to confound the ability to identify and quantify cfDNA originating from peripheral tissue, hampering the diagnostic utility liquid biopsies in detecting and monitoring diseases. This is particularly problematic in detecting tumor- specific mutations originating in peripheral tissue cells in all but very late-stage cancers, presenting a key obstacle in the development of multi-cancer early detection (MCED) tests for cancer. Accordingly, there is a need for shift in strategy for analyzing circulating nucleic acids.
[0008] Disclosed herein, we address this fundamental problem by developing methods and compositions for depleting cfDNA of the leukocyte portion to enrich for cfDNA originating from peripheral tissue.SUMMARY OF THE INVENTION
[0009] The present disclosure provides a compositions and methods for analyzing the total circulating nucleic acid (circNA) burden in bodily fluids, wherein the circNA burden is comprised of both a cell-free component (cfNA) and a membrane-bound component (mbNA). In one aspect, the is applied to the DNA component of circNA (circDNA), wherein the circDNA is comprised of a cell-free component (cfDNA) and a membrane -bound component (mb-DNA). This disclosure is based on the realization that it is possible to co-purify the nucleic acid content from leukocytes present within a blood sample along with circDNA to derive a self-consistentplurality of capture probes that can then be deplete circDNA originating from leukocytes via an appropriately constructed separation medium.
[0010] In one aspect, the purified nucleic acid content from leukocytes is derived from nucleosome protected regions (NPRs) of chromatin in which the nucleosomes are tightly associated with the genomic DNA and inaccessible to the activity of external agents such as nucleases and transposases. In another aspect, the purified nucleic acid content is derived from nucleosome depleted regions (NDRs) of chromatin in which are not associated with nucleosomes nor any DNA binding proteins, and therefore readily accessible to the activity of external agents. In another aspect, the purified nucleic acid content is derived from nucleosome transient regions (NTRs) of chromatin in which the nucleosomes and / or DNABPs are loosely or dynamically associated with the genomic DNA and therefore partially accessible to the activity of external agents. In another aspect, the purified nucleic acid content from leukocytes can also include DNA derived from mitochondria (mitoDNA).
[0011] The capture probes derived from the leukocyte population will have a counterpart within the circDNA with substantial sequence complementarity. Contacting circDNA isolated from blood with the separation medium will therefore cause binding of a portion of the circDNAs to the capture probes. By leveraging the properties of the separation medium, subsequent removal of this bound fraction enables winnowing of the circDNA population to that population originating from peripheral tissue. The methods and compositions disclosed therefore provides a means to mitigate the impact of leukocyte-derived cfDNA / circDNA as a confounding source in blood-based liquid biopsies.
[0012] The present disclosure thus provides a method for purifying circDNA for analysis, the method comprising: a) isolating a circDNA component, in addition to a nuclei and a mitochondrial component from intact cells within a bodily fluid; b) obtaining a plurality of nucleic acid components from the chromatin within said nuclei and from the mitochondrial component, wherein said components from chromatin are derived from NPRs, NTRs, and NDRs; c) converting the nucleic acid components into a plurality of capture probes by fragmenting the nucleic acids components and introducing a moiety to each fragment that enables their attachment to a support to create a separation medium; d) contacting the isolated circDNA component with said fragments such that a subpopulation of the circNA molecules that are substantially similar to the fragments is bound to the separation medium; and e) isolating theunbound circDNA components to obtain a plurality of circDNAs depleted of circDNAs originating from leukocytes.
[0013] In another aspect, the present disclosure provides a method of determining the presence of a tumor within the peripheral tissue of a subject comprising: a) collecting circDNA from a test subject; b) substantially depleting the collected circDNA sample of circDNAs of leukocyte origin to enrich the sample with peripheral tissue derived circDNA; and c) identifying and quantifying the remaining enriched circDNA molecules.
[0014] In another aspect, the present disclosure provides a method of determining the presence of a tumor within the peripheral tissue of a subject comprising: a) collecting circDNA from a test subject; b) substantially depleting the collected circDNA sample of circDNAs of leukocyte origin to enrich the sample with peripheral tissue derived circDNA; c) sequencing the enriched circDNA molecules; d) obtaining a plurality of sequence reads generated by a nucleic acid sequencer from sequencing the enriched circNA molecules; e) mapping the plurality of sequence reads to one or more reference sequences to generate mapped sequence reads; and f) processing the mapped sequence reads to determine the identity and quantity of mutations that are present within the enriched circDNA sample.
[0015] In another aspect, the present disclosure provides a method of surveillance for tumorigenesis within the peripheral tissue of a subject comprising: a) annually collecting circDNA from a test subject; b) substantially depleting the collected circDNA sample of circDNAs of leukocyte origin to enrich the sample with peripheral tissue derived circDNA; c) sequencing the enriched circDNA molecules; d) obtaining a plurality of sequence reads generated by a nucleic acid sequencer from sequencing the enriched circNA molecules; e) mapping the plurality of sequence reads to one or more reference sequences to generate mapped sequence reads; f) processing the mapped sequence reads to determine the identity and quantity of mutations that are present within the enriched circDNA sample, and g) creating an annual report of mutational burden and tissue specific nucleosome coverage.
[0016] In another aspect, the present disclosure provides a method of detecting the presence of disease within the peripheral tissue of a subject comprising: a) collecting circNA from a test subject; b) substantially depleting the collected circDNA sample of circDNAs of leukocyte origin to enrich the sample with peripheral tissue derived circDNA; c) sequencing the enriched circDNA molecules; d) obtaining a plurality of sequence reads generated by a nucleic acidsequencer from sequencing the enriched circNA molecules; e) mapping the plurality of sequence reads to one or more reference sequences to generate mapped sequence reads; and f) processing the mapped sequence reads to assign a likelihood of disease at a particular peripheral tissue site based on the pattern of nucleosome coverage.
[0017] In another aspect, the present disclosure provides a method of surveillance for the presence of disease within the peripheral tissue of a subject comprising: a) annually collecting circDNA from a test subject; b) substantially depleting the collected circDNA sample of circDNAs of leukocyte origin to enrich the sample with peripheral tissue derived circDNA; c) sequencing the enriched circDNA molecules; d) obtaining a plurality of sequence reads generated by a nucleic acid sequencer from sequencing the enriched circNA molecules; e) mapping the plurality of sequence reads to one or more reference sequences to generate mapped sequence reads; f) processing the mapped sequence reads to assign a likelihood of disease at a particular peripheral tissue site based on the pattern of nucleosome coverage and g) creating an annual report of likelihood of disease at a particular peripheral tissue.
[0018] The present disclosure further provides physicochemical methods for fractionating a bodily fluid to obtain total circDNA from said bodily fluid, the method comprising: a) separation of the fluid phase from the cellular component of the bodily fluid sample through a physical property that distinguishes the fluid phase from the cellular material; b) fractionating the cellular component into its crude subcellular constituents to obtain a nuclei component, a mitochondrial component, and a plasma membrane fragment component; and c) isolating the nucleic acid content from the fluid phase and each of these subcellular constituents, wherein the fluid phase containing cfDNA and the mb-DNA together comprise total circDNA.
[0019] The present disclosure further provides a method for fractionating cellular material into its subcellular components while retaining its constituent nucleic acid content, the method comprising: a) treating the cellular material with an agent that causes preferential disruption of the plasma membrane of both nucleated and enucleated cells in the presence of a hypotonic solution, wherein said agent can be a physical agent that causes mechanical disruption of the plasma membrane, a chemical agent that partially solubilizes the plasma membrane, or both a physical and a chemical agent; and b) centrifuging the disrupted material at successively higher speeds to yield a nuclei fraction, a mitochondrial fraction, and a plasma membrane fragment fraction.
[0020] The present disclosure further provides methods for obtaining regions of chromatin from a set number of purified intact nuclei, wherein said method of obtaining comprises: a) treating isolated nuclei with an agent that cleaves chromatin DNA in a substantially random fashion, wherein said agent can include a nuclease, a chemical nuclease, a restriction endonuclease, or a transposase; b) varying treatment conditions with said agent, wherein said conditions can include quantity, incubation time, or both quantity and incubation time, to release fragments corresponding to regions of the chromatin that are poorly, moderately, and strongly protected by nucleosomes and / or DNA binding proteins; and c) separately isolating the released fragments and remaining nucleic acid content within the intact nuclei from each condition.
[0021] The present disclosure further provides methods for obtaining capture probes from the isolated chromatin regions as well as DNA from the mitochondrial component, wherein said method of obtaining comprises: a) treating the isolated chromatin regions and mitochondrial DNA material with an agent, wherein said agent causes additional fragmentation or shearing of the material; b) repairing the re-fragmented DNA material by excising damaged or modified bases; and c) adding a donor moiety to one end of the repaired material, to obtain a capture probe. In some aspect, the obtained capture probes are comprised of single- stranded DNA. In some aspect, the obtained capture probes are comprised of double- stranded DNA. In some aspect, the obtained captures probes are of uniform length. In some aspect, the adding of the donor moiety occurs simultaneously with fragmentation.
[0022] The present disclosure further provides methods for constructing a separation medium from the sets of obtained capture probes, wherein said method of constructing comprises contacting the capture probe with a support comprised of multiple receiver moieties such that said contacting causes binding of the donor moiety of the capture probe to the receiver moiety on the support. In some aspect said support is a physical support comprised of a particle, a paramagnetic particle, or a surface. In some aspect said support is a chemical support comprised of a polymer, wherein said polymer is a linear polymer, a cross-linked polymer, a gel, or a filter, wherein said polymer exhibits a phase transition. In some aspect, said support is a combination of a physical and chemical support. In some aspect, said support can be contained within a device.
[0023] The present disclosure further provides methods for constructing ssDNA library members from the isolated circDNA for sequencing via next generation sequencing (NGS), wherein the method of constructing comprises: a) preloading a first ligase, wherein said ligase is a family 1RNA ligase, with an ODN of a first composition, wherein said composition includes a 5’- phosphate; b) preloading a second ligase, wherein said ligase is an RtcB family RNA ligase with an ODN of a second composition, wherein said composition includes a 3 ’-phosphate; c) contacting both preloaded ligases with DNA fragments, wherein said fragments are obtained from the isolated circDNA that have been (i) additionally fragmented or sheared, (ii) repaired by excision of damaged bases, and dephosphorylated at both their 5’- and 3’-ends, resulting in the attachment of the first ODN to the 3 ’-end and the second ODN to the 5 ’-end of the DNA fragments. In one embodiment, the 5 ’-end of the first ODN is identical to a first of a pair of ODNs that are required for surface amplification on the NGS instrument, and the 5’-end of the second ODN is complementary to a second of a pair of ODNs that are required for surface amplification on the NGS instrument, wherein said ODN pair is unique to the NGS instrument being utilized. In another embodiment, the first ODN and the second ODN are present on the same molecule and joined by a linker molecule, wherein said linker contains a cleavable moiety, wherein ligation with said molecule results the formation of circular ssDNA product.
[0024] The present disclosure further provides methods for depleting the circDNA library of library members that are substantially similar in composition to leukocyte-derived chromatin regions, wherein the method of depleting comprises: a) contacting the circDNA library with the separation medium comprised of capture probes derived from regions of leukocyte chromatin and mitochondrial DNA under conditions where library members that are substantially complementary to the capture probes hybridize and bind to said capture probes; and b) separating bound library members from unbound library members, wherein the unbound library members correspond substantially to circDNA originating from peripheral tissue. In one aspect, the circDNA library is amplified to increase the quantity of library members prior to said contacting, wherein the method of amplification is linear, wherein said method of amplification is exponential. In another aspect, the method of contacting of the circDNA library with the capture probes attached to the separation medium occurs by increasing the mobility of the library molecules across the separation medium, wherein the increase in mobility is induced via fluid flow, wherein said fluid flow is induced by agitation, wherein said fluid flow is induced by applying a centrifugal force, wherein said fluid flow is induced by pumping of the fluid phase. In another aspect, the increase in mobility of the library molecules across the separation medium is induced by the application of an electrical field, wherein said electrical field is constant, wherein said electrical field is alternating, wherein said electrical field is oscillating, wherein said method is SCODAphoresis, wherein said method is isotachophoresis.
[0025] The present disclosure further provides additional methods for analyzing the circDNA, wherein said methods of analyzing can be quantitative PCR, digital PCR, or droplet digital PCR.
[0026] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure.Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 shows a schematic for processing of whole blood to remove PBMC derived nucleic acids.
[0028] FIG. 2 shows an exemplary workflow for blood fractionation.
[0029] FIG. 3 shows a schematic for subcellular fractionation of PBMCs and RBSs.
[0030] FIG. 4 shows an exemplary workflow for preparation of NPRs, NTRs, and / or NDRs from PBMC nuclei.
[0031] FIG. 5 shows a schematic for isolation of NPRs, NTRs, and / or NDRs from chromatin.
[0032] FIGs. 6A-6C show schematics for construction of capture probes with 5 ’-end modification. FIG. 6A shows a first exemplary schematic. FIG. 6B shows a second exemplary schematic. FIG. 6C shows a third exemplary schematic.
[0033] FIGs. 7A-7C show schematics for construction of capture probes with 3 ’-end modification. FIG. 7A shows a first exemplary schematic. FIG. 7B shows a second exemplary schematic. FIG. 7C shows a third exemplary schematic.
[0034] FIG. 8 shows size selection of short DNA fragments via gel electrophoresis.
[0035] FIG. 9 shows a schematic for isolation of NPRs, NTRs, and NDRs capture probes via transposition.
[0036] FIG. 10 shows a schematic for construction of capture probes via transposition.
[0037] FIG. 11 shows exemplary donor- acceptor pairs enabling coupling of NPRs and / or NDRs.
[0038] FIGs. 12A-12C show schematics for formation of single stranded DNA libraries. FIG. 12A shows a first exemplary schematic. FIG. 12B shows a second exemplary schematic. FIG. 12C shows a third exemplary schematic.
[0039] FIG. 13 shows an exemplary workflow for depletion of circDNA from blood using NPRs, NTRs, and / or NDRs.
[0040] FIG. 14 shows a workflow and schematic for depletion of circDNA via filtration.
[0041] FIG. 15 shows a schematic for depletion of circDNA via capture probe extension and release.
[0042] FIG. 16 shows an alternative exemplary workflow for depletion of circDNA from blood using NPRs, NTRs, and / or NDRs.
[0043] FIG. 17 shows an exemplary workflow for comparing sequencing information recorded from circNA against sequencing information a control material.DETAILED DESCRIPTION OF THE INVENTION
[0044] The present disclosure provides compositions and methods for analyzing circulating nucleic acids (circNA) in bodily fluids, and stems from the realization that bodily fluids will inevitably contain locally resident tissue cells, some fraction of which are nucleated and can undergo apoptosis, necrosis, or NETopsis, releasing their nucleic acid content into the local milieu. These locally resident cells can therefore contribute to total circNA population present in the bodily fluid, confounding the identification and quantification of circNAs that may originate from a more peripheral tissue source. In some aspects, the bodily fluid can be the extracellular milieu, and the locally derived cells are the tissue present as part of a tissue biopsy. In other aspects, the bodily fluid is urine, and the locally derived cells are renal cells. In other aspects, the bodily fluid is saliva / sputum and the locally derived cells are epithelial cells. In other aspects, the bodily fluid is cerebral spinal fluid, and the locally derived cells are epithelial cells or leukocytes. In a preferred embodiment, the bodily fluid is blood and the resident cells are leukocytes.
[0045] Blood is comprised of ~5xl09 / mL erythrocytes, ~5xlO6 / mL leukocytes, ~3xl08 / mL thrombocytes, and 40-60% (v / v) of a plasma fluid phase, where circulating nucleic acids (circNAs) can be present as a cell membrane bound component associated with erythrocytes and leukocytes and a cell-free nucleic acid (cfNA) component within plasma. In terms of DNA, circulating DNA (circDNA) can be present as a cell membrane bound component (mb-DNA)and a cell-free component (cfDNA) component within plasma of which a subpopulation is associated with nucleosomes.
[0046] Historically, the DNA component of cfNA (cfDNA) in blood plasma has been the analyte of choice for blood-based liquid biopsies, demonstrating its potential as the basis for a powerful diagnostic for the detection of cancers. Next- generation sequencing (NGS) in particular has become indispensable to advancing liquid biopsies as a broad-based diagnostic platform well- suited for addressing the complex features associated cfDNAs as a proxy for the eventsoccurring peripherally within a tumor, its microenvironment, its progression, as well as the host’s immunological response to its presence. However, numerous features of cfDNA temper its diagnostic utility, particularly when applied to the early detection of cancer.
[0047] First, the amount of recoverable cfDNA from blood plasma is low (0.5-2 ng / mL) and limited by the amount of blood that can be drawn, placing an upper limit on the ability to detect a mutation within tumor derived cfDNA (ctDNA) within the background milieu of normal cfDNA14. The limited amount of cfDNA material also poses technical challenges to its processing and analysis via next-generation sequencing (NGS), requiring high efficiency processes to convert the starting cfDNA into a library of material amenable to analysis via NGS. Current “bestpractices”, however, are prone to poor yields and employ PCR extensively to offset these losses inherent within the preparative steps. PCR is prone to amplification bias, leading to over- and under-representation across amplified genomic regions, and leads to the accumulation of synthetic errors in the final library at frequencies which mimic and mask bona fide mutations that characterize cancer genomes. Error correction methods have been developed to help disambiguate these acquired biases and sequence errors, and while successful, their implementation comes at significant cost, requiring a 20- to 100-fold increase in sequencing depth per sample. To aid in increased sensitivity for the detection of ctDNA, more “coarsegrained” approaches have also been developed, by detecting and measuring the presence of multiple mutations or features of the tumor genome, such as changes in the methylome or in tumor mutational burden (TMB). However, while also prone to the above mentioned errors, these methods also introduce greater technical and analytical challenges which can offset any putative gains in sensitivity. Methylome sequencing requires sample splitting, and bisulfite conversion which are difficult to implement with limited sample quantities. TMB, which measures di- and tr-nucleotide repeat expansions, are highly prone to replicative slippage, which reduces the quantitative value of TMB measurements to very coarse indices of mutational burden.
[0048] Second, the features of cfDNA are highly complex, as it represents the architectural ruins of the genome across a spectrum of tissues due to apoptosis, necrosis, and NETosis, as well as their continued degradation via endogenous nucleases present within blood. These remnants comprising cfDNA reflect areas of the genome that are most resistant to these processes, protected against these degradative processes through their association with DNA binding proteins, and in particular nucleosomes. The majority of cfDNA consists of fragments with unit lengths of -160 bp at multiples corresponding to the length of DNA wrapped around mono-, di-,and tri-nucleosomes, with their persistence in blood arising from continued association with intact nucleosomes, allowing their isolation through antibodies directed to one or more histone units. While additional features beyond the presence of canonical oncogenic mutations have been proposed to distinguish tumor-originating cfDNA (ctDNA) from normal cfDNA, including smaller median fragment distributions, bias in fragment end compositions, none of these features alone or as a composite have been able to clearly distinguish ctDNA versus cfDNA. Recent studies utilizing single-stranded DNA (ssDNA) based approaches focusing on the recovery and analysis of very short DNA fragments to understand the composition of cfDNA have shown that >40% of cfDNA fragments are 25-100 nucleotides (nt) in length, and can be leveraged to provide additional information about their tissue of origin. These studies have demonstrated that not only is the vast majority of cfDNA of mitochondrial origin (mito-cfDNA) rather than of nuclear origin (nuc-cfDNA), ranging from 300-50,000-fold relative abundance of mito-cfDNA to nuc-cfDNA, but that -90% of cfDNA originates from the lymphoid and myeoid population in blood, confounding the ability to identify cfDNA originating from a peripheral tissue site.
[0049] Given these challenges, not only are methods that are highly efficient at processing cfDNA essential, but methods that are able to deplete circNAs originating from lymphocyte / myeloid cells and mitochondria from analysis are critical to improving their diagnostic yield of liquid biopsies by greatly facilitating the identification and analysis of cfDNA originating from peripheral tissue.
[0050] Unfortunately, the challenge of low cfDNA quantities in blood is magnified by depleting cfDNA specific to leukocytes, as at most <10% of the material would be available to process. Recent work however has shown that cfDNA comprises < 10% of the total circDNA present in blood, with a large fraction of circDNA recoverable from leukocytes and erythrocytes as a membrane-bound fraction (mbDNA). Preliminary sequence analysis of mbDNA indicates that, as observed with cfDNA, fragments originating from mitochondrial comprise a significant fraction (up to 50,000x) of mbDNA obtained from RBCs, which are known to sequester mtDNA through binding to TLR9 receptors. Moreover, while the length distribution varies between that found with cfDNA versus those found as mbDNA, with the latter a possessing a longer median range in size, mbDNA is unbiased in its sequence representation across the genome versus cfDNA, suggesting that cfDNA is not priviledged in its sequence content, and that association of circDNA with the surface of the plasma membrane provides additional protection against degradation by circulating blood nucleases. Thus, leveraging this source of circDNA versuscfDNA alone would therefore boost the available input quantity for depletion strategies and minimize the need to amplification strategies which may both bias and introduce sequencing artifacts
[0051] The present disclosure therefore provides a compositions and methods a comprehensive measurement and analysis paradigm for circNAs that have the following general features:
[0052] 1. An integrated blood fractionation method that enables the separation and purification of all putative sources of nucleic acids in blood, namely from plasma, exosomes, membrane- associated, and nuclei.
[0053] 2. A depletion method that physically removes circDNAs originating lymphoid and myeloid blood cells, using purified endogenous nucleosomal DNA from the PBMCs fraction, to retain circNAs originating from peripheral tissue for analysis.
[0054] 3. A high efficiency single- stranded (ss) DNA library preparation method for NGS that directly converts all fragmented DNA into a complete library member that removes the requirement for amplification.FRACTIONATION OF BIOFLUIDS: BLOOD
[0055] In contrast to this traditional route of isolating circNAs within blood plasma (cfDNA) and using this as the sole analyte for liquid biopsies, the present disclosure involves extending the fractionation process to isolate nucleic acids from all putative sources within blood.
[0056] Traditionally, cellular fractionation techniques are utilized for isolation of proteins from various cellular compartments. The methods described here are designed to isolate cellular fractions in blood that substantially maintain the subcellular distribution of nucleic acids within their distinct compartments, namely, extracellular fluid, membrane bound, mitochondrial, and nuclei.
[0057] Blood is typically drawn into either a blood collection tube (BCT) containing an anticoagulant (e.g. K2 / K3EDTA, Na2citrate), a plasma / serum separating gel or barrier (e.g. BD plasma preparation tube), a protease inhibitor (e.g. BD P100) or a fixative / preservative (e.g. Streck cell-free DNA BCT, BD PAXgene DNA tube). Blood collected using BCTs without a fixative are processed within 2 hours of draw or otherwise within 4 days.
[0058] Separation of blood into its cellular constituents relies on the relative densities of erythrocytes, leukocytes, and plasma. Thus, in one aspect, the 6 mL of blood is transferred to a 15 mL conical tube, and centrifuged for 10 minutes at 800 x g where the acceleration and deceleration rate is set at a minimum. Following centrifugation, the top layer of plasma is transferred to a 15 mL conical tube, and then centrifuged for 10 minutes at 1600 x g where the acceleration and deceleration rate is set at a minimum. The plasma supernatant containing cfDNA is carefully removed without disturbing the cell debris pellet and transferred to a 50 mL conical tube for storage at -80°C until ready for use. The remaining sedimented cell layer, comprised of leukocytes, erythrocytes, and thrombocytes is stored at room temperature (<1 hr) until ready for further processing. In another aspect, 6 mL of blood is transferred to a 15 mL conical tube containing a thixotropic compound with a density of between 1.04-1.075 g / mL as described in US3852194 and US4867887, which are hereby incorporated herein by reference in their entirety. The tube is then centrifuged for 30 minutes at 1600 x g where the acceleration and deceleration rate is set at a minimum. The separated plasma fraction containing cfDNA is decanted into a 50 mL conical tube for storage at -80°C until ready for use. After carefully removing the separating barrier, the remaining sedimented cell layer, comprised of leukocytes, erythrocytes, and thrombocytes is stored at room temperature (<1 hr) until ready for further processing. In another aspect, if the blood sample is contained within a BCT with a plasma / serum separating barrier, the sample is centrifuged for 30 minutes at 1600 x g where the acceleration and deceleration rate is set at a minimum and processed as above.
[0059] The primary source of nucleic acids in blood are the lymphoid and myeloid cells, herein described as leukocytes, and their turnover contributes to the total circDNA burden in blood. This material is comprised of degraded nucleosomal DNA from the nucleus and degraded circular DNA from mitochondria. circDNA is also found bound to the plasma membrane of both lekucytes and erythrocytes, and the fractionation method must be able to preserve the integrity of these organelles for subsequent isolation and purification.
[0060] In one aspect, the method of fractionating the cellular component involves differential centrifugation of the cellular component upon treatment with an agent in the presence of a hypotonic solution containing a mixture of proteases and nuclease inhibitors, wherein said agent causes preferential disruption of the plasma membrane of both nucleated and enucleated cells. In one aspect, said agent can be a physical agent, wherein said physical agent can comprisemechanical disruption with a tissue grinder. In another aspect, said agent can be a chemical agent, wherein said chemical agent is comprised of non-ionic detergent at a concentration that is slightly below its critical micelle concentration (CMC). In another aspect, said agent can comprise both a physical and a chemical agent, wherein said chemical agent is comprised of non-ionic detergent at a concentration that is slightly below its (CMC). Following a brief incubation period, centrifugation at a low speed yields a first pellet containing the nuclei fraction and a first supernatant, a supernatant which can then be centrifuged at moderate speeds to yield a second pellet containing the mitochondrial fraction and a second supernatant, a supernatant which can then be centrifuged at high speeds to yield a third pellet containing the plasma membrane fragment fraction and a third supernatant.
[0061] Generally, cell fractionation begins with disruption of the plasma membrane in the presence of a hypotonic buffer to induce turgor pressure, facilitating disruption of the plasma membrane during mechanical shearing. Disruption can also be facilitated through permeabilization of the plasma membrane with a nonionic detergent such as Triton-XlOO or a glycoside such as digitonin that is able to associate with cholesterol-rich membranes. This releases plasma membrane fragments as well as the internal contents of the cell, including nuclei, mitochondria and subcellular organelles, each possessing differences in density that allow their separation via centrifugation. In one aspect, 1 volume equivalent (3-4 mL) of a hypotonic homogenization solution HB comprised of a buffer (e.g. 50 mM Bis-Tris propane, pH 7.4), a non-ionic detergent (e.g. 0.05% (w / v) digitonin), an osmolyte (e.g. 0.3 M NaCl, or 0.14 M sucrose + 0.42 M mannitol), a membrane stabilizer (e.g. 1 M hexylene glycol), a mix of protease inhibitors (e.g. 2 mM phenylmethylsulfonyl fluoride or PMSF), and a mix of nuclease inhibitors (e.g. 40 mM dithiothreitol or DTT, 20 mM Na2EDTA, pH 8.0) is added to the sedimented cell layer, and incubated with gentle inversion for 30 min at 4 °C. Following incubation, the contents are transferred to a pre-chilled Dounce homogenizer and manually homogenized by passing 10- 40 strokes through the sample; or, transferred to a Potter-Elvehjem tissue grinder and homogenized by slowly passing 5-20 strokes through the sample at 1000 rpm.
[0062] The homogenized mixture is then transferred to a pre-chilled 15 mL conical tube, and the contents centrifuged at low speed (e.g. 800 x g) for 10 minutes at 4 °C to pellet nuclei (Pl). The supernatant (SI) containing mitochondria and fragmented plasma membranes is then transferred to a prechilled 15 mL conical tube. The Pl pellet comprised of crude nuclei is resuspended in 2.4 mL of an ice-cold solution NB comprised of a buffer (e.g. 10 mM Bis-Tris propane, pH 7.4, 154mM NaCl), and a membrane protectant (e.g. 1 M hexylene glycol), and divided into 0.6 mL aliquots and kept on ice until ready for further processing.
[0063] The transferred SI supernatant is centrifuged at a moderate speed (e.g. 4000 x g) for 10 minutes at 4 °C to pellet mitochondria (P2). The supernatant (S2) containing plasma membrane fragments is then transferred by aliquoting into prechilled 2 mL Eppendorf tubes. The P2 pellet comprised of mitochondria is resuspended in 0.6 mL of ice-cold BTBS (e.g. 10 mM Bis-Tris propane, pH 7.4, 154 mM NaCl) and kept on ice until ready for further processing.
[0064] The tubes containing the transferred supernatant S2 are centrifuged at 22,000 x g for 30 minutes at 4 °C to pellet plasma membrane fragments (P3). The supernatant (S3) is collected and stored at -20°C until ready for further processing. The P3 pellet is carefully pooled with 0.6 mL of ice-cold BTBS and kept on ice until ready for further processing.PURIFICATION OF PLASMA NUCLEIC ACIDS (CFDNA)
[0065] In one aspect, 3 mL of plasma is incubated with a 1 mL of solution LB comprised of a buffer (e.g. 200 mM HEPES, pH 7.4), an ionic detergent (e.g. 10% (w / v) SDS), a mix of nuclease inhibitors (e.g. 80 mM DTT, 40 mM Na2EDTA, pH 8.0), and a protease (e.g. proteinase K, papain, pronase). Papain however is more efficient at digesting plasma proteins and is stable under the conditions described (unpublished observations). Following incubation for 20 min at 37 °C with gentle agitation (Eppendorf Thermomixer C, 600 rpm), 1 mL of a solution BB comprised of a chaotrope (e.g. 5 M guanidinium isothiocyanate or GITC), a volume-excluding polymer (e.g. 12% PEG- 1000), and paramagnetic beads (e.g. 1 mg / mL Promega MagneSil, 5 mg / mL Cytiva Sera-Mag carboxylate SpeedBeads), is added to the mixture and inverted 5 times to mix. After a brief spin to collect contents to the bottom of the tube, 3.5 mL of isopropanol is added. After incubation for 15 min at room temperature, the mixture is magnetized using a high field strength magnet for 10 minutes. The supernatant is discarded, and a 5 mL of a solution WB1 comprised of a buffer (50 mM Bis-Tris propane, pH 7.4), a chaotrope (e.g. 1 M GITC), a chelator (e.g. 10 mM Na2EDTA, pH 8.0), a volume-excluding polymer (e.g. 12% PEG- 1000), a non-ionic detergent (e.g. 0.01% Tween-20) and 40% isopropanol is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB1 solution, and the solution is discarded. Five milliliters of freshly prepared WB2 (e.g. 75% (v / v) aqueous ethanol) is then added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution, and the solution is discarded.After repeating the WB2 wash step, the tube is centrifuged briefly to collect the material at the bottom of the tube, and then magnetized to draw out the pellet from the residual solution. The residual solution is then carefully removed, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately with 100 pL of solution EB comprised of a buffer (e.g. 10 mM Tris, pH 8.0), a nuclease inhibitor (e.g. 0.1 mM Na2EDTA), and a non-ionic detergent (e.g. 0.01% Tween-20). After incubation for 5 minutes at room temperature, the solution is magnetized, and the solution phase is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tube, avoiding disruption of the magnetized pellet. The solution containing purified cfDNA is stored at -20 °C.PURIFICATION OF MITOCHONDRIAL NUCLEIC ACIDS
[0066] In one aspect, the resuspended pellet P2 comprised of the crude mitochondrial fraction is incubated with 0.2 mL of LB for 20 min at 37 °C with gentle agitation. Following incubation, 0.2 mL BB is added to the mixture, and inverted 5 times to mix. After addition of 0.7 mL isopropanol, the mixture is incubated for 15 min at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 1 mL of WB1 is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB1 solution. After discarding the solution phase, 2 mL of freshly prepared WB2 is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the WB2 wash is repeated. After discarding the solution phase, the tube is centrifuged briefly to collect residual solution at the bottom of the tube. The tube is then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tube is then magnetized, and the solution phase is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tube, avoiding disruption of the magnetized pellet. The solution containing purified mitochondrial DNA (mtDNA) is stored at -20 °C.PURIFICATION OF CELL MEMBRANE BOUND NUCLEIC ACIDS
[0067] In one aspect, the resuspended pellet P3 comprised of the crude plasma membrane fraction is incubated with 0.2 mL of LB for 20 min at 37 °C with gentle agitation. Following incubation, 0.2 mL BB is added to the mixture, and inverted 5 times to mix. After addition of 0.7 mL isopropanol, the mixture is incubated for 15 min at room temperature, then magnetized usinga high field strength magnet for 10 minutes. After discarding the solution phase, 1 mL of WB1 is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB1 solution. After discarding the solution phase, 2 mL of freshly prepared WB2 is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the WB2 wash is repeated. After discarding the solution phase, the tube is centrifuged briefly to collect residual solution at the bottom of the tube. The tube is then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tube is then magnetized, and the solution phase is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tube, avoiding disruption of the magnetized pellet. The solution containing purified mb-circDNA is stored at -20 °C.ISOLATION OF CHROMATIN REGIONS
[0068] Given that cfDNA is primarily comprised of nucleosomal DNA derived from cells of hematopoietic lineage, and that there is a pool of circulating mitoDNA that can also confound analysis of cfDNA originating from peripheral tissue, it is apparent that DNA from leukocytes, both nuclear and mitochondrial, can be leveraged to create a library of leukocyte specific molecules that can be used to deplete cfDNA of haematopoietically derived cfDNA. In particular, nucleosome protected regions of chromatin can be isolated from nuclear DNA, and in conjunction with mitochondrial DNA, used as capture probes for depletion. Moreover, protected regions in chromatin can be categorized by their accessibility based on their association with DNA binding proteins (DNABPs) with more transient occupancy. This potentially allows selective depletion of leukocyte- specific cfDNA based on more stringent and differentiating criteria. Finally, as there is no a priori evidence suggesting that cfDNA is privileged in it composition or origins, and as there is no evidence that suggests that mbDNA is biased in its composition versus cfDNA, leukocyte originating mb-circDNA can also be depleted from this reservoir to improve overall recoveries of circDNA from peripheral tissue.
[0069] Chromatin exist densely packed and localized within the nucleus, and are surrounded by the nuclear lamin proteins which reinforce the nuclear envelope and the 3D structure of the nucleus through its interactions with the nuclear pore complex (NPC), the inner nuclear membrane, and nucleosomes. The nuclear envelope, comprised of the inner and outer nuclearmembrane, acts as a physical barrier between the nucleoplasm and the cytoplasm, with transport between these two regions mediated by the NPC, which largely restricts the passive diffusion of molecules with a molecular weight (MW) of >40 kDa. Exclusion of larger molecules by the NPC is mediated by the presence of a hydrogel-like occlusion within the NPC channel that spontaneously forms due to large phenylalanine-glycine (FG) repeats present within the F98 nucleoporin subunits. This limit is not strict, however, and is influenced both by the molecule’s hydrophobicity and / or its association with a nuclear transport factor that facilitates transport of much larger molecules (MW >1 MDa).
[0070] The present disclosure further provides methods for obtaining regions of chromatin from a set number of purified intact nuclei for use as capture probes, wherein said method of obtaining comprises: a) treating isolated nuclei with a solution containing a nuclear pore complex (NPC) disrupting agent and an enzyme or a chemical agent capable of cleaving DNA at accessible sites within chromatin; b) separately isolating the nucleic acid content released through cleavage at accessible sites and the nucleic acid content remaining within the nuclei component; c) optionally fragmenting or shearing the isolated nucleic acid content from each component with an agent to ensure an adequate recovery of fragments with a size distribution of less than 100 bp, preferably between 20-50 bp; d) attaching a donor moiety to the ends of the fragmented nucleic acid content from each component to create a plurality of capture probes that can then be attached to an receiver moiety bound to a support, wherein said support can be a linear polymer, a cross-linked polymer, a particle, or a combination thereof.
[0071] The isolation and tagging of the nucleosome protected regions (NPRs) and nucleosome depleted regions (NDRs) of genomic DNA is well described. In some aspects, intact isolated nuclei can be incubated an DNA cleaving agent, such as a non-specific nuclease such as DNase I, micrococcal nuclease (MNase), or benzonase (BZase), an intercalating free-radical generator, or a restriction endonuclease (RE). As these agents have a MW <35 kDa, they can freely diffuse into the nucleoplasm through the nuclear pore complex (NPC) and cleave at the accessible regions of chromatin (i.e. NDRs). After a brief incubation period, the entire mixture is solubilized with a denaturing detergent in the presence of a protease to halt the reaction and deproteinize the mixture, followed by an optional decrosslinking step if the nuclei were obtained from cells pretreated with formaldehyde. Alternatively, isolated nuclei can be incubated with a transposome (< 80 kDa) comprised of the Tn5 transposase (MW ~53 kDa)complexed with one of two unique partially dsDNA adaptors consisting of a mosaic end sequence (MES; 19 bp) which integrates into the site of transposition. To facilitate diffusion across the NPC,hydrophobic molecules are included that are able to disrupt the NPC pore. This results in insertion within linker DNA spanning as little as 10 bp between adjacent nucleosomes, in addition to open regions of chromatin, and causing cleavage at the site of integration.
[0072] The extracted DNA is thus comprised of a mixed population of DNA fragments. One population is derived from NPRs, with a size periodicity that largely reflects their protection from cleavage due to their association with nucleosomes. Another population is derived from NDRs, with a distribution of lengths that reflects the accessibility of these regions to the cleaving agent. However, the relative distribution of fragments within each of these populations is influenced by the properties of the cleaving agent used, and their ability to invade and / or displace regions bound to DNA binding proteins (DNABPs), including nucleosomes, transcription factors, enhancers, repressors, as well as regions associated with the surrounding nuclear matrix. This influences the general utility of these methods in context of generating capture probes for an affinity support.
[0073] Cleavage with REs relies on the presence of unique palindromic sequences within accessible regions of chromatin and therefore creates fragments with defined non-overlapping positions in the genome, which may affect capture uniformity of randomly cleaved sequences. Moreover, palindromic tetra-, penta-, and hexa-nucleotide sequences have a non-random distribution within the human genome and are therefore bias the frequency at which REs will cleave. The reduces the probability that such a site exists adjacent to a nucleosome, potentially retaining linker or nucleosome adjacent sequences within a capture probe. Cleavage by REs can also be blocked by the presence of methylated bases within the recognition sequence. While a combination of REs can be identified to improve cleavage uniformity across the genome, potential polymorphisms may exist, affecting the general utility of such an approach.
[0074] In another aspect, the method of treating with an enzyme is applied to an isolated nuclei sample from -300,000 cells, wherein the method of treating involves resuspending the nuclei in a solution containing a restriction endonuclease (RE) in the presence of 1,6-hexanediol, wherein said endonuclease can have a tri-, tetra-, penta-, or hexa-, or hepta-nucleotide recognition sequence, wherein said RE is preferably a mixture of multiple REs that generates fragments with a distribution of 70-120 bp. Following a set incubation period, the REs are inactivated by the addition of a chelator, and the mixture is centrifuged at a medium speed to yield a pellet containing the nuclei fraction and a supernatant, wherein said supernatant is comprised of DNAfragments accessible to the REs. DNA is then separately purified from the pellet and the supernatant samples.
[0075] Cleavage with non-specific nucleases such as DNase I, MNase, or BZase introduce nicks on either strand of dsDNA. These nicks accumulate and increase in density over time, causing local destabilization of the duplex, and eventually leading to scission of the dsDNA and / or the release of ssDNA. The continued activity of nucleases on ssDNA as well as 5’- or 3’-end overhangs leads to further digestion to short oligonucleotides and free nucleotides. As with REs and transposases, cleavage by the nuclease is determined by the accessibility of a given region to nuclease binding. Unlike REs and transposases, however, both nuclease concentration and incubation time determine the size distribution and composition of fragments released, weighted by the relative binding affinity and residency time of a given DNABP versus that of the nuclease. Thus, digesting with increasing quantities of nuclease will yield fragment populations from regions binding DNABPs with greater stability, and with continued exposure, will eventually lead to scission of nucleosome-bound DNA. However, nucleases exhibit compositional biases at the site of cleavage. Both DNase I and MNase prefer to cleave at A / T-rich sites, however, unlike MNase, DNase I also exhibits poor activity against poly(dA dT) tracts. In contrast, BZase prefers to cleave at G / C-rich, although like DNase I, exhibits poor activity against poly(dA dT) tracts. Thus, it is apparent that mixtures of MNase and BZase can provide an unbiased fragmentation profile of chromatin, providing a means to accurately distinguish NPR versus NDRs.
[0076] In one aspect, the method of treating with an enzyme is applied to an isolated nuclei sample from -300,000 cells, wherein the method of treating involves resuspending the nuclei in a solution containing a non-specific endonuclease (ENase) in the presence of 1,6-hexanediol, wherein said endonuclease can be DNase I, micrococcal nuclease (MNase), benzonase (BZase), or preferably a mixture of MNase and BZase. Following a set incubation period, the ENases are inactivated by the addition of a chelator, and the mixture is centrifuged at a medium speed to yield a pellet containing the nuclei fraction and a supernatant, wherein said supernatant is comprised of DNA fragments accessible to the ENase. DNA is then separately purified from the pellet and the supernatant samples. In another aspect, the method of treating involves incubation of multiple isolated nuclei samples each derived from -300,000 cells with multiple solutions comprised of various quantity of ENases (e.g. high, medium, low) for a set incubation period, wherein the nuclei fraction from the highest incubation quantity is retained for DNA purification.
[0077] In another aspect, the method of treating involves incubation of multiple isolated nuclei samples each derived from -300,000 cells with multiple solutions comprised of a single quantity of ENases for various periods of time (e.g. 5 min, 10 min, 20 min), wherein the nuclei fraction from the longest incubation period is retained for DNA purification. In another aspect, the method of treating involves serial incubation of a single isolated nuclei sample derived from -300,000 cells with a solution comprised of a ENases over successive periods of time. Following a first incubation period, the ENases are inactivated by the addition of a chelator, and the mixture centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the ENase released after the first incubation period. After resuspension of the resulting pellet with fresh ENase solution and after a second incubation period, following inactivation the mixture is centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the ENase released after the second incubation period. After resuspension of the resulting pellet with fresh ENase solution and after a final incubation period, following inactivation the mixture is centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the ENase released after the final incubation period. The supernatants from each incubation period as well as the final pellet is retained for DNA purification.
[0078] In another aspect, the method of treating with chemical agent is applied to an isolated nuclei sample from -300,000 cells, wherein the method of treating involves resuspending the nuclei in a solution containing a free-radical generator (FRG) in the presence of 1,6-hexanediol, wherein said FRG is a chelator complexed to a transition metal such as Fe(II) that intercalates into dsDNA and induces fragmentation in the presence of hydrogen peroxide. Following a set incubation period, the FRG is inactivated by the addition of a free-radical scavenger, and the mixture is centrifuged at a medium speed to yield a pellet containing the nuclei fraction and a supernatant, wherein said supernatant is comprised of DNA fragments accessible to the FRG. DNA is then separately purified from the pellet and the and the supernatant samples.
[0079] In another aspect, the method of treating involves serial incubation of a single isolated nuclei sample derived from -300,000 cells with a fresh solution comprised of the FRG over successive periods of time. Following a first incubation period, the FRG are inactivated by the addition of a free-radical scavenger, and the mixture centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the FRG released after the first incubation period. After resuspension of the resulting pellet with fresh FRG solution and after a second incubation period, following inactivation the mixture is centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the FRG released after the secondincubation period. After resuspension of the resulting pellet with fresh FRG solution and after a final incubation period, following inactivation the mixture is centrifuged to yield a pellet and a supernatant comprised of DNA fragments accessible to the FRG released after the final incubation period. The supernatants from each incubation period as well as the final pellet is retained for DNA purification.
[0080] To function as an affinity support, some means selecting fragments generated with increasing amounts of nuclease and / or incubation time would be desirable to allow representation of the NDR, the DNABP and the NPR classes of accessibility within a putative affinity matrix. In some aspects, with the realization that the nuclear envelope in intact nuclei acts as a natural filter via the NPC, the products of nuclease digestion can be isolated and purified serially as they are released and diffuse from the nuclei. The regions most resistant to nuclease cleavage would therefore comprise the NPR which can be subsequently purified from the nuclei.
[0081] In one aspect, three 0.6 mL aliquots of isolated intact nuclei (pellet Pl) are individually incubated with a fragmentation agent that comprises a mixture of MNase and BZase at high (H), medium (M), and low (L) quantities in the presence of a buffer (e.g. 50 mM Bis-Tris propane, pH 7.4), a co-factor (e.g. 2 mM CaCh and 5 mM MgCh), a nuclei stabilizing agent (e.g. 12% w / v hexylene glycol or 12% PEG-8000), and an agent that is able to disrupt the NPC (e.g. 5% v / v 1,6-hexanediol). Alternatively, the fragmentation agent can be a mix of nicking enzymes (e.g. NEB Fragmentase®). After incubation for 10 minutes at 37 °C, the reactions are quenched by the addition of a chelator mix (e.g. 10 mM EDTA and 10 mM EGTA), and centrifuged for 10 minutes at 1200 x g. The supernatants from each sample (HS, MS, LS) are collected and stored in a 2.0 mL Eppendorf Lo-bind tube on ice until ready for further processing. The pellets from each sample (HP, MP, LP) are resuspended in a 0.6 mL of solution NB and stored on ice until ready for further processing.
[0082] To each of tubes HS, MS, LS, and HP, MP, LP, 0.2 mL of LB is added and incubated for 10 minutes at 37 °C with gentle agitation. Eollowing incubation, 0.2 mL BB is added to the mixtures, and inverted 5 times to mix. After addition of 0.7 mL isopropanol, the mixtures are incubated for 15 min at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 1 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through theWB1 solution. After discarding the solution phase, 2 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 2.0 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.CAPTURE PROBE CONSTRUCTION
[0083] The purified products of transposition or nuclease digestion will not only be a mix of ssDNA and dsDNA, but will also have a fragment distribution lying outside of this desired size window. The purified mitoDNA product, representing another source of confounding DNA and therefore important to include as part of the separation matrix, exists in a circular dsDNA form of -11-28 kilobases (kb) in length. Thus, in some aspects, to maximize the amount of purified products that converted into capture probes, it is preferable that these products are further fragmented.
[0084] In some aspects, additional fragmentation can be performed through acoustic cavitation (Covaris shearing) to ensure that >95% of all fragments will be less than 150 bp. Size selection can then performed in order to obtain the desired fragment lengths to generate capture probes. Alternatively, in some aspects, purified products can be treated briefly with the fragmentation agent consisting of MNase and BZase, or alternatively, a duplex DNase, to further reduce the fragment size distribution to the desired window.
[0085] In other aspects, additional fragmentation products of the biotinylated transposition samples are incubated with a streptavidin support. In one embodiment, 2 mg of Cytiva Streptavidin SpeedBeads is added to the Covaris sheared or nuclease treated biotinylated transposition products, and incubated for 15 minutes at room temperature with gentle agitation (25 °C, 1000 rpm, Thermomixer C). Following incubation, the samples are magnetized using a high field strength magnet for 10 minutes. The supernatant from each sample is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of themagnetized pellet. The solutions containing the fragmented transposition material depleted of the MES are stored on ice until ready for further processing.
[0086] In other aspects, additional fragmentation of the transposition samples can be achieved by incubation of the purified fragments with a large excess of transposome to ensure that the DNA is saturated in its occupancy, resulting in fragments of >50 bp in length.
[0087] Fragmentation of DNA however can lead to a mix of 5’- and 3 ’-terminal phosphate and hydroxyl groups. These can be unified to either a 5 ’-phosphate / 3’ -hydroxyl via T4 polynucleotide kinase (PNK) or a 5 ’-hydroxyl / 3’ -hydroxyl via alkaline phosphatase (AlkP). More problematic is the propensity of fragmentation methods, both enzymatic or mechanical, to induce base damage through oxidation and / or deamination. Enzymatic approaches typically produce ssDNA alone or as 5’- or 3’-overhangs of dsDNA, which increases their exposure to cytosine deamination events via hydrolysis to uracil, particularly at increased incubation temperatures used for heat inactivation that causes a concomitant reduction in the pH for Tris buffers. Acoustic cavitation based mechanical shearing approaches, while also producing ssDNA alone or as 5’- or 3’-overhangs of dsDNA, can also cause formation of 8-oxo-7,8- dihydroguanine (8-oxoG) via hydroxyl free radical generation during high energy sonication when shearing to shorter (< 150 bp) fragments sizes. Thus, to ensure consistency in the performance of the affinity support, the impact of these damaged bases must be mitigated, preferably by their removal. In some aspects, the fragmented DNA undergoes excision repair by incubating with a mixture uracil-N-deglycosylase (UDG) to remove uracil deamination products to create an abasic site and Endonuclease VIII to excise the resulting abasic site, as well as Fpg to excise 8-oxoG bases in a solution containing a buffer (20 mM Tris-acetate, pH 8), a cofactor (e.g. 10 mM MgCh), a salt (e.g. 50 mM Potassium Acetate), and a non-specific blocker (e.g. 0.1 mg / mL BSA). In some aspects, PNK is added with ATP to ensure that the fragment ends are 5’- phosphorylated and hydroxylated at their 3’-ends. In other aspects, AlkP is added to ensure that both the 5’- and 3 ’-ends of the fragments are dephosphorylated.
[0088] In another aspect, the purified post-fragmentation DNA samples are repaired through base-excision of damaged bases by incubating the samples with a solution containing uracil-N- deglycosylase, Endonuclease VIII, Fpg, and a polynucleotide kinase with ATP. In another aspect, the purified post-fragmentation DNA samples are repaired through base-excision of damaged bases by incubating the samples with a solution containing uracil-N-deglycosylase, Endonuclease VIII, Fpg, and an alkaline phosphatase. Following incubation, the excisionrepaired DNA samples derived from the post-fragmentation DNA samples are purified for further processing.
[0089] Following excision repair, 30 pL of LB is added to the reaction mix and incubated for 10 min at 37 °C. Following incubation, 30 L mL BB is added to the mixtures, and inverted 5 times to mix. After addition of 105 pL isopropanol, the mixtures are incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.5 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB 1 solution. After discarding the solution phase, 0.5 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.
[0090] In another aspect, the excision repaired DNA samples can be end-repaired (ER) to create flush ends at both the 5’- and 3 ’-ends of each fragment by incubating with a solution containing a strand-displacing DNA polymerase with 3’— >5’ exonuclease activity and dNTPs. In another aspect, the excision repaired DNA samples that have been treated with polynucleotide kinase can be end-repaired to create flush ends at both the 5’- and 3 ’-ends of each fragment by incubating with a solution containing a non- strand displacing DNA polymerase with 3’— >5’ exonuclease activity, followed by incubation with a DNA ligase. In another aspect, the end-repaired dsDNA can be dA-tailed (AT), where the method of dA tailing comprises incubation with a solution containing a followed by enhance specificity of downstream ligation with a dsDNA adaptor molecule, with Taq DNA polymerase. Following incubation, the ER- AT treated DNA samples derived from the excision repaired DNA samples are purified for further processing.
[0091] To enable their use as a capture agent and form the basis for a separation matrix, the final form of the purified fragments from HS, MS, LS, and HP, MP, LP, should be ssDNA less than100 bases in length, preferably between 20-50 bases to limit off-target and / or non-specific hybridization. For size selection, products can be separated via gel electrophoresis and fragments corresponding to the desired size window can be excised. However, this approach is timeconsuming, labor-intensive, and not readily automated. Solid-Phase Reversible Isolation (SPRI) based approaches using paramagnetic beads have been well-established for size selection, by leveraging the volume excluding properties of polymers such as PEG- 8000 in the presence of high salt concentrations (e.g. >0.5 M NaCl) to promote precipitation / sedimentation of nucleic acids of a certain size range onto a surface. However, standard formulations (e.g. AmpureXP or homemade equivalents) are limited in their size selection capabilities to fragments >75 bp. While addition of isopropanol has been used to favor recovery of smaller (>50 bp) fragments, we have discovered that smaller molecular weight PEGs in combination with isopropanol (SeraSELECT) enables size selection of fragments well below this length scale (15-100 bp). In one embodiment, the SeraSELECT solution is comprised of a buffer (20 mM Tris HCl, pH 8.0), a counterion (e.g. 2 M NaCl), a non-ionic detergent (e.g. 0.05% w / v Tween-20), paramagnetic beads (0.2 mg / mL), a polymer that behaves as a volume excluder (e.g. 20% w / v PEG-3350), and isopropanol (e.g. 33%). The combination of the two purification solutions thus allows for size selection across a broad range of DNA fragment lengths.
[0092] In some aspects, following optional fragmentation, fragments < 20 bp are removed through incubation with 2 volumes of SeraSELECT solution. The mixture is incubated for 15 min at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.5 mL of WB2 is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tube is centrifuged briefly to collect residual solution at the bottom of the tube. The tube is then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tube is then magnetized, and the solution phase is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tube, avoiding disruption of the magnetized pellet. The solution containing is stored on ice until ready to be further processed.
[0093] Upon clean-up, to convert the fragments to a capture agent, a donor molecule that enables coupling to a secondary molecule that is present on a solid phase support needs to be added tothe fragmented DNA. This donor molecule can be a biotin, which can bind with extremely high affinity and co-operativity to an avidin subunit or avidin-like molecule (KD ~ 1 fM); a primary amino group, which can react with an activated ester group such as A-hydroxy succinimide (oNHS), pentafluorophenol (oPFP), or tetrafluorophenol (oTFP), yielding an amide linkage via transesterification; an azido group, which can react with an alkynyl group in the presence of a copper (I) catalyst, or with a strained alkyne in the absence of a catalyst, yielding a 1,2,3-triazole linkage through cycloaddition (i.e. Click chemistry); conversely an alkyne or strained alkyne, which can react with an azido group as described; or with a / / wrs-cyclooctcnc such as E- cyclooct-4-enol, which can react with a tetrazine via an inverse electron demand Diels-Alder reaction (IEDDA).
[0094] Many approaches, however, exist for introducing a donor molecule onto DNA. These methods are influenced by the configuration of the DNA fragment ends, namely, 5’- phosphate / 3’-OH (Type I) or 5’-OH / 3’-OH (Type II), and whether the DNA fragment is ssDNA or dsDNA.
[0095] In one aspect, the method of attaching a donor to the ends of the fragmented molecules results in the attachment of the donor molecule to the 3 ’-end of the fragment molecules, the method involving incubation of the excision repaired DNA samples obtained from isolated nuclei and mitochondria with a solution comprised of a polymerase, wherein said polymerase is a terminal transferase (TdT), and a modified dUTP nucleotide, wherein said modification is comprised of the desired donor moiety, and can include a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans-cycloctene. Following incubation, the 3 ’-end donor modified capture probe products are purified for further processing.
[0096] In one aspect, the donor molecule is part of a modified nucleotide such as deoxyuridine triphosphate (dUTP) that can be incorporated at the 3 ’-end of a Type I or Type II DNA by terminal transferase (TdT). Such modifications include biotin- 11 -dUTP, 5-ethynyl-dUTP, DBCO-dUTP, Azide-PEG4-aminoallyl-dUTP, or 5-TCO-PEG4-dUTP. In one embodiment, a 50 pL solution comprised of a buffer (e.g. 40 mM Bis-Tris propane, pH 7.0), a mix of cofactors (e.g. 20 mM Magnesium Acetate + 0.5 mM C0CI2), a salt (e.g. 100 mM Potassium Acetate) is added to 50 pL of purified fragmented DNA. The mixture is heat denatured for 3 min at 95 °C, and immediately placed on ice. TdT (20 U) and 200 pmol of modified dUTP is added to the mixture and incubated for 30 minutes at 37 °C. Following incubation, 20 pL of 0.12 M EDTA is 1added to quench the reaction, followed by 30 pL of LB solution. Following incubation for 10 min at 37 °C, 30 pL mL BB is added to the mixture, and inverted 5 times to mix. After addition of 105 pL isopropanol, the mixtures are incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.5 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB 1 solution. After discarding the solution phase, 0.5 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 20 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.
[0097] However, in some aspects, it is desirable for the capture agent to function as a primer-like molecule, requiring that the 3 ’-end of the capture DNA be extendable with a DNA polymerase. The donor molecule must therefore be attached to the 5 ’-end of the fragment DNA.
[0098] In one preferred aspect, the donor molecule described above is incorporated to the 5 ’-end of a short ODN (8-12 nts) during synthesis. This can be introduced directly as a 5’-BiotinTEG Phosphoramidite, 5'-Amino-Modifier TEG CE-Phosphoramidite, 5'-Hexynyl Phosphoramidite, 5'-DBCO-TEG Phosphoramidite, as part of a nucleotide phosphoramidite, such as Biotin-dT, Amino-Modifier C6 dT, 5-Ethynyl-dU-CE Phosphoramidite, C8-Alkyne-dT-CE Phosphoramidite, C8-Alkyne-dC-CE Phosphoramidite, DBCO-dT-CE Phosphoramidite (Glen Research); or, indirectly, by coupling the active ester (oNHS, oPFP, or oTFP) of a donor molecule to a primary amino group introduced during synthesis of the ODN, either at its 5 ’-end or as a nucleotide. This donor active ester can include Azido-dPEG4-TFP or NHS esters, Alkyne- PEG5-NHS ester, or DBCO-sulfo-NHS Ester, Tetrazine-PEG5-NHS ester, or NHS ester-a-TCO (Sigma Aldrich).
[0099] In one aspect, attachment of the donor modified ODN to Type I fragment molecules is mediated through an RNA ligase 1. The thermophilic RNA ligase CircLigase has been demonstrated to achieve near quantitative ligation of short (< 100 nt) ssDNA in the presence of 20% PEG-8000. To minimize the impact of ligation bias, the donor modified ODN is synthesized with a 3 ’-end dT.
[0100] In another aspect, the method of attaching a donor to the ends of the fragmented molecules results in the attachment of the donor molecule to the 3 ’-end of the fragment molecules, the method involving incubation of the excision repaired alkaline phosphatase-treated DNA samples obtained from isolated nuclei and mitochondria with a solution comprised of a ligase, wherein said ligase is an ATP-dependent family 1 RNA ligase (RNAL1), wherein said RNAL1 is mesophilic or thermophilic, and the molecule containing the donor moiety is an oligodeoxyribonucleotide (ODN), wherein said ODN is modified with a phosphate on its 5’-end and the desired donor moiety on its 3 ’-end, wherein said donor moiety can be a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans-cycloctene. Following incubation, the 3 ’-end donor-ODN modified capture probe products are purified for further processing.
[0101] In one embodiment, 5 pmol of 5 ’-phosphorylated Type I fragment molecules are incubated with 5 U of CircLigase II and 10 pmol of the donor modified ODN in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-Acetate, pH 8), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 10 mM Mg2+), a reducing agent (e.g. 1-5 mM DTT), a catalytic amount of ATP (e.g. 0.1-1 mM), a non-ionic detergent (e.g. 0.1% Tween-20) and a volume excluding polymer (e.g. 12-18% (w / v) PEG-8000). Following incubation for 1 hour at 60 °C, 10 pL of 60 mM EDTA and 10 pL of LB solution is added and the mixture vortexed briefly followed by a brief centrifugation to bring contents to the bottom of the tube. After incubation for 10 minutes at 37 °C, 10 pL of BB solution followed by 35 pL of isopropanol is added and the mixture vortexed briefly followed by a brief centrifugation to bring contents to the bottom of the tube. The mixtures are incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.2 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB 1 solution. After discarding the solution phase, 0.2 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution.The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 20 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.
[0102] In one aspect, attachment of the donor modified ODN can instead be to Type II fragment molecules and mediated by RtcB, a family of RNA repair / splicing enzymes that is able join RNA 2’, 3 ’-cyclic -phosphates or 3’-phosphate ends to RNA 5’-OH ends, and like RNA ligases, is able to join DNA with near quantitative yields.
[0103] In another aspect, the method of attaching a donor to the ends of the fragmented molecules results in the attachment of the donor molecule to the 5 ’-end of the fragment molecules, the method involving incubation of the excision repaired alkaline phosphatase-treated DNA samples obtained from isolated nuclei and mitochondria with a solution comprised of a ligase, wherein said ligase is a GTP-dependent RtcB RNA ligase, wherein said RtcB is mesophilic or thermophilic, and the molecule containing the donor moiety is an ODN, wherein said ODN is modified with a phosphate on its 3 ’-end and the desired donor moiety on its 5 ’-end, wherein said donor moiety can be a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans-cycloctene. Following incubation, the 5 ’-end donor-ODN modified capture probe products are purified for further processing.
[0104] In one embodiment, the donor-modified ODN is synthesized with a 3’-phosphate. To attach this ODN to the 5 ’-end of the Type II fragment molecules, 20 pmol of RtcB from E. coli is incubated with 10 pmol of the donor modified ODN and 5 pmol of the Type II fragment molecules in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-Acetate, pH 8), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 2-5 mM Mn2+), a reducing agent (e.g. 1-5 mM DTT), a catalytic amount of GTP (e.g. 0.1-1 mM), a non-ionic detergent (e.g. 0.1% Tween- 20), bovine serum albumin (BSA), and a volume excluding polymer (e.g. 12-18% (w / v) PEG- 8000). Following incubation for 20 min at 37 °C, 10 pL of 60 mM EDTA and 10 pL of LB solution is added and the mixture vortexed briefly followed by a brief centrifugation to bring contents to the bottom of the tube. After incubation for 10 minutes at 37 °C, 10 pL of BB solution followed by 35 pL of isopropanol is added and the mixture vortexed briefly followed bya brief centrifugation to bring contents to the bottom of the tube. The mixtures are incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.2 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB1 solution. After discarding the solution phase, 0.2 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 20 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.
[0105] In some aspects, it may be beneficial to utilize only the dsDNA products from Type I fragment molecules as an intermediate to generate the desired capture agents. The ER- AT fragments are then ligated to a dsDNA adaptor comprised of first ODN with a donor molecule on the 5 ’-end as described above and a T-overhang on its 3 ’-end and a second ODN that is complementary to the first ODN. Upon ligation with T4 DNA ligase, the first ODN will be ligated to the 5 ’-end of the Type I fragment molecules, while the second ODN will remain unligated. In one embodiment, the first ODN and the second ODN are on the same molecule, and separated by linker tri-, tetra-, penta-, or hexa-oligonucleotide in which one of the nucleotides contains the donor molecule, such that the dsDNA adaptor is a hairpin molecule. This allows the added length of the adaptor to be minimized on the resulting capture probe, while blocking the added adaptor from participating in the hybridization reaction.
[0106] In another aspect, the method of attaching a donor to the ends of the fragmented molecules results in the attachment of the donor molecule to the 5 ’-end and the 3 ’-end of the fragment molecules, the method involving incubation of the ER- AT treated DNA samples obtained from isolated nuclei and mitochondria with a solution comprised of a ligase, wherein said ligase is an ATP-dependent family 1 DNA ligase (DNAL1), wherein said DNAL1 is mesophilic or thermophilic, and the molecule containing the donor moiety is a double-stranded DNA (dsDNA) adaptor comprised of a first ODN with a donor molecule on the 5 ’-end and a dT-overhang on its 3 ’-end and a second ODN that is complementary to the first ODN. In a preferred aspect, the second ODN and the first ODN are part of the same hairpin molecule separated by a tri-, tetra-, penta-, or hexanucleotide ODN loop, wherein the first ODN has a 5 ’-hydroxyl group, wherein said donor moiety is part of a modified nucleotide within said ODN loop, wherein said donor moiety can be a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans- cycloctene. Following incubation, the donor-adaptor modified capture probe products are then purified for further processing.
[0107] In some aspects, it is preferable that all the capture agents are of the same length in order to ensure faster more consistent hybridization kinetics across all species while limiting off-target or non-specific hybridization events. This feature can be realized by introducing a binding site for a Type IIS enzyme, which cleaves at a fixed length outside of its recognition sequence, into the dsDNA adaptor. For example, the enzyme Mme I cleaves 20 nts on the upper and 18 nts on the lower strand away from its recognition sequence 5’-TCCRAC-3’. A similar strategy has previously been utilized to obtain and analyze short sequence tags from DNase hypersensitive sites in chromatin88. Here we adapt this approach to obtain fragments for use as a capture agent.
[0108] In another aspect, the dsDNA adaptor used to construct the donor-adaptor modified capture probes contains a recognition site for a Type IIS enzyme within the first and second ODN comprising the adaptor. Following ligation to the ER-AT treated DNA samples, the product is incubated with a solution containing a Type IIS enzyme to release a >20 bp product from either side of the donor-adaptor modified capture probe, wherein said released products are approximately the same length. Following incubation, the 5 ’-end donor-ODN modified capture probe products are purified for further processing.
[0109] Thus, in one embodiment, an ODN minimally comprised of 5’- GTCGGAGG[T*]AACTCCGAC-3’ (SEQ ID NO:1), where [T*] is modified with a donor molecule, is attached to the ER-AT treated Type I fragment molecules by incubating 50 pmol of the ODN and 5 pmol of the Type I fragment molecules in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-HCl, pH 7.5), a cofactor (e.g. 10 mM MgCh), a reducing agent (e.g. 10 mM DTT), a catalytic amount of ATP (e.g. 1 mM), a non-ionic detergent (e.g. 0.1% Tween- 20), a volume excluding polymer (e.g. 12-18% w / v PEG-8000) and 2000 U of T4 DNA ligase. Following incubation for 10 min at 25 °C, 10 pL of 60 mM EDTA and 10 pL of LB solution is added and the mixture vortexed briefly followed by a brief centrifugation to bring contents to the bottom of the tube. After incubation for 10 minutes at 25 °C, 10 pL of BB solution followed by35 pL of isopropanol is added and the mixture vortexed briefly followed by a brief centrifugation to bring contents to the bottom of the tube. The mixtures are incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.2 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB 1 solution. After discarding the solution phase, 0.2 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. To release capture probes, the purified products are then incubated with 20 U of Mme I by adding a 50 pL solution comprised of a buffer (e.g. 40 mM Tris-acetate, pH 7.9), a cofactor (e.g. 20 mM Magnesium Acetate), a salt (e.g. 100 mM Potassium Acetate) and a non-specific blocker (e.g. 0.2 mg / mL BSA). After incubation for 1 hour at 37 °C, the reaction is heat-inactivated for 20 minutes at 65 °C, and then stored on ice until ready for further processing.COMBINED ISOLATION OF CHROMATIN REGIONS AND CAPTURE PROBE CONSTRUCTION WITH TRANSPOSASE
[0110] Cleavage through transposition with Tn5 induces fragmentation through insertion events that are non-uniform and dependent on structural features governed by sequence content. Due to steric requirements imposed by the size of the transposome, insertion / fragmentation is often less efficient than found with other methods. Advantageously, fragmentation via transposition is not a degradative process over time, but rather, an insertion event governed only by the relative amount of Tn5 to accessible chromatin DNA, eliminating the potential for over-fragmentation. However, as accessibility to DNA within chromatin is determined by the competing binding affinities of the transposome versus a nucleosome or DNABPs at any given site, the representation of these regions within capture probes will reflect their relative accessibility to the transposome. Moreover, transposition necessarily introduces a synthetic sequence to the 5’-end of each resulting fragment that minimally includes the 19 bp MES, which would compromise their specificity as capture probes. This impact can however be mitigated by including apurification handle within the adaptor that allows the removal of fragments containing the MES sequence if followed by additional shearing of the post-transpositionally fragmented DNA. Alternatively, in a preferred embodiment, the dsDNA adaptor that includes the 19 bp MES is a single ODN and forms a hairpin such that the stem of the hairpin is comprised of the MES, and loop includes a nucleotide modified with a donor molecule as described below. The released fragment will have the MES masked by the hairpin, and therefore unable to participate in hybridization. While simple to execute, the number of nuclei that can be processed for transposition is low (-50,000 cells, or -150 ng of gDNA) and must therefore be scaled to obtain higher quantities of fragments to use as the basis of an affinity support.
[0111] In another aspect, the method of treating and attaching a donor moiety is applied to an isolated nuclei obtained from -50,000 cells, wherein the method of treating and attaching a donor moiety involves incubating the isolated nuclei and mitochondrial DNA samples each with a solution containing a transposome, wherein said transposome contains a transposase and a double- stranded DNA (dsDNA) adaptor, wherein said adaptor is comprised of a first ODN with a donor molecule on its 5 ’-end and a mosaic end sequence (MES) on its 3 ’-end and a second ODN with a that is complementary to the first ODN with a phosphate on its 5 ’-end, wherein said donor moiety can be a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans-cycloctene, wherein transposition results in cleavage in both strands with an offset of 9 nts with attachment of the first ODN into the 5 ’-end of each strand. In a preferred aspect, the second ODN and the first ODN are part of the same hairpin molecule separated by a tri-, tetra-, penta-, or hexanucleotide ODN loop, wherein said hairpin molecule has a 5 ’-phosphate group, wherein said donor moiety is part of a modified nucleotide within said ODN loop, wherein said donor moiety can be a biotin, an amine, a strained alkyne, an azide, a tetrazine, or a trans-cycloctene, wherein transposition results in cleavage in both strands with an offset of 9 nts with attachment of the hairpin into the 5 ’-end of each strand. Following a set incubation period, the transposition reaction is quenched and centrifuged at a medium speed to yield a pellet containing the nuclei fraction and a supernatant, wherein said supernatant is comprised of 5 ’-end adapted DNA fragments derived from regions of chromatin accessible to the transposome, and the nuclei is comprised of larger 5 ’-end adapted DNA fragments from inaccessible regions of chromatin. The adapted DNA is then separately purified from the pellet and the supernatant samples.
[0112] In another aspect, the method of treating and attaching a donor moiety with said transposome is applied to multiple isolated nuclei samples obtained from -50,000 cells each,wherein each sample is incubated for with different quantities of the transposome (e.g. lx, 3x, lOx), wherein the nuclei fraction from the highest transposome quantity is retained for DNA purification. In another aspect, the method of treating and attaching a donor moiety with said transposome is applied to multiple isolated nuclei samples obtained from -50,000 cells each, wherein each sample is incubated for a different period of time (e.g. 15 min, 30 min, 60 min), wherein the nuclei fraction from the longest incubation period is retained for DNA purification. In another aspect, the method of treating and attaching involves serial incubation of a single isolated nuclei sample derived from -50,000 cells with said transposome over successive periods of time. Following a first incubation period, the transposition reaction is quenched, and the mixture centrifuged to yield a nuclei pellet and a supernatant comprised of adapted DNA fragments released after the first incubation period. After resuspension of the resulting pellet with fresh transposome and after a second incubation period, the transposition reaction is quenched, and the mixture centrifuged to yield a nuclei pellet and a supernatant comprised of adapted DNA fragments released after the second incubation period. After resuspension of the resulting pellet with fresh transposome and after a third incubation period, the transposition reaction is quenched, and the mixture centrifuged to yield a nuclei pellet and a supernatant comprised of adapted DNA fragments released after the third incubation period. Supernatants from each incubation period as well as the pellet from the third incubation are retained for DNA purification.
[0113] In another aspect, the method of optional fragmenting or shearing to ensure a uniform fragment size distribution of less than 100 bp for use as capture probes involves incubating the purified adapted DNA from each of the pellet and supernatant samples as well as the mitochondrial DNA sample with a solution containing a saturating amount of said transposome. Following incubation, the transposition products, comprised of 5’-end donor modified DNA fragments, are then purified for use as capture probes.
[0114] In one aspect, 60 pL aliquot (~ 50,000) of isolated intact nuclei (pellet Pl) is centrifuged at low speed (e.g. 800 x g) for 10 minutes at 4 °C. The supernatant is discarded, and the pellet is resuspended in 25 pL of NB buffer. The resuspended pellet is then incubated with 25 pL of a fragmentation solution comprised of a buffer (e.g. 40 mM Bis-Tris propane, pH 7.4), a metal cofactor (e.g. 10 mM MgCh), an osmolyte (e.g. 154 mM NaCl), a membrane protectant (e.g. 1 M hexylene glycol), and an NPC disrupting agent (e.g. 20% w / v 1,6-hexanediol) and a transposome comprised of a transposase (e.g. Tn5) that has been precomplexed with a DNAhairpin adaptor sequence (5’-Phosphate- AGATGTGTATAAGAGACAGGGA[T*]ACCTGTCTCTTATACACATCT-3’; SEQ ID NO:2). After incubation at 37 °C for 30 minutes with gentle agitation (1000 rpm, Thermomixer C), 10 pL of 0.12 M EDTA is added, and the mixture is centrifuged at low speed (e.g. 800 x g) for 10 minutes at 4 °C. The supernatant corresponding to transposome accessible sites (TAS) is transferred to a 1.5 mL Eppendorf tube at stored on ice until ready for further processing. The nuclei pellet is resuspended in 60 pL of ice-cold BBTS and stored on ice until ready for further processing.
[0115] To purify DNA, 20 pL of LB is added to each tube and the samples incubated for 10 minutes at 37 °C with gentle agitation. Following incubation, 20 pL BB is added to the mixtures, and inverted 5 times to mix. After addition of 70 pL isopropanol, the mixtures are incubated for 15 min at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.5 mL of WB1 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB 1 solution. After discarding the solution phase, 0.5 mL of freshly prepared WB2 is added to the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the WB2 solution. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and incubated for 5 minutes at room temperature. The tubes are then magnetized, and the solution phase carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tubes, avoiding disruption of the magnetized pellet. The solutions containing purified DNA are stored on ice until ready for further processing.CONSTRUCTION OF SEPARATION MEDIUM
[0116] In one aspect, the method for attaching the plurality of capture probes to a receiver moiety bound to a support comprises incubation of the plurality of capture probes with said support in a buffered solution with mixing, wherein said donor moiety is a biotin and the receiver moiety is a streptavidin; wherein said donor moiety is an amine and the receiver moiety is an active ester; wherein said donor moiety is a strained alkyne and the receiver moiety is an azide, or conversely, wherein said donor moiety is an azide and the receiver moiety is a strained alkyne; wherein said donor moiety is a tetrazine and the receiver moiety is a trans-cycloctene, orconversely, wherein said donor moiety is a trans-cycloctene and the receiver moiety is a tetrazine.
[0117] In another aspect, the support is a paramagnetic particle that is coated covalently with a biotin binding protein, wherein said protein is substantially similar to streptavidin. In another aspect, the support is a paramagnetic particle that is surface coated with an amine group, wherein said binding of the receiver moiety to the support occurs through a transesterification reaction with an active ester form of the receiver moiety. In another aspect, the support is a paramagnetic particle that is coated covalently with carboxylic acid group, wherein said carboxylic acid group is converted to an active ester such that binding of the receiver moiety to the support occurs through a transesterification reaction with an amine modified form of the receiver moiety.
[0118] In one aspect, 50 pg of paramagnetic particles coated with Streptavidin (e.g. 50 pg) are incubated with the 5 pmol of biotinylated capture agent in a binding solution containing a buffer (e.g. 50 mM BTBS, pH 7.4), a salt (e.g. 0.154 M NaCl) and a non-ionic detergent (e.g. 0.01% Tween-20). The mixture is incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.2 mL of binding solution is added to wash the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the binding solution. After discarding the solution phase, the wash is repeated. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and kept on ice until ready for further processing.
[0119] In another aspect, 50 pg of paramagnetic particles coated with Streptavidin (e.g. 50 pg) are incubated with cfDNA or circDNA that has first been bound to the biotinylated capture agent in a binding solution containing a buffer (e.g. 50 mM BTBS, pH 7.4), a salt (e.g. 0.154 M NaCl) and a non-ionic detergent (e.g. 0.01% Tween-20). The mixture is incubated for 15 minutes at room temperature, then magnetized using a high field strength magnet for 10 minutes. After discarding the solution phase, 0.2 mL of binding solution is added to wash the magnetized pellets. The magnet position is alternated 5 times to move the paramagnetic beads through the binding solution. After discarding the solution phase, the wash is repeated. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of thetube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of EB and kept on ice until ready for further processing.
[0120] In another aspect, streptavidin (e.g. 10 pg, or -0.18 nmol) is incubated with cfDNA or circDNA that has been preincubated with the biotinylated capture agent in a binding solution containing a buffer (e.g. 50 mM BTBS, pH 7.4), a salt (e.g. 0.154 M NaCl) and a non-ionic detergent (e.g. 0.01% Tween-20). The mixture is incubated for 20 minutes at room temperature, and transferred to a filtration device equipped with a filter placed atop a 1.5 mL Lo-bind Eppendorf tube that selectively binds streptavidin (e.g. MicroPure EZ, unpublished observations). After centrifugation at high speed (e.g. 12,000 x g) for 10 minutes, the filtration device is removed, and the elute is stored on ice until ready for further processing.
[0121] In one aspect, paramagnetic particles (e.g. 500 pg) coated with a primary amine (e.g. Cytvia Sera-Mag SpeedBeads amine-blocked, or Bangs Laboratories BioMagOPlus Amine) is washed with 1 mL of methanol. The mixture is magnetized using a high field strength magnet for 5 minutes. The solution is removed, and 1 mL of methanol is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the methanol solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual methanol solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately in a 500 pL solution of dimethylformamide (DMF) containing 10 nmol of the active ester of the acceptor molecule (e.g. Dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl, NHS ester-a-TCO, Azido- dPEG®4-NHS ester) and 11 nmol of diisopropylethylamine (DIEA). Following incubation at 37 °C with gentle agitation (1200 rpm, Thermomixer C), the mixture is magnetized using a high field strength magnet for 5 minutes. The solution phase is removed, and 1 mL of nanopure (18 MO) water is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual solution is carefully removed anddiscarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of BTBS and kept on ice until ready for further processing.
[0122] In another embodiment, commercially available paramagnetic particles (e.g. 500 pg) coated with a carboxylic acid (e.g. Cytvia Sera-Mag SpeedBeads Carboxyl, or Bangs Laboratories BioMagOPlus COOH) are washed with 1 mL of methanol. The mixture is magnetized using a high field strength magnet for 5 minutes. The solution is removed, and 1 mL of methanol is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the methanol solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual methanol solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately in a 500 pL solution of DMF containing 1 pmol of N,N,N’,N’- Tetramethyl-O-(A-succinimidyl)uronium tetrafluoroborate (TSTU) and 1.1 pmol of DIEA. Following incubation for 30 minutes at room temperature with gentle agitation (1200 rpm, Thermomixer C), the mixture is magnetized using a high field strength magnet for 5 minutes. The solution is removed, and 1 mL of methanol is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the methanol solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual methanol solution is carefully removed and discarded, avoiding disruption of the magnetized pellet.
[0123] The magnetized pellet is then resuspended immediately in a 500 pL solution of dimethylformamide (DMF) containing 1 pmol of the amine-modified acceptor molecule (e.g. Azido-dPEG®7-amine, Dibenzocyclooctyne-amine, N-[(lR,8S,9s)-Bicyclo[6.1.0]non-4-yn-9- ylmethyloxycarbonyl]-l,8-diamino-3,6-dioxaoctane, (4-(l,2,4,5-Tetrazin-3-yl)phenyl) methanamine hydrochloride, TCO-amine HCl) and 1.1 pmol of diisopropylethylamine (DIEA). Following incubation at 37 °C with gentle agitation (1200 rpm, Thermomixer C), the mixture is magnetized using a high field strength magnet for 5 minutes. The solution phase is removed, and 1 mL of nanopure (18 MO) water is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the solution. After discarding thesolution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of BTBS and kept on ice until ready for further processing.
[0124] However, with this approach, the relatively short distance separating the surface of the solid support to the captured circDNA / cfDNA may sterically inhibit the association of the prebound material to the support or, sterically inhibit the association of the capture agent with the target circDNA / cfDNA. It would be preferred to have the capture agents attached to a polymer brush extending outward from the surface of the paramagnetic particle to minimize these steric effects on capture efficiency. While silanized polymers with acceptor molecules are commercially available, the presence of multiple silanes can lead to network formation across silica particles and lead to their potential aggregation. The ability to grow linear polymers from appropriately activated surfaces has been well described.
[0125] In another aspect, the support is a paramagnetic silica bead that is coated with a polymer synthesized ex situ, wherein said polymer is comprised of a mixture of monomer units, wherein a portion of said monomer units are comprised of a methoxy- or ethoxy-silane, wherein a portion of said monomer units is also comprised of a receiver moiety. In another aspect, the receiver moiety is bound to a polymer synthesized ex situ, wherein said polymer is comprised of a mixture of monomer units, wherein a portion of said monomer units are comprised of a methoxy- or ethoxy- silane, wherein a portion of said monomer units is also comprised of an active ester such that binding of the receiver moiety to the polymer is enabled through a transesterification reaction with an amine modified form of the receiver moiety. In another aspect, the mixture of monomer units can include a portion where said monomer units are comprised of a methoxy- or ethoxy-silane and a portion where said monomer units is comprised of an active ester such that binding of the receiver moiety to the polymer is enabled through a transesterification reaction with an amine modified form of the receiver moiety. In another aspect, the mixture of monomer units can include a portion where said monomer units are comprised of a methoxy- or ethoxy-silane and a portion where said monomer units is comprised of a primary amine such that binding of the receiver moiety to the polymer is enabled through a transesterification reaction with an active ester modified form of the receiver moiety.
[0126] In another aspect, the support is a paramagnetic silica bead that is coated with a polymer synthesized in situ, wherein said bead is first coated with an atomic transfer radical polymerization (ATRP) initiator, wherein said initiator is used to initiate the surface growth of a polymer via ATRP, wherein said ATRP is performed with activators regenerated by electron transfer (ARGET), wherein said polymer generated by ARGET-ATRP is comprised of a mixture of monomer units, wherein a portion of monomer units is comprised of an acrylamide monomer and a portion of monomer units is comprised of an acrylate active ester, such that binding of the receiver moiety to the support occurs through a transesterification reaction of an amine modified form of the receiver moiety with the active ester groups present on the surface-attached polymer. In another aspect, the mixture of monomer units is comprised of an acrylamide monomer and an aminopropyl acrylamide, such that binding of the receiver moiety to the support occurs through a transesterification reaction of an active ester modified form of the receiver moiety with the amino groups present on the surface-attached polymer.
[0127] Thus, in some aspects, paramagnetic silica beads (e.g. Promega MagneSil, Cytiva SeraSil) are rinsed with methanol, then incubated with a 50% mixture of concentrated HC1 (12 M) in methanol. Following incubation for 30 minutes in a bath sonicator, the beads are then rinsed with water, followed by methanol, then air-dried under reduced pressure and stored in a dessicator until ready for further processing.
[0128] Cleaned paramagnetic silica beads are then coated with a 5% (w / v) solution of the ATRP initiator 5% (3-trimethoxysilyl)propyl 2-bromo-2-methylpropionate in a 30% mixture of anhydrous n-butanol in heptane, and incubated for 2 hours at 80 °C with agitation (1200 rpm, Thermomixer C). The mixture is then washed with isopropanol, followed by methanol, then airdried under reduced pressure and stored under anhydrous N2 gas until ready for further processing.
[0129] The cleaned beads are resuspended in a solution comprised of a 6% (w / v) mixture of 20:80 pentafluorophenyl acrylate: N, / V-di methyl acrylamide, 0.4 mM Cu(II)Br, and 0.7 mM Me2TREN in DMF. To initiate polymerization, a neutralized solution of 8 mM ascorbic acid and 8 mM DIEA in DMF is added. Following incubation for 10 minutes at room temperature in a bath sonicator, the mixture is magnetized using a high field strength magnet for 5 minutes. The solution phase is removed, and 1 mF of methanol is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the solution. Afterdiscarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual solution is carefully removed and discarded, avoiding disruption of the magnetized pellet.
[0130] For conversion of the surface attached polymers to a “clickable” format, the magnetized pellet is then resuspended immediately in a 500 pE solution of dimethylformamide (DMF) containing 1 pmol of the amine-modified acceptor molecule (e.g. Azido-dPEG®7-amine, Dibenzocyclooctyne-amine, N-[(lR,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyloxycarbonyl]-l,8- diamino-3,6-dioxaoctane, (4-(l,2,4,5-Tetrazin-3-yl)phenyl) methanamine hydrochloride, TCO- amine-HCl) and 1.1 pmol of diisopropylethylamine (DIEA). Following incubation at 37 °C with gentle agitation (1200 rpm, Thermomixer C), the mixture is magnetized using a high field strength magnet for 5 minutes. The solution phase is removed, and 1 mL of nanopure (18 M ) water is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of BTBS and kept on ice until ready for further processing.
[0131] Upon coupling of the attachment molecule to the paramagnetic beads, the capture agent in BTBS with the complementary clickable donor molecule is added to the beads. Following incubation for 1 hour at room temperature with gentle agitation (e.g. 1200 rpm, Thermomixer C), the mixture is magnetized using a high field strength magnet for 5 minutes. The solution phase is removed, and 1 mL of nanopure (18 MQ) water is added to wash the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the solution. After discarding the solution phase, the wash is repeated two more times. After discarding the solution phase, the tubes are centrifuged briefly to collect residual solution at the bottom of the tube. The tubes are then magnetized to draw out the pellet from the residual wash solution. The residual solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellets are then resuspended immediately with 50 pL of BTBS and kept on ice until ready for further processing.
[0132] In other aspects, capture agents can be attached to a linear polymer in solution, which enables contacting of the circNA / cfDNA to occur in solution. This mitigates the effects of steric inhibition to hybridization due to proximity to a surface. The presence of multiple capture agents bound to multiple target molecules allows separation of the unbound materials by exploiting the large difference in molecule weight between bound and unbound species. To illustrate, if a 140 kDa linear polymer has 10 capture agents present, each approximately >6 kDa in size, with each capture agent binding a 50 bp target sequence of ~ 15 kDa, then the total size of the complexed material will be >300 kDa. This enables the use of 50 kDa MWCO filter to separate out the bound material (> 300 kDa) from the unbound material (~30 kDa).
[0133] 5% (w / v) solution of the ATRP initiator 5% (3-trimethoxysilyl)propyl 2-bromo-2- methylpropionate in a 30% mixture of anhydrous n-butanol in heptane, and incubated for 2 hours at 80 °C with agitation (1200 rpm, Thermomixer C). The mixture is then washed with isopropanol, followed by methanol, then air-dried under reduced pressure and stored under anhydrous N2 gas until ready for further processing.
[0134] The cleaned beads are resuspended in a solution comprised of a 6% (w / v) mixture of 20:80 pentafluorophenyl acrylate: N, / V-di methyl acrylamide, 0.4 mM Cu(II)Br, and 0.7 mM Me2TREN in DMF. To initiate polymerization, a neutralized solution of 8 mM ascorbic acid and 8 mM DIEA in DMF is added. Following incubation for 10 minutes at room temperature in a bath sonicator.
[0135] In one aspect, the capture agents are attached to a cross-linked polymer within a device, wherein such device is a column, a tube, or a microfluidic chamber, wherein said device enables mobility of the isolated circNA across the separation medium, wherein said mobility is induced by flow of a mobile phase, wherein the flow of said mobile phase is induced through the use of a pump, wherein said flow of said mobile phase is induced by centrifugation, wherein said mobility is induced by an electrical field, wherein said electrical field is constant, wherein said electrical field is an oscillating, wherein said electrical field is rotating, wherein said method of applied electrical field can be electrophoresis, isotachophoresis or SCODAphoresis.CONSTRUCTION OF ssDNA EIBRARY MEMBERS
[0136] Next-generation sequencing (NGS) involves the massively parallel sequencing of molecules clonally isolated on a solid- support. This solid-phase support can be part of a planar surface, or part of a spherical surface that are then arrayed on a planar surface. This can alsoinclude a cross-linked polymer or hydrogel that is attached to said surface. To minimize the need for sophisticated optical instrumentation, some form of solid-phase amplification (SPA) such as isothermal polymerase chain reaction (PCR), is utilized to expand the local concentration of a sequencing template on the support, increasing the signal-to-noise ratio (SNR) in detecting nucleotide incorporation. A pair of unique oligodeoxynucleotides (ODNs), referred herein as P5 and P7 flow-cell ODNs (FC-ODNs), are covalently attached at their 5’-ends to the solid-phase support, allowing polymerase mediated extension of these FC-ODNs for SPA.
[0137] To enable SPA, however, the input template material, typically fragmented DNA, must possess regions corresponding to both FC-ODNs, where at least one of the regions is complementary one of the FC-ODNs. These regions can be introduced to the input material as part of synthetic ODNs molecules.
[0138] Traditionally, these FC-ODNs can also be embedded within a pair of double- stranded (ds) ODN adaptors where one adaptor A is comprised of a (+) strand 5’-P5-3’ with a 3’-end dT overhang and its phosphorylated (Phos) (-) strand complement 5’-Phos-P5’-3’, and where the other adaptor B is comprised of a (+) strand with a 3 ’-end dT overhang 5’-P7-3’ and its phosphorylated (-) strand complement 5’-Phos-P7’-3’. To enable the attachment of these adaptors, the input fragmented DNA must be end-repaired using a DNA polymerase that can extend and / or displace any 5 ’-end overhangs to create flush ends, with subsequent addition of a 3 ’-end dA overhang, followed by phosphorylation at the 5 ’-ends of the finished fragments using a polynucleotide kinase.
[0139] However, in many instances, the input material is highly fragmented, and the purified material can exist in single- stranded (ss) as well as double-stranded DNA forms. In the dsDNA library methods described above, this requires that the input DNA be dsDNA and that the dsDNA be end-repaired so that it is blunt-ended, with optional single-base tailing with adenine deoxyribonucleotide (i.e. dA-tailed) to be amenable to ligation of the ds adaptors. Under this strategy, therefore, the portion of the input material that is ssDNA cannot be analyzed via NGS. Moreover, end-polishing, not only can be a source of synthetic artifacts, but whose success can be affected by the presence of damaged bases. Given that a significant portion of highly informative cfDNA is found in short ssDNA fragments, methods of library preparation that are able to utilize ssDNA are preferred.
[0140] The use of ssDNA ligation methods to create ssDNA NGS libraries fully preserves the original content of the sample by first converting all species into ssDNA through denaturation and then directly attaching FC-ODNs to the ssDNA molecules. Originally described for creating libraries for highly degraded archeological samples, this method has been successfully applied to cfDNA analysis.
[0141] Fundamentally, the formation of a NGS library requires that two unique adaptors, herein denoted by convention only as P5 and P7, are ligated to either end of the fragment DNA. Converting the fragmented DNA sample into a form amenable to sequencing can be achieved using double- stranded DNA (dsDNA) or single-stranded DNA (ssDNA) molecules. While both approaches are equivalent and pose different technical challenges, the use of ssDNA molecules as adaptors forgoes the need for end-polishing of fragmented DNA required for ligating dsDNA adaptors, preserving the in situ characteristics of the sample DNA. This has become increasingly important for cfDNA studies where the sequence of the ends are recognized to provide important information towards identifying the cfDNA fragment as tumor originating as well as providing additional information about tissue of origin.
[0142] Methods for constructing ssDNA libraries.Meyer developed a strategy for ssDNA library construction from archeological samples with very short ssDNA 10 nt adaptor to 50 nt ssDNAExtended by Meyer with the use of splint oligos Further modified by (SRSY, SPLAT)Ligation yields measured as recoverable PCR products rather than direct measurement of yield SSB interferes with association of splint must be titratedLonger randomers may non- specifically hybridize, distorting the composition of the end sequence in sequencing.Random hybridization events can lead to non-specific products or poor efficiency due to improper positioning of splint for ligationHigh AT can lead to poorer ligation with splint
[0143] In one aspect, the present disclosure describes a method for ssDNA adaptor ligation by exploiting the general mechanistic properties shared by ATP-dependent RNA ligases. The first step of ligation involves the coupling of an adenosine triphosphate (ATP or Appp) to the ligase enzyme E, resulting in adenylation of the enzyme to an active form, E-Ap. This activated enzyme then binds to a 5 ’-phosphorylated donor ODN, p-ODNl, resulting in the transfer of theAp to the p-ODN to form a E Ap-p-ODNl complex. Following formation of this active intermediate species, a 3 ’-hydroxylated acceptor ODN, 0DN2-0H, is bound and undergoes a transesterification reaction with the bound Ap-p-ODNl that is catalyzed by Mn2+, resulting in the 0DN2-0DN1 product and release of E and Ap.
[0144] Generally, this reaction is performed as a “one-pot” reaction, where all the components are combined into a single reaction. However, prior work has shown that, when using the ATP- dependent RNA ligase (RNAL) CircLigase II, separation of the activation step from the transesterification step, and forming the E Ap-p-ODNl in the presence of a volume excluder such as 15% polyethylene glycol 8000, allows stable accumulation and isolation of this active complex. Resolution of this active complex through the subsequent addition of the donor HO- ODN2 species in the presence of Mn2+then enables the transesterification reaction, proceeding to near completion. Using this approach, quantitative ligation (> 50% yield) of 110 nt ssDNA with denatured fragmented DNA with a median size distribution of 300 bp has been observed and is independent of length, in contrast to the upper limit length of 120 nts reported generally for RNA ligases under standard conditions.
[0145] In some aspects, this method allows “pre-loading” of an RNAL with a p-ODN prior to ligation with a target fragment molecule. This RNAL can be mesophilic (T4) or thermophilic (M. thermoautotrophicum, RM378, TS2126 / CircLigase II).
[0146] In one embodiment, to attach a ssDNA adaptor to the 3 ’-end of a target fragment molecule, 5 U of CircLigase II (MW - 44 kDa) is incubated with 10 pmol of a 5 ’-phosphorylated ODN, p-ODNl (-2-40 kDa, or 6-120 nt) possessing a region that is complementary to the P7 FC-ODN in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-Acetate, pH 8), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 10 mM Mg2+), a reducing agent (e.g. 1-5 mM DTT), a catalytic amount of ATP (e.g. 0.1-1 mM), a non-ionic detergent (e.g. 0.1% Tween- 20) and a volume excluding polymer (e.g. 12-18% (w / v) PEG-8000). Following incubation for 10 min at 60 °C, the reaction mixture is sedimented by centrifugation for 20 minutes at >12,000 x g. The supernatant is carefully removed, and the non-visible pellet is optionally rinsed with 50% (v / v) isopropanol, followed by storage at -20 °C until ready for use. In another embodiment, the reaction above is performed in the presence of paramagnetic beads (e.g. 0.2 mg / mL (w / v) Cytiva Sera-Mag carboxylate Speedbeads). After incubation for 10 min at 60 °C, the reaction mixture is magnetized for 15 minutes at room temperature, and the solution phase isremoved. The magnetized beads are optionally rinsed with 50% (v / v) isopropanol, and stored at 4 °C until ready for use.
[0147] Another enzyme that exhibits both RNA and DNA ligase activities is RtcB, a family of GTP-dependent RNALs that is involved in tRNA ligation. Mechanistically analogous to ligation with ATP-dependent family 1 RNALs, RtcB joins 3’-phosphate donor molecules (ODNl-p) to 5 ’-hydroxyl acceptor (OH-ODN2) molecules through an initial guanylation of the enzyme active site with guanosine triphosphate (GTP or Gppp), resulting in an active form of the enzyme, E- Gp. This activated enzyme then binds to a 3 ’-phosphorylated donor ODN, ODNl-p, resulting in the transfer of the Gp to the p-ODN to form a ODNl-p-pG E complex. Following formation of this active intermediate species, a 5 ’-hydroxylated acceptor ODN, HO-ODN2, is bound and undergoes a transesterification reaction with the bound ODNl-p-pG E that is also catalyzed by Mn2+, resulting in the ODN1-ODN2 product and release of E and Gp.
[0148] In one embodiment, to attach a ssDNA adaptor to the 5 ’-end of a target fragment molecule, 15 pmol of RtcB from E. coli (MW - 47 kDa) is incubated with 10 pmol of a 3’- phosphorylated ODN (-2-40 kDa, or 6-120 nt) possessing a region that is complementary to the P5 FC-ODN in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-Acetate, pH 8), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 2-5 mM Mg2+), a reducing agent (e.g. 1-5 mM DTT), a catalytic amount of GTP (e.g. 0.1-1 mM), a non-ionic detergent (e.g. 0.1% Tween-20), bovine serum albumin (BSA), and a volume excluding polymer (e.g. 12-18% (w / v) PEG-8000). Following incubation for 10 min at 37 °C, the reaction mixture is sedimented by centrifugation for 20 minutes at >12,000 x g. The supernatant is carefully removed, and the non- visible pellet is optionally rinsed with 50% (v / v) isopropanol, followed by storage at -20 °C until ready for use. In another embodiment, the reaction above is performed in the presence of paramagnetic beads (e.g. 0.2 mg / mL (w / v) Cytiva Sera-Mag carboxylate Speedbeads). After incubation for 10 min at 37 °C, the reaction mixture is magnetized for 15 minutes at room temperature, and the solution phase is removed. The magnetized beads are optionally rinsed with 50% (v / v) isopropanol, then stored at 4 °C until ready for use.
[0149] In some aspects, to enable attachment of the ssDNA adaptor molecule, a fragmented DNA sample is optionally treated with a DNA ligase capable of sealing nicked DNA (e.g. E. coli DNA ligase), followed by treatment with a phosphatase to remove any existing 5’- or 3 ’-end phosphate groups. The dephosphorylated DNA sample is then denatured, either throughincubation at 95 °C for 5 minutes then immediate cooling on ice; or, through treatment with a denaturing agent for 3 min at room temperature (e.g. KOH, 10-50 mM final), followed by treatment with a slight molar excess of a neutralization agent (e.g. acetic acid, 11-55 mM final). Following preparation and isolation of the E Ap-p-ODNl active intermediate above, the solution containing the denatured fragmented DNA is added to the intermediate in the presence of a buffer (e.g. 20-50 mM Tris-Acetate, pH 7.5), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 5 mM Mn2+), a reducing agent (e.g. 5-10 mM DTT), a non-ionic detergent (e.g. 0.1% Tween-20), a volume excluding polymer (e.g. 12-18% (w / v) PEG-8000), optionally a denaturant (e.g. betaine), and optionally a catalytic amount of protease (e.g. proteinase K). Following incubation for 30 min at 60 °C, the reaction mixture is sedimented by centrifugation for 20 minutes at >12,000 x g. The supernatant is carefully removed, and the non- visible pellet is resuspended is kept on ice until ready for further processing.
[0150] In another embodiment, the attachment is performed in the presence of paramagnetic beads (e.g. 0.2 mg / mL (w / v) Cytiva Sera-Mag carboxylate Speedbeads). Following incubation for 10 min at 60 °C, the reaction mixture is magnetized for 15 minutes at room temperature. After discarding the solution phase, 0.2 mL of freshly prepared 75% (v / v) ethanol is added to the magnetized pellet. The magnet position is alternated 5 times to move the paramagnetic beads through the ethanol solution. After discarding the solution phase, the tube is centrifuged briefly to collect residual solution at the bottom of the tube. The tube is then magnetized to draw out the pellet from the residual wash solution. The residual wash solution is carefully removed and discarded, avoiding disruption of the magnetized pellet. The magnetized pellet is then resuspended immediately with 20 pL of EB and incubated for 5 minutes at room temperature. The tube is then magnetized, and the solution phase is carefully transferred to a 1.5 mL Lo-bind Eppendorf microfuge tube, avoiding disruption of the magnetized pellet. The solution containing purified ligation product is stored at -20 °C.
[0151] With the realization that RNAL1 (El) and RtcB (E2) ligases are orthogonal in their substrate specificity, namely to a 5 ’-phosphorylated ODN, p-ODNl, versus a 3 ’-phosphorylated ODN, ODN2-p, respectively, it is possible to combine the activated enzyme products so that attachment of both adaptors to the fragmented DNA, dephosphorylated and denatured as described above, can be performed concurrently, resulting directly in the product ODN2-DNA- ODN1 in the absence of any undesired ligation products. Under these conditions, the target ssDNA substrate cannot self-ligate, and both p-ODNl and ODN2-p are prevented from ligatingto each other by introducing a blocking group B to the unphosphorylated end of each molecule i.e. p-ODNl-B and B-0DN2-p. Furthermore, as RNAL1 is not inhibited by the presence of GTP and RtcB is not inhibited by the presence of ATP, formation of the El Ap-p-ODNl and 0DN2-p- pG E2 active intermediates can occur concurrently within a single “one-pot” reaction.
[0152] In one aspect, the dephosphorylated and denatured fragmented DNA is added first to the E. coli RtcB-activated adaptor, ODN2-p-pG-E2, and incubated under the conditions described above for 30 minutes at 37 °C. Following this first incubation, the mixture is added to the CircLigase Il-activated adaptor, and the combined mixture is then incubated at 60 °C for 30 minutes.
[0153] In another aspect, it is preferable to utilize an RNAL1 and an RtcB pair that are derived from either mesophilic (e.g. T4 RNAL1 + E. coli RtcB) or thermophilic (M. Thermoautotrophicum, P. pyrococcus RNAL1 + T Thermophilus P horikoshii RtcB) organisms to ensure that optimal conditions are shared between the two ligases for substrate activation.
[0154] Finally, in other aspects, ODN1 and ODN2 can be combined into a single adaptor molecule where both ends of the molecule are phosphorylated, with the orientation 5’-p-ODNl- ODN2-p-3’. Upon activation with both RNAL1 and RtcB, the expected active complex would have the configuration El Ap-p-ODNl-ODN2-p-pG E2 which cannot self-ligate. Upon ligation of either the 5’-end or the 3’-end of a target fragment ssDNA, the proximity of the opposing acceptor end increases its rate of reaction through diffusion restriction and a large increase in the effective substrate concentration. The circular product of this reaction can then be purified against any unreacted linear template or linear adaptor through their digestion with an exonuclease such as Exonuclease VII following removal of terminal phosphates with alkaline phosphatase. This would enable the use of rolling circle amplification (RCA) or hyperbranching RCA (hRCA) for SPA to create clonal clusters. In another aspect, a cleavable group X can be introduced into the adaptor molecule with the configuration 5’-p-ODNl-X-ODN2-p-3’, such that following circular product formation and purification, the product can be linearized. This cleavable group can consist of deoxyuridines (Un, where n = 1,...,6), where cleavage can be achieved through the use of uracil-V-dcglycosylasc (UDG) to excise . This cleavable group can also be comprised of apurinic / apyrimidinic (AP) bases (A„, where n = 1,...,6), where cleavage can be mediate by a nuclease exhibiting AP lyase activity such as endonuclease VIII, endonuclease IV, or endonuclease III. This cleavable group can also be comprised of dithiolgroup, where cleavage can be mediated through treatment with a reducing agent such as dithiothreitol (DTT), |3-mercaptoethanol (bME), or Tris(2-carboxyethyl)phosphine (TCEP).
[0155] In one embodiment, to attach a ssDNA adaptor to the 5 ’-end of a target fragment molecule, 5 U of RtcB (MW - 47 kDa) is incubated with 10 pmol of a 5 ’-phosphorylated ODN (-2-40 kDa, or 6-120 nt) possessing a region that is complementary to the P5 FC-ODN in 20 pL of a solution consisting of a buffer (e.g. 20-50 mM Tris-Acetate, pH 7.5), salts (e.g. 50-100 mM potassium acetate), a cofactor (e.g. 10 mM Mg2+), a reducing agent (e.g. 1-5 mM DTT), a catalytic amount of ATP (e.g. 0.1-1 mM), a non-ionic detergent (e.g. 0.1% Tween-20) and a volume excluding polymer (e.g. 12-18% (w / v) PEG-8000).
[0156] In another embodiment, the target fragment molecule is not fully denatured, and the ligation reaction is allowed to proceed such that the 5 ’-end of the (+) strand and the 3 ’-end of the (-) strand is ligated to the 3 ’-end and the 5 ’-end, respectively, of the activated ssDNA adaptor. Within the ssNDA adaptor is a unique molecule index (UMI) or barcode that tags the (+) and (-) strand of the dsDNA, identifying the molecule as the “parent” molecule. The end result is a dumbbell like molecule which is uniquely identified by two UMIs occurs under conditions that lead to end fraying of the dsDNA.ENRICHMENT OF PERIPHERAL TISSUE circDNA BY DEPLETION
[0157] The present disclosure further provides methods for depleting the circDNA library of library members that are substantially similar in composition to leukocyte-derived chromatin regions, wherein the method of depleting comprises: a) contacting the circDNA library with the separation medium comprised of capture probes derived from regions of leukocyte chromatin and mitochondrial DNA under conditions where library members that are substantially complementary to the capture probes hybridize and bind to said capture probes; and b) separating bound library members from unbound library members, wherein the unbound library members correspond substantially to circDNA originating from peripheral tissue. In one aspect, the circDNA library is amplified to increase the quantity of library members prior to said contacting, wherein the method of amplification is linear, wherein said method of amplification is exponential. In another aspect, the method of contacting of the circDNA library with the capture probes attached to the separation medium occurs by increasing the mobility of the library molecules across the separation medium, wherein the increase in mobility is induced via fluid flow, wherein said fluid flow is induced by agitation, wherein said fluid flow is induced byapplying a centrifugal force, wherein said fluid flow is induced by pumping of the fluid phase. In another aspect, the increase in mobility of the library molecules across the separation medium is induced by the application of an electrical field, wherein said electrical field is constant, wherein said electrical field is alternating, wherein said electrical field is oscillating, wherein said method is SCODAphoresis, wherein said method is isotachophoresis.SEQUENCING DATA ANALYSIS
[0158] In one aspect, the method of analyzing includes comparison of the sequencing information recorded from the circNA against the sequencing information recorded from a control material, wherein said control material can be from said PMBC, wherein said control material can be from a biopsy obtained from a putative primary site of disease, wherein said control material can also include a reference cell line, wherein the disease is an autoimmune disease, a cancer, a trauma, a viral, bacterial or fungal induced necrotic event, wherein said biopsy is a fresh tissue biopsy, wherein the method of analysis includes a tissue fractionation step into a nuclear fraction and a non-nuclear fraction, wherein each fraction is analyzed by sequencing, wherein said nuclear fraction is additionally partitioned to enable single-cell analysis.
[0159] In another aspect, the method of analyzing includes recording the sequencing information from multiple blood samples obtained serially over time to establish a time-dependent profile for an individual that can be correlated to a particular disease state.
[0160] Also provided herein are illustrations of certain aspects of processing of whole blood to remove PBMC derived nucleic acids (FIG. 1); workflows for blood fractionation (FIG. 2); schematics for subcellular fractionation of PBMCs and RBSs (FIG. 3); preparation of NPRs, NTRs, and / or NDRs from PBMC nuclei (FIG. 4); isolation of NPRs, NTRs, and / or NDRs from chromatin (FIG. 5); construction of capture probes with 5’-end modification (FIG. 6); construction of capture probes with 3’-end modification (FIG. 7); size selection of short DNA fragments via gel electrophoresis (FIG. 8); isolation of NPRs, NTRs, and NDRs capture probes via transposition (FIG. 9); construction of capture probes via transposition (FIG. 10); exemplary donor-acceptor pairs enabling coupling of NPRs and / or NDRs (FIG. 11); formation of single stranded DNA libraries (FIG. 12); depletion of circDNA from blood using NPRs, NTRs, and / or NDRs (FIG. 13); depletion of circDNA via fdtration (FIG. 14); depletion of circDNA via capture probe extension and release (FIG. 15); alternative workflow for depletion of circDNA from blood using NPRs, NTRs, and / or NDRs (FIG. 16); and a workflow for comparing sequencing information recorded from circNA against sequencing information a control material (FIG. 17).SEQUENCESSEQ ID NO:1 - Example oligodeoxyribonucleotide5 ’ -GTCGGAGG[T*] AACTCCGAC-3 ’SEQ ID NO:2 - DNA hairpin adaptor sequence5 ’ -Phosphate- AG ATGTGTATAAGAGACAGGGA[T*] ACCTGTCTCTTATACACATCT-3 ’
Claims
CLAIMSWhat is claimed is:
1. A method of obtaining a circulating nucleic acid (circNA) component from a sample from an individual, the method comprising:(a) fractionating the sample to obtain a portion of the sample comprising circNA; and(b) contacting the portion of the sample comprising circNA, or a composition comprising nucleic acids isolated therefrom or derived therefrom, with a separation medium to obtain the circNA component from the sample, wherein the separation medium comprises self-consistent capture probes complementary to, and derived from, one or more nucleic acid sequences of one or more cells in the sample.
2. The method of claim 1, wherein the circNA component comprises a cell-free nucleic acid (cfNA) component and / or a membrane-bound nucleic acid (mbNA) component.
3. The method of claim 1 or 2, wherein the circNA component comprises one or more of a cell-free DNA (cfDNA) or membrane-bound DNA (mbDNA).
4. The method of claim 3, wherein the cfNA is free floating and / or bound to nucleosome proteins.
5. The method of any one of claims 1-4, wherein the one or more nucleic acid sequences of the one or more cells in the sample comprise nuclear DNA of the one or more cells in the sample.
6. The method of any one of claims 1-5, wherein the one or more nucleic acid sequences of the one or more cells in the sample comprise mitochondrial DNA of the one or more cells in the sample.
7. The method of any one of claims 1-6, wherein the sample is a biofluid, and wherein the one or more cells in the sample comprise a contaminating cell.
8. The method of any one of claims 1-6, wherein the sample is a blood sample, and wherein the one or more cells in the sample comprise leukocytes.
9. The method of any one of claims 1-6, wherein the sample is urine, and wherein the one or more cells in the sample comprise renal cells.
10. The method of any one of claims 1-6, wherein the sample is a saliva sample, and wherein the one or more cells in the sample comprise epithelial cells.
11. The method of any one of claims 1-6, wherein the sample is a cerebral spinal fluid sample, and the one or more cells in the sample comprise epithelial cells and / or leukocytes.
12. The method of any one of claims 1-6, wherein the sample is a biopsy, and wherein the one or more cells in the sample comprise a cell in the biopsy.
13. The method of claim 12, wherein the biopsy comprises a fluid component.
14. The method of any one of claims 1-13, wherein the circDNA component has a reduced amount of nucleic acid content originating from the one or more cells in the sample as compared to the sample from the individual.
15. The method of any one of claims 1-14, wherein the fractionating of the sample comprises obtaining a portion comprising one or more cellular components.
16. The method of any one of claims 1-15, wherein the fractionating the sample comprises performing a technique based on a physico-chemical property of the sample or a component originating therefrom, of a cellular component, or a component originating therefrom, of the sample and / or a fluid component of the sample.
17. The method of claim 16, wherein the technique is based on the physico-chemical property of a cellular component and / or a fluid component of the sample.
18. The method of any one of claims 1-17, wherein the fractionating the sample comprises performing a technique based on density and / or size.
19. The method of any one of claims 1-18, wherein the fractionating the sample comprises centrifuging the sample.
20. The method of any one of claims 1-19, wherein the fractionating the sample comprises performing a technique that separates the sample into subcellular components.
21. The method of any one of claims 15-20, further comprising fractionating the portion comprising the one or more cellular components into one or more subcellular components.
22. The method of claim 19, further comprising isolating nucleic acid content from the one or more subcellular constituents.
23. The method of claim 19 or 20, wherein the one or more subcellular components comprises one or more of a nuclei component, a mitochondrial component, or a plasma membrane fragment component.
24. The method of any one of claims 1-23, wherein the contacting the portion of the sample comprising circNA, or the composition comprising isolated nucleic acids therefrom or derived therefrom, with the separation medium to obtain the circNA component from the sample comprises contacting the portion of the sample comprising circNA with the separation medium to obtain the circNA component from the sample.
25. The method of any one of claims 1-23, wherein contacting the portion of the sample comprising circNA, or the composition comprising isolated nucleic acids therefrom or derived therefrom, with the separation medium to obtain the circNA component from the sample comprises contacting a circNA library derived from the portion of the sample comprising circNA with the separation medium to obtain the circNA component from the sample.
26. The method of any one of claims 1-25, wherein the self-consistent capture probes comprise a nucleic acid from a nucleosome protected region (NPR) of the one or more cells of the sample.
27. The method of any one of claims 1-26, wherein the self-consistent capture probes comprise a nucleic acid from a nucleosome depleted region (NDR) of the one or more cells of the sample.
28. The method of any one of claims 1-27, wherein the self-consistent capture probes comprise a nucleic acid from a nucleosome transient region (NTR) of the one or more cells of the sample.
29. The method of any one of claims 1-28, wherein the self-consistent capture probes comprise a nucleic acid from the mitochondria of the one or more cells of the sample.
30. The method of any one of claims 1-29, further comprising producing the separation medium comprising the self-consistent capture probes from nucleic acid content of the one or more cells of the sample.
31. The method of claim 30, wherein the producing the separation medium comprises fragmenting nucleic acid content obtained from the one or more cells of the sample and introducing a moiety on the resulting one or more fragments, wherein the moiety is configured for attaching the one or more fragments to the separation medium.
32. The method of any one of claims 1-31, further comprising sequencing the obtained circNA component from the sample.
33. The method of any one of claims 1-32, further comprising obtaining a plurality of sequencing reads.
34. The method of claim 33, further comprising mapping the plurality of sequencing reads to one or more reference sequences to generate mapped sequence reads.
35. The method of claim 33 or 34, further comprising identifying the plurality of sequencing reads or a feature thereof.
36. The method of any one of claims 33-35, further comprising quantifying the plurality of sequencing reads.
37. The method of any one of claims 1-36, further comprising constructing a circNA library.
38. A composition comprising a circNA component from a sample of an individual obtained according to a method of any one of claims 1-37.
39. The composition of claim 38, wherein the circNA comprises circulating DNA (circDNA).
40. A method of analyzing circulating nucleic acids (circNAs) originating from a peripheral tissue and found in the blood of an individual, the method comprising:(a) obtaining a (circNA) component from a blood sample from an individual according to the methods of any one of claims 1-37, wherein the circNA component comprises circNA originating from the peripheral tissue of the individual; and(b) analyzing the circNA component.
41. The method of claim 40, wherein the analyzing comprises detecting any one or more of: a genetic characteristic or a condition.
42. The method of claim 40, wherein the analyzing comprises monitoring a condition following a treatment.
43. The method of claim 41 or 42, wherein the condition is a cancer.
44. The method of any one of claims 40-43, wherein the circNAs comprise circulating DNA (circDNA).
45. A separation medium comprising self-consistent capture probes obtained from nucleic acid content of a cellular component of a sample comprising circulating nucleic acids (circNAs) from an individual.
46. The separation medium of claim 45, wherein the circNAs comprise circulating DNA (circDNA).
47. A library of self-consistent capture probes obtained from nucleic acid content of a cellular component of a sample comprising circulating nucleic acids (circNAs) from an individual.
48. A library of self-consistent capture probes obtained from nucleic acid sequence information of a cellular component present, or suspected of being present, in a sample comprising circulating nucleic acids (circNAs) from an individual.
49. The library of claim 47 or 48, wherein the circNAs comprise circulating DNA (circDNA).
50. A method of constructing a circulating nucleic acid (circNA) library, the method comprising:(a) obtaining a composition comprising circNAs from a sample from an individual;(b) processing the circNAs in the composition, or a product thereof, to dephosphorylate 5’ and 3’ ends; and(c) subjecting the processed circNAs to ligases to construct the circNA library, wherein the ligases comprise a ligase of family 1 RNA ligase pre-complexed with a first ODN comprising a 5’ phosphate and a ligase of an RtcB family RNA ligase pre-complexed with a second ODN comprising a 3’ phosphate.
51. The method of claim 50, further comprising subjecting, prior to step (b), the circNAs in the composition to: fragment or shear the circNAs, and / or repair and / or remove one or more damaged bases.
52. The method of claim 50 or 51, wherein the first ODN and the second ODN are linked or linkable.
53. The method of claim 52, wherein the first ODN and the second ODN are linked or linkable via a linker molecule comprising a cleavable moiety.
54. The method of claim 53, wherein the linker molecule comprises biotin.
55. The method of claim 52, wherein the first ODN and the second ODN are linked via a surface.
56. The method of claim 52, wherein the first ODN and the second ODN are each a portion of a single ODN.
57. The method of any one of claims 50-56, wherein the obtaining the composition comprising circNA comprises subjecting the sample from the individual to a fractionation technique.
58. The method of any one of claims 50-57, wherein the circNA comprises circulating DNA (circDNA).