Long-read and short-read co-sequencing device and bioinformatics sequencing method

Abstract

The present invention relates to the technical field of gene detection. Provided are a long-read and short-read co-sequencing device and a bioinformatics sequencing method. The method comprises: performing first base sequencing processing on a test object, so as to obtain a long base sequence of the test object; and performing second base sequencing processing on the test object, so as to obtain at least one short base sequence of the test object; and on the basis of the long base sequence and the at least one short base sequence, determining a target base sequence corresponding to the test object. Obtaining an accurate target base sequence while ensuring the base detection efficiency is achieved on the basis of maintaining the base detection efficiency of the acquiring of the long base sequence in combination with the base information accuracy of the short base sequence, such that the target base sequence can conform to the actual situation of the test object.

Description

Long and short read length common sequencing equipment, and bioinformatics sequencing methods Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular to a long- and short-read co-sequencing device, and a bioinformatics sequencing method. Background Art

[0002] In order to obtain and study the genetic information sequence of DNA (DeoxyriboNucleic Acid), DNA sequencing is an indispensable step. In the existing technology, DNA sequencing operations can be achieved through long-read sequencing technology or short-read sequencing technology to meet the needs of obtaining ultra-long base sequences of DNA.

[0003] However, the ultra-long base sequences obtained by DNA sequencing using long-read sequencing technology have low accuracy and cannot effectively reflect the actual base sequence of DNA. In existing long-read sequencing technologies, multiple rounds of cycle sequencing are often required for the same long base sequence, and the accuracy problem is compensated by repeated sequencing, which greatly increases the time and resource costs of sequencing.

[0004] However, the sequence results of short-read sequencing are too short compared to the tens of millions or even billions of sequences in the genome. Extremely deep repetitive sequencing (at least 30x) is required to identify and assemble ultra-long gene sequences. This approach not only results in long short-read sequencing times and high costs, but also places extremely high demands on the memory and computing time occupied by de novo bioinformatics. At the same time, due to length limitations, short-read sequencing is extremely difficult to identify structural variations and copy number variations such as translocations, inversions, duplications, deletions, and insertions in the genome. Conventional short-read sequencing and matched bioinformatics methods make it difficult to confirm the specific sequence location of these structural variant sites, or even whether a deletion variation has occurred.

[0005] Summary of the Invention

[0006] Based on this, it is necessary to address the above technical problems and provide a long-short read length co-sequencing device and a bioinformatics sequencing method that can accurately obtain ultra-long base sequences with lower sequencing times, lower consumables costs, shorter sequencing time, and less bioinformatics computing investment.

[0007] In a first aspect, the present application provides a long-short read length common sequencing device, the long-short read length common sequencing device comprising a device input component, a device sequencing component, and a device output component;

[0008] The device input component is used to obtain a base sequence sample of the object to be detected;

[0009] The device sequencing component is used to perform base sequencing processing on the base sequence sample to obtain the base target sequence corresponding to the object to be detected; wherein the base sequencing processing includes a first base sequencing processing and a second base sequencing processing;

[0010] The device output component is used to output the base target sequence determined by the device sequencing component.

[0011] In one embodiment, the device sequencing component includes: a first sample extraction, purification, and library construction device, a first sequencing device, a second sample extraction, purification, and library construction device, and a second sequencing device;

[0012] A first sample extraction, purification, and library construction device and a first sequencing device are used to perform a first base sequencing process on the base sequence sample;

[0013] The second sample extraction, purification and library construction equipment and the second sequencing equipment are used to perform a second base sequencing process on the base sequence sample.

[0014] In a second aspect, the present application provides a bioinformatics sequencing method. The method comprises:

[0015] Obtaining a base sequence sample of the object to be detected;

[0016] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0017] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0018] The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence.

[0019] In one embodiment, determining a target base sequence corresponding to an object to be detected based on a long base sequence and at least one short base sequence includes:

[0020] Performing bioinformatics analysis on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0021] At least one short base sequence is used to correct the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0022] In one embodiment, performing bioinformatics analysis on a long base sequence based on at least one short base sequence to obtain a difference sequence in the long base sequence includes:

[0023] From the long base sequence, determine the reference sequence corresponding to each short base sequence;

[0024] Performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain analysis results for each reference sequence;

[0025] Based on each analysis result, the difference sequence in the base-long sequence is determined from each reference sequence.

[0026] In one embodiment, determining the difference sequence in the base-long sequence from each reference sequence based on each analysis result includes:

[0027] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

[0028] In one embodiment, determining a reference sequence corresponding to each short base sequence from a long base sequence includes:

[0029] For each short base sequence, the starting position of the sequence is determined from the long base sequence according to the first and second base information contained in the short base sequence;

[0030] Determine the end position of the sequence from the long base sequence according to the last second base information contained in the short base sequence;

[0031] According to the starting position and the ending position of the sequence, the reference sequence corresponding to the short base sequence is determined from the long base sequence.

[0032] In one embodiment, determining a reference sequence corresponding to a short base sequence from a long base sequence based on a sequence start position and a sequence end position includes:

[0033] The sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0034] In one embodiment, the first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

[0035] In one embodiment, at least one short base sequence is used to correct the difference sequence to obtain the base target sequence corresponding to the object to be detected, including:

[0036] Obtaining the short base sequence corresponding to the difference sequence from each short base sequence;

[0037] The short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0038] In one embodiment, the short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected, including:

[0039] The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0040] In one embodiment, performing a first base sequencing process on the object to be detected to obtain a long base sequence of the object to be detected includes:

[0041] Perform long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.

[0042] In one embodiment, performing a second base sequencing process on the object to be detected to obtain at least one short base sequence of the object to be detected includes:

[0043] Perform short base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0044] In a third aspect, the present application also provides a bioinformatics sequencing device. The device comprises:

[0045] An acquisition module is used to obtain a base sequence sample of an object to be detected;

[0046] A first determination module is configured to perform a first base sequencing process on the object to be detected based on the base sequence sample to obtain a long base sequence of the object to be detected;

[0047] A second determination module is configured to perform a second base sequencing process on the object to be detected based on the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0048] The third determination module is used to determine the base target sequence corresponding to the object to be detected based on the long base sequence and at least one short base sequence.

[0049] In one embodiment, the analysis module includes:

[0050] an analysis unit, configured to perform bioinformatics analysis on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0051] The correction unit is used to correct the difference sequence using at least one short base sequence to obtain the base target sequence corresponding to the object to be detected.

[0052] In a fourth aspect, the present application further provides a computer device. The computer device includes a memory and a processor. The memory stores a computer program. When the processor executes the computer program, the following steps are performed:

[0053] Obtaining a base sequence sample of the object to be detected;

[0054] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0055] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0056] The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence.

[0057] In a fifth aspect, the present application further provides a computer-readable storage medium having a computer program stored thereon, which, when executed by a processor, implements the following steps:

[0058] Obtaining a base sequence sample of the object to be detected;

[0059] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0060] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0061] The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0063] FIG1 is a schematic diagram of a bioinformatics sequencing method provided in an embodiment of the present application;

[0064] Figure 2 is a schematic diagram of another bioinformatics sequencing method provided in an embodiment of the present application

[0065] FIG3 is a schematic diagram of a long base sequence and a short base sequence provided in an embodiment of the present application;

[0066] FIG4 is a schematic diagram of a process for determining a difference sequence according to an embodiment of the present application;

[0067] FIG5 is a schematic diagram of a process for determining a base target sequence according to an embodiment of the present application;

[0068] FIG6 is a schematic diagram of a process for determining a long base sequence and at least one short base sequence according to an embodiment of the present application;

[0069] FIG7 is a schematic diagram of another bioinformatics sequencing method provided in an embodiment of the present application;

[0070] FIG8 is a structural block diagram of a first bioinformatics sequencing device provided in an embodiment of the present application;

[0071] FIG9 is a block diagram of the structure of a second bioinformatics sequencing device provided in an embodiment of the present application;

[0072] FIG10 is a block diagram of the structure of a third bioinformatics sequencing device provided in an embodiment of the present application;

[0073] FIG11 is a structural block diagram of a fourth bioinformatics sequencing device provided in an embodiment of the present application;

[0074] FIG12 is a block diagram of the structure of a fifth bioinformatics sequencing device provided in an embodiment of the present application;

[0075] FIG13 is a diagram showing the internal structure of a computer device in one embodiment. DETAILED DESCRIPTION

[0076] In order to make the purpose, technical solutions and advantages of this application more clear, the following further describes this application in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not intended to limit this application.

[0077] It should be understood that the specific embodiments described herein are merely used to explain the present application and are not intended to limit the present application. In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms are not necessarily directed to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, unless they contradict each other.

[0078] In one embodiment, as shown in FIG1 , a long-short read length co-sequencing device and a bioinformatics sequencing method are provided. This embodiment uses the method applied to a terminal as an example for illustration. It is understandable that the method can also be applied to a server, and can also be applied to a system including a terminal and a server, and is implemented through the interaction between the terminal and the server. Among them, the terminal can be, but is not limited to, various personal computers, laptops, smart phones, tablets, Internet of Things devices and portable wearable devices. The Internet of Things devices can be smart speakers, smart TVs, smart air conditioners, smart car-mounted devices, etc. Portable wearable devices can be smart watches, smart bracelets, head-mounted devices, etc. The server can be implemented as an independent server or a server cluster consisting of multiple servers. In this embodiment, the method includes the following steps:

[0079] S101, obtaining a base sequence sample of an object to be detected;

[0080] Among them, the base sequence sample refers to a sample that can be extracted by conventional methods (such as throat swab collection, blood collection), and the base sequence sample can be a throat swab or blood, etc.

[0081] S102 , performing a first base sequencing process on the object to be detected according to the base sequence sample to obtain a long base sequence of the object to be detected.

[0082] It should be noted that the first base sequencing process refers to the base sequencing of the object to be detected using a sequencing technology that can obtain a long base sequence of the object to be detected. Therefore, when the first base sequencing process is required for the object to be detected, the object to be detected can be sequenced using long-read sequencing technology (third-generation sequencing technology) to obtain a long base sequence of the object to be detected.

[0083] Among them, the first base sequencing process can be a long read sequencing method or a third-generation sequencing. For example, the first base sequencing process can be nanopore single-molecule sequencing. In summary, there are many sequencing methods corresponding to the first base sequencing process, and no regulations or restrictions are made here on the long sequencing method.

[0084] In one embodiment of the present application, a base sequence sample of the object to be detected can be obtained, and the sample extraction, purification, and library construction steps adapted to the long sequence sequencing scheme can be performed on the object to be detected to obtain a base sequence sample library for first base sequencing of the object to be detected, and the first base sequencing is performed on the base sequence sample to obtain a long base sequence of the object to be detected.

[0085] S103 , performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0086] It should be noted that the second base sequencing process refers to the base sequencing of the object to be detected by a sequencing technology that can obtain a short base sequence of the object to be detected. The second base sequencing process can be a short-read sequencing scheme or second-generation sequencing. No provisions or restrictions are made for the second base sequencing process here. Therefore, when it is necessary to perform a second base sequencing process on the object to be detected, the sample extraction, purification, and library construction steps of the short-read sequencing scheme can be adapted to the object to be detected, and the second base sequencing of the library of the object to be detected can be performed by short-read sequencing technology (second-generation sequencing technology) to obtain at least one short base sequence of the object to be detected.

[0087] In one embodiment of the present application, an input sample of the object to be detected can be obtained, a base sequence sample of the object to be detected can be extracted to obtain a base sequence sample of the object to be detected for performing a second base sequencing, and the base sequence sample can be subjected to a second base sequencing to obtain at least one short base sequence of the object to be detected.

[0088] To further illustrate, the present application can combine or modularly integrate different sequencing devices into an instrument to achieve first base sequencing processing of the object to be detected and second base sequencing processing of the object to be detected; specifically, as shown in Figure 2, the first base sequencing processing of the object to be detected is performed by the first sample extraction, purification and library construction device A-1 and the first sequencing device A-2, and the second base sequencing processing of the object to be detected is performed by the second sample extraction, purification and library construction device B-1 and the second sequencing device B-2.

[0089] Among them, the sample processing, library construction and sequencing equipment series A can perform first base sequencing on the base sequence samples of the object to be detected; the sample processing, library construction and sequencing equipment series B can perform second base sequencing on the base sequence samples of the object to be detected.

[0090] To further illustrate, the present application can also implement first base sequencing processing and second base sequencing processing on the object to be detected through the same sequencing device; specifically, the first base sequencing processing and second base sequencing processing are performed on the object to be detected through sequencing device C.

[0091] The sequencing device C can perform both first base sequencing and second base sequencing on the base sequence sample of the object to be detected.

[0092] S103: Determine a target base sequence corresponding to the object to be detected based on the long base sequence and at least one short base sequence.

[0093] In one embodiment of the present application, when it is necessary to determine the base target sequence corresponding to the object to be detected, the long base sequence can be subjected to bioinformatics analysis based on at least one short base sequence to obtain a difference sequence in the long base sequence; and the difference sequence can be corrected using at least one short base sequence to obtain the base target sequence corresponding to the object to be detected.

[0094] The difference sequence refers to a sequence in which the first base information in the long base sequence is different from the corresponding second base information in the short base sequence.

[0095] Among them, the base target sequence can be the entire base sequence of the object to be detected, or it can be the strain type, bacterial type, pathogenic gene, etc. after the base sequence of the object to be detected is compared with the reference sequence.

[0096] In one embodiment of the present application, the present application can combine or modularly integrate an instrument through different sequencing devices to achieve the first base sequencing process of the object to be detected and the second base sequencing process of the object to be detected; specifically, as shown in Figure 2, the first base sequencing process is performed on the object to be detected by the sample extraction, purification and library construction device A-1 and the sequencing device A-2 to obtain a long base sequence, and the second base sequencing process is performed on the object to be detected by the sample extraction, purification and library construction device B-1 and the sequencing device B-2 to obtain at least one short base sequence. According to the long base sequence and the at least one short base sequence, the base target sequence corresponding to the object to be detected is determined; the base target sequence is displayed through the test result display module. Among them, the base target sequence can be an accurate base full sequence, virus type, bacterial species, pathogenic gene result, drug resistance gene test result, etc.

[0097] Among them, the sample processing, library construction and sequencing equipment series A can perform first base sequencing on the base sequence samples of the object to be detected; the sample processing, library construction and sequencing equipment series B can perform second base sequencing on the base sequence samples of the object to be detected.

[0098] The above-mentioned bioinformatics sequencing method determines the base target sequence corresponding to the object to be detected according to the long base sequence and the short base sequence by determining the long base sequence and the short base sequence. According to the above content, the present application, in the process of obtaining the base target sequence, realizes the operation of obtaining the base target sequence according to each short base sequence and the long base sequence. Since the base information accuracy contained in the short base sequence is relatively high, the present application relies on the high accuracy of the base information in the short base sequence when determining the base target sequence corresponding to the object to be detected, and realizes the base detection efficiency of the long base sequence while maintaining the base information accuracy of the short base sequence, so as to obtain the base target sequence with accuracy while ensuring the base detection efficiency, so that the base target sequence can meet the actual situation of the object to be detected.

[0099] In one embodiment, when DNA sequencing is performed using long-read sequencing technology, although it can meet the need to obtain ultra-long base sequences of DNA, the accuracy of the ultra-long base sequences obtained by sequencing is low and cannot effectively reflect the actual base sequence of the DNA. To solve the above problem, as shown in Figure 2, the base target sequence corresponding to the object to be detected can be determined based on the long base sequence and at least one short base sequence, which may specifically include the following:

[0100] S301: Determine a long base sequence and at least one short base sequence of an object to be detected.

[0101] It should be noted that the long base sequence refers to the base sequence obtained after the key base sequencing operation in the chassis of the object to be detected is performed through the long read sequencing technology; the short base sequence refers to the base sequence obtained after the base sequencing operation is performed on the object to be detected through the short read sequencing technology, wherein the number of base information contained in the long base sequence is greater than the number of base information contained in the short base sequence.

[0102] In one embodiment of the present application, when it is necessary to determine the long base sequence of the object to be detected, an input sample of the object to be detected can be obtained, and the input sample can be sequenced using long-read sequencing technology to obtain the long base sequence of the object to be detected.

[0103] Among them, the long-read sequencing technology can be a third-generation sequencing technology or a nanopore sequencing technology, etc., and the technical type of the third-generation sequencing technology is not limited here.

[0104] The input sample may include but is not limited to: saliva of the subject to be tested, blood of the subject to be tested, etc.

[0105] In one embodiment of the present application, when it is necessary to determine the short base sequence of the object to be detected, an input sample of the object to be detected can be obtained, and the input sample can be sequenced using short read sequencing technology to obtain the short base sequence of the object to be detected.

[0106] It is further explained that in order to further ensure the sequence accuracy of the long base sequence and at least one short base sequence of the object to be detected, before sequencing the input sample, the input sample needs to be subjected to nucleic acid extraction, purification, enrichment and library construction to ensure the accuracy of the sequencing processing results corresponding to the input sample.

[0107] Specifically, a sample receiving and placing device is provided to receive base sequence samples input by the tester, such as blood, throat swabs, etc.; in the same test, the base sequence samples are used to perform long sequencing sample processing and short sequencing sample processing on the base sequence samples respectively; the samples adapted to long read length are adapted to long read length sequencing library construction process to obtain a long read length sequencing library, and the samples adapted to short read length are adapted to short read length sequencing library construction process to obtain a short read length sequencing library; then, according to the long read length sequencing library, the base sequence samples are subjected to long base sequencing (long base sequencing can be third-generation sequencing) to obtain the long base sequence of the object to be tested, and according to the short read length sequencing library, the base sequence samples are subjected to short base sequencing (short base sequencing can be second-generation sequencing) to obtain at least one short base sequence of the object to be tested, and according to the above-mentioned base correction bioinformatics algorithm process, the sequencing results required by the tester are output, including but not limited to: full sequencing base sequence, virus type, pathogenic gene type, drug resistance results, etc.

[0108] S302: Performing bioinformatics analysis on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence.

[0109] It should be noted that, since the difference sequence refers to a sequence in which the first base information in the long base sequence is different from the corresponding second base information in the short base sequence; therefore, according to the definition of the difference sequence, when it is necessary to obtain the difference sequence in the long base sequence, it may include the following contents: from the long base sequence, determine the reference sequence corresponding to each short base sequence, and then judge whether the first base information in the reference sequence is the same as the second base information in the corresponding short base sequence, and determine the difference sequence in the long base sequence based on the judgment result.

[0110] Among them, the first base information refers to the base information contained in the long base sequence; the second base information refers to the base information contained in the short base sequence; further, the base information refers to deoxyadenine nucleotides, deoxythymine nucleotides, deoxycytosine nucleotides and deoxyguanine nucleotides.

[0111] Specifically, if the first base information in a reference sequence is the same as the second base information in the corresponding short base sequence, the reference sequence is determined not to be a differential sequence; if the first base information in a reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is regarded as a differential sequence in the long base sequence.

[0112] S303: Correct the difference sequence using at least one short base sequence to obtain a base target sequence corresponding to the object to be detected.

[0113] In one embodiment of the present application, in order to ensure that the base target sequence corresponding to the object to be detected can accurately reflect the true base information of the object to be detected, the first base information corresponding to the difference sequence can be replaced with the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected, so as to realize the correction of the difference sequence using at least one short base sequence.

[0114] For example, as shown in FIG4 , if the first base information in the long base sequence can be expressed as: ATCCCGTAGCTTTGGAACTCGATCATGCACC… (wherein A refers to deoxyadenine nucleotide, T refers to deoxythymine nucleotide, C refers to deoxycytosine nucleotide, and G refers to deoxyguanine nucleotide); and contains two short base sequences, the two short base sequences are short base sequence a and short base sequence b, wherein the second base information of short base sequence a can be expressed as: ATCGCGT AGC, the second base information of the short base sequence b can be expressed as: ATCATGGACC, and then, it is determined that the short base sequence a corresponds to the reference sequence a in the long base sequence, and the short base sequence b corresponds to the reference sequence b in the long base sequence; wherein, it is determined that the first base information in the reference sequence a is different from the second base information in the corresponding short base sequence, therefore, the reference sequence a is used as the difference sequence, and the first base information corresponding to the difference sequence is replaced with the second base information of the short base sequence a corresponding to the difference sequence, to obtain the base target sequence corresponding to the object to be detected.

[0115] In the above-mentioned bioinformatics sequencing method, in the process of obtaining the base target sequence, the present application first determines the difference sequence from the long base sequence based on each short base sequence, and then corrects the difference sequence through the short base sequence to achieve the operation of obtaining the base target sequence. Since the base information contained in the short base sequence is highly accurate, when correcting the difference sequence based on the short base sequence, the erroneous base information in the long base sequence can be effectively corrected to the correct base information to ensure the accuracy of the base information in the base target sequence; and, in the process of determining the base target sequence, it is achieved while maintaining the base detection efficiency of obtaining the long base sequence, combined with the accuracy of the base information of the short base sequence, so as to achieve the acquisition of an accurate base target sequence while ensuring the base detection efficiency, so that the base target sequence can meet the actual situation of the object to be detected.

[0116] In one embodiment, as shown in FIG5 , a bioinformatics analysis may be performed on a long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence, which may specifically include the following:

[0117] S501: Determine the reference sequence corresponding to each short base sequence from the long base sequence.

[0118] It should be noted that when it is necessary to determine the reference sequence corresponding to each short base sequence, it can be verified whether the long base sequence and the short base sequence are obtained by sequencing the same segment of base information of the DNA of the object to be detected; if so, the segment of base information is used as the reference sequence corresponding to the short base sequence; if not, it is determined that the segment of base information is not the reference sequence corresponding to the short base sequence.

[0119] To further illustrate, when it is necessary to determine the reference sequence corresponding to each short base sequence, the following may be specifically included: for each short base sequence, the starting position of the sequence is determined from the long base sequence based on the first second base information contained in the short base sequence; wherein, the first base information corresponding to the starting position of the sequence of the long base sequence corresponds to the first second base information; and based on the last second base information contained in the short base sequence, the ending position of the sequence is determined from the long base sequence.

[0120] Among them, the first base information corresponding to the end position of the long base sequence corresponds to the last second base information; according to the sequence start position and the sequence end position, the reference sequence corresponding to the short base sequence is determined from the long base sequence.

[0121] Specifically, the sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0122] S502 : Perform base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding short base sequence to obtain analysis results for each reference sequence.

[0123] It should be noted that base similarity analysis is used to detect whether the first base information in each reference sequence is identical to the second base information in the corresponding short base sequence. Therefore, when base similarity analysis is required for the first base information in each reference sequence and the second base information in the corresponding short base sequence, the first base information in each reference sequence can be verified to determine whether it is identical to the second base information in the corresponding short base sequence. The analysis results for each reference sequence can then be determined based on the verification results.

[0124] To further illustrate, the analysis results may include: the first base information in the reference sequence is different from the second base information in the corresponding base short sequence, and the first base information in the reference sequence is the same as the second base information in the corresponding base short sequence.

[0125] S503: Determine the difference sequence in the long base sequence from each reference sequence according to each analysis result.

[0126] In one embodiment of the present application, for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

[0127] For example, if the first base information of the reference sequence is expressed as: TCGCG (T refers to deoxythymine nucleotide, C refers to deoxycytosine nucleotide, and G refers to deoxyguanine nucleotide), the second base information in the corresponding base short sequence is expressed as: TCGCA (A refers to deoxyadenine nucleotide), wherein each first base information contained in the reference sequence is verified in turn to be the same as the second base information in the corresponding base short sequence. When the sixth first base information "G" of the reference sequence is verified, it is determined that the first base information "G" is different from the second base information "A" in the corresponding base short sequence, and the reference sequence where the first base information "G" is located is used as the difference sequence in the base long sequence.

[0128] In another embodiment of the present application, for each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is the same as the second base information in the corresponding short base sequence, it is determined that the reference sequence is not a difference sequence in the long base sequence.

[0129] The above-mentioned bioinformatics sequencing method, by determining the reference sequence corresponding to each short base sequence, realizes that the reference sequence whose first base information in the reference sequence is different from the second base information in the corresponding short base sequence is used as the differential sequence in the long base sequence, providing a data basis for the subsequent determination of the base target sequence based on the differential sequence, thereby ensuring the accuracy of the subsequent determination of the base target sequence.

[0130] In one embodiment, as shown in FIG6 , when it is necessary to determine the base target sequence corresponding to the object to be detected, the following may be specifically included:

[0131] S601: Obtain a short base sequence corresponding to the difference sequence from each short base sequence.

[0132] It should be noted that, since the short base sequence corresponding to the difference sequence is needed in the process of correcting the difference sequence, before obtaining the base target sequence corresponding to the object to be detected, the short base sequence corresponding to the difference sequence needs to be obtained from each short base sequence.

[0133] S602: Using the short base sequence corresponding to the difference sequence, the difference sequence is updated to obtain a target base sequence corresponding to the object to be detected.

[0134] In one embodiment of the present application, when the difference sequence needs to be updated, the following may be specifically included: replacing the first base information corresponding to the difference sequence with the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0135] The above-mentioned bioinformatics sequencing method determines the short base sequence corresponding to the differential sequence, thereby determining the base target sequence based on the short base sequence corresponding to the differential sequence, so that the base target sequence can conform to the actual situation of the object to be detected.

[0136] In one embodiment, as shown in FIG7 , when it is necessary to perform first base sequencing on the object to be detected to obtain a long base sequence of the object to be detected, the following may be specifically included:

[0137] S701, obtaining a base sequence sample of the object to be detected;

[0138] In one embodiment of the present application, an input sample of the object to be detected may be obtained in advance, and a base sequence sample may be extracted from the input sample to obtain a base sequence sample for performing a first base sequencing process on the object to be detected.

[0139] It should be noted that since the input sample may include but is not limited to: saliva of the subject to be tested, blood of the subject to be tested, etc., when it is necessary to obtain the input sample of the subject to be tested, different input sample acquisition methods need to be adopted according to different input sample types; furthermore, there are many methods for obtaining the input sample of the subject to be tested, and the method of obtaining the input sample of the subject to be tested is not limited here.

[0140] S702: Perform base sequencing on the base sequence sample to obtain a long base sequence of the object to be detected.

[0141] To further illustrate, before determining the base sequence sample, the following steps are also included: pre-processing the input sample to obtain a target sample; and splitting the target sample to obtain a base sequence sample. The pre-processing includes at least one of extraction, purification, enrichment, and library construction.

[0142] In one embodiment of the present application, after obtaining the input sample, it is necessary to perform extraction, purification, enrichment, library construction and other operations on the input sample to obtain a target sample to ensure the accuracy of the subsequent determination of the long base sequence; according to the sequencing scheme corresponding to the long base sequence, a base sequence sample for determining the long base sequence is prepared, and then, the base sequence sample is base sequenced to obtain the long base sequence of the object to be detected.

[0143] The above-mentioned bioinformatics sequencing method, by determining the base sequence sample, realizes the acquisition of the long base sequence of the object to be detected based on the base sequence sample, providing a data basis for the subsequent acquisition of the base target sequence.

[0144] In one embodiment, as shown in FIG8 , when a second base sequencing process is required for the object to be detected to obtain at least one short base sequence of the object to be detected, the following may be specifically included:

[0145] S801: Obtain a base sequence sample of an object to be detected.

[0146] In one embodiment of the present application, after obtaining the input sample, it is necessary to perform extraction, purification, enrichment, library construction and other operations on the input sample to obtain a target sample to ensure the accuracy of the subsequent determination of the short base sequence; according to the sequencing scheme corresponding to the short base sequence, a base sequence sample for determining the short base sequence is prepared, and then, the base sequence sample is base sequenced to obtain the short base sequence of the object to be detected.

[0147] S802: Perform base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0148] In one embodiment of the present application, after obtaining the input sample, it is necessary to perform extraction, purification, enrichment, library construction and other operations on the input sample to obtain a target sample to ensure the accuracy of the subsequent determination of the short base sequence; according to the sequencing scheme corresponding to the short base sequence, a base sequence sample for determining the short base sequence is prepared, and then, the base sequence sample is base sequenced to obtain at least one short base sequence of the object to be detected.

[0149] The above-mentioned bioinformatics sequencing method, by determining the base sequence sample, realizes the acquisition of the short base sequence of the object to be detected based on the base sequence sample, providing a data basis for the subsequent acquisition of the base target sequence.

[0150] In one embodiment, as shown in FIG9 , when it is necessary to determine the base target sequence corresponding to the object to be detected, the following may be specifically included:

[0151] S901: Obtain a base sequence sample of the object to be detected.

[0152] S902, performing base sequencing on the base sequence sample to obtain a long base sequence of the object to be detected.

[0153] S903: Obtain a base sequence sample of the object to be detected.

[0154] S904: Perform base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0155] S905: Determine the reference sequence corresponding to each short base sequence from the long base sequence.

[0156] S906 , performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding short base sequence to obtain analysis results for each reference sequence.

[0157] S907: Determine the difference sequence in the base sequence from each reference sequence based on the analysis results.

[0158] S908: Obtain the short base sequence corresponding to the difference sequence from each short base sequence.

[0159] S909: Replace the first base information corresponding to the difference sequence with the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0160] The above-mentioned bioinformatics sequencing method determines the base target sequence corresponding to the object to be detected according to the long base sequence and the short base sequence by determining the long base sequence and the short base sequence. According to the above content, the present application, in the process of obtaining the base target sequence, realizes the operation of obtaining the base target sequence according to each short base sequence and the long base sequence. Since the base information accuracy contained in the short base sequence is relatively high, the present application relies on the high accuracy of the base information in the short base sequence when determining the base target sequence corresponding to the object to be detected, and realizes the base detection efficiency of the long base sequence while maintaining the base information accuracy of the short base sequence, so as to obtain the base target sequence with accuracy while ensuring the base detection efficiency, so that the base target sequence can meet the actual situation of the object to be detected.

[0161] Furthermore, the present application also discloses a long-short read length common sequencing device, which includes a device input component, a device sequencing component, and a device output component;

[0162] Specifically, the device input component is used to obtain a base sequence sample of the object to be detected; the device sequencing component is used to determine the base target sequence corresponding to the object to be detected based on the base sequence sample; and the device output component is used to output the base target sequence determined by the device sequencing component.

[0163] It should be noted that the output component of the device should also contain a comparison unit that is adapted to the output of different application results. The output results should include but not be limited to the full gene sequence, strain type, bacterial type, pathogenic gene, and any other results related to the sequencing sequence required by the tester. To achieve this goal, the comparison unit should contain all known reference sequences corresponding to the tester's required results. After comparing the sequencing sequence information of interest with the reference sequence, it will directly output any of the above sequencing results required by the tester. For example: in the application of sequencing the new coronavirus strain, after all the sequence information of the sample has been obtained, the result sequence and the reference sequence are compared based on the strain reference base sequence information already in the comparison unit, and the strain type (such as Alpha B1.1.7; Beta B1.351, etc.) is directly output.

[0164] This application combines the two sequencing solutions in an all-round and synchronous manner, so that the two sets of sequencing methods, long and short reads, are integrated into the same product solution and implemented simultaneously, including sample processing, library construction, sample preparation on the machine, sequencing process, algorithm calculation and result output. The complete sequencing results are in place in one step, avoiding the complex and time-consuming steps of sample pre-processing. At the same time, the product system has its own bioinformatics system, which does not require time-consuming deep processing of sequencing data. Moreover, it is matched with a shorter-time bioinformatics splicing algorithm, using long-length data as the skeleton and incorporating short-read data as correction to quickly reassemble and produce a draft genome, reducing the waste of computing resources and reducing financial and time costs. According to needs, the bioinformatics analysis software required by the user can be installed in the computing software to directly output the sequencing results required by the user, such as: tumor target gene screening, prenatal detection screening, etc., directly output tumor types / infant gene defect types, etc., to provide customers with different result requirements with whole genome sequences or results required by customers.

[0165] It should be understood that, although the steps in the flowcharts of the above embodiments are shown in sequence as indicated by the arrows, these steps are not necessarily performed in the order indicated by the arrows. Unless otherwise specified herein, there is no strict order restriction on the execution of these steps, and these steps can be performed in other orders. Moreover, at least a portion of the steps in the flowcharts of the above embodiments may include multiple steps or multiple stages, and these steps or stages are not necessarily performed at the same time, but can be performed at different times. The execution order of these steps or stages is not necessarily to be performed in sequence, but can be performed in turn or alternately with other steps or at least a portion of steps or stages in other steps.

[0166] Based on the same inventive concept, the present application also provides a bioinformatics sequencing device for implementing the aforementioned bioinformatics sequencing method. The solution provided by this device is similar to the solution described in the aforementioned method. Therefore, the specific limitations of one or more bioinformatics sequencing device embodiments provided below can be found in the above-mentioned limitations of the bioinformatics sequencing method and will not be further elaborated here.

[0167] In one embodiment, as shown in FIG9 , a bioinformatics sequencing device is provided, including: an acquisition module 10, a first determination module 20, a second determination module 30, and a third determination module 40, wherein:

[0168] An acquisition module 10 is used to obtain a base sequence sample of the object to be detected;

[0169] The first determining module 20 is configured to perform a first base sequencing process on the object to be detected to obtain a long base sequence of the object to be detected.

[0170] The first determination module is specifically used to obtain a base sequence sample of the object to be detected; perform base sequencing on the base sequence sample to obtain a long base sequence of the object to be detected.

[0171] The second determining module 30 is configured to perform a second base sequencing process on the object to be detected to obtain at least one short base sequence of the object to be detected.

[0172] The second determination module is specifically used to obtain a base sequence sample of the object to be detected; perform base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0173] The third determining module 40 is configured to determine a target base sequence corresponding to the object to be detected based on the long base sequence and at least one short base sequence.

[0174] The above-mentioned bioinformatics sequencing device determines the base target sequence corresponding to the object to be detected according to the long base sequence and the short base sequence by determining the long base sequence and the short base sequence. According to the above content, the present application realizes the operation of obtaining the base target sequence according to each short base sequence and the long base sequence in the process of obtaining the base target sequence. Since the base information contained in the short base sequence is more accurate, the present application relies on the high accuracy of the base information in the short base sequence when determining the base target sequence corresponding to the object to be detected. It realizes that under the premise of maintaining the base detection efficiency of obtaining the long base sequence, the base information accuracy of the short base sequence is combined, and the base target sequence with accuracy is obtained under the premise of ensuring the base detection efficiency, so that the base target sequence can meet the actual situation of the object to be detected.

[0175] In one embodiment, as shown in FIG10 , a bioinformatics sequencing device is provided. In the bioinformatics sequencing device, a third determination module 30 includes: an analysis unit 31 and a correction unit 32 , wherein:

[0176] An analysis unit 31 is configured to perform bioinformatics analysis on a long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0177] The correction unit 32 is used to correct the difference sequence using at least one short base sequence to obtain a base target sequence corresponding to the object to be detected.

[0178] The correction unit is specifically configured to obtain a short base sequence corresponding to the difference sequence from each short base sequence; and update the difference sequence using the short base sequence corresponding to the difference sequence to obtain a target base sequence corresponding to the object to be detected. Specifically, the first base information corresponding to the difference sequence is replaced with the second base information of the short base sequence corresponding to the difference sequence to obtain the target base sequence corresponding to the object to be detected.

[0179] In one embodiment, as shown in FIG11 , a bioinformatics sequencing device is provided. The analysis unit 31 in the bioinformatics sequencing device includes: a first determination subunit 311 , a second determination subunit 312 , and a third determination subunit 313 , wherein:

[0180] The first determining subunit 311 is configured to determine a reference sequence corresponding to each short base sequence from the long base sequence.

[0181] The first determination subunit is specifically configured to determine, for each short base sequence, a sequence start position from the long base sequence based on the first second base information contained in the short base sequence; determine a sequence end position from the long base sequence based on the last second base information contained in the short base sequence; and determine a reference sequence corresponding to the short base sequence from the long base sequence based on the sequence start position and sequence end position. Specifically, the sequence between the sequence start position and the sequence end position in the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0182] Among them, the first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

[0183] The second determining subunit 312 is configured to perform base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding short base sequence to obtain analysis results for each reference sequence.

[0184] The third determining subunit 313 is configured to determine the difference sequence in the long base sequence from each reference sequence according to each analysis result.

[0185] The third determining unit is specifically configured to, for each reference sequence, use the reference sequence as a differential sequence in the long base sequence if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence.

[0186] Each module in the above-mentioned apparatus may be implemented in whole or in part by software, hardware, or a combination thereof. Each module may be embedded in or independent of a processor in a computer device in the form of hardware, or may be stored in a memory in the computer device in the form of software, so that the processor can call and execute the operations corresponding to each module.

[0187] In one embodiment, a computer device is provided, which may be a terminal, and its internal structure diagram may be shown in Figure 12. The computer device includes a processor, a memory, an input / output interface, a communication interface, a display unit, and an input device. The processor, the memory, and the input / output interface are connected via a system bus, and the communication interface, the display unit, and the input device are connected to the system bus via the input / output interface. The processor of the computer device is used to provide computing and control capabilities. The memory of the computer device includes a non-volatile storage medium and an internal memory. The non-volatile storage medium stores an operating system and a computer program. The internal memory provides an environment for the operation of the operating system and the computer program in the non-volatile storage medium. The input / output interface of the computer device is used to exchange information between the processor and an external device. The communication interface of the computer device is used to communicate with an external terminal in a wired or wireless manner, and the wireless manner may be implemented through WIFI, a mobile cellular network, NFC (near field communication) or other technologies. When the computer program is executed by the processor, a bioinformatics sequencing method is implemented. The display unit of the computer device is used to form a visually visible image, which may be a display screen, a projection device, or a virtual reality imaging device. The display screen can be a liquid crystal display screen or an electronic ink display screen, and the input device of the computer device can be a touch layer covering the display screen, or a button, trackball or touchpad set on the computer device casing, or an external keyboard, touchpad or mouse.

[0188] Those skilled in the art will understand that the structure shown in FIG12 is merely a block diagram of a portion of the structure related to the solution of the present application, and does not constitute a limitation on the computer device to which the solution of the present application is applied. The specific computer device may include more or fewer components than shown in the figure, or combine certain components, or have a different arrangement of components.

[0189] In one embodiment, a computer device is provided, including a memory and a processor, wherein a computer program is stored in the memory, and when the processor executes the computer program, the following steps are implemented:

[0190] Obtaining a base sequence sample of the object to be detected;

[0191] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0192] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0193] The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence.

[0194] In one embodiment, a bioinformatics analysis is performed on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0195] At least one short base sequence is used to correct the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0196] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0197] From the long base sequence, determine the reference sequence corresponding to each short base sequence;

[0198] Performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain analysis results for each reference sequence;

[0199] Based on each analysis result, the difference sequence in the base-long sequence is determined from each reference sequence.

[0200] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0201] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

[0202] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0203] For each short base sequence, the starting position of the sequence is determined from the long base sequence according to the first and second base information contained in the short base sequence;

[0204] Determine the end position of the sequence from the long base sequence according to the last second base information contained in the short base sequence;

[0205] According to the starting position and the ending position of the sequence, the reference sequence corresponding to the short base sequence is determined from the long base sequence.

[0206] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0207] The sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0208] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0209] The first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

[0210] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0211] Obtaining the short base sequence corresponding to the difference sequence from each short base sequence;

[0212] The short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0213] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0214] The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0215] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0216] Perform long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.

[0217] In one embodiment, when the processor executes the computer program, the processor further implements the following steps:

[0218] Perform short base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0219] In one embodiment, a computer-readable storage medium is provided, on which a computer program is stored. When the computer program is executed by a processor, the following steps are implemented:

[0220] Obtaining a base sequence sample of the object to be detected;

[0221] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0222] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0223] According to the long base sequence and at least one short base sequence, a base target sequence corresponding to the object to be detected is determined. In one embodiment, when the computer program is executed by the processor, the following steps are further implemented:

[0224] Performing bioinformatics analysis on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0225] At least one short base sequence is used to correct the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0226] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0227] From the long base sequence, determine the reference sequence corresponding to each short base sequence;

[0228] Performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain analysis results for each reference sequence;

[0229] Based on each analysis result, the difference sequence in the base-long sequence is determined from each reference sequence.

[0230] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0231] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

[0232] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0233] For each short base sequence, the starting position of the sequence is determined from the long base sequence according to the first and second base information contained in the short base sequence;

[0234] Determine the end position of the sequence from the long base sequence according to the last second base information contained in the short base sequence;

[0235] According to the starting position and the ending position of the sequence, the reference sequence corresponding to the short base sequence is determined from the long base sequence.

[0236] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0237] The sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0238] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0239] The first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

[0240] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0241] Obtaining the short base sequence corresponding to the difference sequence from each short base sequence;

[0242] The short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0243] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0244] The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0245] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0246] Perform long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.

[0247] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0248] Perform short base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0249] In one embodiment, a computer program product is provided, comprising a computer program, which, when executed by a processor, implements the following steps:

[0250] Obtaining a base sequence sample of the object to be detected;

[0251] According to the base sequence sample, the first base sequencing process is performed on the object to be detected to obtain the long base sequence of the object to be detected;

[0252] Performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected;

[0253] The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence.

[0254] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0255] Performing bioinformatics analysis on the long base sequence based on at least one short base sequence to obtain a differential sequence in the long base sequence;

[0256] At least one short base sequence is used to correct the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0257] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0258] From the long base sequence, determine the reference sequence corresponding to each short base sequence;

[0259] Performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain analysis results for each reference sequence;

[0260] Based on each analysis result, the difference sequence in the base-long sequence is determined from each reference sequence.

[0261] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0262] For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

[0263] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0264] For each short base sequence, the starting position of the sequence is determined from the long base sequence according to the first and second base information contained in the short base sequence;

[0265] Determine the end position of the sequence from the long base sequence according to the last second base information contained in the short base sequence;

[0266] According to the starting position and the ending position of the sequence, the reference sequence corresponding to the short base sequence is determined from the long base sequence.

[0267] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0268] The sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

[0269] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0270] The first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

[0271] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0272] Obtaining the short base sequence corresponding to the difference sequence from each short base sequence;

[0273] The short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0274] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0275] The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

[0276] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0277] Perform long base sequencing on the base sequence sample to obtain the long base sequence of the object to be detected.

[0278] In one embodiment, when the computer program is executed by a processor, the following steps are further implemented:

[0279] Perform short base sequencing on the base sequence sample to obtain at least one short base sequence of the object to be detected.

[0280] Those skilled in the art will appreciate that all or part of the processes in the above-mentioned embodiments can be implemented by instructing the relevant hardware through a computer program, and the computer program can be stored in a non-volatile computer-readable storage medium. When the computer program is executed, it can include the processes of the embodiments of the above-mentioned methods. Among them, any reference to memory, database or other media used in the embodiments provided in this application may include at least one of non-volatile and volatile memory. Non-volatile memory may include read-only memory (ROM), magnetic tape, floppy disk, flash memory, optical memory, high-density embedded non-volatile memory, resistive random access memory (ReRAM), magnetic random access memory (MRAM), ferroelectric random access memory (FRAM), phase change memory (PCM), graphene memory, etc. Volatile memory may include random access memory (RAM) or external cache memory, etc. By way of illustration and not limitation, RAM can be in various forms, such as static random access memory (SRAM) or dynamic random access memory (DRAM). The database involved in the various embodiments provided herein may include at least one of a relational database and a non-relational database. Non-relational databases may include, but are not limited to, distributed databases based on blockchains. The processor involved in the various embodiments provided herein may be, but are not limited to, a general-purpose processor, a central processing unit, a graphics processing unit, a digital signal processor, a programmable logic unit, a data processing logic unit based on quantum computing, and the like.

[0281] The technical features of the above embodiments can be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0282] The above embodiments merely illustrate several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present application shall be determined by the appended claims.

Claims

1. A long-short read length combined sequencing device, comprising a device input component, a device sequencing component, and a device output component; The device input component is used to obtain a base sequence sample of the object to be detected; The device sequencing component is used to perform base sequencing on the base sequence sample to obtain the base target sequence corresponding to the object to be detected; wherein, The base sequencing process includes a first base sequencing process and a second base sequencing process; The device output component is used to output the base target sequence determined by the device sequencing component.

2. The method according to claim 1, characterized in that The device sequencing component includes: a first sample extraction, purification and library construction device, a first sequencing device, a second sample extraction, purification and library construction device, and a second sequencing device; The first sample extraction, purification and library construction equipment and the first sequencing equipment are used to perform a first base sequencing process on the base sequence sample; The second sample extraction, purification and library construction equipment and the second sequencing equipment are used to perform a second base sequencing process on the base sequence sample.

3. A bioinformatics sequencing method, characterized in that: The method is applied to the device sequencing component in claim 1, and the method comprises: Obtaining a base sequence sample of the object to be detected; performing a first base sequencing process on the object to be detected according to the base sequence sample to obtain a long base sequence of the object to be detected; performing a second base sequencing process on the object to be detected according to the base sequence sample to obtain at least one short base sequence of the object to be detected; The base target sequence corresponding to the object to be detected is determined based on the long base sequence and at least one short base sequence.

4. The method according to claim 3, characterized in that The step of determining a target base sequence corresponding to the object to be detected based on the long base sequence and at least one short base sequence includes: performing bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a differential sequence in the long base sequence; The difference sequence is corrected using the at least one short base sequence to obtain a base target sequence corresponding to the object to be detected.

5. The method according to claim 4, characterized in that The performing bioinformatics analysis on the long base sequence according to the at least one short base sequence to obtain a difference sequence in the long base sequence includes: Determining a reference sequence corresponding to each short base sequence from the long base sequence; Performing base similarity analysis on the first base information in each reference sequence and the second base information in the corresponding base short sequence to obtain analysis results for each reference sequence; According to each analysis result, the difference sequence in the long base sequence is determined from each reference sequence.

6. The method according to claim 5, characterized in that Determining the difference sequence in the long base sequence from each reference sequence based on each analysis result includes: For each reference sequence, if the analysis result corresponding to the reference sequence is that the first base information in the reference sequence is different from the second base information in the corresponding short base sequence, the reference sequence is used as the difference sequence in the long base sequence.

7. The method according to claim 5, characterized in that Determining a reference sequence corresponding to each short base sequence from the long base sequence includes: For each short base sequence, determining the sequence start position from the long base sequence according to the first second base information contained in the short base sequence; Determining the end position of a sequence from the long base sequence according to the last second base information contained in the short base sequence; According to the sequence start position and the sequence end position, a reference sequence corresponding to the short base sequence is determined from the long base sequence.

8. The method according to claim 7, characterized in that The step of determining a reference sequence corresponding to the short base sequence from the long base sequence according to the sequence start position and the sequence end position includes: The sequence between the start position and the end position of the long base sequence is used as the reference sequence corresponding to the short base sequence.

9. The method according to claim 7, characterized in that The first base information corresponding to the starting position of the long base sequence corresponds to the first second base information; the first base information corresponding to the ending position of the long base sequence corresponds to the last second base information.

10. The method according to claim 5, characterized in that The step of correcting the difference sequence using the at least one short base sequence to obtain a base target sequence corresponding to the object to be detected includes: Obtaining a short base sequence corresponding to the difference sequence from each short base sequence; The short base sequence corresponding to the difference sequence is used to update the difference sequence to obtain the base target sequence corresponding to the object to be detected.

11. The method according to claim 10, characterized in that The method of updating the difference sequence using the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected includes: The first base information corresponding to the difference sequence is replaced by the second base information of the short base sequence corresponding to the difference sequence to obtain the base target sequence corresponding to the object to be detected.

12. The method according to claim 3, characterized in that The first base sequencing process is performed on the object to be detected to obtain a long base sequence of the object to be detected, including: The base sequence sample is subjected to long base sequencing to obtain the long base sequence of the object to be detected.

13. The method according to claim 3, characterized in that The performing a second base sequencing process on the object to be detected to obtain at least one short base sequence of the object to be detected includes: Short base sequencing is performed on the base sequence sample to obtain at least one short base sequence of the object to be detected.

14. A bioinformatics sequencing device, characterized in that: The device comprises: An acquisition module is used to obtain a base sequence sample of an object to be detected; A first determination module is configured to perform a first base sequencing process on the object to be detected based on the base sequence sample to obtain a long base sequence of the object to be detected; A second determining module is configured to perform a second base sequencing process on the object to be detected based on the base sequence sample to obtain at least one short base sequence of the object to be detected; The third determination module is used to determine the base target sequence corresponding to the object to be detected based on the long base sequence and at least one short base sequence.

15. The device according to claim 14, characterized in that The third determining module includes: an analyzing unit, configured to perform bioinformatics analysis on the long base sequence based on the at least one short base sequence to obtain a differential sequence in the long base sequence; A correction unit is used to correct the difference sequence using the at least one short base sequence to obtain a base target sequence corresponding to the object to be detected.

16. A computer device comprising a memory and a processor, wherein the memory stores a computer program, wherein: When the processor executes the computer program, the steps of the method according to any one of claims 3 to 13 are implemented.

17. A computer-readable storage medium having a computer program stored thereon, characterized in that: When the computer program is executed by a processor, the steps of the method according to any one of claims 3 to 13 are implemented.

Images