Method for producing deoxyribonucleoside triphosphate or ribonucleoside triphosphate

A cost-effective and time-efficient method using yeast and E. coli-derived enzymes with PEP in a single reaction vessel synthesizes dNTPs and NTPs, addressing the high costs and complexity of existing production methods.

WO2025183217A1PCT designated stage Publication Date: 2025-09-04YAMAGUCHI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/007325
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-29
Filing Date
2025-02-28
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

The production of deoxyribonucleoside triphosphates (dNTPs) and ribonucleoside triphosphates (NTPs) is costly due to expensive substrates and enzymes, and existing methods require complex reactions with long durations and oxygen-free conditions, making large-scale synthesis of DNA and RNA challenging.

Method used

A novel method using enzymes like ScADO1, ECADK, and ECpykF derived from yeast and E. coli, combined with phosphoenolpyruvate (PEP) in a single reaction vessel, to enzymatically synthesize dNTPs and NTPs at low cost and in a shorter time.

Benefits of technology

Enables the production of dNTPs and NTPs inexpensively and efficiently, reducing production time and costs by using enzymes extracted from yeast and E. coli without disrupting the bacteria or yeast cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000076_0000
    Figure 00000076_0000
  • Figure 00000076_0001
    Figure 00000076_0001
  • Figure 00000077_0000
    Figure 00000077_0000
Patent Text Reader

Abstract

The present invention addresses the problem of providing a novel method for synthesizing a deoxynucleoside triphosphate or nucleoside triphosphate. This method for synthesizing a deoxynucleoside triphosphate (dNTP) from a deoxyribonucleoside or synthesizing a ribonucleoside triphosphate (NTP) from a ribonucleoside is characterized by: adding, to a reaction vessel, (i) a deoxyribonucleoside or ribonucleoside as a starting material, (ii) a kinase capable of producing a deoxyribonucleoside monophosphate from the deoxyribonucleoside or a ribonucleoside monophosphate from the ribonucleoside, a kinase capable of producing a deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or a ribonucleoside diphosphate from the ribonucleoside monophosphate, and a pyruvate kinase as enzymes, and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and a phosphoenolpyruvic acid (PEP) as phosphoric acid donors, thereby adjusting a reaction solution; and reacting the same in one pot.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing deoxyribonucleoside triphosphate or ribonucleoside triphosphate

[0001] The present invention relates to a method for producing deoxyribonucleoside triphosphates or ribonucleoside triphosphates.

[0002] In recent years, the development of nucleic acid drugs and vaccines has progressed. The production of DNA and RNA used in these nucleic acid drugs requires deoxyribonucleoside triphosphates (hereinafter also referred to as "dNTPs"), including deoxyadenosine triphosphate (hereinafter also referred to as "dATP"), and ribonucleoside triphosphates (hereinafter also referred to as "NTPs"). For example, dATP can be produced by chemical synthesis or by synthesis from deoxyadenosine monophosphate (hereinafter also referred to as "dAMP") using microorganisms or yeast (see Patent Document 1). However, in both methods, the substrates and enzymes used in the reaction are expensive, and the reaction is complicated, so currently commercially available nucleotides are expensive. In particular, since a large amount of dATP is required to synthesize DNA or RNA in large quantities by PCR or the like, a method for synthesizing dATP at as low a cost as possible is desired.

[0003] Research into methods for synthesizing dATP or adenosine triphosphate (hereinafter also referred to as "ATP") from relatively inexpensive deoxyadenosine (hereinafter also referred to as "dAd") or adenosine (hereinafter also referred to as "Ad") has also been progressing (see Non-Patent Documents 1 and 2). However, there is room for improvement in practical application due to factors such as insufficient synthesis of dATP or ATP due to the influence of equilibrium, the need for a long reaction time under oxygen-free conditions, and the need to add acetate kinase immobilized on polyacrylamide gel 120 hours after the start of the reaction.

[0004] Furthermore, enzymes for synthesizing dATP or ATP have been expensive because they have been produced in bacteria or yeast and then purified, which has also contributed to the high production costs of dATP or ATP.

[0005] Furthermore, dATP, dGTP, dTTP, and dCTP are required for synthesizing large amounts of DNA by PCR or the like, and ATP, GTP, UTP, CTP, and the like are required for synthesizing large amounts of RNA by PCR or the like, but these are also expensive for the same reasons as dATP.

[0006] International Publication No. 1998 / 048031

[0007] Maryke Fehlau et al., Frontiers in Bioengineering and Biotechnology, August 2020 Volume 8 Article 854Richard L. Baughn, et al., J. Am. Chem. Soc. 1978, 100, 1, 304-306

[0008] An object of the present invention is to provide a novel method for synthesizing deoxyribonucleoside triphosphates or ribonucleoside triphosphates.

[0009] The present inventors conducted extensive research to solve the above-mentioned problems. First, they investigated the conversion of Ad to adenosine monophosphate (hereinafter also referred to as "AMP") and found that ScADO1, an adenosine kinase derived from yeast, could be used. Furthermore, the conversion of AMP to adenosine diphosphate (hereinafter also referred to as "ADP") was performed using ECADK, a phosphorylating enzyme (adenosine monophosphate kinase / adenylate kinase) derived from Escherichia coli, and the conversion of ADP to ATP was performed using ECpykF, a phosphorylating enzyme (pyruvate kinase) derived from Escherichia coli, with phosphoenolpyruvate (hereinafter also referred to as "PEP") as the substrate. Finally, they discovered a method for enzymatically synthesizing dATP or ATP from deoxyadenosine or adenosine at low cost by reacting the three enzymes ScADO1, ECADK, and ECpykF in a single reaction vessel using a single reaction solution. Furthermore, the inventors have found that enzymes derived from E. coli or yeast can be extracted from E. coli or yeast by a predetermined method, and the extract can be used as an enzyme solution as is, thereby completing the present invention.In addition, the inventors have found a method for enzymatically synthesizing dATP or ATP from deoxyadenosine or adenosine at low cost by using deoxyguanosine, deoxycytidine, or deoxythymidine instead of deoxyadenosine, using nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase as enzymes, and using phosphoenolpyruvate as a substrate for the reaction from dNDP to dNTP, and reacting them in the same reaction vessel.

[0010] That is, the present invention is as follows: [1] A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or synthesizing ribonucleoside triphosphate (NTP) from ribonucleosides, comprising, in a reaction vessel, (i) a deoxyribonucleoside or a ribonucleoside as a starting material; (ii) enzymes, a nucleoside kinase capable of producing deoxyribonucleoside monophosphate from the deoxyribonucleoside or ribonucleoside monophosphate from the ribonucleoside, a nucleoside monophosphate kinase capable of producing deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase; and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate, and phosphoenolpyruvic acid (PEP) as a phosphate donor are added to prepare a reaction solution, and the reaction is carried out in one pot. [2] The method according to [1] above, wherein the concentration ratio of phosphoenolpyruvic acid (PEP) to the deoxyribonucleoside or ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) in the reaction solution at the start of the reaction is 3.0 or more. [3] The method according to [1] or [2] above, wherein the concentration ratio of the deoxyribonucleoside triphosphate (dNTP) or ribonucleoside triphosphate (NTP) to the deoxyribonucleoside or ribonucleoside in the reaction solution at the start of the reaction (dNTP or NTP / deoxyribonucleoside or ribonucleoside) is 0.5 or less. [4] The method according to any one of [1] to [3] above, wherein the nucleoside kinase, the nucleoside monophosphate kinase, and the pyruvate kinase are derived from yeast or bacteria. [5] The method according to any one of [1] to [4] above, wherein the reaction time is 0.1 to 24 hours.[6] The method according to any one of [1] to [5] above, wherein the enzyme reaction solution obtained by extracting at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast expressing the enzyme comprises treating the bacteria or yeast with an enzyme extract, which is a 0.01 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hours to 4 days, and wherein the method does not include a step of disrupting or lysing the bacteria or yeast; characterized in that the enzyme reaction solution obtained by the method is used as the enzyme as is. [7] The method according to any one of [1] to [6] above, characterized in that deoxyadenosine or adenosine is used as a starting material, adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase are used as enzymes, the adenosine kinase is adenosine kinase derived from yeast, and the adenosine monophosphate kinase is adenosine kinase derived from yeast or bacteria. [8] A method for synthesizing deoxynucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate, or synthesizing ribonucleoside triphosphate (NTP) from ribonucleoside monophosphate, characterized in that a reaction solution is prepared by adding the following to a reaction vessel: (i) deoxyribonucleoside monophosphate or ribonucleoside monophosphate as a starting material; (ii) nucleoside monophosphate kinase capable of producing deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate, or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase as enzymes; and (iii) nucleoside triphosphate or deoxynucleoside triphosphate, and phosphoenolpyruvate (PEP) as phosphate donors; and the method is carried out in one pot.[9] The method according to [8] above, wherein the enzyme reaction solution obtained by extracting at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast expressing the enzyme comprises treating the bacteria or yeast with an enzyme extract, which is a 0.01 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hours to 4 days, and wherein the method does not include a step of disrupting or lysing the bacteria or yeast; characterized in that the enzyme reaction solution obtained by this method is used as the enzyme as is.

[0011] Other aspects of the present disclosure are as follows: [1] A method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine (dAd) or adenosine triphosphate (ATP) from adenosine (Ad), comprising: preparing a reaction solution by adding deoxyadenosine (dAd) or adenosine (Ad) as a starting material, adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase as enzymes, a nucleoside triphosphate or deoxynucleoside triphosphate as a phosphate donor, and phosphoenolpyruvate (PEP) into a reaction vessel, and carrying out a one-pot reaction. [2] The method according to [1] above, wherein the concentration ratio of phosphoenolpyruvate (PEP) to deoxyadenosine (dAd) or adenosine (Ad) (PEP / dAd or Ad) in the reaction solution at the start of the reaction is 3.0 or higher. [3] The method according to [1] or [2] above, wherein the concentration ratio of nucleoside triphosphate (NTP) or deoxynucleoside triphosphate (dNTP) to deoxyadenosine (dAd) or adenosine (Ad) in the reaction solution at the start of the reaction (dNTP or NTP / dAd or Ad) is 0.5 or less. [4] The method according to [1] or [2] above, wherein the adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase are derived from yeast or bacteria. [5] The method according to [1] or [2] above, wherein the adenosine kinase is an adenosine kinase derived from yeast. [6] The method according to [1] or [2] above, wherein the reaction time is 0.1 to 24 hours.[7] The method according to [1] or [2] above, wherein the enzyme reaction solution obtained by extracting at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast expressing the enzyme comprises treating the bacteria or yeast with an enzyme extract, which is a 0.01 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 4 to 95°C for 0.1 hours to 4 days, and wherein the method does not include a step of crushing or lysing the bacteria or yeast; characterized in that the enzyme reaction solution obtained by the method is used as the enzyme as is.

[0012] The method of the present invention for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside or synthesizing ribonucleoside triphosphate (NTP) from ribonucleoside makes it possible to produce deoxyribonucleoside triphosphate or ribonucleoside triphosphate inexpensively and in a short time.

[0013] FIG. 1 shows the results of confirming enzyme extraction by SDS-PAGE in Example 1. FIG. 2 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 1. FIG. 3 shows the results of SDS-PAGE of the enzyme reaction solution obtained in Example 2. FIG. 4 shows the results of SDS-PAGE of the enzyme reaction solution obtained in Example 3. FIG. 5 shows an outline of the reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP) in Example 4. FIG. 6 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 4. FIG. 7 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 5. FIG. 8 shows the results of examining the dATP concentration in a dATP solution reacted for 1 hour or 24 hours with 60 mM PEP in Example 5. FIG. 9 shows the results of examining the dATP concentration in a dATP solution reacted for 1 hour or 24 hours with 90 mM PEP in Example 5. FIG. 10 shows the results of confirming enzyme extraction by SDS-PAGE in Example 6. FIG. 11 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 7. FIG. 12 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 7. FIG. 13 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 7. FIG. 14 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 7. FIG. 15 shows the results of confirming enzyme extraction by SDS-PAGE in Example 8. FIG. 16 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 8. FIG. 17 shows the results of confirming enzyme extraction by SDS-PAGE in Example 9. FIG. 18 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 10. FIG. 19 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 10. Fig. 20 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 10. Fig. 21 shows the results of confirming PCR amplification products by agarose electrophoresis in Example 10.

[0014] The method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or ribonucleoside triphosphate (NTP) from ribonucleosides described herein comprises placing, in a reaction vessel, (i) a deoxyribonucleoside or a ribonucleoside as a starting material; (ii) enzymes, a nucleoside kinase capable of generating deoxyribonucleoside monophosphate from the deoxyribonucleoside or ribonucleoside monophosphate from the ribonucleoside, a nucleoside monophosphate kinase capable of generating deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase; and (iii) preparing a reaction solution by adding a nucleoside triphosphate or a deoxynucleoside triphosphate as a phosphate donor, and phosphoenolpyruvate (PEP); and carrying out a one-pot reaction. The method is not particularly limited as long as it is characterized in that the method is hereinafter also referred to as "method 1 for synthesizing the dNTP or NTP of the present invention."

[0015] Furthermore, a method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate or synthesizing ribonucleoside triphosphate (NTP) from ribonucleoside monophosphate in the present specification includes placing, in a reaction vessel, (i) deoxyribonucleoside monophosphate or ribonucleoside monophosphate as a starting material; (ii) as enzymes, nucleoside monophosphate kinase capable of producing deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase; and (iii) nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors; There are no particular limitations on the method as long as it is characterized in that a reaction solution is prepared by adding the above and reacting in one pot, and hereinafter this method is also referred to as "method 2 of synthesizing the dNTP or NTP of the present invention." Note that hereinafter, "method 1 of synthesizing the dNTP or NTP of the present invention" and "method 2 of synthesizing the dNTP or NTP of the present invention" will also be collectively referred to simply as "method of synthesizing the dNTP or NTP of the present invention."

[0016] As used herein, deoxyribonucleosides include deoxyadenosine (dAd), deoxyguanosine (dGua), deoxythymidine (dThy), and deoxycytidine (dCyt). As used herein, deoxyribonucleoside monophosphates include deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP), and deoxycytidine monophosphate (dCMP). As used herein, deoxyribonucleoside diphosphates include deoxyadenosine diphosphate (dADP), deoxyguanosine diphosphate (dGDP), deoxythymidine diphosphate (dTDP), and deoxycytidine diphosphate (dCDP). As used herein, deoxyribonucleoside triphosphate (dNTP) may include deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), or deoxycytidine triphosphate (dCTP).

[0017] As used herein, ribonucleosides include adenosine (Ad), guanosine (Gua), 5'-methyluridine (m5Uri), uridine (Uri), and cytidine (Cyt). As used herein, ribonucleoside monophosphates include adenosine monophosphate (AMP), guanosine monophosphate (GMP), 5'-methyluridine monophosphate (m5UMP), uridine monophosphate (UMP), and cytidine monophosphate (CMP). As used herein, ribonucleoside diphosphates include adenosine diphosphate (ADP), guanosine diphosphate (GDP), 5'-methyluridine diphosphate (m5UDP), uridine diphosphate (UDP), and cytidine diphosphate (CDP). As used herein, ribonucleoside triphosphate (NTP) may include adenosine triphosphate (ATP), guanosine triphosphate (GTP), 5'-methyluridine triphosphate (m5UTP), uridine triphosphate (UTP), or cytidine monotriphosphate (CTP).

[0018] In the present specification, the method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine (dAd) or adenosine triphosphate (ATP) from adenosine (Ad) comprises adding deoxyadenosine (dAd) or adenosine (Ad) as a starting material, adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize dATP or ATP, which will hereinafter also be referred to as "the present dATP or ATP synthesis method 1."

[0019] In the present specification, the method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine monophosphate (dAMP) or adenosine triphosphate (ATP) from adenosine (AMP) involves adding deoxyadenosine monophosphate (dAMP) or adenosine monophosphate (AMP) as starting materials, adenosine monophosphate kinase and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then allowing the reaction to proceed in one pot to synthesize dATP or ATP, which will hereinafter also be referred to as "present dATP or ATP synthesis method 2." Hereinafter, "present dATP or ATP synthesis method 1" and "present dATP or ATP synthesis method 2" will also be collectively referred to simply as "present dATP or ATP synthesis method."

[0020] In the present specification, the method for synthesizing deoxyguanosine triphosphate (dGTP) from deoxyguanosine (dGua) or guanosine triphosphate (GTP) from guanosine (Gua) involves adding deoxyguanosine (dGua) or guanosine (Gua) as a starting material, guanosine kinase, guanosine monophosphate kinase, and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize dGTP or GTP, which will hereinafter also be referred to as "the present dGTP or GTP synthesis method 1."

[0021] In the present specification, the method for synthesizing deoxyguanosine triphosphate (dGTP) from deoxyguanosine monophosphate (dGMP) or guanosine triphosphate (GTP) from guanosine monophosphate (GMP) involves adding deoxyguanosine monophosphate (dGMP) or guanosine monophosphate (GMP) as starting materials, guanosine monophosphate kinase and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then allowing the reaction to proceed in one pot to synthesize dGTP or GTP, which will hereinafter also be referred to as "the present dGTP or GTP synthesis method 2." Hereinafter, "the present dGTP or GTP synthesis method 1" and "the present dGTP or GTP synthesis method 2" will also be collectively referred to simply as "the present dGTP or GTP synthesis method."

[0022] In the present specification, the method for synthesizing deoxythymidine triphosphate (dTTP) from deoxythymidine (dThy) involves adding deoxythymidine (dThy) as a starting material, deoxythymidine kinase, deoxythymidine monophosphate kinase, and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize dTTP, which will hereinafter also be referred to as "the present dTTP synthesis method 1."

[0023] In the present specification, the method for synthesizing deoxythymidine triphosphate (dTTP) from deoxythymidine monophosphate (dTMP) involves adding deoxythymidine monophosphate (dTMP) as a starting material, deoxythymidine monophosphate kinase and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize dTTP, which will hereinafter also be referred to as "Present dTTP Synthesis Method 2." Hereinafter, "Present dTTP Synthesis Method 1" and "Present dTTP Synthesis Method 2" will also be collectively referred to simply as "Present dTTP Synthesis Method."

[0024] In the present specification, the method for synthesizing 5-methyluridine triphosphate (m5UTP) from 5-methyluridine (m5Uri) or the method for synthesizing uridine triphosphate (UTP) from uridine (Uri) comprises adding 5-methyluridine (m5Uri) or uridine (Uri) as a starting material, uridine kinase, uridine monophosphate kinase, and pyruvate kinase as enzymes, and a nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize m5UTP or UTP, which will hereinafter also be referred to as "the present method 1 for synthesizing m5UTP or UTP."

[0025] In the present specification, the method for synthesizing 5-methyluridine triphosphate (m5UTP) from 5-methyluridine monophosphate (m5UMP) or the method for synthesizing uridine triphosphate (UTP) from uridine monophosphate (UMP) involves adding 5-methyluridine monophosphate (m5UMP) or uridine monophosphate (UMP) as a starting material, uridine monophosphate kinase and pyruvate kinase as enzymes, and a nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize m5UTP or UP, and this method is hereinafter also referred to as "the present method 2 for synthesizing m5UTP or UTP." Hereinafter, "method 1 for synthesizing m5UTP or UTP of the present invention" and "method 2 for synthesizing m5UTP or UTP of the present invention" will be collectively referred to simply as "method for synthesizing m5UTP or UTP of the present invention."

[0026] In the present specification, the method for synthesizing deoxycytidine triphosphate (dCTP) from deoxycytidine (dCyt) or cytidine triphosphate (CTP) from cytidine (Cyt) involves adding deoxycytidine (dCyt) or cytidine (Cyt) as a starting material, cytidine kinase, cytidine monophosphate kinase, and pyruvate kinase as enzymes, and nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors to a reaction vessel to prepare a reaction solution, and then carrying out a one-pot reaction to synthesize dCTP or CTP, which will hereinafter also be referred to as "the present dCTP or CTP synthesis method 1."

[0027] In the present specification, the method for synthesizing deoxycytidine triphosphate (dCTP) from deoxycytidine monophosphate (dCMP) or synthesizing cytidine triphosphate (CTP) from cytidine monophosphate (CMP) involves adding deoxycytidine monophosphate (dCMP) or cytidine monophosphate (CMP) as a starting material, cytidine monophosphate kinase and pyruvate kinase as enzymes, nucleoside triphosphate or deoxynucleoside triphosphate as a phosphate donor, and phosphoenolpyruvate (PEP) to a reaction vessel to prepare a reaction solution, and then reacting in one pot to synthesize dCTP or CTP, which will hereinafter also be referred to as "method 2 for synthesizing dCTP or CTP of the present invention." Note that, hereinafter, "method 1 for synthesizing dCTP or CTP of the present invention" and "method 2 for synthesizing dCTP or CTP of the present invention" will also be collectively referred to simply as "method for synthesizing dCTP or CTP of the present invention."

[0028] The subject dNTP or NTP synthesis method is a term used to describe the subject dATP or ATP synthesis method, the subject dGTP or GTP synthesis method, the subject dTTP synthesis method, the subject m5UTP or UTP synthesis method, or the subject dCTP or CTP synthesis method.

[0029] (Enzyme) In the present specification, examples of nucleoside kinases capable of producing deoxyribonucleoside monophosphate from deoxyribonucleosides or ribonucleoside monophosphate from ribonucleosides include deoxynucleoside kinases such as deoxyadenosine kinase, deoxyguanosine kinase, deoxythymidine kinase, and deoxycytidine kinase, and nucleoside kinases such as adenosine kinase, guanosine kinase, uridine kinase, and cytidine kinase. Furthermore, examples of nucleoside monophosphate kinases capable of producing deoxyribonucleoside diphosphate from deoxyribonucleoside monophosphate or ribonucleoside diphosphate from ribonucleoside monophosphate include deoxynucleoside monophosphate kinases such as deoxyadenosine monophosphate kinase, deoxyguanosine monophosphate kinase, deoxythymidine monophosphate kinase, and deoxycytidine monophosphate kinase, as well as nucleoside monophosphate kinases such as adenosine monophosphate kinase, guanosine monophosphate kinase, uridine monophosphate kinase, and cytidine monophosphate kinase.

[0030] In the present dATP or ATP synthesis method 1, deoxyadenosine kinase or adenosine kinase is used as the enzyme for the reaction from dAd to dAMP or from Ad to AMP. As used herein, deoxyadenosine kinase or adenosine kinase refers to an enzyme (e.g., EC 2.7.1.20, EC 2.7.1.76, EC 2.7.1.145) that uses dATP or ATP as a phosphate source and catalyzes the phosphorylation of deoxyadenosine to dAMP or the phosphorylation of adenosine to AMP. The deoxyadenosine kinase or adenosine kinase is not particularly limited, and known enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxyadenosine kinase or adenosine kinase derived from yeast or bacteria is preferred, and deoxyadenosine kinase or adenosine kinase derived from yeast is more preferred. Examples of yeast-derived deoxyadenosine kinase or adenosine kinase include a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1, or an amino acid sequence in which one or several amino acids have been deleted, substituted, or added in the amino acid sequence set forth in SEQ ID NO: 1, and which has the above-mentioned deoxyadenosine kinase or adenosine kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, and which has deoxyadenosine kinase or adenosine kinase activity. The yeast-derived deoxyadenosine kinase or adenosine kinase polypeptide consisting of the yeast-derived amino acid sequence set forth in SEQ ID NO: 1 is known as ADO1 (Patricia Barrado et al., Yeast 2003; 20: 1145-1150). Furthermore, as long as the reaction from dAd to dAMP is possible, either deoxyadenosine kinase or adenosine kinase may be used in this reaction. Similarly, either deoxyadenosine kinase or adenosine kinase may be used in this reaction, so long as the reaction from Ad to AMP is possible.

[0031] In the present dGTP or GTP synthesis method 1, deoxyguanosine kinase or guanosine kinase is used as the enzyme for the reaction from dGua to dGMP or from Gua to GMP. As used herein, deoxyguanosine kinase or guanosine kinase refers to an enzyme (e.g., EC 2.7.1.73, EC 2.7.1.113) that uses dGTP, GTP, ATP, or the like as a phosphate source to catalyze the phosphorylation of deoxyguanosine to dGMP or the phosphorylation of guanosine to GMP. The deoxyguanosine kinase or guanosine kinase is not particularly limited, and known enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxyguanosine kinase or guanosine kinase derived from yeast or bacteria is preferred, and deoxyguanosine kinase or guanosine kinase derived from bacteria is more preferred. Examples of bacterial deoxyguanosine kinases or guanosine kinases include polypeptides consisting of the amino acid sequence set forth in SEQ ID NO: 17, or polypeptides consisting of the amino acid sequence set forth in SEQ ID NO: 17 with one or several amino acids deleted, substituted, or added, and having the above-mentioned deoxyguanosine kinase or guanosine kinase activity, and polypeptides consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 17 and having deoxyguanosine kinase or guanosine kinase activity. Among bacterial deoxyguanosine kinases or guanosine kinases, the bacterial polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 17 is known as gsk. Furthermore, as long as the reaction from dGua to dGMP is possible, either deoxyguanosine kinase or guanosine kinase may be used in this reaction. Similarly, as long as the reaction from Gua to GMP is possible, either deoxyguanosine kinase or guanosine kinase may be used in this reaction.

[0032] In the present dTTP synthesis method 1, deoxythymidine kinase is used as the enzyme for the reaction from dThy to dTMP. As used herein, deoxythymidine kinase refers to an enzyme (e.g., EC 2.7.1.21) that catalyzes the phosphorylation of deoxythymidine to dTMP using dTTP, ATP, or the like as a phosphate source. This deoxythymidine kinase is not particularly limited, and known enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxythymidine kinase derived from yeast or bacteria is preferred, and deoxythymidine kinase derived from bacteria is more preferred. Examples of bacterial deoxythymidine kinases include a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 18, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 18 in which one or several amino acids have been deleted, substituted, or added, and which has the above-mentioned deoxythymidine kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 18 and which has deoxythymidine kinase activity. Note that, as a bacterial deoxythymidine kinase, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 18 is known as tdk.

[0033] In the present m5UTP or UTP synthesis method 1, uridine kinase or cytidine kinase is used as the enzyme in the reaction from 5'-methyluridine (m5Uri) to m5UMP or the reaction from uridine (Uri) to UMP. As used herein, uridine kinase refers to an enzyme (e.g., EC 2.7.1.48) that catalyzes the phosphorylation of 5'-methyluridine (m5Uri) or uridine (Uri) to m5UMP or UMP using UTP, ATP, or the like as a phosphate source. The uridine kinase or cytidine kinase is not particularly limited, and known enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, uridine kinase or cytidine kinase derived from yeast or bacteria is preferred, and bacterial uridine kinase or cytidine kinase is more preferred. Examples of bacterial uridine kinase or cytidine kinase include a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19, or a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19 in which one or several amino acids have been deleted, substituted, or added, and which has uridine kinase or cytidine kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 19, and which has uridine kinase or cytidine kinase activity. Note that the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19 is known as udk as a bacterial uridine kinase or cytidine kinase.

[0034] In the present dCTP or CTP synthesis method 1, deoxycytidine kinase or cytidine kinase is used as the enzyme for the reaction from dCyt to dCMP or from Cyt to CMP. As used herein, deoxycytidine kinase or cytidine kinase refers to an enzyme (e.g., EC 2.7.1.48, EC 2.7.1.74, or EC 2.7.1.213) that catalyzes the phosphorylation of deoxycytidine to dCMP or the phosphorylation of cytidine to CMP using dCTP or CTP, ATP, or the like as a phosphate source. The deoxycytidine kinase or cytidine kinase is not particularly limited, and known enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxycytidine kinase or cytidine kinase derived from yeast or bacteria is preferred, and deoxycytidine kinase or cytidine kinase derived from bacteria is more preferred. Examples of bacterial deoxycytidine kinase or cytidine kinase include a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19, or a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19 in which one or several amino acids have been deleted, substituted, or added, and having the above-mentioned deoxycytidine kinase or cytidine kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 19 and having deoxycytidine kinase or cytidine kinase activity. Among bacterial deoxycytidine kinases or cytidine kinases, the bacterial polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 19 is known as udk. Furthermore, as long as the reaction from dCyt to dCMP is possible, either deoxycytidine kinase or cytidine kinase may be used in this reaction. Similarly, as long as the reaction from Cyt to CMP is possible, either deoxycytidine kinase or cytidine kinase may be used in this reaction.

[0035] The above-mentioned "amino acid sequence in which one or several amino acids are deleted, substituted or added" means an amino acid sequence in which any number of amino acids are deleted, substituted or added, for example, 1 to 20, preferably 1 to 10, more preferably 1 to 3, even more preferably 1 or 2, and most preferably 1.

[0036] In the present method for synthesizing dATP or ATP, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase is used as an enzyme in the reaction from dAMP to dADP or from AMP to ADP. Deoxyadenosine monophosphate kinase or adenosine monophosphate kinase is an enzyme (e.g., EC 2.7.4.3, EC 2.7.4.11) that uses dATP or ATP, etc., as a phosphate source and catalyzes the phosphorylation of dAMP to dADP or the phosphorylation of AMP to ADP, and is also called adenylate kinase or adenylate kinase (ADK). The origin of this deoxyadenosine monophosphate kinase or adenosine monophosphate kinase is not particularly limited, and known enzymes such as those derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase derived from yeast or bacteria is preferred, and deoxyadenosine monophosphate kinase or adenosine monophosphate kinase derived from bacteria, preferably from Gram-negative bacteria, more preferably from Escherichia coli, can be mentioned. Examples of deoxyadenosine monophosphate kinase or adenosine monophosphate kinase derived from Escherichia coli include a polypeptide (adk) consisting of the amino acid sequence set forth in SEQ ID NO: 2, or a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 with one or several amino acids deleted, substituted, or added, and having the above-mentioned deoxyadenosine monophosphate kinase or adenosine monophosphate kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 and having deoxyadenosine monophosphate kinase or adenosine monophosphate kinase activity. In addition, as long as the reaction from dAMP to dADP is possible, either deoxyadenosine monophosphate kinase or adenosine monophosphate kinase may be used in this reaction. Similarly, as long as the reaction from AMP to ADP is possible, either deoxyadenosine monophosphate kinase or adenosine monophosphate kinase may be used in this reaction.

[0037] In the present method for synthesizing dGTP or GTP, deoxyguanosine monophosphate kinase or guanosine monophosphate kinase is used as an enzyme in the reaction from dGMP to dGDP or from GMP to GDP. Deoxyguanosine monophosphate kinase or guanosine monophosphate kinase is an enzyme (e.g., EC 2.7.4.8) that catalyzes the phosphorylation of dGMP to dGDP or the phosphorylation of GMP to GDP using dGTP, GTP, ATP, or the like as a phosphate source, and is also called guanylate kinase or guanylate kinase (GMK). The origin of this deoxyguanosine monophosphate kinase or guanosine monophosphate kinase is not particularly limited, and known enzymes such as enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxyguanosine monophosphate kinase or guanosine monophosphate kinase derived from yeast or bacteria is preferred, and examples thereof include deoxyguanosine monophosphate kinase or guanosine monophosphate kinase derived from bacteria, preferably from Gram-negative bacteria, more preferably from Escherichia coli. Examples of deoxyguanosine monophosphate kinase or guanosine monophosphate kinase derived from Escherichia coli include a polypeptide (gmk) consisting of the amino acid sequence set forth in SEQ ID NO: 13, or a polypeptide consisting of an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence set forth in SEQ ID NO: 13 and having the above-mentioned deoxyguanosine monophosphate kinase or guanosine monophosphate kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 13 and having deoxyguanosine monophosphate kinase or guanosine monophosphate kinase activity. Furthermore, as long as the reaction from dGMP to dGDP is possible, either deoxyguanosine monophosphate kinase or guanosine monophosphate kinase may be used in this reaction. Similarly, as long as the reaction from GMP to GDP is possible, either deoxyguanosine monophosphate kinase or guanosine monophosphate kinase may be used in this reaction.

[0038] In the present method for synthesizing dTTP, deoxythymidine monophosphate kinase is used as an enzyme in the reaction from dTMP to dTDP. Deoxythymidine monophosphate kinase is an enzyme (EC 2.7.4.9) that catalyzes the phosphorylation of dTMP to dTDP using dTTP, ATP, or the like as a phosphate source, and is also called thymidylate kinase or thymidylate kinase (TMK). The origin of this deoxythymidine monophosphate kinase is not particularly limited, and known enzymes such as enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, deoxythymidine monophosphate kinase derived from yeast or bacteria is preferred, and deoxythymidine monophosphate kinase derived from bacteria, preferably from gram-negative bacteria, more preferably from Escherichia coli, can be used. Examples of deoxythymidine monophosphate kinase derived from Escherichia coli include a polypeptide (tmk) consisting of the amino acid sequence shown in SEQ ID NO: 14, a polypeptide consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 14 and having the above-mentioned deoxythymidine monophosphate kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 14 and having deoxythymidine monophosphate kinase activity.

[0039] In the present method for synthesizing m5UTP or UTP, uridine monophosphate kinase is used as an enzyme in the reaction from m5UMP to m5UDP or from UMP to UDP. Uridine monophosphate kinase is an enzyme (EC 2.7.4.22) that catalyzes the phosphorylation of m5UMP to m5UDP or the phosphorylation of UMP to UDP using UTP, ATP, or the like as a phosphate source, and is also called uridylate kinase or uridylate kinase (UMK). The origin of this uridine monophosphate kinase is not particularly limited, and known enzymes such as enzymes derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, uridine monophosphate kinase derived from yeast or bacteria is preferred, and examples thereof include uridine monophosphate kinase derived from bacteria, preferably from Gram-negative bacteria, and more preferably from Escherichia coli.

[0040] In the present method for synthesizing dCTP or CTP, deoxycytidine monophosphate kinase or cytidine monophosphate kinase is used as an enzyme in the reaction from dCMP to dCDP or from CMP to CDP. Deoxycytidine monophosphate kinase or cytidine monophosphate kinase is an enzyme (EC 2.7.4.14, EC 2.7.4.25) that catalyzes the phosphorylation of dCMP to dCDP or CMP to CDP using dCTP or CTP, ATP, or the like as a phosphate source, and is also called cytidylate kinase or cytidylate kinase (cmk). The origin of this deoxycytidine monophosphate kinase or thymidine monophosphate kinase is not particularly limited, and known enzymes such as those derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used, although deoxycytidine monophosphate kinase or cytidine monophosphate kinase derived from yeast or bacteria is preferred, and examples thereof include deoxycytidine monophosphate kinase or cytidine monophosphate kinase derived from bacteria, preferably from Gram-negative bacteria, more preferably from Escherichia coli. Examples of deoxycytidine monophosphate kinase or cytidine monophosphate kinase derived from Escherichia coli include a polypeptide (cmk) consisting of the amino acid sequence set forth in SEQ ID NO: 12, or a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 12 in which one or several amino acids have been deleted, substituted, or added, and which has deoxycytidine monophosphate kinase or cytidine monophosphate kinase activity, or a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 12 and which has deoxycytidine monophosphate kinase or cytidine monophosphate kinase activity. In addition, as long as the reaction from dCMP to dCDP is possible, either deoxycytidine monophosphate kinase or cytidine monophosphate kinase may be used in this reaction. Similarly, as long as the reaction from CMP to CDP is possible, either deoxycytidine monophosphate kinase or cytidine monophosphate kinase may be used in this reaction.

[0041] In the present method for synthesizing dNTP or NTP, pyruvate kinase is used as an enzyme in (1) the reaction from dADP to dATP or from ADP to ATP, (2) the reaction from dGDP to dGTP or from GDP to GTP, (3) the reaction from dTDP to dTTP, (4) the reaction from m5UDP to m5UTP or from UDP to UTP, or (5) the reaction from dCDP to dCTP or from CDP to CTP. Pyruvate kinase is an enzyme that uses phosphoenolpyruvate (PEP) as a phosphate source and catalyzes the phosphorylation of deoxyadenosine diphosphate (dADP), deoxyguanosine diphosphate (dGDP), deoxythymidine diphosphate (dTDP), or deoxycytidine diphosphate (dCDP), or the phosphorylation of adenosine diphosphate (ADP), guanosine diphosphate (GDP), 5'-methyluridine diphosphate (m5UDP), uridine diphosphate (UDP), or cytidine diphosphate (CDP), thereby producing one molecule of pyruvate and one molecule of dATP, dGTP, dTTP, or dCTP, or ATP, GTP, m5UTP, UTP, or CTP, respectively (EC 2.7.1.40). The origin of this pyruvate kinase is not particularly limited, and known enzymes, such as those derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, pyruvate kinase derived from yeast or bacteria is preferred, and examples thereof include pyruvate kinase derived from bacteria, preferably from Gram-negative bacteria, and more preferably from Escherichia coli. Examples of pyruvate kinase derived from Escherichia coli include a polypeptide (PykA) consisting of the amino acid sequence set forth in SEQ ID NO: 3 and a polypeptide (PykF) consisting of the amino acid sequence set forth in SEQ ID NO: 4. Further examples include polypeptides having pyruvate kinase activity and consisting of an amino acid sequence with one or more amino acids deleted, substituted, or added in the amino acid sequence set forth in SEQ ID NO: 3 or 4, and polypeptides having pyruvate kinase activity and consisting of an amino acid sequence with 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 or 4.Furthermore, examples of yeast-derived pyruvate kinase include a polypeptide (CDC19) consisting of the amino acid sequence shown in SEQ ID NO: 5, a polypeptide consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 5 and having pyruvate kinase activity, and a polypeptide consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 5 and having pyruvate kinase activity.

[0042] The amino acid sequences and nucleotide sequences of the above kinases can be obtained from the database of the National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov / ) and the like.

[0043] Whether or not each kinase has activity can be evaluated by, for example, reacting the kinase with a substrate and confirming whether or not a reaction product is produced, as shown in the Examples below.

[0044] It is also possible to use nucleoside diphosphate kinase (NDPK), such as adenosine diphosphate (ADP) kinase, for the reaction from dADP to dATP or ADP to ATP. However, depending on the enzyme used, the reaction may stop at equilibrium due to the concentration equilibrium between dADP and dATP or ADP and ATP, making it difficult for the reaction to progress to a state where the concentration of dATP or ATP is high. Furthermore, even if the reaction is allowed to proceed for a long time, the concentration of dATP or ATP cannot be increased. On the other hand, unlike NDPK, by using pyruvate kinase, which uses PEP as a substrate, the reverse reaction does not proceed, and the reaction proceeds in the direction of synthesizing dATP or ATP until PEP is almost depleted. From this perspective, it is preferable to use a kinase that does not cause the reaction from dATP to dADP or from ATP to ADP in the present dATP or ATP synthesis method, and pyruvate kinase was adopted. In the case of the reaction from dGDP to dGTP or GDP to GTP, the reaction from dTDP to dTTP, the reaction from m5UDP to UTP or UDP to UTP, and the reaction from dCDP to dCTP or CDP to CTP, it is also possible to use a nucleoside diphosphate kinase (NDPK), such as guanosine diphosphate kinase, thymidine diphosphate kinase, cytidine diphosphate kinase, etc. However, from the same viewpoint as above, it is preferable to use a kinase that does not cause the reaction from dGTP to dGDP or GTP to GDP, the reaction from dTTP to dTDP, the reaction from m5UTP to m5UDP or UTP to UDP, the reaction from dCTP to dCDP, or the reaction from CTP to CDP, and pyruvate kinase was adopted.

[0045] In the present dNTP or NTP synthesis method, the reaction solution may contain other kinases, but it is preferable to contain as few other kinases as possible, such as nucleoside diphosphate kinase (NDPK) and acetate kinase, from the viewpoint of reducing costs and improving yields, and even if other kinases are contained, the concentration can be 0.1 mg / mL or less, preferably 0.05 mg / mL or less, more preferably 0.02 mg / mL or less, and more preferably 0 mM. In particular, when NDPK is used, for example, in the case of the present dATP or ATP synthesis method, when an equilibrium state is reached between dADP and dATP or ADP and ATP, the reaction to dATP or ATP does not proceed, and the yield decreases.

[0046] In the present method for synthesizing dATP or ATP, the combination of deoxyadenosine kinase or adenosine kinase, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and pyruvate kinase is not particularly limited in origin, and known enzymes such as those derived from yeast, bacteria, or mammals, as well as commercially available enzymes, can be used. However, it is preferable that all kinases are derived from yeast or bacteria, and that Drosophila-derived kinases are not included. Alternatively, one kinase may be derived from yeast and the other kinases may be derived from bacteria. Alternatively, deoxyadenosine kinase or adenosine kinase may be derived from yeast, and deoxyadenosine monophosphate kinase or adenosine monophosphate kinase and pyruvate kinase may be derived from Escherichia coli. When multiple enzymes are mixed and reacted in one pot, it is generally preferable to use kinases of the same origin from the standpoint of adjusting the pH and composition of the reaction solution and enzymatic activity. However, kinases of different origins may be used as long as the kinase activity can be maintained by adjusting the pH and composition of the reaction solution and enzymatic activity. The same applies to the combination of deoxyguanosine kinase or guanosine kinase, deoxyguanosine monophosphate kinase or guanosine monophosphate kinase, and pyruvate kinase origins in the present method for synthesizing dGTP or GTP, the combination of deoxythymidine kinase, deoxythymidine monophosphate kinase, and pyruvate kinase origins in the present method for synthesizing dTTP, the combination of uridine kinase, uridine monophosphate kinase, and pyruvate kinase origins in the present method for synthesizing m5UTP or UTP, and the combination of deoxycytidine kinase or cytidine kinase, deoxycytidine monophosphate kinase or cytidine monophosphate kinase, and pyruvate kinase origins in the present method for synthesizing dCTP or CTP.

[0047] In the present method for synthesizing dATP or ATP, the amounts of deoxyadenosine kinase or adenosine kinase, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and pyruvate kinase contained in the reaction solution can be appropriately adjusted depending on the concentration of the starting material, deoxyadenosine (dAd) or adenosine (Ad), and the activity of each enzyme. The same applies to the amounts of deoxyguanosine kinase or guanosine kinase, deoxyguanosine monophosphate kinase or guanosine monophosphate kinase, and pyruvate kinase in the present method for synthesizing dGTP or GTP, the amounts of deoxythymidine kinase or thymidine kinase, deoxythymidine monophosphate kinase or thymidine monophosphate kinase, and pyruvate kinase in the present method for synthesizing dTTP, the amounts of uridine kinase, uridine monophosphate kinase, and pyruvate kinase in the present method for synthesizing m5UTP or UTP, and the amounts of deoxycytidine kinase or cytidine kinase, deoxycytidine kinase or cytidine monophosphate kinase, and pyruvate kinase in the present method for synthesizing dCTP or CTP.

[0048] In the present method for synthesizing dTP or ATP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UTP, or the present method for synthesizing dCTP or CTP, it is preferable from the viewpoint of reaction efficiency that the enzyme added to the reaction vessel is not immobilized on a carrier such as polyacrylamide gel.

[0049] (Phosphate Donor) In the present dATP or ATP synthesis method, a nucleoside triphosphate or deoxynucleoside triphosphate is used as the phosphate donor in the reaction from dAd to dAMP or from Ad to AMP. Similarly, in the reaction from dGua to dGMP or from Gua to GMP in the present dGTP or GTP synthesis method, from dThy to dTMP in the present dTTP synthesis method, from m5Uri to m5UMP or from Uri to UMP in the present m5UTP or UTP synthesis method, or from dCyt to dCMP or from Cyt to CMP in the present dCTP or CTP synthesis method, a nucleoside triphosphate or deoxynucleoside triphosphate is used as the phosphate donor. The nucleoside triphosphate or deoxynucleoside triphosphate includes any one of ATP, guanosine triphosphate (GTP), 5'-methyl-uridyl triphosphate (m5UTP), uridyl triphosphate (UTP), and cytidine triphosphate (CTP), and the deoxynucleoside triphosphate includes any one of dATP, deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), and deoxycytidine triphosphate (dCTP), or a combination thereof. As the nucleoside triphosphate or deoxynucleoside triphosphate, in the present method for synthesizing dATP or ATP, it is preferable to use dATP or ATP as the phosphate donor; in the present method for synthesizing dGTP or GTP, it is preferable to use dGTP or GTP as the phosphate donor; in the present method for synthesizing dTTP, it is preferable to use dTTP or TTP; in the present method for synthesizing m5UTP or UTP, it is preferable to use UTP; and in the present method for synthesizing dCTP or CTP, it is preferable to use dCTP or CTP as the phosphate donor, but there are no particular limitations.That is, in the case of the present method for synthesizing dATP or ATP, the phosphate donor is not limited to ATP or dATP, but may also be any of guanosine triphosphate (GTP), cytidine triphosphate (CTP), 5'-methyl-uridyl triphosphate (m5UTP), uridyl triphosphate (UTP), or any of deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), or a combination thereof. The same applies to the phosphate donor in the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UTP, or the present method for synthesizing dCTP or CTP. In addition, dATP or ATP, dGTP or GTP, dTTP or TTP, the present m5UTP or UTP, and dCTP or CTP added as phosphate donors serve as reaction initiators in the present method for synthesizing dATP or ATP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UP, or the present method for synthesizing dCTP or CTP.

[0050] Furthermore, once the reaction proceeds in the present dATP or ATP synthesis method 1, dATP or ATP is produced and utilized. Therefore, the concentration ratio of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor to deoxyadenosine (dAd) or adenosine (Ad) at the start of the reaction (dNTP or NTP / dAd or Ad) can be 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, even more preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. Reducing the concentration ratio of dNTP or NTP to dAd or Ad is preferred from the viewpoint of cost reduction.

[0051] In the present method 1 for synthesizing dGTP or GTP, the present method 1 for synthesizing dTTP, the present method 1 for synthesizing m5UTP or UTP, or the present method 1 for synthesizing dCTP or CTP, once the reaction proceeds, dGTP or GTP, dTTP, m5UTP or UP, or dCTP or CTP are produced, respectively, and are used in the synthesis reaction of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UP, or dCTP or CTP. Therefore, the concentration ratio of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor to deoxyguanosine (dGua) or guanosine (Gua), deoxythymidine (dThy), 5-methyluridine (m5Uri) or uridine (Uri), or deoxycytidine (dCyt) or cytidine (Cyt) at the start of the reaction can be 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, even more preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. Reducing the concentration ratio of dNTP or NTP to dGua or Gua, dThy, m5Uri or Uri, dCyt or Cyt is preferred from the viewpoint of reducing costs.

[0052] Furthermore, since dATP or ATP is produced and utilized once the reaction proceeds in the present dATP or ATP synthesis method 2, the concentration ratio of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor to deoxyadenosine monophosphate (dAMP) or adenosine monophosphate (AMP) at the start of the reaction can be 1.0 or less, 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, even more preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. Reducing the concentration ratio of dNTP or NTP to dAMP or AMP is preferred from the viewpoint of cost reduction.

[0053] In the present method 2 for synthesizing dGTP or GTP, the present method 2 for synthesizing dTTP, the present method 2 for synthesizing m5UTP or UTP, or the present method 2 for synthesizing dCTP or CTP, once the reaction proceeds, dGTP or GTP, dTTP, m5UTP or UP, or dCTP or CTP are produced, respectively, and are used in the synthesis reaction of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UP, dCTP or CTP. Therefore, the concentration ratio of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor to deoxyguanosine monophosphate (dGMP) or guanosine monophosphate (GMP), deoxythymidine monophosphate (dTMP), 5'-methyluridine monophosphate (m5UMP) or uridine monophosphate (UMP), or deoxycytidine monophosphate (dCMP) or cytidine monophosphate (CMP) at the start of the reaction can be 1.0 or less, 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, even more preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. Reducing the concentration ratio of dNTP or NTP to dGMP or GMP, dTMP, m5UMP or UMP, or dCMP or CMP is preferred from the viewpoint of reducing costs.

[0054] (Enzyme Reaction Conditions) The pH of the reaction solution in the present dNTP or NTP synthesis method, specifically the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, the present m5UTP or UTP synthesis method, or the present dCTP or CTP synthesis method can be adjusted appropriately depending on the enzyme used, and can be 4.5 to 10.0, preferably 5.0 to 9.0, more preferably 5.5 to 8.5, and even more preferably 6.0 to 8.0.

[0055] The temperature of the reaction solution in the present dNTP or NTP synthesis method, specifically the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, the present m5UTP or UTP synthesis method, or the present dCTP or CTP synthesis method can be adjusted appropriately depending on the enzyme used, but can be 25 to 40°C, preferably 28 to 37°C.

[0056] The reaction time in the present dNTP or NTP synthesis method, specifically the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, the present m5UTP or UTP synthesis method, or the present dCTP or CTP synthesis method, can be appropriately adjusted depending on the enzyme used, the concentration of dAd or Ad, dGua or Gua, the concentration of dThy, the concentration of m5Uri or Uri, the concentration of dCyt or Cyt, the concentration of dAMP or AMP, dGMP or GMP, the concentration of dTMP, the concentration of m5UMP or UMP, or the concentration of dCMP or CMP, but can be 0.1 to 24 hours, preferably 0.5 to 12 hours, and more preferably 1 to 4 hours. If the reaction time exceeds 24 hours, the amount of synthesized deoxyribonucleotide triphosphate or ribonucleotide triphosphate such as dATP or ATP will decrease, so it is preferable to stop the reaction time at 24 hours.

[0057] In the present dNTP or NTP synthesis method 1, specifically, the present dATP or ATP synthesis method 1, the present dGTP or GTP synthesis method 1, the present dTTP synthesis method 1, the present m5UTP or UTP synthesis method 1, or the present dCTP or CTP synthesis method 1, the concentration of phosphoenolpyruvic acid (PEP) is determined based on the enzyme or deoxyribonucleoside or ribonucleoside used, specifically, the concentration of dAd or Ad, the concentration of dGua or Gua, The concentration of PEP can be appropriately adjusted by adjusting the concentration of dThy, the concentration of m5Uri or Uri, and the concentration of dCyt or Cyt, but the concentration ratio of PEP to deoxyribonucleoside or ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) can be 1 or more, preferably 2 or more, more preferably 3 or more, even more preferably 5 or more, still more preferably 6 or more, particularly preferably 9 or more, and most preferably 5 to 10.

[0058] In the present dNTP or NTP synthesis method 2, specifically, the present dATP or ATP synthesis method 2, the present dGTP or GTP synthesis method 2, the present dTTP synthesis method 2, the present m5UTP or UTP synthesis method 2, and the present dCTP or CTP synthesis method 2, the concentration of phosphoenolpyruvate (PEP) is determined based on the concentration of the enzyme or deoxynucleoside monophosphate or nucleoside monophosphate used, specifically, the concentration of dAMP or AMP, the concentration of dGMP or GMP, The concentration of PEP can be appropriately adjusted by varying the concentration of dTMP, m5UMP or UMP, and dCMP or CMP, but the concentration ratio of PEP to deoxynucleoside monophosphate or nucleoside monophosphate (PEP / deoxynucleoside monophosphate or ribonucleoside monophosphate) can be 1 or more, preferably 2 or more, more preferably 3 or more, even more preferably 5 or more, still more preferably 6 or more, particularly preferably 9 or more, and most preferably 5 to 10.

[0059] In the present dATP or ATP synthesis method, specifically, the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, the present m5UTP or UTP synthesis method, or the present dCTP or CTP synthesis method, an ionic compound such as magnesium ion, potassium ion, or manganese ion, or magnesium sulfate may be contained to promote the enzymatic reaction. Examples of sources of magnesium ion and potassium ion include magnesium chloride and potassium chloride. When magnesium chloride is contained, the concentration in the reaction solution is 2 to 200 mM, preferably 5 to 100 mM, and more preferably 10 to 80 mM. When potassium chloride is contained, the concentration in the reaction solution is 3 to 300 mM, preferably 10 to 70 mM.

[0060] In the present method for synthesizing dNTP or NTP, specifically, the present method for synthesizing dATP or ATP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UP, or the present method for synthesizing dCTP or CTP, the concentration of phosphoenolpyruvic acid in the reaction solution can be 5 to 120 mM, preferably 10 to 100 mM, and more preferably 30 to 90 mM.

[0061] In the present method for synthesizing dATP or ATP, specifically, the present method for synthesizing dATP or ATP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UTP, or the present method for synthesizing dCTP or CTP, by adjusting the concentration of phosphoenolpyruvic acid, all of the phosphate used in the reaction can be derived from phosphoenolpyruvic acid. Therefore, depending on the reaction solution, theoretically, approximately one molecule of dNTP or NTP can be synthesized from one molecule of the starting deoxyribonucleoside or ribonucleoside. Specifically, approximately one molecule of dATP or ATP can be synthesized from one molecule of dAd or Ad, approximately one molecule of dGTP or GTP can be synthesized from one molecule of dGua or Gua, approximately one molecule of dTTP can be synthesized from one molecule of dThy, approximately one molecule of m5Uri or Uri can be synthesized from one molecule of m5UTP or UP, and approximately one molecule of dCyt or Cyt can be synthesized from one molecule of dCTP or CTP. Taking the present method for synthesizing dATP or ATP as an example, one molecule of deoxynucleoside triphosphate such as dATP or nucleoside triphosphate such as ATP is consumed per molecule of deoxynucleoside such as dAd or nucleoside such as Ad in the reaction pathway, but deoxynucleoside triphosphate such as dATP or deoxynucleoside triphosphate such as ATP loses one phosphate to produce deoxynucleoside diphosphate such as dADP or nucleoside diphosphate such as ADP, and this deoxynucleoside diphosphate such as dADP or nucleoside diphosphate such as ADP is reacted with pyruvate kinase using PEP as a phosphate donor to produce deoxynucleoside triphosphate such as dATP or nucleoside triphosphate such as ATP. In order to initiate the reaction, dATP or ATP is initially added to the reaction solution. However, as the reaction progresses, the produced dATP or ATP is consumed, so it is sufficient to initially add only the minimum amount of dATP or ATP necessary to initiate the reaction.The same applies to the method for synthesizing the present dGTP or GTP, the method for synthesizing the present dTTP, the method for synthesizing the present m5UTP or UTP, and the method for synthesizing the present dCTP or CTP.

[0062] In the present dNTP or NTP synthesis method, only one of the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, the present m5UTP or UP synthesis method, and the present dCTP or CTP synthesis method may be carried out in one pot, i.e., by reaction in the same reaction vessel, but a combination of any two, any three, or all of the above synthesis methods may also be carried out in one pot by reaction.

[0063] For example, only the synthesis method of the present dATP or ATP, only the synthesis method of the present dGTP or GTP, only the synthesis method of the present dTTP, only the synthesis method of the present m5UTP or UTP, or only the synthesis method of the present dCTP or CTP may be practiced.

[0064] In addition, combinations of the above two synthesis methods include the present dATP or ATP synthesis method and the present dGTP or GTP synthesis method, the present dATP or ATP synthesis method and the present dTTP synthesis method, the present dATP or ATP synthesis method and the present m5UTP or UTP synthesis method, the present dATP or ATP synthesis method and the present dCTP or CTP synthesis method, and the present dGTP or GTP synthesis method and the present dTTP synthesis method. Examples of such a method include a combination of the present dGTP or GTP synthesis method and the present m5UTP or UP synthesis method, a combination of the present dGTP or GTP synthesis method and the present dCTP or CTP synthesis method, a combination of the present dTTP synthesis method and the present m5UTP or UP synthesis method, a combination of the present dTTP synthesis method and the present dCTP or CTP synthesis method, or a combination of the present m5UTP or UP synthesis method and the present dCTP or CTP synthesis method.

[0065] Furthermore, combinations of the above three synthesis methods include the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, and the present dTTP synthesis method, the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, and the present m5UTP or UTP synthesis method, the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, and the present dCTP or CTP synthesis method, the present dATP or ATP synthesis method, the present dTTP synthesis method, and the present m5UTP or UTP synthesis method, and the present dATP or ATP synthesis method, the present dTTP synthesis method, and the present dCTP or CTP synthesis method. Examples of such a combination include the present method for synthesizing dATP or ATP, the present method for synthesizing m5UTP or UP, and the present method for synthesizing dCTP or CTP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, and the present method for synthesizing m5UTP or UTP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, and the present method for synthesizing dCTP or CTP, the present method for synthesizing dGTP or GTP, the present method for synthesizing m5UTP or UP, and the present method for synthesizing dCTP or CTP, and the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UP, and the present method for synthesizing dCTP or CTP.

[0066] In addition, combinations of the above four synthesis methods include the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, and the present m5UTP or UTP synthesis method, the present dATP or ATP synthesis method, the present dGTP or GTP synthesis method, the present dTTP synthesis method, and the present dCTP or CTP synthesis method, and the present dATP or ATP synthesis method and the present dGTP or GTP synthesis method. Examples of combinations include the present method, the present method for synthesizing m5UTP or UTP, and the present method for synthesizing dCTP or CTP; the present method for synthesizing dATP or ATP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UP, and the present method for synthesizing dCTP or CTP; and the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UP, and the present method for synthesizing dCTP or CTP.

[0067] Specifically, an example of a one-pot method combining the present dATP or ATP synthesis method and the present dGTP or GTP synthesis method is shown below. Other synthesis combinations are similar. A reaction solution is prepared by adding the following to a reaction vessel: (i) deoxyadenosine or adenosine and deoxyguanosine or guanosine as starting materials; (ii) deoxyadenosine kinase or adenosine kinase, and deoxyguanosine kinase or guanosine kinase, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and deoxyguanosine monophosphate kinase or guanosine monophosphate kinase, and pyruvate kinase as enzymes; and (iii) nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors. This method involves carrying out a one-pot reaction.

[0068] In the present method for synthesizing dATP or ATP, specifically, the present method for synthesizing dATP or ATP, the present method for synthesizing dGTP or GTP, the present method for synthesizing dTTP, the present method for synthesizing m5UTP or UTP, or the present method for synthesizing dCTP or CTP, the reaction solution may contain a buffer solution to suppress pH fluctuations. The concentration of such a buffer solution may be 0.01 to 1.0 M, preferably 0.05 to 0.8 M, and more preferably 0.1 to 0.6 M. The buffer solution is not particularly limited, but examples thereof include Tris ((hydroxymethyl)aminomethane) hydrochloric acid buffer solution, phosphate buffer solution, borate buffer solution, carbonate buffer solution, MES (2-morpholinoethanesulfonic acid) buffer solution, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer solution, MOPS (3-(N-morpholino)propanesulfonic acid), TEA (Tris-acetate-EDTA) buffer solution, and Tricine buffer solution.

[0069] (Enzyme Reaction Solution) The enzymes used in the present dNTP or NTP synthesis method 1, i.e., at least one, preferably two, more preferably three enzymes selected from the group consisting of (i) nucleoside kinases such as adenosine kinase, (ii) nucleoside monophosphate kinases such as adenosine monophosphate kinase, and (iii) pyruvate kinase, are a method for preparing an enzyme reaction solution by extracting at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast that express the enzyme, the method comprising the step of treating the bacteria or yeast with an enzyme extract that is a 0.05 to 1.0 M buffer containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11 at 25 to 95°C for 0.1 hours to 4 days, and does not include a step of disrupting or lysing the bacteria or yeast (hereinafter also referred to as "the present enzyme reaction solution preparation method 1"); The enzyme reaction solution obtained by the above may be used as the enzyme as it is.

[0070] Furthermore, the enzyme used in the present dNTP or NTP synthesis method 2, i.e., at least one, preferably two enzymes selected from the group consisting of (ii) nucleoside monophosphate kinase such as adenosine monophosphate kinase, and (iii) pyruvate kinase, may be an enzyme reaction solution obtained by a method in which an enzyme, while retaining its enzymatic activity, is extracted from bacteria or yeast expressing at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase, the method comprising the step of treating the bacteria or yeast with an enzyme extract, which is a 0.05 to 1.0 M buffer containing 0 to 3% of a nonionic surfactant or a zwitterionic surfactant and adjusted to a pH of 6 to 11, at 25 to 95°C for 0.1 hour to 4 days, and which does not include a step of disrupting or lysing the bacteria or yeast (hereinafter also referred to as "the present enzyme reaction solution preparation method 2").

[0071] Below, we will explain the present enzyme reaction solution preparation methods 1 and 2 (hereinafter, the present enzyme reaction solution preparation method 1 and the present enzyme reaction solution preparation method 2 will be collectively referred to simply as the ``present enzyme reaction solution preparation methods'').

[0072] (Bacteria or Yeast) In the present method for preparing an enzyme reaction solution, the bacteria are not particularly limited as long as they are taxonomically classified as bacteria, and may be either Gram-negative or Gram-positive bacteria. Examples of Gram-negative bacteria include Escherichia coli, Pseudomonas bacteria, and Streptomyces bacteria. Examples of Gram-positive bacteria include Bacillus bacteria such as Bacillus subtilis, Streptococcus bacteria, Staphylococcus bacteria, Brevibacillus bacteria, Corynebacterium bacteria, Lactobacillus bacteria, and lactic acid bacteria. The above bacteria also include mutant strains of these bacteria. To further increase the amount of a specific enzyme in the enzyme reaction solution, it is preferable to use transformed bacteria or transformed yeast incorporating a polynucleotide encoding the specific enzyme. The polynucleotide may be a polynucleotide encoding an enzyme derived from the host to be transformed, or a polynucleotide encoding an enzyme derived from a heterologous organism other than the host, or a polynucleotide or mutant polynucleotide whose codons have been optimized for the host.

[0073] In the present method for preparing an enzyme reaction solution, the yeast is not particularly limited as long as it is taxonomically classified as yeast, and examples thereof include yeasts of the genus Saccharomyces, Kluyveromyces, Candida, and Pichia. Specific examples include Saccharomyces cerevisiae, Kluyveromyces lactis, Candida utilis, and Pichia pastoris. The above yeasts also include mutant strains of these yeasts.

[0074] (Enzyme Extract and Its Treatment Conditions) Examples of surfactants used in the present method for preparing an enzyme reaction solution include nonionic surfactants, amphoteric surfactants, and salts thereof. Examples of nonionic surfactants include ether-based nonionic surfactants such as Triton X-100 and NP40. Examples of amphoteric surfactants include MEGA-10 and CHAPS. The above nonionic surfactants may be used in combination with the above amphoteric surfactants or salts thereof. It is also preferable that the surfactant does not contain cationic surfactants and / or anionic surfactants or salts thereof. Examples of cationic surfactants include sulfonic acid surfactants such as 1-dodecanesulfonic acid and cetyltrimethylammonium bromide (CTAB). Examples of anionic surfactants include sodium dodecyl sulfate (SDS), lauryltrimethylammonium (Lauryltrimethylammonium Cl), and sodium deoxycholate. It should be noted that this does not preclude the addition of a surfactant, preferably a nonionic surfactant or a bipolar surfactant, to the enzyme reaction solution obtained by the method for preparing the enzyme reaction solution of the present invention for the purpose of stabilizing the enzyme.

[0075] In the present method for preparing an enzyme reaction solution, the concentration of the nonionic surfactant or amphoteric surfactant in the enzyme extract can be adjusted appropriately depending on the molecular weight of the enzyme to be extracted and the type of bacteria or yeast, and can be 0 to 3%, for example, 0%, 0 to 0.01%, 0 to 0.1%, 0 to 0.25%, 0 to 0.5%, or even 0.1 to 2%, 0.5 to 1.5%, or 0.8 to 1.2%. Note that the above concentrations are in % (v / v) when the nonionic surfactant or amphoteric surfactant is in liquid form, and in % (w / v) when it is prepared by dissolving a powder.

[0076] In the method for preparing the enzyme reaction solution of the present invention, the pH of the enzyme extract can be appropriately adjusted depending on the stability of the enzyme to be extracted, and can be, for example, pH 6 to 11, pH 6.3 to 10.5, more preferably pH 6.5 to 10.2, even more preferably pH 7 to 10, and particularly preferably pH 8 to 9.

[0077] In the method for preparing the enzyme reaction solution of the present invention, a buffer solution may be used in the enzyme extract to suppress pH fluctuations. The concentration of such a buffer solution may be 0.05 to 1.0 M, preferably 0.1 to 0.6 M. The buffer solution is not particularly limited, but examples thereof include Tris ((hydroxymethyl)aminomethane) hydrochloric acid buffer solution, phosphate buffer solution, borate buffer solution, carbonate buffer solution, MES (2-morpholinoethanesulfonic acid) buffer solution, HEPES (4-(2-hydroxyethyl)-1-piperazineethane sulfonic acid) buffer solution, MOPS (3-(N-morpholino)propanesulfonic acid) buffer solution, TEA (Tris-acetate-EDTA) buffer solution, and Tricine buffer solution.

[0078] The temperature during treatment with the enzyme extract can be adjusted appropriately depending on the heat resistance of the enzyme to be extracted, but examples of the temperature include 4 to 95°C, and preferably 25 to 90°C or 40 to 60°C.

[0079] The time for treatment with the enzyme extract is not particularly limited, but is preferably 0.1 hour or more, for example, 0.5 hours to 4 days, may be 1 hour to 2 days, or may be 3 hours to 24 hours.

[0080] (Disruption or lysis) The present method for preparing an enzyme reaction solution does not include a step of disrupting or lysing bacteria or yeast. Here, disruption or lysis of bacteria or yeast means physically treating the bacteria or yeast with ultrasound, beads such as zirconia beads or glass beads, or a pressure homogenizer, or chemically treating the bacteria or yeast with an acid or base, alkaline SDS treatment, or enzyme treatment with lysozyme or lyticase, to remove any remaining cell structure. Whether or not the cell structure remains can be confirmed by observing the bacteria or yeast under a microscope.

[0081] Whether or not the enzyme in the obtained enzyme reaction solution retains its enzymatic activity can be confirmed by adding the enzyme reaction solution to the substrate of the enzyme and determining whether or not an enzyme reaction product is obtained.

[0082] The present method for preparing an enzyme reaction solution preferably does not include a purification step for removing contaminants after treatment with an enzyme extract to extract the enzyme. Conventionally, when bacteria or yeast are disrupted or lysed to extract an enzyme, a purification step using a commercially available nucleic acid purification kit or a method such as precipitation using polyethyleneimine is required to remove contaminants such as disrupted or lysed cell walls and nucleic acids such as DNA and RNA. In contrast, the present method for preparing an enzyme reaction solution does not require a purification step for removing the contaminants because the enzyme is extracted without disrupting or lysing the bacteria or yeast. Note that, in this specification, the step of separating undisrupted or unlysed bacteria or yeast by centrifugation or the like is not included in the purification step for removing the contaminants. Furthermore, the purification step does not include the step of removing the contaminants and polypeptides other than the target enzyme by chromatography (e.g., affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography), ultrafiltration, or the like after treatment with an enzyme extract to remove substances that inhibit the enzymatic activity of the target enzyme.

[0083] In the present method for preparing an enzyme reaction solution, when the enzyme reaction solution obtained by treatment with an enzyme extract is used directly for an enzyme reaction, there may be cases where it is not necessary to obtain only the desired enzyme. In this case, a peptide can be prepared that does not contain modifications, such as a tag sequence, that are necessary to obtain only the desired enzyme.

[0084] (Enzyme Reaction Product) In the method for preparing the present enzyme reaction product, the enzyme reaction product is not particularly limited. For example, by using a deoxyribonucleoside triphosphate as a substrate and carrying out a PCR reaction using a DNA polymerase reaction solution prepared by extracting DNA polymerase using the present enzyme reaction solution preparation method as the enzyme reaction solution, a PCR amplification product can be obtained as the enzyme reaction product. Furthermore, by using a compound that causes the desired phosphorylation as a substrate and carrying out an enzymatic reaction using a phosphorylating enzyme reaction solution prepared by extracting a phosphorylating enzyme using the present enzyme reaction solution preparation method as the enzyme reaction solution, a phosphorylated compound in which the substrate is phosphorylated can be obtained as the enzyme reaction product.

[0085] The PCR reaction solution may contain template DNA, primers, probes, and a buffer solution in addition to the substrate and enzyme reaction solution. The enzyme reaction solution may be used as the buffer solution.

[0086] In the method for preparing the present enzyme reaction product, the solution in which the enzyme reaction is carried out can contain 0.1 to 20% (v / v) of the enzyme reaction solution prepared by the method for preparing the present enzyme reaction solution.

[0087] The contents of all patent and non-patent literature cited herein are hereby incorporated by reference in their entirety.

[0088] The present invention will be explained in more detail below with reference to examples, but the technical scope of the present invention is not limited to these examples.

[0089] Example 1 Extraction of Enzyme (DNA Polymerase) from Escherichia coli First, PCR is performed to confirm the synthesis of dATP in the Examples described later. The DNA polymerase used in the PCR was extracted from Escherichia coli that highly expresses DNA polymerase by the following method.

[0090] (Culturing E. coli expressing DNA polymerase) E. coli was used as a host and transformed using the following method. A Pfu DNA polymerase-containing plasmid was prepared by incorporating a polynucleotide encoding Pfu DNA polymerase in place of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). Pfu DNA polymerase is a thermostable DNA polymerase derived from Pyrococcus furiosus.

[0091] 1 μL of the Pfu DNA polymerase-containing plasmid was added to 30 μL of competent E. coli cells in an ice bath, stirred for 1 second, and then transformed by ice bathing for 10 minutes and then at 42°C for 45 seconds to obtain Pfu DNA polymerase-expressing E. coli. Next, 50 μL of sterile water was added, and the Pfu DNA polymerase-expressing E. coli was plated on agar medium containing glucose, yeast extract, peptone, and ampicillin, spread with beads, and cultured at 37°C for 1 day. Approximately 3 cm of colonies growing on the agar medium were scraped off with a loop, inoculated into AB medium (Yamaguchi TLO), and cultured at 37°C for 1 day with gentle stirring. 500 mL of AB medium was added to a 1 L beaker. The beaker was covered with aluminum foil and sterilized.

[0092] (Extraction of DNA polymerase) The culture solution obtained by culturing E. coli in the above AB medium was dispensed into ten 50 mL tubes at 50 mL each, centrifuged at 12,000 rpm for about 5 minutes, and the supernatant was removed. Next, the sample was suspended in 5 mL of extraction solution prepared by adding surfactants (Triton X-100, MEGA-10 (348-05093: Dojindo Laboratories), CHAPS, SDS, 1-Dodecanesulfonic Acid, lauryltrimethylammonium (Lauryltrimethylammonium Cl)) to a final concentration of 1% in 0.1 M or 0.6 M Tris-HCl adjusted to pH 7, 8, 9, or 10, and treated at 50°C for 1 hour to extract Pfu DNA polymerase. Thereafter, the mixture was centrifuged at 12,000 rpm for about 5 minutes, and the supernatant was used as an enzyme reaction solution (pH 7, 8, 9 or 10) for the enzyme reaction (PCR reaction) described below.

[0093] (Confirmation of enzyme extraction by SDS-PAGE) Whether or not the enzyme was extracted into the enzyme reaction solution was confirmed by SDS-PAGE. 10 μL of the enzyme reaction solution (DNA polymerase extract) treated at 50°C for 1 hour was transferred to a 0.2 mL 8-tube PCR tube, and 2 μL of 6x sample buffer for SDS-PAGE (product code 09499-14: Nacalai Tesque) was added and mixed well. The tube was placed in a 95°C heat block for 5 minutes, and then applied to the gel at 1.2 μL / lane. A 10-20% precast gel (Supersep: Wako Pure Chemical Industries, Ltd.) was used.

[0094] The results of confirming enzyme extraction by SDS-PAGE are shown in Figure 1. The position of the arrow on the right side of the figure indicates the molecular weight of Pfu DNA polymerase. A band was observed at the molecular weight position corresponding to Pfu DNA polymerase at all pH values, confirming that Pfu DNA polymerase can be extracted without disrupting or lysing E. coli. Furthermore, it was confirmed that Pfu DNA polymerase was extracted in large quantities with surfactants, particularly Triton X-100, MEGA10, CHAPS, SDS, and 1-Dodecanesulfonic Acid.

[0095] (Confirmation of polymerase activity of enzyme by PCR) Whether or not the Pfu DNA polymerase in the obtained enzyme reaction solution has enzymatic activity was confirmed by PCR reaction.

[0096] The PCR reaction solution was as follows: 1 M Tris-HCl pH 8.5 1.5 μL Enzyme reaction solution (pH 7, 8, 9, 10) 0.2 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO 4 (50mM) 0.5μL dNTP solution mix (10mM NEB) 0.5μL Distilled water 5.3μL Total 10.0μL

[0097] The PCR reaction was carried out for 30 cycles of 98°C for 5 seconds and 68°C for 5 seconds. The pAmp-srlAp-eEGFP plasmid described in the above-mentioned Nakamura et al. publication was used as template DNA, and a 711-bp polynucleotide encoding EGFP was amplified using eEGFP+1(35) (SEQ ID NO: 6) as the forward primer and eEGFP+711c(35) (SEQ ID NO: 7) as the reverse primer. If DNA is amplified by the PCR reaction, it indicates that the DNA polymerase has enzymatic activity. Forward primer eEGFP+1(35): atggtgagcaaaggtgaagaactgtttaccggtgt (SEQ ID NO: 6) Reverse primer eEGFP+711c(35): ttattcatccatacccagggtaatacctgctgcgg (SEQ ID NO: 7)

[0098] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 2. As shown in Figure 2, when extraction was performed using Triton X-100, MEGA10, or CHAPS as a surfactant, PCR amplification products were confirmed at all pH values ​​from 7 to 10, confirming that the extracted DNA polymerase maintained its enzymatic activity. Furthermore, when extraction was performed using Lauryltrimethylammonium Cl, PCR amplification products were confirmed at pH 7, confirming that the extracted DNA polymerase maintained its enzymatic activity. On the other hand, when extraction was performed using SDS or dodecanesulfonic acid as a surfactant, no PCR amplification products were confirmed, indicating that the extracted DNA polymerase had lost its enzymatic activity. Therefore, it was revealed that the enzyme was extracted in a state where its activity was maintained when extracted using Triton X-100, MEGA10, or CHAPS at pH 7 to 10, or when extracted using Lauryltrimethylammonium Cl at pH 7. Note that Figure 2 shows the results when 0.1 M Tris-HCl adjusted to pH 7, 8, 9, or 10 was used in preparing the enzyme reaction solution, but bands were also detected when 0.6 M Tris-HCl was used, similar to when 0.1 M Tris-HCl was used.

[0099] From the above results, it was confirmed that the enzyme reaction solution obtained by the above-mentioned method for preparing the enzyme reaction solution of the present invention can be used as an enzyme in a PCR reaction directly to cause an enzymatic reaction with a substrate, thereby producing an enzyme reaction product.

[0100] [Example 2] Extraction of enzyme (phosphorylation enzyme: kinase) from Escherichia coli (1) An enzyme reaction solution was prepared by extracting kinase from Escherichia coli expressing kinase without disrupting the Escherichia coli, using the method for preparing the enzyme reaction solution in Example 1 as a reference. The method is described below.

[0101] Plasmids were prepared in which a polynucleotide (SEQ ID NO: 8) encoding Ecadk, a phosphorylation enzyme (adenosine monophosphate kinase) derived from E. coli, or a polynucleotide (SEQ ID NO: 9) encoding ECpykF, a phosphorylation enzyme (pyruvate kinase) derived from E. coli, was incorporated instead of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). Then, E. coli was transformed with the above plasmids in the same manner as in Example 1. The transformed E. coli was then cultured in AB medium in the same manner as in Example 1.

[0102] Next, the sample was suspended in 5 mL of an extract prepared by adding a surfactant (Triton X-100) to a final concentration of 1% (v / v) in 0.1 M Tris-HCl adjusted to pH 9, and an enzyme reaction solution was prepared in the same manner as in Example 1. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 3. A band was observed at the position of the molecular weight corresponding to Ecadk or ECpykF, confirming that Ecadk or ECpykF could be extracted without disrupting or lysing E. coli.

[0103] The enzymatic activities of the kinase Ecadk and kinase ECpykF in the obtained enzyme reaction solution will be demonstrated by obtaining reaction products by PCR reaction in the Examples described later.

[0104] [Example 3] Extraction of enzymes (phosphorylation enzymes) from yeast In Example 2, the enzymes Ecadk and ECpykF were extracted from E. coli. Next, an attempt was made to extract the ScADO1 enzyme from yeast in order to synthesize dAMP from dAd.

[0105] (Culturing of yeast expressing kinase) Yeast (Saccharomyces cerevisiae) was transformed as follows: A polynucleotide (SEQ ID NO: 10) encoding the kinase ScADO1 of Saccharomyces cerevisiae was incorporated into the YHp plasmid (Misumi et al., Yeast Volume 36, Issue 5 Special Issue: May 2019 Pages 249-257) instead of yEmRFP to prepare an ScADO1-containing plasmid.

[0106] The ScADO1-containing plasmid was added to 30 μL of yeast competent cells, and the cells were transformed by treating on a heat block at 42°C for approximately 30 minutes. Then, 100 μL of sterile water was added, and the transformed yeast was plated on uracil-deficient synthetic medium, spread with beads, and cultured at 30°C for 3 days. The resulting colonies were scraped and inoculated into 50 mL of YPD medium in a 250 mL baffled Erlenmeyer flask and cultured with shaking at 30°C for 1 day. The cells were then suspended in 5 mL of extract solution prepared by adding surfactant (Triton X-100) to a final concentration of 1% in 0.1 M Tris-HCl adjusted to pH 9, and allowed to stand in an incubator at 30°C for 1 day to extract ScADO1. The cells were then centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was used as the enzyme reaction solution (pH 9) for SDS-PAGE and the enzyme reaction described below. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 4. Enzyme reaction solutions prepared from two different clones were applied to each lane. A band was observed at the position of the molecular weight corresponding to ScADO1, confirming that ScADO1 could be extracted without destroying or lysing yeast. The enzymatic activity of the kinase ScADO1 in the obtained enzyme reaction solution will be shown in the Examples below. The above-mentioned surfactant treatment did not destroy the yeast cell wall or lyse the yeast.

[0107] Example 4 Activity of Extracted Enzymes (Kinase) (1) The kinases Ecadk and ECpykF extracted in Example 2 and the kinase ScADO1 extracted in Example 3 were used as enzyme reaction solutions to examine the reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP). The outline of the reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP) is shown in Figure 5.

[0108] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dATP, which was used as a dATP solution: 2 μL of 1 M Tris-HCl pH 8, 2 μL of 0.5 M KCl, and 100 mM MgCl. 2 2 μL 300 mM PEP (phosphoenolpyruvic acid) 2 μL 1 mM dATP 2 μL 100 mM dAd 2 μL Enzyme reaction solution prepared in Example 3 (ScADO1: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECadk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0109] Next, PCR was carried out using the following reaction solution: 0.2 μL of the enzyme reaction solution (Pfu: pH 9) prepared in Example 1, 1.5 μL of 1 M Tris-HCl pH 8.5, 0.5 μL of the above dATP solution, 1.0 μL of template DNA (1 ng / μL), 0.5 μL of forward primer (10 μM), and 0.5 μL of reverse primer (10 μM) MgSO. 4(50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0110] The PCR reaction was carried out for 30 cycles of 98°C for 5 seconds and 68°C for 5 seconds. Using the pAmp-srlAp-eEGFP plasmid as template DNA, eEGFP+1(35) (SEQ ID NO: 6) as the forward primer, and eEGFP+711c(35) (SEQ ID NO: 7) as the reverse primer, a 711-bp polynucleotide encoding EGFP was amplified. If DNA is amplified by the PCR reaction, it means that the added dATP solution contains dATP, i.e., the kinases Ecadk and ECpykF extracted in Example 2 and the kinase ScADO1 extracted in Example 3 have enzymatic activity. In the dATP synthesis reaction, an initial concentration of 0.1 mM dATP was added to initiate the reaction. In addition, the initial concentration of dATP was 0.1 mM, and 0.5 μL of the dATP synthesis reaction solution was added to the total 10 μL PCR reaction solution, so the concentration of dATP added initially was 0.005 mM. Since the concentration of each dNTP required for PCR is about 0.5 mM, it can be said that the progress of the PCR reaction was not substantially due to the dATP added initially, but rather due to the dATP synthesized from the 10 mM dAd substrate.

[0111] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 6. In Figure 6, the left lane is the marker, and the right lane is the lane to which the PCR amplification products were applied. As is clear from Figure 6, PCR amplification products were obtained, confirming that the kinases Ecadk and ECpykF extracted in Example 2 and the kinase ScADO1 extracted in Example 3 have enzymatic activity. Therefore, it was revealed that the above-mentioned method for preparing an enzyme reaction solution makes it possible to extract enzymes from both bacteria and yeast while retaining their enzymatic activity, and that ATP or dATP can be synthesized by mixing the enzymes directly from the enzyme reaction solution and reacting them in one pot without purification to remove impurities.

[0112] The enzyme reaction solution is prepared without disruption or lysis as in the conventional method. Therefore, the obtained enzyme can be used directly in the enzymatic reaction without purification. Furthermore, if the solution from which the enzyme is extracted is used directly in the enzymatic reaction, it is possible to simplify the process of synthesizing ATP or dATP, which is the enzymatic reaction product of the enzymatic reaction, from the enzyme reaction solution.

[0113] Example 5 Activity of Extracted Enzyme (Kinase) (2) While ECpykF was used in Example 4, analysis was carried out using ECpykA instead of ECpykF, and further by changing the pH and PEP conditions.

[0114] ECpykA was extracted in the same manner as in Example 2. A plasmid was prepared by incorporating a polynucleotide (SEQ ID NO: 11) encoding ECpykA, a phosphorylating enzyme (pyruvate kinase) derived from Escherichia coli, in place of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). MOPS was used as a buffer to adjust the pH to 6.0, and PEP concentrations were 30 mM, 60 mM, or 90 mM, and the reaction time was 1 hour or 24 hours.

[0115] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 1 or 2 hours to synthesize dATP, which was used as a dATP solution: 2 μL of 1 M MOPS pH 6.0, 2 μL of 0.5 M KCl, and 2 μL of 100 mM MgCl. 2 2 μL 300, 600, or 900 mM PEP (phosphoenolpyruvic acid) 2 μL 1 mM dATP 2 μL 100 mM dAd 2 μL Enzyme reaction solution prepared in Example 4 (ScADO1: pH 9) 2 μL Enzyme reaction solution prepared in Example 3 (ECadk: pH 9) 2 μL Enzyme reaction solution prepared in Example 5 (ECpykA: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0116] The PCR reaction was carried out in the same manner as in Example 4. The resulting PCR reaction solution was diluted to 1 / 2, 1 / 4, and 1 / 8, and then subjected to agarose electrophoresis together with the undiluted solution. The results of agarose electrophoresis after 24 hours of reaction are shown in Figure 7.

[0117] 7 , PCR amplification products were obtained even when ECpykA was used instead of ECpykF, confirming that the kinase Ecadk extracted in Example 2, the kinase ECpykA extracted in this Example, and the kinase ScADO1 extracted in Example 3 all had enzymatic activity. Furthermore, the bands were darker when PEP was added in a 6-fold or 9-fold amount relative to dAd than when it was added in a 3-fold amount, confirming that a PEP to dAd concentration ratio of 6 to 9 is preferable for dATP synthesis.

[0118] The dATP concentration in the resulting dATP solution was also examined using AKTA start (Cytiva). First, 1 mL of a standard (10 mM dAd, 10 mM dAMP, or 10 mM dATP diluted 1 / 10) was loaded onto a Q HP column. Water was used as the initial eluent, and gradient elution (0 to 0.3 M NH ) was initiated from T1. 4 HCO 3 ). The positions, heights, and areas of the peaks in the standard sample were confirmed and used as reference values. Next, the dATP solution to be measured was loaded onto a Q HP column in the same manner as above and eluted, and the dATP concentration in the dATP solution was determined based on the peak positions, heights, and areas. The dATP concentrations in dATP solutions reacted with 60 mM or 90 mM PEP for 1 hour or 24 hours were examined using the above method, and the results are shown in Figures 8 and 9.

[0119] As shown in Figure 8, the dATP concentrations in the dATP solutions obtained after 1 hour and 24 hours of reaction at 60 mM PEP were 6.5 mM and 8.4 mM, respectively. Also, as shown in Figure 9, the dATP concentrations in the dATP solutions obtained after 1 hour and 24 hours of reaction at 90 mM PEP were 5.2 mM and 8.4 mM, respectively. Since the dAd concentration before the reaction was 10 mM, it was confirmed that dATP was obtained in 84% of the reactions when the enzymatic reaction was carried out from dAd with 60 mM or 90 mM PEP for 24 hours.

[0120] Example 6 Extraction of Enzymes (Phosphorylating Enzymes: Kinases) from Escherichia coli (2) In Example 2, an enzyme reaction solution was prepared by extracting kinase from Escherichia coli expressing Ecadk, an adenosine monophosphate kinase, without disrupting the Escherichia coli, using the method for preparing the enzyme reaction solution in Example 1 as a reference. Here, ECcmk, ECgmk, and ECtmk were extracted in the same manner as above to prepare an enzyme reaction solution. The method is described below.

[0121] Plasmids were prepared in which, instead of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)), a polynucleotide encoding ECcmk (SEQ ID NO: 12), a kinase (cytidine monophosphate kinase / cytidylate kinase) derived from E. coli; ECgmk (SEQ ID NO: 13), a kinase (guanosine monophosphate kinase / guanylate kinase) derived from E. coli; a polynucleotide encoding ECtmk (SEQ ID NO: 14), a kinase (thymidine monophosphate kinase / thymidylate kinase) derived from E. coli; or a polynucleotide encoding ECpykF (SEQ ID NO: 9), a kinase (pyruvate kinase) derived from E. coli were incorporated. Then, E. coli was transformed with the above plasmids in the same manner as in Example 1. The transformed E. coli was then cultured in AB medium in the same manner as in Example 1.

[0122] Next, the sample was suspended in 5 mL of an extract prepared by adding a surfactant (Triton X-100) to a final concentration of 1% (v / v) in 0.1 M Tris-HCl adjusted to pH 9, and an enzyme reaction solution was prepared in the same manner as in Example 1. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 10. Bands were observed at the positions of the molecular weights corresponding to ECcmk, ECgmk, or ECtmk, confirming that ECcmk, ECgmk, or ECtmk could be extracted without disrupting or lysing E. coli.

[0123] The enzymatic activity of the kinase ECcmk, ECgmk or ECtmk in the obtained enzyme reaction solution will be demonstrated by the reaction product obtained by PCR reaction in the Examples described later.

[0124] Example 7 Synthesis of dNTP from dNMP Using Extracted Enzymes (Kikinases) <1> Synthesis of dATP from dAMP The reaction of deoxyadenosine monophosphate (dAMP) to deoxyadenosine triphosphate (dATP) was investigated using the kinases Ecadk and ECpykF extracted in Example 2 as an enzyme reaction solution. This reaction involves two steps: synthesis of dADP from dAMP and synthesis of dATP from dADP, as shown in Figure 5.

[0125] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dATP, producing a dATP solution: 1 M Tris-HCl pH 8, 2 μL (final 100 mM), 0.5 M KCl, 2 μL (final 50 mM), 125 mM MgCl 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 4 μL (Final 25 mM) 1 mM dATP 2 μL (Final 0.1 mM) 100 mM dAMP 2 μL (Final 10 mM) Enzyme reaction solution (ECadk: pH 9) prepared in Example 2 2 μL Enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL Distilled water 2 μL Total 20 μL

[0126] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dATP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4(50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0127] The PCR reaction was performed for 30 cycles of 98°C for 5 seconds and 60°C for 5 seconds. The template DNA used was the pAmp-srlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)), in which eEGFP was incorporated instead of eEmRFP. A 711-bp polynucleotide encoding EGFP was amplified using eEGFP+1(35) (SEQ ID NO: 6) as the forward primer and eEGFP+711c(35) (SEQ ID NO: 7) as the reverse primer. If DNA is amplified by the PCR reaction, the added dATP solution contains dATP, i.e., the kinases Ecadk and ECpykF extracted in Example 2 possess enzymatic activity. Note that in the dATP synthesis reaction, an initial concentration of 0.1 mM dATP was added to initiate the reaction. Furthermore, the initial concentration of dATP was 0.1 mM, and 0.5 μL of the dATP synthesis reaction solution was added to the total 10 μL PCR reaction solution, so the initial dATP concentration was 0.005 mM. Since the concentration of each dNTP required for PCR is about 0.5 mM, it can be said that the progress of the PCR reaction was not substantially due to the dATP added initially, but rather due to the dATP synthesized from the 10 mM dAMP substrate.

[0128] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 11. In Figure 11, the left lane is a marker, and the right lane is a lane to which the PCR amplification product was applied (dATP reaction solution), a lane to which distilled water was applied (DW), and a lane to which 10 mM dATP was applied as a standard. As is clear from Figure 11, PCR amplification products were obtained, confirming that the kinases Ecadk and ECpykF extracted in Example 2 have enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dAMP.

[0129] <2> Synthesis of dGTP from dGMP In (1) above, dATP was synthesized from dAMP, but whether dGTP could be synthesized from dGMP was investigated.

[0130] The reaction from deoxyguanosine monophosphate (dGMP) to deoxyguanosine triphosphate (dGTP) was investigated using the kinase (guanosine monophosphate kinase) ECgmk extracted in Example 6 and the kinase ECpykF extracted in Example 2 as enzyme reaction solutions.

[0131] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dGTP, producing a dGTP solution: 1 M Tris-HCl pH 8, 2 μL (final 100 mM), 0.5 M KCl, 2 μL (final 50 mM), 125 mM MgCl 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 4 μL (Final 25 mM) 1 mM dGTP 2 μL (Final 0.1 mM) 100 mM dGMP 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 6 (ECgmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0132] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dGTP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4 (50 mM) 0.5 μL dATP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0133] The PCR reaction was the same as that described in the above <1> Synthesis of dATP from dAMP in this Example.

[0134] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 12. In Figure 12, the left lane is the marker, and the right lane is the lane to which the PCR amplification products were applied. As is clear from Figure 12, PCR amplification products were obtained, confirming that the kinase ECgmk extracted in Example 6 and ECpykF extracted in Example 2 have enzymatic activity. Furthermore, it was confirmed that dGTP was synthesized from dGMP.

[0135] <3> Synthesis of dTTP from dTMP In the above (1), dATP was synthesized from dAMP, but whether dTTP could be synthesized from dTMP was investigated.

[0136] The reaction of deoxythymidine monophosphate (dTMP) to deoxythymidine triphosphate (dTTP) was investigated using ECtmk, the kinase (thymidine monophosphate kinase) extracted in Example 6, and ECpykF, the kinase extracted in Example 2, as enzyme reaction solutions.

[0137] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dTTP, producing a dTTP solution: 2 μL of 1 M Tris-HCl pH 8 (final 100 mM), 2 μL of 0.5 M KCl (final 50 mM), and 125 mM MgCl. 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 4 μL (Final 25 mM) 1 mM dTTP 2 μL (Final 0.1 mM) 100 mM dTMP 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 6 (ECtmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0138] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dTTP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4 (50 mM) 0.5 μL dATP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dGTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0139] The PCR reaction was the same as that described in the above <1> Synthesis of dATP from dAMP in this Example.

[0140] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 13. In Figure 13, the left lane is a marker, and the right lane is a lane to which the PCR amplification products were applied. As is clear from Figure 13, PCR amplification products were obtained, confirming that the kinase ECtmk extracted in Example 6 and ECpykF extracted in Example 2 have enzymatic activity. Furthermore, it was confirmed that dTTP was synthesized from dTMP.

[0141] <4> Synthesis of dCTP from dCMP In the above (1), dATP was synthesized from dAMP, but whether dCTP could be synthesized from dCMP was also investigated.

[0142] The reaction of deoxycytidine monophosphate (dCMP) to deoxycytidine triphosphate (dCTP) was investigated using ECcmk, the kinase (cytidine monophosphate kinase) extracted in Example 6, and ECpykF, the kinase extracted in Example 2, as enzyme reaction solutions.

[0143] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dCTP, producing a dCTP solution: 2 μL of 1 M Tris-HCl pH 8 (final 100 mM), 2 μL of 0.5 M KCl (final 50 mM), and 125 mM MgCl. 22 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 4 μL (Final 25 mM) 1 mM dCTP 2 μL (Final 0.1 mM) 100 mM dCMP 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 6 (ECcmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0144] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dCTP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4 (50 mM) 0.5 μL dATP (10 mM) 0.5 μL dGTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0145] The PCR reaction was the same as that described in the above <1> Synthesis of dATP from dAMP in this Example.

[0146] The results of confirming the PCR amplification products by agarose electrophoresis are shown in Figure 14. In Figure 14, the left lane is the marker, and the right lane is the lane to which the PCR amplification products were applied. As is clear from Figure 14, PCR amplification products were obtained, confirming that the kinase ECcmk extracted in Example 6 and ECpykF extracted in Example 2 have enzymatic activity. Furthermore, it was confirmed that dCTP was synthesized from dCMP.

[0147] Example 8 Extraction of Enzymes (Kinase) from Yeast (2) In Example 2, enzymes Ecadk, a kinase (adenosine monophosphate kinase), and ECpykF, a kinase (pyruvate kinase), were extracted from Escherichia coli. Next, extraction of kinase (adenosine monophosphate kinase) and kinase (pyruvate kinase) from yeast was attempted.

[0148] Transformation was performed using yeast (Saccharomyces cerevisiae) as a host by the following method: An ScADK1-containing plasmid was prepared by incorporating a polynucleotide (SEQ ID NO: 15) encoding ScADK1, a Saccharomyces cerevisiae kinase (adenosine monophosphate kinase), in place of yEmRFP in the YHp plasmid (Misumi et al., Yeast Volume 36, Issue 5 Special Issue: May 2019 Pages 249-257), and an ScADK1-containing plasmid was prepared by incorporating a polynucleotide (SEQ ID NO: 16) encoding ScCDC19, a Saccharomyces cerevisiae kinase (pyruvate kinase).

[0149] The ScADK1-containing plasmid or ScCDC19-containing plasmid was added to 30 μL of competent yeast cells, and the cells were transformed by treating on a heat block at 42°C for approximately 30 minutes. Then, 100 μL of sterile water was added, and the transformed yeast was plated on uracil-deficient synthetic medium, spread with beads, and cultured at 30°C for 3 days. The resulting colonies were scraped and inoculated into 10 mL of YPD medium in a 125 mL baffled Erlenmeyer flask and cultured with shaking at 30°C for 1 day. The cells were then suspended in 5 mL of extraction solution prepared by adding a surfactant (Triton X-100) to a final concentration of 1% to 0.1 M Tris-HCl adjusted to pH 8 (used for ScADK1 extraction) or 0.1 M Tris-HCl adjusted to pH 9 (used for ScCDC19 extraction). The cells were then left to stand in an incubator at 30°C for 1 day to extract ScADK1 or ScCDC19. The mixture was then centrifuged at 12,000 rpm for approximately 5 minutes, and the supernatant was used as the enzyme reaction solution for SDS-PAGE and the enzyme reaction described below. The results of SDS-PAGE of the resulting enzyme reaction solution are shown in Figure 15. Bands were observed at the positions corresponding to the molecular weights of ScADK1 and ScCDC19, confirming that ScADK1 and ScCDC19 could be extracted without destroying or lysing the yeast. Furthermore, the above-mentioned surfactant treatment did not destroy the yeast cell wall or lyse the yeast.

[0150] The reaction from deoxyadenosine monophosphate (dAMP) to deoxyadenosine triphosphate (dATP) was investigated using the ScADK1 enzyme reaction solution and ScCDC19 enzyme reaction solution extracted above. ScADK is deoxyadenosine monophosphate kinase, and ScCDC19 is pyruvate kinase.

[0151] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about a day to synthesize dATP, which was used as a dATP solution: 2 μL of 1 M Tris-HCl pH 8, 2 μL of 2.0 M KCl, and 2 μL of 100 mM MgCl. 22 μL 250 mM PEP (phosphoenolpyruvic acid) 4 μL 1 mM dATP 2 μL 100 mM dAMP 2 μL Enzyme reaction solution (ScADK1) prepared above: pH 8 2 μL Enzyme reaction solution (ScCDC19) prepared above: pH 9 2 μL Distilled water 2 μL Total 20 μL

[0152] Next, PCR was carried out using the following reaction solution: Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL, 1 M Tris-HCl pH 8.5 1.5 μL, the above dATP solution 0.5 μL, template DNA (1 ng / μL) 1.0 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, MgSO 4 (50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0153] The PCR reaction was the same as that described in Example 7 <1> Synthesis of dATP from dAMP.

[0154] The results of PCR amplification products confirmed by agarose electrophoresis are shown in Figure 16. As is clear from Figure 16, PCR amplification products were obtained, confirming that the kinases ScADK1 and ScCDC19 extracted from yeast in this example have enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dAMP.

[0155] Example 9 Extraction of Enzymes (Phosphorylating Enzymes: Kinases) from Escherichia coli (3) In Example 2, an enzyme reaction solution was prepared by extracting kinases from Escherichia coli expressing the kinase Ecadk without disrupting the E. coli, using the method for preparing the enzyme reaction solution in Example 1 as a reference. Here, ECgsk, a guanosine monophosphate kinase (guanylate kinase), ECtdk, a cytidine monophosphate kinase (cytidylate kinase), and ECudk, a thymidine monophosphate kinase (thymidylate kinase), were extracted in the same manner as above to prepare enzyme reaction solutions. The method is described below.

[0156] Plasmids were prepared in which a polynucleotide (SEQ ID NO: 17) encoding ECgsk, a phosphorylation enzyme (guanosine kinase) derived from E. coli, a polynucleotide (SEQ ID NO: 18) encoding ECtdk, a phosphorylation enzyme (thymidine kinase) derived from E. coli, and a polynucleotide (SEQ ID NO: 19) encoding ECudk, a phosphorylation enzyme (uridine cytidine kinase) derived from E. coli were incorporated instead of eEmRFP in the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, pages 912-923 (2018)). Then, E. coli was transformed with the above plasmids in the same manner as in Example 1. The transformed E. coli was cultured in AB medium in the same manner as in Example 1.

[0157] Next, the extract was suspended in 5 mL of an extract prepared by adding a surfactant (Triton X-100) to a final concentration of 1% (v / v) in 0.1 M Tris-HCl adjusted to pH 9, and an enzyme reaction solution was prepared in the same manner as in Example 1. The results of SDS-PAGE of the obtained enzyme reaction solution are shown in Figure 17. Bands were observed at positions corresponding to the molecular weights of ECgsk, ECtdk, and ECudk, confirming that ECgsk, ECtdk, and ECudk could be extracted without disrupting or lysing E. coli.

[0158] [Example 10] Activity of extracted enzyme (kinase) (3) The synthesis of dNTP from dNMP was confirmed in Example 8. Therefore, the synthesis of dNTP from dN was further investigated.

[0159] <1> Synthesis of dATP from dA The reaction of deoxyadenosine (dA) to deoxyadenosine triphosphate (dATP) was investigated using the kinase ScADO1 extracted in Example 3 and the kinases Ecadk and ECpykF extracted in Example 2 as an enzyme reaction solution.

[0160] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dATP, producing a dATP solution: 1 M Tris-HCl pH 8, 2 μL (final 100 mM), 0.5 M KCl, 2 μL (final 50 mM), 125 mM MgCl 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 2 μL (Final 25 mM) 1 mM dATP 2 μL (Final 0.1 mM) 100 mM dA 2 μL (Final 10 mM) Enzyme reaction solution (ScADO1: pH 9) prepared in Example 3 2 μL Enzyme reaction solution (ECadk: pH 9) prepared in Example 2 2 μL Enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL Distilled water 2 μL Total 20 μL

[0161] Next, PCR was carried out using the following reaction solution. The PCR reaction was the same as that described in Example 7 <1> Synthesis of dATP from dAMP. Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL 1 M Tris-HCl pH 8.5 1.5 μL The above dATP solution 0.5 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50 mM) 0.5 μL dGTP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0162] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 18. In Figure 18, the left lane is a marker, and the right lane is a lane to which the PCR amplification product was applied (dATP reaction solution), a lane to which distilled water was applied (DW), and a lane to which 10 mM dATP was applied as a standard. As is clear from Figure 18, PCR amplification products were obtained, confirming that the kinase ScADO1 extracted in Example 3 and the kinases Ecadk and ECpykF extracted in Example 2 have enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dA.

[0163] <2> Synthesis of dGTP from dG The reaction of deoxyguanosine (dG) to deoxyguanosine triphosphate (dGTP) was investigated using the kinase ECgsk extracted in Example 9, the kinase ECgmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 as an enzyme reaction solution.

[0164] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dGTP, producing a dGTP solution: 1 M Tris-HCl pH 8, 2 μL (final 100 mM), 0.5 M KCl, 2 μL (final 50 mM), 125 mM MgCl 22 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvate) 2 μL (Final 25 mM) 1 mM dGTP 2 μL (Final 0.1 mM) 100 mM dG 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 9 (ECgsk: pH 9) 2 μL Enzyme reaction solution prepared in Example 6 (ECgmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0165] Next, PCR was carried out using the following reaction solution. The PCR reaction was the same as that described in Example 7 <1> Synthesis of dATP from dAMP. Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL 1 M Tris-HCl pH 8.5 1.5 μL The above dGTP solution 0.5 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO 4 (50 mM) 0.5 μL dATP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0166] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 19. In Figure 19, the left lane is a marker, and the right lane is a lane to which the PCR amplification product was applied (dGTP reaction solution), a lane to which distilled water was applied (DW), and a lane to which 10 mM dGTP was applied as a standard. As is clear from Figure 19, PCR amplification products were obtained, confirming that the kinase ECgsk extracted in Example 9, the kinase ECgmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 had enzymatic activity. Furthermore, it was confirmed that dGTP was synthesized from dG.

[0167] <3> Synthesis of dTTP from dT The reaction of deoxythymidine (dT) to deoxythymidine triphosphate (dTTP) was investigated using the kinase ECtdk extracted in Example 9, the kinase ECtmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 as an enzyme reaction solution.

[0168] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dTTP, producing a dTTP solution: 2 μL of 1 M Tris-HCl pH 8 (final 100 mM), 2 μL of 0.5 M KCl (final 50 mM), and 125 mM MgCl. 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 2 μL (Final 25 mM) 1 mM dTTP 2 μL (Final 0.1 mM) 100 mM dT 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 9 (ECtdk: pH 9) 2 μL Enzyme reaction solution prepared in Example 6 (ECtmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0169] Next, PCR was carried out using the following reaction solution. The PCR reaction was the same as that described in Example 7 <1> Synthesis of dATP from dAMP. Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL 1 M Tris-HCl pH 8.5 1.5 μL The above dTTP solution 0.5 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO 4 (50 mM) 0.5 μL dATP (10 mM) 0.5 μL dCTP (10 mM) 0.5 μL dGTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0170] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 20. In Figure 20, the left lane is a marker, and the right lane is a lane to which the PCR amplification product was applied (dTTP reaction solution), a lane to which distilled water was applied (DW), and a lane to which 10 mM dTTP was applied as a standard. As is clear from Figure 20, PCR amplification products were obtained, confirming that the kinase ECtdk extracted in Example 9, the kinase ECtmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 had enzymatic activity. Furthermore, it was confirmed that dTTP was synthesized from dT.

[0171] <4> Synthesis of dCTP from dC The reaction of deoxycytidine (dC) to deoxycytidine triphosphate (dCTP) was investigated using the kinase ECudk extracted in Example 9, the kinase ECcmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 as an enzyme reaction solution.

[0172] The following was added to a 1.5 mL container and reacted in one pot at 30°C for about 2 hours to synthesize dCTP, producing a dCTP solution: 2 μL of 1 M Tris-HCl pH 8 (final 100 mM), 2 μL of 0.5 M KCl (final 50 mM), and 125 mM MgCl. 2 2 μL (Final 12.5 mM) 250 mM PEP (phosphoenolpyruvic acid) 2 μL (Final 25 mM) 1 mM dCTP 2 μL (Final 0.1 mM) 100 mM dC 2 μL (Final 10 mM) Enzyme reaction solution prepared in Example 9 (ECudk: pH 9) 2 μL Enzyme reaction solution prepared in Example 6 (ECcmk: pH 9) 2 μL Enzyme reaction solution prepared in Example 2 (ECpykF: pH 9) 2 μL Distilled water 2 μL Total 20 μL

[0173] Next, PCR was carried out using the following reaction solution. The PCR reaction was the same as that described in Example 7, <1> Synthesis of dATP from dAMP. Helix DNA polymerase (Helix Extension Co., Ltd.) 0.2 μL 1 M Tris-HCl pH 8.5 1.5 μL The above dCTP solution 0.5 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO 4(50 mM) 0.5 μL dATP (10 mM) 0.5 μL dGTP (10 mM) 0.5 μL dTTP (10 mM) 0.5 μL Distilled water 3.8 μL Total 10.0 μL

[0174] The results of confirming PCR amplification products by agarose electrophoresis are shown in Figure 21. In Figure 21, the left lane is a marker, and the right lane is a lane to which the PCR amplification product was applied (dCTP reaction solution), a lane to which distilled water was applied (DW), and a lane to which 10 mM dCTP was applied as a standard. As is clear from Figure 21, PCR amplification products were obtained, confirming that the kinase ECudk extracted in Example 9, the kinase ECcmk extracted in Example 6, and the kinase ECpykF extracted in Example 2 had enzymatic activity. Furthermore, it was confirmed that dCTP was synthesized from dC.

[0175] The contents of all patent and non-patent literature cited herein are hereby incorporated by reference in their entirety.

Claims

1. A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or synthesizing ribonucleoside triphosphate (NTP) from ribonucleosides, comprising placing in a reaction vessel: (i) a deoxyribonucleoside or a ribonucleoside as a starting material; (ii) enzymes, including a nucleoside kinase capable of generating deoxyribonucleoside monophosphate from the deoxyribonucleoside or ribonucleoside monophosphate from the ribonucleoside, a nucleoside monophosphate kinase capable of generating deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase; and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as a phosphate donor to prepare a reaction solution, and then the reaction is carried out in one pot.

2. The method according to claim 1, wherein the concentration ratio of phosphoenolpyruvic acid (PEP) to deoxyribonucleoside or ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) in the reaction solution at the start of the reaction is 3.0 or more.

3. The method according to claim 1 or 2, characterized in that the concentration ratio of the deoxyribonucleoside triphosphate (dNTP) or ribonucleoside triphosphate (NTP) to the deoxyribonucleoside or ribonucleoside in the reaction solution at the start of the reaction (dNTP or NTP / deoxyribonucleoside or ribonucleoside) is 0.5 or less.

4. The method according to any one of claims 1 to 3, wherein the nucleoside kinase, the nucleoside monophosphate kinase, and the pyruvate kinase are derived from yeast or bacteria.

5. The method according to any one of claims 1 to 4, characterized in that the reaction time is 0.1 to 24 hours.

6. A method according to any one of claims 1 to 5, wherein the enzyme reaction solution obtained by extracting at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast expressing the enzyme comprises treating the bacteria or yeast with an enzyme extract at 4 to 95°C for 0.1 hour to 4 days in a 0.01 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or amphoteric surfactant and adjusted to a pH of 6 to 11, and wherein the enzyme reaction solution obtained by the method does not include a step of disrupting or lysing the bacteria or yeast; and wherein the enzyme reaction solution obtained by the method is used as is as the enzyme.

7. The method according to any one of claims 1 to 6, characterized in that deoxyadenosine or adenosine is used as a starting material, adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase are used as enzymes, the adenosine kinase is adenosine kinase derived from yeast, and the adenosine monophosphate kinase is adenosine kinase derived from yeast or bacteria.

8. A method for synthesizing deoxynucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate, or synthesizing ribonucleoside triphosphate (NTP) from ribonucleoside monophosphate, characterized in that a reaction solution is prepared by adding the following to a reaction vessel: (i) deoxyribonucleoside monophosphate or ribonucleoside monophosphate as a starting material; (ii) nucleoside monophosphate kinase capable of producing deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate, or ribonucleoside diphosphate from the ribonucleoside monophosphate, and pyruvate kinase as enzymes; and (iii) nucleoside triphosphate or deoxynucleoside triphosphate and phosphoenolpyruvate (PEP) as phosphate donors, and the method is carried out in one pot.

9. The method according to claim 8, wherein the enzyme reaction solution obtained by extracting at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase while retaining its enzymatic activity from bacteria or yeast expressing said enzyme comprises treating the bacteria or yeast with an enzyme extract which is a 0.01 to 1.0 M buffer solution containing 0 to 3% of a nonionic surfactant or amphoteric surfactant and adjusted to a pH of 6 to 11 at 4 to 95°C for 0.1 hours to 4 days, and wherein the method does not include a step of disrupting or lysing the bacteria or yeast; and wherein the enzyme reaction solution obtained by the method is used as is as the enzyme.

Citation Information

Patent Citations

  • Method for making nucleotides

    JP2002537772A