Guide RNA for targeting the beta-casein gene and methods to use the same

Abstract

The present invention relates to a guide RNA (gRNA) molecule targeting the beta- casein / CSN2 and methods using the same.

Description

GUIDE RNA FOR TARGETING THE BETA-CASEIN GENE AND METHODSTO USE THE SAMEFIELD OF INVENTION

[0001] The present invention relates to a guide RNA (gRNA) molecule targeting the beta-casein / CSN2 gene; in particular for targeting the exon 2 of the beta-casein / CSN2 gene. The present invention also relates to gene editing methods targeting the beta- casein / CSN2 gene with improved guide RNA molecules.BACKGROUND OF INVENTION

[0002] The beta-casein gene is a known gene in the field of biotechnologies. In particular, the beta-casein gene became a relevant tool for genetic modifications in order to modify milk composition, thereby offering opportunities in both pharmaceutical and agricultural biotechnologies. The beta-casein promoter or gene may be engineered for the production of recombinant proteins, allowing to express a desired protein in the milk of the animals. This approach facilitates the large-scale production and extraction of specific proteins, such as therapeutic proteins.

[0003] CRISPR-Cas9 technology has emerged as one of the most revolutionized tools in the field of genetic engineering, and during the last decades became the most widespread practiced technology for genome editing. CRISPR-Cas9 based gene editing involves two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein), the gRNA sequence being designed to guide a Cas nuclease such as the Cas9 protein to the targeted genomic region.

[0004] Liu et al. (“Comparing successful gene knock-in efficiencies of CRISPR- Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts”;Journal of integrative Agriculture, 2018) reports the knock-in of beta-casein in fibroblasts by different gene editing systems.

[0005] Yet, there remains a need for improved means and method for producing recombinant proteins; in particular large-scale production of therapeutic proteins.

[0006] There also remains a need for improved means and method for successful gene knock-in or gene knock-out of beta-casein genes; and methods of altering the function or expression of functional beta-casein gene products, in particular in vivo.

[0007] There also remains a need for targeted means avoiding off-targets effects, which remain applicable industrially and validated with in vitro or in vivo models.

[0008] The invention has for purpose to meet the above-mentioned needs.SUMMARY

[0009] According to a first main embodiment, the present invention relates to a guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof.

[0010] According to a second main embodiment, the present invention relates to a nucleic acid sequence encoding a guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof.

[0011] According to a third main embodiment, the present invention relates to a vector comprising a nucleic acid sequence operably linked to a suitable promoter; or composition thereof; said nucleic acid sequence encoding a guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof.

[0012] According to a fourth main embodiment, the present invention relates to a DNA targeting system characterized in that it comprises: a) a first regulatory element operable in a eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; in particular a CRISPR-Cas system guide RNA, and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0013] According to a fifth main embodiment, the present invention relates to a ribonucleoprotein (RNP), or composition thereof, comprising:- at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene, in particular at least one gRNA as defined above, and- at least one RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein, or a variant thereof, for example a Cas protein from the Cas protein family, preferably a Cas9 protein or a variant thereof.

[0014] According to a sixth main embodiment, the present invention relates to a method, in particular an in vitro method, for altering expression, or editing, beta-casein / CSN2 gene in a cell, comprising: expressing in the cell at least one guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21, and at least one RNA-guided nuclease, in particular at least one RNA-guided nuclease from the Cas protein family; or introducing at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene and at least one RNA-guided nuclease in the cell; orbringing into contact the at least one guide RNA (gRNA) with the cell, in conditions where the cell is capable of expressing at least one RNA-guided nuclease and / or comprising the at least one RNA-guided nuclease; and optionally expressing in the cell a donor nucleic acid; or introducing in the cell a donor nucleic acid; or bringing into contact a donor nucleic acid; the donor nucleic acid comprising a nucleic acid sequence of interest, in particular suitable for encoding a protein / polypeptide of interest, and being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

[0015] According to a seventh main embodiment, the present invention relates to a modified / edited cell obtained by the previously mentioned method for altering expression, or editing, beta-casein / CSN2 gene in said cell.

[0016] According to an eighth main embodiment, the present invention relates to a method, in particular an in vitro method, for producing a recombinant polypeptide, in a cell; comprising steps of: a) providing a modified cell, as defined previously, the cell being characterized in that the donor nucleic acid encodes a polypeptide of interest; b) recovering the polypeptide from the cell.

[0017] According to a ninth main embodiment, the present invention relates to a kit comprising: the guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof; or the nucleic acid sequence encoding the guide RNA (gRNA); or the vector comprising the nucleic acid sequence operably linked to a suitable promoter; or the DNA targeting system as defined previously; orthe ribonucleoprotein (RNP) comprising: at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene, and at least one RNA-guided nuclease.DEFINITIONS

[0018] In the present invention, the following terms have the following meanings:

[0019] “About” preceding a figure means plus or less 10% of the value of said figure.

[0020] “And / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0021] “At least one” includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 75, 100, 250, 500, 750, 103,104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015or more.

[0022] “Comprising”, “comprises” and “comprised of’ are used herein are synonymous with “including”, “includes” or “containing”, “contains”, and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. These terms also encompass “consisting of’.

[0023] “CRISPR-Cas system”, wherein “CRISPR” stands for “clustered regularly interspaced short palindromic repeats”, refers to an engineered system that contains two components: a guide RNA (gRNA) and a CRISPR-associated endonuclease (Cas protein). The CRISPR-Cas system is routinely used to perform genome editing enabling site-specific alterations in a variety of organisms and cellular contexts. The genome editing by the CRISPR-Cas9 system entails three steps: (1) scanning of the genome by the RNA-guided Cas9 nuclease to find the DNA sequence complementary to the gRNA, (2) creation of a DNA double-strand break (DSB) by Cas9, and (3) repair of the lesion by the endogenous DNA repair machinery. The induced DSB is repaired through DNA repair machinery, such as, for example, the efficient but error-prone non-homologous end joining (NHEJ) or the less efficient but high-fidelity homology-directed repair for gene modifications (HDR), and the like. The CRISPR-Cas system may be used to generateinsertions or deletions (termed Indels) or frameshift mutations due to error-prone repair pathways. The CRISPR-Cas system may also be used to silence or mutate a gene. The CRISPR-Cas system may furthermore be used to produce knock-out (KO) mutants. Moreover, the CRISPR-Cas system may be used to perform base editing and prime editing, thereby generating precise and on demand nucleotide conversion, allowing, for example, fine-tuning of protein function and generating gain-of-function mutants. The CRISPR-Cas system may be delivered through different Cas and gRNA formats, for example selected in the list comprising, but not limited to, plasmid DNA (pDNA), RNA or proteins (e.g., Cas ribonucleoproteins (RNPs)), and the like.

[0024] “Cas” stands for “CRISPR-associated protein” and relates in particular to a CRISPR-associated endonuclease, i.e., an enzyme that cleaves both strands of DNA molecule. The Cas proteins can comprise (i) an active DNA cleavage domain and (ii) a guide RNA binding domain. As part of the CRISPR-Cas system, the Cas protein is guided to its specific site of action (i.e., to the target DNA sequence) by a gRNA. The Cas may originate from different protein families selected in the list comprising, but not limited to, Cas3, Cas7, Cas8, Cas9, CaslO, Casl 1, Casl2, and Casl4. In some specific embodiments, the present invention relates to Cas9. Classically, a Cas9 comprises two nuclease domains, namely the HNH and the RuvC, each of them cleaving a DNA strand. The Cas used in the present invention may be a variant form of a classical Cas (e.g., a mutant form), such as a nickase, a dead Cas (dCas), a high fidelity (Hifi) Cas, and the like. As used herein, a “nickase Cas” comprises a mutation either on the HNH or on the RuvC domain of the Cas protein, providing to the nickase Cas the capacity to cleave only one DNA strand.

[0025] As used herein, a “dCas9” comprises two mutations, the first one in the HNH domain and the second one in the RuvC domain, thereby completely abolishing the cleavage capacity of the Cas9 protein.

[0026] As used herein, a “Hifi Cas9” is a less tolerant form of Cas9, in particular a form less tolerant to mismatches between the gRNA and the targeted DNA sequence, thereby reducing off-targets. Cas9 nuclease (and variants) or nickase, or Hifi Cas9 may in particular be used to perform genome editing, while dCas9 may be used as a cargo totarget other molecules (DNA, RNA, proteins and the like) to a specific DNA sequence in the genome. Or dCas9 can be used as shield to protect a DNA sequence from other Cas activities, restriction enzymes or proteins.

[0027] “Guide RNA” or “gRNA” refers to any nucleic acid that promotes the specific association (or “targeting”) of an RNA-guided nuclease (such as, for example, Cas9) to a target sequence (e.g., a genomic or episomal sequence) in a cell. A gRNA comprises a first part capable of binding the RNA-guided nuclease and a second part, that contains a sequence that may be referred to as a “spacer”, capable of binding to the target sequence to be modified, and typically located at the 5’ terminus of the gRNA. A gRNA may consist of a “single” or “unimolecular” gRNA molecule (also known as “single guide RNA (sgRNA)” when the first and second part are comprised in a same nucleic acid molecule. Alternatively, a gRNA may comprise 2 or more nucleic acid molecules (these gRNA may be referred to as “modular gRNA”). An example of a modular gRNA (e.g. in 2 parts) is a gRNA formed of a CRISPR RNA (crRNA) comprising the spacer and a transactivating crRNA (tracrRNA), wherein the crRNA and the tracrRNA are usually associated with one another by complementarity (these gRNA may be referred to as “crtracrRNA”, or 2-piece gRNA). For example, the 3’ end of the crRNA may be linked covalently or by complementarity to the 5’ end of the tracrRNA. The crRNA sequence is customizable depending on the purpose of the experiment. For example, the gRNA may have a specific crRNA sequence allowing the gRNA to bind to other(s) molecules(s). The tracrRNA sequence depends on the Cas protein the gRNA is binding to. The spacer region of a gRNA if fully or partially complementary to a target domain or target polynucleotide within a DNA sequence where editing is desired. The spacer region of a gRNA is typically 10-30 nucleotides in length (for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length), preferably 16-24 nucleotides in length. gRNAs and their component parts are described throughout the literature (see, e.g., Briner et al. Mol. Cell, 56(2), 333-339 (2014), which is incorporated by reference).

[0028] The term “identity” when used in a relationship between the sequences of two or more polypeptides or of two or more nucleic acid molecules, refers to the degree of sequence relatedness between polypeptides or nucleic acid molecules, as determined bythe number of matches between strings of two or more amino acid or nucleotide residues. “Identity” measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (i.e., “algorithms”). Identity of related polypeptides can be readily calculated by known methods. Such methods include, but are not limited to, those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo et al., SIAM J. Applied Math. 48, 1073 (1988). Preferred methods for determining identity are designed to give the largest match between the sequences tested. Methods of determining identity are described in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include the GCG program package, including GAP (Devereux et al., Nucl. Acid. Res. \2, 387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., J. Mol. Biol. 215, 403-410 (1990)). The BLASTX program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul et al. NCB / NLM / NIH Bethesda, Md. 20894; Altschul et al., supra). The well-known Smith Waterman algorithm may also be used to determine identity. In one embodiment, the term identity is measured over the entire length of the sequence to which it refers.

[0029] “Nucleic acid” or “polynucleotide” refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. “Nucleic acid” or “Polynucleotides” include, without limitation single-and doublestranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double- stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, “Nucleic acid” or “polynucleotide” refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term “nucleic acid” or “polynucleotide” also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, “nucleic acid” or “polynucleotide” embraces chemically, enzymatically, or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. “Polynucleotide” also embraces relatively short polynucleotides, often referred to as oligonucleotides.

[0030] “Protein”, “polypeptide” and “peptide” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified by, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, pegylation, or any other manipulation, such as conjugation with a labelling component. As used herein the term “amino acid” includes natural and / non-natural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.

[0031] “Ribonucleoprotein” or “RNP” as disclosed herein refers broadly to a complex comprising a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof, for example a Cas protein (e.g., a Cas9 protein) or a variant thereof, and a guide RNA (gRNA). RNPs may for example be delivered into cells by lipofection or electroporation.

[0032] “Target sequence”, “target domain” or “target region” all correspond to a DNA sequence to be edited, and thus to a DNA sequence in a genome of a cell that is complementary to the spacer part of the gRNA molecule for one of its strands. Particular examples of a target sequence within the beta-casein gene, in particular exon 2 of a betacasein goat gene, include those selected from the group consisting of SEQ ID N°23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 and 44.

[0033] As used herein, the “exon 2 of a beta-casein gene of sequence” encompasses a reference sequence having at least 85% of sequence identity with exon 2 of a beta-casein goat gene of reference sequence SEQ ID NO 58 (GAATCGAGAGCCATGAAGGTCCTCATCCTTGCCTGTCTGGTGGCTCTGGCC ATTGCAAGAGAG); in particular a sequence having at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even 100% sequence identity with exon 2 of a betacasein goat gene.

[0034] “Transfection” refers to a process by which exogenous nucleic acid and / or protein are transferred or introduced into a host cell, in particular a host cell of eukaryotic origin. A “transfected” host cell is one which has been manipulated so as to incorporate the exogenous nucleic acid or protein. The cell includes the primary subject cell and its progeny. As used herein, “viral-mediated transfection” and “transduction” are considered as synonymous.

[0035] The term “vector” is meant to refer to any vehicle carrying a foreign nucleic sequence into a cell, for replication and / or expression. Hence, the term is susceptible to encompass both a replication vector and an expression vector; the two embodiments not being mutually exclusive.

[0036] The term “expression vector” is meant to encompass any vector which is susceptible to allow expression of a nucleic acid sequence within a given expression system; which may thus include transcription of the corresponding nucleic acid sequence, or alternatively both transcription and translation of the corresponding nucleic acid sequence. Such expression vectors generally include at least one - or more - promoter region (e.g. inducible or non-inducible promoter region) and at least one - or more - terminator and / or regulatory region, although not necessarily. For example, expression vectors may be part of expression systems including one or more than one (e.g. a plurality) of vector (e.g. as part of a dual expression system).

[0037] Within an expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitrotranscription / translation system or in a host cell when the vector is introduced into the host cell). Advantageous vectors include lentiviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells.

[0038] A “regulatory element” is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY : METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas), or particular cell types (e.g., lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g., 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g., 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and Hl promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RS V enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the P-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter. Also encompassed by the term “regulatory element” are enhancer elements, such as WPRE ; CMV enhancers ; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988) ; SV40 enhancer ; and the intron sequence between exons 2 and 3 of rabbit P-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to betransformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).

[0039] A « lipid aggregate-forming cationic lipid » and the like refer, in the usual and customary sense, to a net positively charged lipid which can facilitate the formation of lipid aggregates. The term « lipid aggregate » refers to a lipid structure including a plurality of lipids or type of lipids, forming a higher order structure (e.g., secondary, tertiary or quaternary structure). Non-limiting examples of lipid aggregates include liposomes, unilamellar vesicles, multilamellar vesicles, micelles, amorphous aggregates, and the like. The lipid aggregates of the present invention can contain any suitable lipid, including cationic lipids, zwitterionic lipids, neutral lipids, or anionic lipids.

[0040] An « enhancer element » as provided herein refers to a compound (e.g. a peptide or otherwise) which facilitates transfection, thereby increasing transfection efficiency. Therefore, the transfection efficiency of a nucleic acid, polypeptide or complex thereof into a cell is higher in the presence of an enhancer element compared to the transfection efficiency in the absence of said enhancer element.

[0041] As used herein, a “plasmid” refers to a small extra-genomic DNA molecule, most commonly found as circular double stranded DNA molecules that may be used as a cloning vector in molecular biology, to make and / or modify copies of DNA fragments up to about 15 kb (i.e., 15,000 base pairs). Plasmids may also be used as expression vectors to produce large amounts of proteins of interest encoded by a nucleic acid sequence found in the plasmid downstream of a promoter sequence.

[0042] As used herein, the term “cosmid” refers to a hybrid plasmid that contains cos sequences from Lambda phage, allowing packaging of the cosmid into a phage head and subsequent infection of bacterial cell wherein the cosmid is cyclized and can replicate as a plasmid. Cosmids are typically used as cloning vector for DNA fragments ranging in size from about 32 to 52 kb.

[0043] As used herein, “bacterial artificial chromosome” or “BAC” refers to an extra- genomic nucleic acid molecule based on a functional fertility plasmid that allows the even partition of said extra-genomic DNA molecules after division of the bacterial cell. BACs are typically used as cloning vector for DNA fragment ranging in size from about 150 to 350 kb.DETAILED DESCRIPTION

[0044] The inventors have identified the beta casein / CSN2 gene, and more particularly the goat beta casein / CSN2 gene, as a promising target for the expression of recombinant proteins, under the control of the beta-casein associated promoter.

[0045] Without wishing to be bound by the theory, the inventors are of the opinion that the 5’ end of the beta casein / CSN2 gene, which corresponds to exon 2 of the goat beta casein / CSN2 gene, could be edited with a CRISPR-Cas strategy, in an efficient manner while reducing off-target effects.

[0046] In response to this need, the inventors have developed novel means and methods for enabling an improved edition of the second exon of the beta-casein gene.

[0047] The proposed guide RNAs, and strategy of targeting of the corresponding exon 2 of the beta-casein gene, in particular targeting of sequences selected from the group consisting of SEQ ID N°23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 and 44, were further found to be workable even as ribonucleoproteins (RNP), and validated with a goat fibroblast model.

[0048] Thus, the present application provides novel guide RNAs (gRNAs) targeting the goatbeta-casein / CSN2 gene, but also novel ribonucleoproteins, and other DNA-targeting systems for improved edition of the second exon of the beta-casein gene.

[0049] The present invention thus relates to a guide RNA (gRNA) molecule targeting the beta-casein / CSN2 gene; and in particular a guide RNA molecule targeting the exon 2 of goat beta-casein / CSN2 gene.

[0050] In particular, the invention relates to a guide RNA (gRNA) comprising a sequence having at least 85% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 22; or composition thereof.

[0051] Hence, the invention relates in particular to a guide RNA (gRNA) comprising a sequence having at least 85% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 to SEQ ID NO: 22; or composition thereof.

[0052] In particular, the invention relates to a guide RNA (gRNA) comprising a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 22; or composition thereof.

[0053] In particular, the invention relates to a guide RNA (gRNA) comprising a nucleic acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 22; or composition thereof. In particular, the invention relates to a guide RNA (gRNA) consisting of a nucleic acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 22; or composition thereof. In particular, the invention relates to a guide RNA (gRNA) comprising a sequence having at least 85% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof. In particular, the invention relates to a guide RNA (gRNA) comprising a sequence having at least 90% sequence identity, preferably 95% sequence identity, with a nucleic acid sequence SEQ ID NO: 1; or composition thereof.

[0054] According to exemplary and preferred embodiments, the invention relates to a guide RNA (gRNA) comprising a nucleic acid sequence SEQ ID NO: 1; or composition thereof.

[0055] According to another main embodiment, the invention relates to a nucleic acid sequence encoding the gRNA.

[0056] Hence, according to a main embodiment, the invention relates to a nucleic acid sequence encoding a guide RNA (gRNA) comprising a sequence having at least 90%sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition thereof.

[0057] Hence, according to a main embodiment, the invention relates to a nucleic acid sequence encoding a guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence SEQ ID NO: 1; or composition thereof.

[0058] Hence, according to a main embodiment, the invention relates to a nucleic acid sequence encoding a guide RNA (gRNA) comprising a nucleic acid sequence SEQ ID NO: 1; or composition thereof.

[0059] According to another main embodiment, the invention relates to a vector comprising the nucleic acid sequence encoding the gRNA, operably linked to a suitable promoter; or composition thereof.

[0060] Hence, according to a main embodiment, the invention relates to a vector comprising the nucleic acid sequence encoding a gRNA comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21, operably linked to a suitable promoter; or composition thereof.

[0061] Hence, according to a main embodiment, the invention relates to a vector comprising the nucleic acid sequence encoding a gRNA comprising a sequence having at least 90% sequence identity with a nucleic acid sequence SEQ ID NO: 1, operably linked to a suitable promoter; or composition thereof.

[0062] Hence, according to a main embodiment, the invention relates to a vector comprising the nucleic acid sequence encoding a gRNA comprising a nucleic acid sequence SEQ ID NO: 1, operably linked to a suitable promoter; or composition thereof.

[0063] According to another main embodiment, the invention relates to a DNA targeting system for targeting exon 2 of a beta-casein gene, in particular exon 2 of a beta-casein goat gene of sequence SEQ ID NO: 58(GAATCGAGAGCCATGAAGGTCCTCATCCTTGCCTGTCTGGTGGCTCTGGCC ATTGCAAGAGAG).

[0064] The DNA targeting system may, in particular, be selected from the group consisting of a vector (e.g. a nucleic acid vector) or a ribonucleoprotein.

[0065] Hence, according to a main embodiment, the invention relates to a DNA targeting system, comprising - or consisting of : a) a first regulatory element operable in a eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) capable of targeting exon 2 of the beta-casein gene, in particular a CRISPR-Cas system guide RNA, and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0066] Hence, according to a main embodiment, the invention relates to a DNA targeting system, comprising - or consisting of : a) a first regulatory element operable in a eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) capable of targeting exon 2 of the beta-casein gene, in particular capable of targeting a sequence selected from the group consisting of SEQ ID N°23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 and 44 , and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0067] Hence, according to a main embodiment, the invention relates to a DNA targeting system, comprising - or consisting of: a) a first regulatory element operable in an eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA), in particular a CRISPR-Cas system guide RNA, the guide RNA having at least 85% sequence identity with a nucleic acid sequence selected from the group consisting of SEQID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 to SEQ ID NO: 22, and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0068] Hence, according to a main embodiment, the invention relates to a DNA targeting system, comprising - or consisting of: c) a first regulatory element operable in a eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA), in particular a CRISPR-Cas system guide RNA, the guide RNA having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 to SEQ ID NO: 21, and d) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0069] The DNA targeting system may be further characterized in that components (a) and (b) are located on same or different vectors of the system, whereby the guide RNA targets the target sequence (in particular the exon 2 of the beta-casein gene sequence) and the RNA-guided nuclease cleaves the DNA molecule.

[0070] According to some embodiments, the expression of the beta-casein gene sequence, in particular the beta-casein goat gene sequence, is altered.

[0071] Alternatively, the DNA targeting system may be a ribonucleoprotein, or a composition thereof.

[0072] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein, or composition thereof, characterized in that it comprises at least one gRNA according to the invention, and at least one RNA-guided nuclease.

[0073] According to one embodiment, the ribonucleoprotein consists of a RNA-guided nuclease and a guide RNA according to the invention.

[0074] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein characterized in that it comprises at least one gRNA according to the invention, capable of targeting a sequence selected from the group consisting of SEQ ID N°23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 and 44, and at least one RNA-guided nuclease

[0075] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein characterized in that it comprises at least one gRNA comprising a sequence having at least 85% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 22, and at least one RNA- guided nuclease.

[0076] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein characterized in that it comprises at least one gRNA comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21, and at least one RNA- guided nuclease.

[0077] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein characterized in that it comprises at least one gRNA comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, and at least one RNA-guided nuclease.

[0078] Hence, according to a main embodiment, the invention relates to a ribonucleoprotein, or composition thereof, characterized in that it comprises at least one gRNA comprising a sequence consisting of SEQ ID NO: 1, and at least one RNA-guided nuclease.

[0079] According to a main embodiment, the invention relates to a ribonucleoprotein, or composition thereof, characterized in that it comprises at least one gRNA according to the invention, at least one RNA-guided nuclease, and at least one donor nucleic acidcomprising a nucleic acid sequence of interest, in particular suitable for encoding a polypeptide of interest.

[0080] According to a main embodiment, the invention relates to a ribonucleoprotein comprising (i) at least one gRNA according to the invention, (ii) at least one RNA-guided nuclease, and (iii) at least one donor nucleic acid comprising a nucleic acid sequence of interest, in particular suitable for encoding a polypeptide of interest, and being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

[0081] According to a particular embodiment, the ribonucleoprotein is characterized in that it consists of the gRNA according to the invention, and a RNA-guided nuclease.

[0082] According to a main embodiment, the DNA targeting system may be a composition comprising the ribonucleoprotein according to the invention; optionally in combination with a lipid aggregate-forming cationic lipid and / or an enhancer element.

[0083] According to a main embodiment, the DNA targeting system may thus be a composition comprising the ribonucleoprotein according to the invention; in combination with a lipid aggregate-forming cationic lipid and an enhancer element.

[0084] According to some embodiments, the enhancer element is a peptide including one or more cationic moieties. According to some embodiments, the one or more cationic moieties are attached to the C-terminus of the enhancer element. According to some embodiments, the one or more cationic moieties are attached to the N-terminus of the enhancer element.

[0085] According to a main particular embodiment, the invention thus also relates to a vector system comprising: a vector comprising the nucleic acid sequence encoding the gRNA, operably linked to a suitable promoter; and a vector comprising a nucleic acid sequence encoding at least one RNA-guided nuclease or a variant thereof, operably linked to a suitable promoter.

[0086] According to a main particular embodiment, the invention thus also relates to a vector system comprising: a vector comprising (i) the nucleic acid sequence encoding the gRNA, operably linked to a first suitable promoter, and (ii) a nucleic acid sequence encoding at least one RNA-guided nuclease or a variant thereof, operably linked to a second suitable promoter, which may be the same as the first promoter or a different promoter.

[0087] According to another main embodiment, the invention relates to a method for altering expression, or editing, beta-casein / CSN2 gene in a cell, comprising: expressing in the cell the at least one gRNA and the at least one RNA-guided nuclease; or introducing the at least one gRNA and the at least one RNA-guided nuclease in the cell; or- bringing into contact the at least one gRNA with the cell, in conditions where the cell is capable of expressing at least one RNA-guided nuclease and / or comprising the at least one RNA-guided nuclease; and optionally expressing in the cell a donor nucleic acid coding; or introducing in the cell a donor nucleic acid; or bringing into contact a donor nucleic acid with the cell; the donor nucleic acid comprising a nucleic acid sequence of interest, in particular suitable for encoding a protein / polypeptide of interest, and being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

[0088] In particular, for gene knock-in related embodiments, the invention relates to a method for altering expression, or editing, beta-casein / CSN2 gene in a cell, comprising:expressing in the cell the at least one gRNA and the at least one RNA-guided nuclease; or introducing the at least one gRNA and the at least one RNA-guided nuclease in the cell; or- bringing into contact the at least one gRNA with the cell, in conditions where the cell is capable of expressing at least one RNA-guided nuclease and / or comprising the at least one RNA-guided nuclease; and expressing in the cell a donor nucleic acid; or introducing in the cell a donor nucleic acid; or bringing into contact a donor nucleic acid with the cell; the donor nucleic acid comprising a nucleic acid sequence of interest, in particular suitable for encoding a protein / polypeptide of interest, and being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

[0089] Hence, according to a main embodiment, the invention relates to a method for altering expression, or editing, beta-casein / CSN2 gene in a cell, comprising expressing in the cell at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene and at least one RNA-guided nuclease, in particular at least one RNA-guided nuclease from the Cas protein family; or alternatively comprising introducing at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene and at least one RNA-guided nuclease in the cell.

[0090] According to another main embodiment, the invention relates to a (e.g. isolated) modified cell obtained by the previously disclosed methods for altering expression, or editing, beta-casein / CSN2 gene.

[0091] According to another main embodiment, the invention relates to a method for producing a recombinant polypeptide, in a cell; comprising steps of:a) providing a modified cell obtained by the previously disclosed method for altering expression, or editing, beta-casein / CSN2 gene, the cell being characterized in that the donor nucleic acid encodes a polypeptide of interest ; b) recovering the beta-casein, or modified form thereof from the cell.

[0092] In particular, the invention relates to a method for producing a recombinant polypeptide, in a cell; comprising steps of a) providing a modified cell obtained by the previously disclosed method for altering expression, or editing, beta-casein / CSN2 gene, the cell being characterized in that the donor nucleic acid encodes a polypeptide of interest; b) inducing the expression of the polypeptide of interest in the modified cell; c) recovering the polypeptide from the cell.

[0093] According to a main embodiment, the invention relates to a kit comprising the guide RNA, the vector or vector system, the ribonucleoprotein or the DNA targeting system according to the invention.Beta casein

[0094] In some embodiment, the gRNA targets a nucleic acid sequence, preferably a DNA sequence.

[0095] In some embodiments, the gRNA targets a gene encoding a protein from the casein family, preferably encoding the beta-casein / CSN2 gene.

[0096] In some embodiments, the gRNA targets or spans an exonic region, preferably any exon from the beta-casein / CSN2 gene; in particular the goat beta-casein / CSN2 gene. In some embodiment, the gRNA targets or spans the exon 2 of the goat beta-casein / CSN2 gene, and at least one other exon of the same goat beta-casein / CSN2 gene.

[0097] In some embodiments, the gRNA targets the beta-casein / CSN2 gene from a mammalian species. Examples of mammalian species include, but are not limited to rodents (e.g., a mouse, rat, rabbit and the like), bovines (e.g., a calf, cow, bull and the like), equines (e.g., a donkey, horse and the like), lama, pig, dog, cat, sheep, goat, monkey, and the like. In some embodiments, the gRNA targets the beta-casein / CSN2 from sheep or goat. In some embodiments, the gRNA targets the beta-casein / CSN2 from goat.

[0098] In some embodiments, the gRNA targets the beta-casein / CSN2 from a nonmammalian species, for example from a species selected in the non-limitative list comprising chicken, axolot, frog, fruit fly, zebrafish, worm, and the like.

[0099] In some embodiments, the gRNA of the present invention is specific for the second exon of beta-casein / CSN2 gene, most preferably the second exon of goat beta- casein / CSN2 gene.Guide RNA

[0100] In some embodiments, the gRNA is a single-guide RNA (sgRNA).

[0101] In some embodiments, the gRNA is a crtracrRNA.

[0102] In some embodiments, the gRNA of the present invention comprises a spacer sequence having a length ranging from 10 to 30 nucleotides, for example having 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, preferably ranging from 16 to 24 nucleotides in length.

[0103] In some embodiments, the spacer is located at or near the 5’ terminus of the gRNA molecule.

[0104] In some embodiments, the gRNA comprises a sequence having at least 85% of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to SEQ ID NO: 22.

[0105] In some embodiments, the gRNA comprises a sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to 22.

[0106] In some embodiments, the gRNA of the present invention comprises a spacer sequence having a length ranging from 10 to 30 nucleotides, said spacer sequence having at least 85% of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to SEQ ID NO: 22.

[0107] In some embodiments, the gRNA comprises a sequence having at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 25 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or more of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to 22.

[0108] In some embodiments, the gRNA comprises a sequence selected from the group comprising or consisting of SEQ ID NO: 1 to SEQ ID NO: 22.

[0109] In some embodiments, the gRNA comprises a sequence having at least 85% of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to SEQ ID NO: 10.

[0110] In some embodiments, the gRNA comprises a sequence having at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 25 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or more of sequence identity with a nucleic acid sequence selected from the group comprising or consisting of SEQ ID NO: 1 to 10.

[0111] In some embodiments, the gRNA comprises a sequence selected from the group comprising or consisting of SEQ ID NO: 1 to SEQ ID NO: 10.

[0112] In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 1 to 22 or consists of a sequence presenting at least about 85% identity with a sequence selected from SEQ ID NO: 1 to 22.

[0113] In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 1 to 22, or consists of a sequence presenting at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence selected from SEQ ID NO: 1 to 22.

[0114] In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 1, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 1. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 2, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 2. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 3, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 3. In some embodiments, the spacer sequence of the gRNA of the present inventionconsists of a sequence selected from SEQ ID NO: 4, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 4. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 5, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 5. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 6, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 6. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 7, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 7. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 8, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 8. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 9, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%,96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 9. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 10, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 10. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 11, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 11. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 12, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 12. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 13, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 13. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 14, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%,99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 14. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 15, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 15. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 16, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 16. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 17, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 17. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 18, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 18. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 19, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 19. In some embodiments, the spacer sequence of the gRNA of the present inventionconsists of a sequence selected from SEQ ID NO: 20, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 20. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 21, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 21. In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 22, or consists of a sequence presenting at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence SEQ ID NO: 22.

[0115] In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 1 to 10 or consists of a sequence presenting at least about 85% identity with a sequence selected from SEQ ID NO: 1 to 10.

[0116] In some embodiments, the spacer sequence of the gRNA of the present invention consists of a sequence selected from SEQ ID NO: 1 to 10, or consists of a sequence presenting at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.65%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or more identity with a sequence selected from SEQ ID NO: 1 to 10. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 1 or a variant thereof, presenting at least 85% identity with SEQID NO: 1. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 1 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 1. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 2 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 2. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 2 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 2. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 3 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 3. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 3 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 3. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 4 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 4. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 4 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 4. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 5 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 5. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 5 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 5. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 6 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 6. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 6 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 6. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 7 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 7. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 7 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 7. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 8 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 8. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 8 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 8. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 9 or a variant thereof, presenting at least 85% identity with SEQID NO: 9. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 9 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 9. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 10 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 10. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 10 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 10. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 11 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 11. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 11 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 11. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 12 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 12. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 12 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 12. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 13 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 13. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 13 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 13. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 14 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 14. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 14 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 14. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 15 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 15. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 15 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 15. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 16 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 16. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 16 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 16. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 17 or a variant thereof, presenting at least 85% identity with SEQID NO: 17. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 17 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 17. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 18 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 18. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 18 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 18. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 19 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 19. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 19 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 19. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 20 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 20. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 20 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 20. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 21 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 21. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 21 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 21. In some embodiments, the gRNA of the present invention comprises SEQ ID NO: 22 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 22. In some embodiments, the spacer of the gRNA of the present invention comprises or consists of SEQ ID NO: 22 or a variant thereof, presenting at least 85% identity with SEQ ID NO: 22. In some embodiments, the gRNA according to the invention comprises at least one mutation (e.g., 1, 2, 3, 4 or 5 mutations) within the sequence SEQ ID NO 1 to 22.Modifications of the gRNA

[0117] In some embodiments, the gRNA according to the invention comprises chemical modifications. In some embodiments, the gRNA according to the invention comprises chemical modifications so as to improve its efficacity or half-life.

[0118] In some embodiments, at least one nucleotide of the gRNA of the present invention, e.g., at least one nucleotide of the spacer of the gRNA of the present invention, comprises a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

[0119] Examples of modifications of the ribose group include, but are not limited to, 2’- O-methyl, 2’-fluoro, 2’-deoxy, 2’-O-(2-methoxyethyl) (MOE), 2’-NH2, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(S)-constrained ethyl (S-cEt), a constrained MOE, and a 2’-O,4’-C-aminomethylene bridged nucleic acid (2’,4’-BNANC).

[0120] Examples of modifications of the phosphate group include, but are not limited to, a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.

[0013] Examples of modifications of the nucleobase group include, but are not limited to, 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, or halogenated aromatic groups.

[0121] In some embodiments, the gRNA according to the invention comprises at least one deoxyribonucleotide. Therefore, in some embodiments, the gRNA of the present invention is a RNA / DNA chimeric molecule.RNA-guided endonuclease / Cas9

[0122] In some embodiments, the gRNA is capable of binding a DNA binding protein, i.e., a protein having a general or specific affinity for single- or double-stranded DNA.

[0123] The present invention thus also relates to a complex formed by a gRNA as described hereinabove, with a DNA binding protein; and compositions thereof.

[0124] In some embodiments, the DNA binding protein is selected from the group comprising or consisting of RNA-guided DNA endonucleases or nucleases, zinc finger proteins, transcription activator like effector nucleases, and the like.

[0125] In some embodiments, the DNA binding protein is a nuclease protein. In some embodiments, the nuclease protein comprises an active DNA cleavage domain and a gRNA binding domain.

[0126] In some most preferred embodiments, the DNA binding protein is a RNA guided- nuclease.

[0127] In some embodiments, the RNA-guided nuclease is a CRISPR-associated endonuclease (Cas), more particularly a Type-II Cas protein, or a variant thereof; for example a Cas protein, preferably a Cas9, or a variant or functional fragment thereof.

[0128] In some embodiments, the RNA-guided nuclease is an endoribonuclease and an endodeoxyribonuclease

[0129] In some embodiments, the RNA-guided endonuclease is a Cas9 protein selected from the group comprising or consisting of S. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9), and the like. Among the known Cas9 proteins, the S. pyogenes Cas9 protein has been widely used as a tool for genome engineering.

[0130] In some embodiments, the Cas9 is a variant (e.g., a mutant) of the classical Cas9, i.e., presents an altered or modified activity as compared to the classical Cas9. A “Cas9 variant”, as used herein, is a protein sharing homology to a Cas9 protein as described herein and includes fragments thereof.

[0131] In some embodiments, the Cas9 is a variant (e.g., a mutant) of the classical Cas9, selected in the list comprising or consisting of catalytically dead or inactive Cas9 (dCas9), a nickase Cas9 (nCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9- Hifi), an enhanced specificity Cas9 (eCas9), a fluorescent or tag Cas9 (for example: Cas9- GFP or Cas9-Streptavidin), a Cas 12a protein, a Cas 12b protein, a Cpfl protein or an expanded PAM Cas9 (xCas9), including variants and functional fragments thereof.

[0132] In some embodiments, Cas9 is a recombinant S. pyogenes Cas9 nuclease, purified from an A. coli strain expressing the nuclease.

[0133] Examples of commercially available Cas9 proteins include, but are not limited to, Alt-R™ S.p. Cas9 Nuclease V3 (IDT# 1081058), Alt-R™ S.p. Cas9 D10A Nickase V3 (IDT #1081062), Alt-R™ S.p. Cas9 H840A Nickase V3 (IDT #1081064), Alt-R™ S.p. HiFi Cas9 Nuclease V3, (IDT # 1081060) and Alt-R™ S.p. dCas9 Protein V3 (IDT #1081066).

[0134] In some embodiment, the Cas9 or variant thereof is able to associate with other molecules than the gRNA of the present invention, such as, for example, with RNA molecules, DNA molecules or proteins. In some embodiments, the Cas9 or variant thereof is a chimeric Cas9.Vector / tar et cell

[0135] The present invention also relates to a nucleic acid sequence encoding a gRNA according to the invention. In some embodiments, the gRNA is a sgRNA, and the nucleic acid sequence is monocistronic.

[0136] The present invention is further directed to a vector comprising a nucleic acid sequence encoding a gRNA according to the invention.

[0137] In some embodiments, the vector of the present invention further comprises a nucleic acid sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein, or a variant thereof (preferably Cas9 or a variant thereof).

[0138] The present invention further relates to a kit, comprising:(i) a first part comprising a vector or a nucleic acid sequence encoding a gRNA according to the invention, and / or the said gRNA; and(ii) a second part comprising a vector or nucleic acid sequence encoding a RNA- guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein, or a variant thereof; for example a Cas protein (preferably Cas9 or a variant thereof), and / or the said RNA-guided nuclease.

[0139] In some embodiments, said vector is suitable for expression of the gRNA of the present invention and / or of the RNA-guided nuclease in a target and / or host cell.

[0140] In some embodiments, the target and / or host cell is a eukaryote cell.

[0141] Within the scope of the invention, a “eukaryote / eukaryotic cell” encompasses a yeast, an algae cell, fungal cells, a plant cell, an animal cell, such as, e.g., an insect cell, a mammal cell, including a human cell; in particular a eukaryote / eukaryotic cell comprising a nucleic acid sequence encoding the beta-casein gene.

[0142] In some embodiments, the eukaryote cell is a mammal cell. In some embodiments, the eukaryote cell is a goat cell.

[0143] In some embodiments, a target cell and / or a host cell may encompass, without limitation, a cell of the central nervous system, an epithelial cell, a muscular cell, an embryonic cell, a germ cell, a stem cell, a progenitor cell, a hematopoietic stem cell, a hematopoietic progenitor cell, an induced Pluripotent Stem Cell (iPSC).

[0144] In some particular embodiments, the target cell and / or the host cell is not a stem cell, a progenitor cell, a germinal cell or an embryonic cell and the like.

[0145] In some embodiments, the target cell and / or the host cell may belong to a tissue selected in the list comprising a muscle tissue, a nervous tissue, a connective tissue, an adipose tissue, an epithelial tissue. In one embodiment, the target cell and / or the host cell is from an epithelial tissue.

[0146] In some embodiments, the target cell and / or the host cell may belong to an organ selected in the list comprising a an adipose tissue, bladder, a bone, a brain, a breast, a central nervous system, a cervix, a colon, an endometrium, a kidney, a larynx, a liver, a lung, a lymphoid organ, an esophagus, a mammary gland, an ovarian, a pancreas, a pleura, a prostate, a rectum, a retina, a salivary gland, a skin, a small intestine, soft tissue, a stomach, a testis, a thyroid, an uterus, a vagina.

[0147] In some embodiments, the target cell and / or the host cell belong to a gland. In some embodiments, the target cell and / or the host cell belong to an endocrine gland. In some embodiments, the target cell and / or the host cell belong to an exocrine gland.

[0148] In some embodiments, the target cell and / or the host cell belong to a gland, selected in the list comprising skin gland, a tongue gland, a digestive tract gland, a respiratory / lung gland, a genital gland, an ear gland, an eye / eyelids gland, a tong gland, a coccyx gland, a urethra gland, a breast gland, a cervix gland, a uterus gland, and the like.

[0149] In some embodiments, the target cell and / or the host cell belong to a breast gland or a mammary gland. In one embodiment, the target cell and / or the host cell belong to the mammary gland.

[0150] In some embodiments, the target cell and / or the host cell is an endothelial cell. In some embodiments, the target cell and / or the host cell is an epithelial cell.

[0151] In some embodiments, the vector comprises a nucleic acid sequence encoding the gRNA as described herein or a RNA-guided nuclease operably linked to a suitable promoter.

[0152] In some embodiments, the promoter is a non-inducible promoter. In some embodiments, the promoter is an inducible promoter.

[0153] Examples of vectors that may be used in the present invention include, but are not limited to, a plasmid, a cosmid, a viral vector or a bacterial artificial chromosome.

[0154] In some embodiments, the vector is transfected in the target cells and / or host cell in vivo. In some embodiments, the vector is transfected in the target cells and / or host cell in vitro or ex vivo.

[0155] In some embodiments, the vector is introduced into the host cell by transfection. In practice, transfection may be performed according to the methods known in the state of the art, or methods adapted therefrom. Illustratively, these methods include chemicaltransfection, gene gun, electroporation, sonoporation, magnetofection, and viral mediated transfection.

[0156] In some embodiments, transfection is performed chemically, in particular by the mean of calcium phosphate, cationic lipids, dendrimers, liposomes, polycation, polymers and / or nanoparticles. In some embodiments, chemical transfection includes the use of calcium phosphate, polyethylenimine or lipofectamine.

[0157] In some embodiments, transfection is performed by the mean of a viral vector, also referred to as transduction, such as, for example, a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus and combination thereof.Ribonucleoprotein (RNP)

[0158] The present invention also relates to a ribonucleoprotein (RNP) comprising at least one gRNA according to the invention, and at least one RNA-guided nuclease or variant thereof from the Cas protein family, preferably a Cas9 or a variant thereof.

[0159] The present invention further relates to a composition comprising the ribonucleoprotein (RNP), as defined above; or alternatively a composition consisting of the ribonucleoprotein (RNP), as defined above.

[0160] In some embodiments, the RNP is prepared by mixing a gRNA as described hereinabove and a Cas9 protein or a variant thereof, as described hereinabove.

[0161] In some embodiments, the RNP is prepared by mixing in solution a gRNA and a Cas9 or variant thereof at micromolar (pM) concentration, such as, for example at concentrations ranging from 0.5 to 200 pM, in particular from 1 to 200 pM, preferably from 10 to 100 pM, and more preferably from 15 to 50 pM.

[0162] In some embodiments, the RNP is transfected into the cells by incubating the RNP with the cells for at least 1 day, more preferably 2 days.

[0163] In some embodiments, the RNP is delivered into cells by a method selected in the list comprising or consisting of physical approaches such as microinjection, electroporation, biolistic and microfluidic techniques, and approaches based on synthetic carriers such as, for example, lipid nanoparticles and cell-derived vesicles, polymers, nanogels, inorganic nanoparticles, chemicals technique, and DNA nanoclews, and the like.

[0164] In a certain embodiment, the RNP is delivered into cells by lipofection or electroporation.

[0165] In some embodiment, the RNP is transfected to the cells at a dose of at least 0.1 pM, 0.2 pM, 0.3 pM, 0.4 pM, 0.5 pM, 0.6 pM, 0.7 pM, 0.8 pM, 0.9 pM, or at least 1 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.1 to 100 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.1 to 50 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.1 to 30 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from about 0.5 to 10 pM, preferably from about 1 to 5 pM, even more preferably, from about 1 to 1,8 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.5 to 10 pM, preferably from 1 to 5 pM, even more preferably, from 1 to 1,8 pM. In some embodiments, the RNP is transfected at a dose of at least 0.1 pg, 0.2 pg, 0.3 pg, 0.4 pg, 0.5 pg, 0.6 pg, 0.7 pg, 0.8 pg, 0.9 pg, or at least 1 pg; for example at least 1, 5, 10 or 20 pg. In some embodiments, a composition of ribonucleoproteins may comprise at least 1 pg, for example at least 1, 5, 10 or 20 pg, of a guide RNA according to the invention.Genome Editing

[0166] In some embodiments, the gRNA as described herein above, is for use in genome editing method.

[0167] The present invention thus further relates to a method for editing beta- casein / CSN2 gene in a cell, comprising expressing or introducing in said cell at least onegRNA as described hereinabove and at least one RNA-guided nuclease or variant (e.g., Hifi Cas9) thereof as described herein.

[0168] In some embodiments, the method for altering the expression of beta casein / CSN2 gene, or for editing beta-casein / CSN2 gene in the cell, is characterized in that the at least one gRNA and / or the at least one RNA-guided nuclease is inducible.

[0169] In some embodiments, the method for altering the expression of beta casein / CSN2 gene, or for editing beta-casein / CSN2 gene in the cell, is characterized in that the expression of the at least one gRNA and the at least one RNA-guided nuclease are inducible.

[0170] In some embodiments, the gRNA comprises a sequence selected from SEQ ID NO: 1 to 22, or variants thereof presenting at least 85% identity with SEQ ID NO: 1 to 22.

[0171] In some embodiments, the RNA-guided nuclease or variant thereof is a CRISPR endonuclease, more particularly a Type-II Cas protein or variant thereof.

[0172] In some embodiments, the RNA-guided nuclease or variant thereof is Cas9 or a variant thereof.

[0173] In some embodiment, the guide RNA is transfected to the cells at a dose of at least 0.1 pM, 0.2 pM, 0.3 pM, 0.4 pM, 0.5 pM, 0.6 pM, 0.7 pM, 0.8 pM, 0.9 pM, or at least 1 pM. In some embodiments, the guide RNA is transfected to the cells at a dose ranging from 0.1 to 100 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.1 to 50 pM. In some embodiment, the RNP is transfected to the cells at a dose ranging from 0.1 to 30 pM. In some embodiment, the guide RNA is transfected to the cells at a dose ranging from 0.5 to 10 pM, preferably from 1 to 5 pM, even more preferably, from 1 to 1,8 pM. In some embodiments, the guide RNA is transfected at a dose of at least 0.1 pg, 0.2 pg, 0.3 pg, 0.4 pg, 0.5 pg, 0.6 pg, 0.7 pg, 0.8 pg, 0.9 pg, or at least 1 pg; for example at least 1, 5, 10 or 20 pg. In some embodiments, a composition of guide RNAs may comprise at least 1 pg, for example at least 1, 5, 10 or 20 pg, of a guide RNA according to the invention.

[0174] In some embodiments, a vector of the present invention, comprising a nucleic acid sequence encoding a gRNA of the present invention, is transfected into the cell. In some embodiments, a vector comprising a nucleic acid sequence encoding a RNA-guided nuclease or variant thereof is transfected into the cell. In some embodiments, a vector of the present invention, comprising a nucleic acid sequence encoding a gRNA of the present invention and a nucleic acid sequence encoding a RNA-guided nuclease or a variant thereof is transfected into the cell.

[0175] In some embodiments, the vector (e.g plasmid) is transfected to the cells at a dose of at least 0.1 nM, 0.2 nM, 0.3 nM, 0.4 nM, 0.5 nM, 0.6 nM, 0.7 nM, 0.8 nM, 0.9 nM, or at least 1 nM. In some embodiment, the vector (e.g plasmid) is transfected to the cells at a dose ranging from about 0.5 to 10 nM, preferably from about 1 to 5 nM, even more preferably, from about 1 to 1,8 nM. In some embodiments, the vector (e.g plasmid) is transfected at a dose of at least 0.1 pg, 0.2 pg, 0.3 pg, 0.4 pg, 0.5 pg, 0.6 pg, 0.7 pg, 0.8 pg, 0.9 pg, or at least 1 pg; for example at least 1, 5, 10 or 20 pg.

[0176] The present invention thus further relates to a method for altering the expression of the beta-casein / CSN2 gene, or for editing the beta-casein / CSN2 gene in a cell, comprising bringing into contact said cell with a ribonucleoprotein (RNP) of the present invention, comprising at least one RNA-guided nuclease or variant thereof and the at least one gRNA.

[0177] In some of the above-mentioned embodiments, the cell is transfected with a ribonucleoprotein (RNP) of the present invention, comprising at least one RNA-guided nuclease or variant thereof and the at least one gRNA.

[0178] According to some embodiments, the transfected cell is a fibroblast. In some embodiment, the transfected cell is a fibroblast from the ear cartilage. In some embodiment, the transfected cell is a goat fibroblast.

[0179] According to some embodiments, the transfected cell is a mammalian cell.

[0180] The invention also relates to a method for producing a recombinant polypeptide in a cell, comprising the steps of:(a) providing a modified cell as defined previously;(b) expressing in said cell a gRNA and a RNA-guided nuclease or variant thereof, in particular a Cas9 protein or variant thereof, e.g., by transfecting said cell with a vector encoding a gRNA and a RNA-guided nuclease or variant thereof, as described hereinabove, or transfecting said cell with a ribonucleoprotein (RNP) of the present invention.

[0181] Advantageously, guide RNAs, vectors, DNA-targeting systems and ribonucleoproteins according to the invention may be suitable for beta-casein gene knock- in; in particular for introducing a further “donor” nucleic acid sequence coding for a recombinant protein / polypeptides of interest.

[0182] Such an additional / further coding nucleic acid sequence may thus also be referred in herein as a “donor nucleic acid” or “transgene”.

[0183] According to some embodiments, the further “donor” nucleic acid sequence may be an exogenous nucleic acid coding for a protein of interest distinct from P-casein, or fragment thereof.

[0184] According to some embodiments, the further “donor” nucleic acid sequence may be an exogenous nucleic acid coding for all or part of an antibody or an antigen-binding fragment thereof.

[0185] Advantageously such a further nucleic acid sequence coding for a protein of interest may be flanked by additional homology arms, either at the 5’ end, then 3’ end, or both the 5’ and 3’ end.

[0186] Homology arm sequences may, for example, include nucleic acid sequences having 500 bp or more in length, for example having 800 bp or more in length, for example having 1000 bp or more in length either at the 5’ end, then 3’ end, or both the 5’ and 3’ end of the said nucleic acid sequence.

[0187] Homology arm sequences may, for example, include nucleic acid sequences having 1100 bp or more in length, for example having 1500 bp or more in length.Alternatively, homology arm sequences may include nucleic acid sequences having 1100 bp or less in length, for example having 1000 bp or less in length.

[0188] Homology arm sequences may, for example, include nucleic acid sequences having less than 500 bp or more in length, for example having less than 400 bp in length, for example having less than 300 bp in length either at the 5’ end, then 3’ end, or both the 5’ and 3’ end of the said nucleic acid sequence.

[0189] In some embodiments, the invention thus relates to the said guide RNA, vector, DNA-targeting system and / or ribonucleoprotein in combination with a further nucleic acid, or transgene, coding for the protein of interest, which is optionally flanked by one or more nucleic acid sequences from the beta-casein gene.

[0190] In some embodiments, the invention thus also relates to a kit further comprising the nucleic acid, or transgene, coding for a protein / polypeptide of interest, optionally flanked by one or more nucleic acid sequences from the beta-casein gene.

[0191] Hence, according to some embodiments, the method for altering expression, or editing, beta-casein / CSN2 gene in a cell, may further comprise: expressing in the cell a further “donor” nucleic acid sequence coding for a protein / polypeptide of interest; or introducing a further “donor” nucleic acid sequence coding for a protein / polypeptide of interest; or bringing into contact the further “donor” nucleic acid sequence coding for a protein / polypeptide of interest with the cell; the further “donor” nucleic acid being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

[0192] In some embodiments, the gene-editing method is an in vitro, in cellulo or ex vivo method. In some embodiments, the gene-editing method is an in vivo method.

[0193] The present invention further relates to a modified cell obtained by the method for altering the expression of the beta-casein / CSN2 gene, or for editing the beta- casein / CSN2 gene as described above.

[0194] The present invention further relates to a method for producing a recombinant polypeptide in a cell; comprising steps of: a) providing a modified cell obtained by the method for altering the expression of the beta-casein / CSN2 gene, or for editing the beta-casein / CSN2 gene as described above, the cell being characterized in that the donor nucleic acid comprises a nucleic acid sequence suitable for encoding a polypeptide of interest ; b) recovering the polypeptide from the cell.

[0195] The present invention further relates to a method for producing a recombinant polypeptide in a cell; comprising steps of: a) expressing in the cell at least one guide RNA (gRNA) according to the invention and at least one RNA-guided nuclease,; or introducing at least one guide RNA (gRNA) according to the invention and at least one RNA-guided nuclease in the cell; or bringing into contact the at least one gRNA with the cell, in conditions where the cell is capable of expressing at least one RNA-guided nuclease and / or comprising the at least one RNA-guided nuclease; b) expressing in the cell a donor nucleic acid coding for a protein / polypeptide of interest; or introducing a donor nucleic acid coding for a protein / polypeptide of interest; or bringing into contact a donor nucleic acid coding for a protein / polypeptide of interest with the cell, the donor nucleic acid being capable of inserting the nucleotide sequence into the beta- casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease;c) optionally inducing the expression of the polypeptide of interest in the modified cell; d) recovering the polypeptide from the cell.Other applications

[0196] The present invention further relates to a method for addressing a molecule of interest at a specific locus in the beta-casein / CSN2 gene, preferably in exon 2 of the beta- casein / CSN2 gene, comprising the use of a gRNA of the present invention and of a RNA- guided nuclease, for example a dCas9, fused to said molecule of interest.

[0197] The present invention further relates to a method for addressing a molecule of interest at a specific locus in the beta-casein / CSN2 gene, preferably in exon 2 of the beta- casein / CSN2 gene, comprising the use of a ribonucleoprotein and / or DNA targeting system according to the invention, wherein the RNA-guided nuclease, for example the dCas9, is fused to said molecule of interest.

[0198] The present invention further relates to a method for modulating, protecting and / or editing a specific locus in the beta-casein / CSN2 gene, preferably exon 2 of the beta-casein / CSN2 gene, comprising the use of a ribonucleoprotein and / or DNA targeting system of the present invention.

[0199] The present invention further relates to a method for modulating, protecting and / or editing a specific locus in the beta-casein / CSN2 gene, preferably exon 2 of the beta-casein / CSN2 gene, comprising the use of a gRNA of the present invention and of a RNA-guided nuclease, for example a dCas9.

[0200] The present invention further relates to a guide RNA, vector, ribonucleoprotein, DNA targeting system according to the invention; for use as a medicament.

[0201] Thus, the present invention invention further relates to a use of a guide RNA, vector, ribonucleoprotein, DNA targeting system; for the preparation of a medicament.

[0202] The present invention further relates to a guide RNA, vector, ribonucleoprotein, DNA targeting system according to the invention; for use in a method for treating or preventing or delaying the occurrence of a beta-casein related disorder.The present invention further relates to a use of a guide RNA, vector, ribonucleoprotein, DNA targeting system; for the preparation of a medicament for treating or preventing or delaying the occurrence of a beta-casein related disorder.BRIEF DESCRIPTION OF THE DRAWINGS

[0203] Figure l is a photograph of a polyacrylamide gel showing the cleavage efficiency of the Cas9 combined to the sgRNA3, sgRNA4, sgRNA5a, gRNA#l, gRNA#2, and gRNA#3 in cellulo. T7 endonuclease 1(T7E1) assay was performed on PCR products of CSN2 exon 2 amplified from the genomic DNA (gDNA) of non-transfected goat fibroblasts (Ctrl) or goat fibroblasts transfected with a plasmid encoding the Cas9 enzyme and the sgRNA3, sgRNA4, sgRNA5a, gRNA#l, gRNA#2, or gRNA#3, by using the primers 16 and 27.

[0204] Figure 2 is a photograph of an agarose gel showing the cleavage efficiency of the Cas9 combined to the gRNA#l, gRNA#2, or gRNA#3 in vitro. Electrophoresis of PCR product of CSN2 exon 2 amplified from goat fibroblast gDNA by using the primers 16 and 27 and digested by the Cas9 protein combined to the gRNA#l (RNP#1), gRNA#2 (RNP#2), or gRNA#3 (RNP#3), or not digested (ctrl).

[0205] Figures 3A-3C is a combination of polyacrylamide gel photographs showing the comparison of the cleavage efficiency of the Cas9 expressed by a plasmid to the Cas9 protein, in cellulo. Fig. 3A-B are T7E1 assay performed on PCR products of CSN2 exon 2 amplifiedfrom the genomic DNA (gDNA) of non-transfected goat fibroblasts (Ctrl) or goat fibroblasts transfected with a plasmid (A: 10 or 20 pg; B: 1 or 5 pg) encoding the Cas9 enzyme and the gRNA#l, gRNA#2, or gRNA#3 by using voltages of 1600 V or 1800 V. Fig. 3C is a T7E1 assay performed on PCR products of CSN2 exon 2 amplified from the genomic DNA (gDNA) of non-transfected goat fibroblasts (Ctrl) or goat fibroblasts transfected with RNP#1, RNP#2 or RNP#3 by using voltages of 1800 V or 2000 V

[0206] Figures 4A-4B is a combination of scheme and agarose gel photographs showing the screening PCR of genetically modified fibroblasts. Fig. 4A is a schematic representation of PCRs to validate the knock-in of a transgene into the CSN2 locus. Fig.4B are photographs of an agarose gel showing the amplification of 3 ’-junction, 5’- junction and transgene from gDNA of fibroblast clones (F1C, F2C, F3C and GNF-4), gDNA of non-transfected fibroblast (A), a vector mimicking the knock-in alone (B) or mixed with gDNA of non-transfected fibroblast (D), the DNA template used for the CRISPR alone (C) or mixed with gDNA of non-transfected fibroblast (E) and H2O (F).

[0207] Figures 5A-5B is a combination of graphs showing the cleavage efficiency of the gRNA#16, gRNA#17, or gRNA#18, in vitro. Fig. 5A shows electrophoresis of PCR product of CSN2 exon 2 amplified from goat fibroblast gDNA: F3C, GNF-4 and GNF-5 by using the primers 16 and 27. Fig. 5B is a photograph of an agarose gel showing digestion of the PCR products 16-27 by RNP# 16, RNP# 17, and RNP# 18, or not digested (CTRL). RNP#2 was used as positive control for the cleavage.

[0208] Figure 6A-6B is a combination of graphs showing the cleavage efficiency of the Cas9 combined to the gRNA#l 8, in vitro. Fig. 6A shows electrophoresis of PCR products (surrounding the exon 2) amplified from goat fibroblast gDNA: F3C, GNF-4 and GNF-5 with different pairs of primers. Fig. 6B shows digestion of the PCR products of Fig.6A by RNP#18.

[0209] Figure 7 is a photograph of an agarose gel showing the cleavage of DNA by combination of RNP#16, 17 or 18 with RNP#2. After PCR amplification of the sequence surrounding the CSN2 exon 2, with primer 16-27, from goat fibroblast gDNA: F3C, GNF- 4 and GNF-5, the PCR products were digested by a combination of RNPs (RNP#2 + RNP#16, RNP#17 or RNP#18). The CTRL corresponds to samples without RNP. The top panel is a normal exposure, and the bottom panel is more exposed.

[0210] Figure 8A-8B is a combination of graphs showing the inhibition of the activity of the RNP# 18 by mutation of the targeted sequence. Fig. 8 A is a photograph of an agarose gel showing the confirmation of the presence of the mutation at the targeted sequence of the RNP#18, in plasmid “Clone 27” & “Clone 28” generated by mutagenesis.After PCR amplification of the sequence targeted by the gRNA#18 in the plasmids with primers 619-17, each PCR product was digested or not with the enzyme BspH I. (Clones 27 & 28 are plasmids coming from the bacteria colony 27 & 28 which carry the right mutation in the plasmid). Plasmid l is the plasmid of origin and CTRL- is H20. The digested PCR products were analyzed by electrophoresis on agarose gel. Fig. 8B is a photograph of a polyacrylamide gel showing PCR products of the sequence targeted by the gRNA#18, in the plasmids in “Clone 27”, “Clone 28” and “plasmid_l”, with primers 619-17. The PCR products were digested or not with RNP# 18 and analyzed by electrophoresis.

[0211] Figure 9 is a photograph of an agarose gel showing amplification of CSN2 exon 2 and cleavage by RNP#2 with or without RNP#18. After PCR amplification of the sequence surrounding the CSN2 exon 2, with primers 89-27, from goat fibroblast gDNA: GNF-4 and GNF-5, and primers 16-28 from goat fibroblast F3C, the PCR Products were digested by a combination of RNPs (RNP#2, RNP#18 or RNP#2 + RNP#18). The CTRL- correspond to samples without RNP.

[0212] Figure 10: is a photograph of a polyacrylamide gel showing the cleavage efficiency of the RNP# 18 in cellulo in F3C, GNF-4 and GNF-5. T7E1 assay was performed on PCR products (Observed in Fig. 9) of CSN2 exon 2 amplified from the genomic DNA (gDNA) of non-transfected goat fibroblasts (CTRL-) and from goat fibroblasts transfected with the RNP#18. The fragments (heteroduplexes) cleaved by T7E1 are indicated by the arrows.

[0213] Figure 11A-11B: is a combination of graphs showing the comparison of the cleavage efficiency of the Cas9 combined to the gRNA#2 and gRNA#I, and their impact on the cell viability when the Cas9 is used in the format of plasmid or protein. Figure 11A is a graph comparing the cell viability of different goat fibroblasts (GNF-4, F5EB or F5745B) after transfection with the RNP#2 or RNP#I or the plasmid (1, 5, 10 and 20pg) expressing the Cas9 and the sgRNA#2 or the sgRNA#I. Each experiment was performed in technical triplicate. The statistical analysis is an ANOVA assay, RNP#2 (*) or RNP#I (#) vs plasmid transfection samples, p<0.05:* / #, p<0.02:** / ##, p<0.001 :*** / ###, p<0.0001 :**** / ####. Figure 11B is a graph comparing the viability of fibroblaststransfected with the RNP#2 or the RNP#I (left axe) and comparing the predicted off- targets of the gRNA#2 and the gRNA#I by using the prediction tool Chopchop and Crispor (Right axe). For the viability, the graph represents five independent experiments, each one was repeated in technical triplicate. The statistical analysis is an t test assay, RNP#2 vs RNP#I, p<0.05:*.EXAMPLES

[0214] The present invention is further illustrated by the following examples.Materials and MethodsCrispr-Cas9 guide design

[0215] crRNAs (For Cas9 proteins, NGG PAM region) were designed, according to a previous sequencing of the CSN2 gene and thanks to predictive tools like: https: / / chopchop.cbu.uib.no / & http: / / crispor.tefor.net / .

[0216] Table 1 : List of guides RNA targeting exon 2 and surrounding sequence of exon2 of the P-casein gene, in particular the goat P-casein geneCell culture

[0217] Primary goat fibroblasts were cultured in DMEM Low glucose (Gibco, 31885), FBS 10% (Pan Biotech, P30-3031) and 1% Antibiotic antimycotic (Gibco, 15240-062).When the cells reached 90% confluency they were detached by trypsin (Gibco, 25200056) and seeded in a new flask with fresh medium.DNA extraction

[0218] For the in vitro and in cellulo validation of the RNP, genomic DNA (gDNA) was extracted from transfected and non-transfected goat fibroblasts using NucleoSpinDNA RapidLyse kit (Macherey -Nagel, 740100) or the DNeasy Blood & Tissue Kit (Qiagen 69504). For the screening of the clones after transfection of the knock-in vector into the fibroblasts, the gDNA of isolated clones was extracted using the Wizard® Genomic DNA Purification Kit (Promega, Al 120) or NucleoSpinDNA RapidLyse kit (Macherey -Nagel, 740100).PCR amplifying nuclease binding sites

[0219] DNA fragment covering exon 2 of the goat P-casein gene was amplified from gDNA of transfected and non-transfected fibroblasts. To achieve this amplification several primers at a final concentration of 500nM were used (Table 2) and the PCR were performed using the Phusion polymerase (NEB, M053 IL) or Q5 high fidelity polymerase (NEB, M0491) following the manufacturer’s protocol, with 100-200ng of gDNA. The thermocycling conditions were adjusted regarding the providers recommendations and primer characteristics. The PCR products were analysed by electrophoresis using a 0.8% or 2% agarose gel, or 5% polyacrylamide gel.

[0220] Table 3: List of primersElectrophoresis, 0.8% or 2% agarose gel

[0221] PCR reactions mixed with loading dye, Smart Ladder (Eurogentec, MW- 1700- 10) or Smart ladder SF (Eurogentec, MW- 1800-04) were loaded on a 0.8% or 2% 0.5X TAE (Trizma base 20mM, EDTA 0.5 mM pH 7.6) agarose gel containing SYBR Safe (Invitrogen, S33102). After migration in TAE 0.5x buffer, the gel was analyzed by Camera.Electrophoresis, 5% polyacrylamide gel

[0222] Final 5% polyacrylamide gel was prepared with 5% of acrylamide 29: 1 40% (Sigma, A7802), IX TBE (Tris-borate, EDTA), 0,15% APS (Ammonium persulfate), 0.08% TEMED (Tetramethylethylenediamine. Bio-Rad 161-0800). PCR reactions mixed with loading dye, or Smart Ladder SF (Eurogentec, MW- 1700-04) were loaded on the gel. After the migration in TBE IX Buffer, the gels were stained with SYBR safe TAE buffer before analysis.Plasmid preparation

[0223] For the plasmids encoding the Cas9 and the gRNA, the designed sgRNAs were cloned into CRISPR-Cas9 px458 plasmid. For the knock-in assay, the DNA templates, encoding the transgene flanked by homology arms corresponding to the targeted site, were designed, and cloned using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB, E5520S) into pGEM®-T Easy Vector (Promega, A1360) or subcontracted and cloned into a plasmid containing an ampicillin resistance gene and a pUC Ori site for bacteria production. For the inhibition assay of RNP#18, three plasmids were used: the plasmid l, a DNA template used in a previous knock-in experiment, and 2 additional plasmids, the clone 27 and clone 28. The clone 27 and clone 28 derived from the plasmid l and were mutated for the sequence targeted by the gRNA#18. To perform this modification, the kit Q5® Site-Directed Mutagenesis Kit (NEB, E0554), and primers: AATCGCATTGtcatgaTCATAAATGTATAAATAATG (SEQ ID NO: 56) and TTCTACACATAGGCAGAC (SEQ ID NO: 57) were used. This mutation substituted 1 base in the PAM region used by the RNP#18, and 2 bases in the region of the plasmid complementary of the seed region (nucleic acid sequence at the 3’ end of thecomplementary region of the corresponding guide RNA, in this case the complementary region targeted by the RNP#18). Moreover, to facilitate the screening of the bacteria and the identification of the good clones during the cloning, the BspH I restriction site was added in the mutated site. Briefly, a PCR, on plasmid l, was performed with the two primers carrying the mutation and after ligation of the PCR products, bacteria were transformed and seeded on plate. Each colony was amplified, and, after plasmid extraction, the plasmids were digested with BspH I and analysed on agarose gel. A maxiprep was performed on the two best clones: Clone 27 and Clone 28. The plasmid sequence was confirmed by sequencing.Mutation detection using gel retardation assay and T7E1 assay.

[0224] For heteroduplexes formation followed by gel retardation assay, the PCR products of the exon 2 were denaturated at 95°C and then, annealed by slow cooling to 4°C using a thermocycler. For the gel retardation assay, DNA was mixed with loading dye and loaded directly onto a polyacrylamide gel. After gel electrophoresis using TBE buffer, the gels were visualized. For the T7 Endonuclease 1 (T7E1) assay, heteroduplexes were generated by denaturation of the PCR products at 95°C for 5 minutes and annealing by slow cooling to 4°C, and then, they were cleaved by the T7E1 by adding 0.5 to 1 pl of T7E1 (NEB) to the mix and by incubating the reaction at 37°C for 20 minutes. The reaction was stopped by adding 0.8 pl EDTA 500 mM and separated on a polyacrylamide gel.RNP preparation

[0225] The preparation of the RNP was made according to the provider protocol (IDT). TracrRNA and crRNA oligos were mixed in equimolar concentration to a final duplex concentration of 44 pM to form the guide RNA. The mix was heated at 95°C and cool downed to room temperature (RT). The duplex was combined to the Cas9 protein (IDT, 1081059) and incubated at room temperature (RT) 15 minutes to form the RNP (Cas9 + gRNA).In vitro validation of the RNPAfter PCR amplification of the sequence covering exon 2 of the goat P-casein gene from gDNA of wild type fibroblast or from a plasmid encoding the goat P-casein, 10 nM of the PCR product were incubated with 0.1 pM of RNP (10: 1 ratio) in lx Cas9 nuclease reaction buffer (200 mM hepes, 1 M NaCl, 50 mM MgC12, ImM EDTA pH 6.5) for 60 minutes at 37°C. The reaction was stopped by adding 20 pg of Proteinase K and the DNA substrate was released from the Cas9 endonuclease by incubating the mixture at 56°C for 10 minutes. Then, loading dye was added to the reaction and the mix was subsequently loaded on a 5% polyacrylamide gel.Generation of knock-in fibroblasts

[0226] Goat fibroblasts were transfected with the RNP#2 and a DNA template using the Neon™ Transfection System 100 pl kit (Thermofisher, MPK10096), according to the manufacturer protocol. After transfection, colonies were isolated and screened by PCR.

[0227] The following PCR were used for the screening: (i) 3 ’-junction PCR: primers within the transgene and downstream of the right homology arm (RHA) in the genomic locus; (ii) 5 ’-junction PCR: primers within the transgene and downstream of the left homology arm (LHA) in the genomic locus; and (iii) Transgene PCR: primers within the transgene.

[0228] Then, the correct knock-in was confirmed by Targeted Locus Amplification (TLA) by the subcontractor Cergentis.In cellulo validation of the RNP

[0229] To assess the efficiency in cellulo of the RNP, goat fibroblasts were transfected with the RNP or with 1, 5, 10, 20 pg of plasmid encoding the Cas9 and the gRNA using the Neon™ Transfection System (Thermofisher), according to the manufacturer protocol. After 2 days of culture for the cells transfected with the RNP and after 7-10 days of culture for the cells transfected with the plasmid, the genomic DNA of the cells was extracted, and the targeted sequence was amplified by PCR and subjected to T7E1 assay and gel retardation assay.Crystal Violet Viability Assay

[0230] After Neon transfection, 30 000 cells were seeded in a 96-wells plate. Twenty- four hours after seeding, the medium was removed, and the cells were washed with milliQ water. When the wells were dry, Crystal Violet 0.3% (5% Absolute Ethanol q.s. 200mL in milliQ water) was added for 30 minutes, then, removed and washed with milliQ water. The 96-wells plate was dried again 30 minutes and, the crystal violet was resolubilized in the wells by adding 10% Acetic Acid. The absorbance of each well was read at 595nm.Plasmid preparation

[0231] For the plasmids encoding the Cas9 and the gRNA, in the case of the comparison experiment between sgRNA#2 (SEQ ID NO: 1) and sgRNA#I (SEQ ID NO : 22), the designed sgRNAs were cloned into the CRISPR-Cas9 plasmid pRP[CRISPR]-EGFP- hCas9-U6 by the subcontractor Vector Builder.ResultsExample 1 : Comparison of the cleavage efficiency of 6 gRNA targeting the ATG of the goat beta-casein gene

[0232] The first validation of gRNA targeting the ATG of the goat beta-casein gene was performed by using plasmids encoding the Cas9 enzyme and the gRNA. Six gRNA (sgRNA3, sgRNA4, sgRNA5a, sgRNA#l, sgRNA#2, and sgRNA#3) were tested. Goat fibroblasts were transfected with the plasmids, and the gDNA of the transfected and nontransfected (ctrl) fibroblasts was extracted.

[0233] The cleavage of the targeted sequence was confirmed by gel retardation assay and T7E1 Assay (Figure 1). The amplification of the CSN2 exon 2 sequence results in a band at 659 bp, and the sizes of the expected cleaved products are 180 and 479 for sgRNA3, 181 and 478 for sgRNA4, 198 and 461 for sgRNA5a, 198 and 461 bp for gRNA#l, 200 and 459 for gRNA#2, and 219 and 440 for gRNA#3. A shift of -100 / 200 bp are always observed in the retardation and T7E1 assay due to the fact that polyacrylamide gels are more susceptible to base composition than agarose gel. Indeed, on the Figure 5, the same PCR product (CTRL- sample) shows a different migrationpattern on an agarose gel (Figure 5A, at 659 bp) compared to a migration at -950 bp on the polyacrylamide gel (Figure 5B). On Figure 1, the PCR product of the CSN2 exon 2 sequence is observable around 700 bp in each sample. The presence of retarded heteroduplex bands in the samples not treated with T7E1 suggested that the targeted sequence was cleaved (Figure 1).

[0234] Furthermore, the presence of two shorter bands at the expected sizes (indicated by the arrows on Figure 1), in the samples treated with the T7E1, confirms that Cas9 guided by the sgRNA3, #1, #2 and #3 has successfully introduced indel mutations at the targeted chromosomal site. No heteroduplex (without T7E1) nor shorter band (with T7E1) were observed in samples corresponding to the sgRNA 4 and sgRNA 5a. The 3 best gRNA (#1, #2 and #3) were selected for the following experiments.Example 2: Comparison of the Cas9 plasmid and Cas9 protein format

[0235] In order to improve the cell viability and the cleavage efficiency, and to reduce the potential off-target effect of the CRISPR-Cas9, another Cas9 format, the ribonucleoprotein (RNP) complex, consisting of Cas9 protein and guide RNA (gRNA), was compared to the plasmid format.

[0236] First, Cas9 combined to gRNA #1, #2 and #3 were validated in vitro by incubating the RNP with the amplified PCR product of the CSN2 exon 2 (Figure 2). The targeted sequence was correctly amplified (ctrl sample on Figure 2) and the presence of the 2 smaller fragments at the expected size confirms the cleavage of the targeted fragment by the 3 RNPs (RNP#1, #2 and #3 samples on Figure 2).

[0237] To compare the cell viability and the cleavage efficiency of the 2 Cas9 formats, goat fibroblasts were transfected using different voltages (1600, 1800 and 2000), different amount of Cas9 plasmid (1, 5, 10 or 20 pg) or one amount of RNP for the 3 gRNAs (#1, #2 and #3). The cell viability was assessed by observing the cells in culture (data not shown) and the cleavage efficiency by gel retardation assay and T7E1 assay (Figure 3A- 3C).

[0238] The viability of the cells was reduced using 10 and 20 pg of plasmid, and by transfecting the cells at 2000 V. Cells transfected with the RNP suffered less than the cells transfected with the plasmid. Heteroduplexes in the samples not treated with T7E1 and the presence of two shorter bands of predicted sizes (“cleaved fragments” on Figure 3A-C) in the samples treated with the T7E1, confirm that Cas9 guided by the gRNA #1, #2 and #3 has successfully introduced indel mutations at the targeted chromosomal site by using the RNP or 5, 10 and 20 pg of plasmids. By electrophoresis, no cleavage was observed using 1 pg of plasmid. Figure 3 shows that the cleavage is more efficient by using RNP and that a high amount of plasmids (10-20 pg) is required to obtain a similar effect. No difference was observed between the different voltages used.

[0239] As the cell viability and cleavage efficiency are higher using RNP, this technic was used in the following experiments.-casein locus bythe

[0240] gRNA#2 was selected for the knock-in experiments as its complementary sequence is disturbed by the insertion of the transgene into the targeted site preventing new editing post-insertion (cleavage of the DNA template or the knock-in).

[0241] Three knock-in experiments were performed for the insertion of 3 different transgenes into the exon 2 of the goat P-casein gene of fibroblasts isolated from 9 goat donors. For the 3 knock-in experiments, goat fibroblasts were transfected with the RNP#2 and a DNA template encoding the coding sequence of the protein of interest and flanked by homology arms for the Homologous Directed Repair (HDR). After transfection, the fibroblasts were cultivated, isolated, and screened by PCRs to select the clones with the correct knock-in. The clones showing amplification of a band at a correct size for the 3’- and 5 ’ -junction PCRs, and the transgene PCR were selected and further analyzed by TLA.

[0242] TLA validates the correct insertion of the transgene at the targeted site by allowing: (i) the sequencing of the transgene and the regions flanking its integration site, (ii) the detection of structural changes in host DNA at the transgene integration site(s) and within the transgene, and (iii) the detection of any single nucleotide variants within the transgene. Clones with correct knock-in were obtained for the 3 knock-in experimentsand PCR results of one experiment is shown as example on Figure 4.Example 4: Comparison of the in vitro cleavage efficiency of 3 gRNAs targeting the surrounding of the goat beta-casein exon 2

[0243] Fibroblasts were isolated from three different donors (F3C, GNF-4 and GNF-5) and expanded. gDNA was extracted from the fibroblasts, then the sequence surrounding CSN2 exon 2 was amplified by PCR using primers 16 & 27. The PCR amplicons were analyzed on agarose gel, and the band at 659 bp confirmed the correct amplification (Figure 5A).

[0244] To test the ability of the gRNA#16, 17 and 18 to guide the Cas9 on target, RNPs were generated with the duplexes (crRNA:TracrRNA) of each gRNA (gRNA#16, 17, 18 and 2), and named respectively : RNP#16, 17, 18 and RNP#2. In vitro, the PCR products previously analyzed were digested by the RNPs and analyzed on polyacrylamide gel (Figure 5B). The bands observed at the expected sizes (RNP#2 (200+459 bp), RNP#16 (242+414 bp), RNP#17 (399+206 bp) and RNP#18 (324+335 bp)) validate the cleavage efficiency of gRNA#16, 17 and 18 and confirmed the cleavage efficiency of the RNP#2.

[0245] As the RNP#18 cleaves the PCR products in the middle, the two fragments are superimposed on the polyacrylamide gel. In order to observe the 2 bands, four new PCRs were designed, and the amplifications were obtained (Figure 6A). The amplified products of the PCR 16-19, 16-28 and 26-27 were digested with the RNP#18, and fragments at the right size were observed at, 326+682 bp, 326+821 bp and 335+932 bp, respectively (Figure 6B).

[0246] These results confirm that the three designed gRNAs guide the Cas9 protein to the targeted site and induce the cleavage of this site.Example 5: Cleavage efficiency of RNP combination, in vitro

[0247] Another experiment was conducted to demonstrate that using two RNPs leads to the deletion of the sequence between the targeted sites. Furthermore, this experiment further confirmed the cleavage efficiency of the tested gRNAs. The CSN2 exon 2 surrounding sequence was amplified from gDNA of fibroblasts isolated from three donors(F3C, GNF-4 & GNF-5). These fragments were digested with a combination of RNP#16, 17 or 18 with or without RNP#2 (Figure 7). The analysis on polyacrylamide gel of the digested products shows bands at 417, 200 and 42pb for the combination: RNP#2 + RNP#16; 260, 200 and 199pb for RNP#2 + RNP#17; and at 335, 200 and 124pb for RNP#2 + RNP#18. These observations confirm that the three gRNAs (16, 17 and 18) guide the Cas9 protein to the targeted site and induce the cleavage of this site and suggest that RNP combination is able to remove the DNA sequence between the targeted sites. The gRNA# 16, #17 and #18 showed a similar cleavage efficiency, however, the gRNA#18 was selected for the following experiments as its targeted sequence is more conserved between specimens. Indeed, no single nucleotide polymorphism (SNP) was observed at this site for the fibroblast donors used in the different CRISPR experiments, compared to the sites targeted by the gRNA #16 and #17.of the

[0248] To assess the gRNA sequence specificity, three plasmids were generated: plasmid l with the native sequence of CSN2 exon 2 and its surrounding sequence; and clones 27 & 28 with a mutation in the targeted sequence of RNP#18 (substitution of 3 bases to generate a BspH I restriction enzyme site). The presence of the mutation in the clones 27 and 28 was confirmed by the digestion of the plasmids with the BspH I enzyme (Figure 8A).

[0249] Then, the cleavage efficiency of the RNP# 18 was assessed. The targeted sequence was amplified by PCR from the 3 plasmids (plasmid l, clone 27 and clone 28) and the PCR products were incubated with the RNP#18. The analysis on agarose gel shows that only the plasmid with native CSN2 sequence was digested by the RNP#18, suggesting that 1 substitution in the PAM sequence and 2 mutations in the seeding sequence are enough to prevent the activity of the RNP# 18 (Figure 8B).Example 7: Cleavage efficiency of RNP#2 and RNP# 18 combination, in cellulo

[0250] The RNP#18 was selected for the cleavage experiment in cellulo. Fibroblasts isolated from three goat donors (F3C, GNF-4 and GNF-5) were transfected with RNP#18, RNP#2 or both. After three days of culture, the genomic DNA of the cells was extracted,and the surrounding region of CSN2 exon 2 was amplified by PCR using primers 16 and 28 (amplicon of 1148 bp) for gDNA of F3C and primers 89 and 27 (amplicon of 2092 bp) for GNF-4 and GNF-5 (Figure 9). In the samples transfected with RNP#2 and RNP#18 a shift of the band of 124bp was observed (corresponding to the fragment cleaved by RNP#2 at one side and RNP#18 at the other side), confirming the cleavage at the expected position (Figure 9).

[0251] The condition with the RNP#18 was further analyzed. The cleavage efficiency of the Cas9 guided by the gRNA#18 was assessed by performing a T7E1 assay on the surrounding region of CSN2 exon 2 amplified by PCR from gDNA of the cells transfected with the RNP#18 (Figure 10). In the samples treated with the T7E1, the presence of bands at the expected size (F3C, 325bp + 823bp; GNF-4 and GNF-5, 1757bp+355bp) confirmed the cleavage of the heteroduplexes by the T7E1. This observation confirmed the introduction of indels at the targeted chromosome site and validated the efficiency of RNP#18 in cellulo. Again, in this experiment, a shift of the bands was observed as described previously, due to the sensibility of the polyacrylamide gel to the base composition of the fragments.efficiency of, and their on the cell viability when used in the format

[0252] Three types of primary goat fibroblasts were transfected with the RNP#2, the RNP#I and 4 different quantities (1, 5, 10 and 20 pg) of plasmid encoding the Cas9 and the sgRNA#2 or the gRNA#I (Figure 11). The cell viability of the fibroblasts after transfection was determined by a crystal violet staining (Figure 11 A). In the three types of primary goat fibroblasts tested, RNP induces significatively less cell death compared to plasmid. Furthermore, the RNP#2 induced statistically less cell death compared to the RNP#I (Figure 11B)

[0253] The observed difference in cell viability may be related to the off-target effect of Cas9 driven by the gRNA. Indeed, off target leads to more double strand breaks, that are known to induce cell death, and off targets may affect gene essential for cell viability. The off-targets of each guide were analysed by using the predictions tools Chopchop(https: / / chopchop.cbu.uib.no / ) and Crispor (http: / / crispor.tefor.net / ) (Figure 11B).According to Chopchop or Crispor, it has been observed that RNP#2 has less off targets than RNP#I.

[0254] The efficiency of the targeting of CSN2 exon2 by the RNP#2 / sgRNA#2 or RNP#I / sgRNA#I was then assessed by T7E1 assay. The experiment was performed in technical triplicate and with 3 different fibroblast donors (GNF-4, F5EB and F5745EB). The T7E1 assay was performed on PCR products of CSN2 exon 2 amplified from the DNA of the previous transfected fibroblast. The expected size of the cleaved products bands are, respectively for RNP#2 / sgRNA#2 and RNP#I / sgRNA#I, 200 / 459 and 221 / 438 bp. The results obtained show that using plasmid expressing Cas9 and sgRNA are less efficient than using RNP. The cleavage efficiency of the RNP#2 is similar to RNP#I, while inducing less cell death.

[0255] In conclusion, the guide RNA#2, in particular when combined with the use of RNPs compared to plasmid expressing CRISPR systems, is advantageous to target CSN2 exon 2 with Cas9, with fewer off-targets and a reduced effect on cell viability, especially for future applications that require healthy and young cells, such as nuclear transfer for cloning.

Claims

CLAIMS1. A guide RNA (gRNA) comprising a sequence having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition comprising said gRNA.

2. The gRNA according to claim 1, wherein said gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; or composition comprising said gRNA.

3. The gRNA according to claim 1, wherein said gRNA comprises a sequence having at least 90% sequence identity with nucleic acid sequence SEQ ID NO: 1; or composition comprising said gRNA.

4. The gRNA according to any one of claims 1 to 3, wherein said gRNA comprises or consists of sequence SEQ ID NO: 1; or composition comprising said gRNA.

5. The gRNA according to any one of claims 1 to 4, being a single-guide RNA (sgRNA); or composition comprising said gRNA.

6. A nucleic acid sequence encoding a gRNA according to any one of claims 1 to 5; or composition comprising said nucleic acid.

7. A vector comprising a nucleic acid sequence according to claim 6 operably linked to a suitable promoter; or composition comprising said vector.

8. A DNA targeting system characterized in that it comprises: a) a first regulatory element operable in a eukaryotic cell operably linked to at least one nucleotide sequence encoding a guide RNA (gRNA) having at least 90% sequence identity with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 21; in particular a CRISPR-Cas system guide RNA, andb) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein.

9. The DNA targeting system according to the preceding claim; further characterized in that: components (a) and (b) are located on same or different vectors of the system, whereby the guide RNA is capable of targeting exon 2 of beta-casein goat gene and the RNA-guided nuclease cleaves the DNA molecule.

10. A ribonucleoprotein (RNP), or composition comprising said RNP, comprising:- at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene, in particular at least one gRNA according to any one of claims 1 to 5, and- at least one RNA-guided nuclease, in particular a CRISPR endonuclease, more particularly a Type-II Cas protein, or a variant thereof, for example a Cas protein from the Cas protein family, preferably a Cas9 protein.

11. The guide RNA according to any of claims 1 to 5; or the nucleic acid according to claim 6; or the vector according to claim 7; or the DNA targeting system according to claims 8 or 9; or the ribonucleoprotein according to claim 10; for use as a medicament12. A method for altering expression, or editing, beta-casein / CSN2 gene in a cell, comprising: expressing in the cell at least one guide RNA (gRNA) according to any one of claims 1 to 5 and at least one RNA-guided nuclease, in particular at least one RNA- guided nuclease from the Cas protein family; or introducing at least one guide RNA (gRNA) targeting exon 2 of a beta-casein gene and at least one RNA-guided nuclease in the cell; orbringing into contact the at least one gRNA with the cell, in conditions where the cell is capable of expressing at least one RNA-guided nuclease and / or comprising the at least one RNA-guided nuclease; and optionally expressing in the cell a donor nucleic acid; or introducing in the cell a donor nucleic acid; or bringing into contact the donor nucleic acid sequence with the cell; the donor nucleic acid comprising a nucleic acid sequence of interest, in particular suitable for encoding a polypeptide of interest, and being capable of inserting the nucleotide sequence into the beta-casein / CSN2 gene via homologous recombination (HR) at a site of cleavage with the RNA-guided nuclease.

13. A modified cell obtained by the method according to claim 12.

14. A method for producing a recombinant polypeptide in a cell, comprising steps of: a) providing a modified cell according to claim 13, the cell being characterized in that the donor nucleic acid encodes a polypeptide of interest; b) recovering the polypeptide of interest from the cell.

15. A kit comprising:- the guide RNA according to any of claims 1 to 5; or- the nucleic acid according to claim 6; or- the vector according to claim 7; or- the DNA targeting system according to claims 8 or 9; or- the ribonucleoprotein according to claim 10.

Images