Compositions and methods for generating protein-based sheets for tissue engineering
Protein-based sheets with a crosslinked network of partially ordered polypeptides address the limitations of ADM by providing a cost-effective, biocompatible, and mechanically adaptable solution for tissue engineering in diverse surgical applications.
Patent Information
- Application Number
- PCT/US2025/010122
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-01
- Filing Date
- 2025-01-02
- Publication Date
- 2025-09-04
AI Technical Summary
Existing biological implants, such as acellular dermal matrix (ADM), face limitations including high cost, lack of elasticity, and risks of infection, which hinder their widespread adoption in applications like burns, wounds, abdominal wall procedures, reconstructive and cosmetic breast procedures, and head and neck surgeries.
Development of protein-based articles comprising a crosslinked network of partially ordered polypeptides with disordered and ordered domains, which can be produced at scale and tailored for specific applications, offering biocompatibility and mechanical properties suitable for tissue engineering.
The protein-based sheets provide a cost-effective, biocompatible solution with tunable mechanical properties, enhancing wound healing and structural support while reducing the risk of infection and extrusion, suitable for various surgical applications.
Smart Images

Figure US2025010122_04092025_PF_FP_ABST
Abstract
Description
Attorney Docket No.: INSO-006 / 01WO 344681-2029 COMPOSITIONS AND METHODS FOR GENERATING PROTEIN-BASED SHEETS FOR TISSUE ENGINEERING CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to U.S. Application No.63 / 560,293, which was filed on March 1, 2024. This application is hereby incorporated by reference in its entirety for all purposes. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (INSO_006_01WO_SeqList_ST26.xml; Size: 497,963 bytes; and Date of Creation: January 1, 2025) are herein incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under R43GM149096 awarded by the National Institute of General Medical Sciences (NIGMS) of the National Institutes of Health. The government has certain rights in the invention. BACKGROUND
[0004] As our understanding of wound healing, tissue biology, and manufacturing / materials science has progressed in recent decades, the methods and techniques employed for reshaping traumatized, congenitally malformed, or aesthetically displeasing abnormalities have expanded rapidly, in part due to the wide array of materials available as substrates. While synthetic materials are helpful in a variety of surgical settings, permanent prostheses suffer by nature of their inability to become completely incorporated into the human form—a permanent synthetic implant is always at risk for infection, extrusion, and invasion into surrounding tissue. Biological implants, however, carry the unique ability to become integrated into the native tissue, which aids in wound healing and offers a more biocompatible solution.
[0005] Specifically, acellular dermal matrix (ADM) has revolutionized approaches to difficult clinical scenarios, including head and neck, breast, abdominal wall, and extremity surgery. Due to the unique characteristics of biological implants and the variety of available products, ADMs can be tremendously helpful in a range of applications within the field of plastic surgery, includingAttorney Docket No.: INSO-006 / 01WO 344681-2029 burns and wounds, abdominal wall procedures, reconstructive breast procedures, cosmetic breast procedures, and head and neck procedures. While most ADMs comprise processed tissue, such as freeze-dried intact basement membrane obtained from donor skin, the applications of such biologically-derived materials are limited. Accordingly, the present disclosure presents a protein- based material for use in tissue engineering, including as an ADM or an ADM alternative for burns and wounds, and extending to abdominal wall procedures, reconstructive breast procedures, cosmetic breast procedures, head and neck procedures, and beyond. BRIEF SUMMARY
[0006] The present disclosure relates generally to protein-based articles, methods, and systems thereof for generated sheets for tissue engineering.
[0007] In one aspect, the disclosure provides a protein-based article comprising: a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
[0008] In another aspect, the disclosure provides a system, comprising: a protein-based article comprising a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or a GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; and a support structure.
[0009] In another aspect, the disclosure provides a method, comprising: preparing a solution comprising a plurality of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; adding crosslinker to the solution to form a composition; applying the |composition to a mold and heating the mold to a predetermined temperature, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating) and the predetermined temperature is greater than the Tt-Attorney Docket No.: INSO-006 / 01WO 344681-2029 heating, wherein the partially ordered polypeptides aggregate at the predetermined temperature, wherein the aggregated partially ordered polypeptides are crosslinked; and drying the molded, crosslinked composition.
[0010] In another aspect, the disclosure provides a protein-based article comprising: a crosslinked network of partially ordered polypeptides, the crosslinked network having a three-dimensional shape, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, and wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
[0011] Additional variations, features, and advantages of the invention will be apparent from the following detailed description and through practice of the invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 (top) shows the incorporation of ordered domains into disordered elastin-like polypeptides (ELPs), which leads to the formation of microporous protein networks, shown in FIG.1 (bottom), which are reminiscent of native elastin.
[0013] FIG.2A demonstrates phase separation of a partially-ordered polypeptide (POP) solution into a porous, solid network at a critical threshold temperature. FIG. 2B demonstrates three- dimensional reconstructed confocal images of networks, revealing that pore size can be tuned with concentration to between 10 μm (at 100 μM concentration) and 500 nm (at 800 μM concentration). FIG. 2C shows that network stiffness can be tuned across more than 4 orders of magnitude by controlling polymer properties.
[0014] FIG. 3 illustrates optical density (OD) measurements of a POP as a function of temperature. The graph shows a sharp, reversible phase behavior and hysteresis (ΔTt). The Tt-heat and Tt-cool can be independently controlled.
[0015] FIG.4 is a summary of POPs developed. Recombinant POPs are comprised of disordered ELP regions and ordered polyalanine helices. As shown, recombinant POPs were constructed of at least one of three ELP components (E1 (SEQ ID NO: 43), E2 (SEQ ID NO: 62), E3 (SEQ ID NO: 63)) and at least one of four polyalanine helices (Helix 1 (SEQ ID NO: 60), Helix 2 (SEQ ID NO: 12), Helix 3 (SEQ ID NO: 61), Helix 4 (SEQ ID NO: 11)) at amino acid percentages up to 50%.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0016] FIGs.5A-5C depict images of POP-comprising compositions as protein-based sheets for tissue engineering. FIG.5A depicts a free protein-based sheet (left) and a support-backed protein- based sheet (right) as recombinant skin grafts. FIG.5B depicts a protein-based sheet as a flexible protein “rubber”. FIG.5C (left) depicts protein-based sheets as translucent thin films. Microscopic images of the translucent thin films are shown on the right (top, bottom) of FIG.5C. As shown in FIG.5C, the protein-based sheet may be a translucent thin film that is, resilient, elastic, and thin (< 300 nm thick).
[0017] FIG. 6 is a flow diagram of a method of forming a protein-based sheet for tissue engineering.
[0018] FIG. 7A and FIG. 7B are flow diagrams of a sub process of a method for forming a protein-based sheet for tissue engineering. Optional steps are indicated by boxes with dashed lines.
[0019] FIGs. 8A-8C depict images of a protein-based sheet as a skin graft. FIG. 8A depicts a protein-based sheet submerged in a fluid. FIG.8B depicts a protein-based sheet folded over itself. FIG.8C depicts a protein-based sheet as a skin patch.
[0020] FIGs. 9A-9D depict a process for forming dehydrated protein-based sheets. Dehydrated protein-based sheets can form the basis for a tissue engineered solution, such as the skin graft in FIG.8C. In FIG.9A, a 7 ml dried 3.5% by weight (750 μM) POP solution plus crosslinker sheet fabricated in the shape of a weigh boat mold is shown. The protein-based sheet in FIG. 9A has been dried at room temperature for 48 hours. FIG.9A, left depicts a top down view of the protein- based sheet and FIG.9A, right depicts a thickness of the protein-based sheet. In FIG.9B, a 7 ml dried 3.5% by weight (750 μM) protein-based sheet fabricated in the shape of a weigh boat mold is shown. The protein-based sheet in FIG.9B was incubated at room temperature for 48 hours. In FIG.9C, a 7 ml 5% by weight (1 mM) POP solution plus crosslinker sheet fabricated in the shape of a weigh boat mold is shown. The protein-based sheet has been dried, rehydrated in PBS, and then further dried. In FIG. 9D, a 750 μM, 7ml protein-based sheet is shown. The protein-based sheet has been dried, rehydrated, and then dried again, and was shown to have a higher transparency after the second drying.
[0021] FIGs.10A-10D depict images of a support-backed protein-based sheet and its application. FIG. 10A shows an exemplary mesh support backing used in conjunction with a protein-based sheet. FIG.10B and FIG. 10C depict a 7 ml hydrated 3.5% by weight (750 μM) protein-based sheet that has been cured over a mesh support backing. FIG.10B depicts a top down view of the support-backed protein-based sheet and FIG. 10C depicts a side view of the support-backedAttorney Docket No.: INSO-006 / 01WO 344681-2029 protein-based sheet to convey thickness. The mesh support backing provides a durable backing for the protein-based sheet. FIG.10D depicts a support-backed protein-based sheet applied as a skin graft. As shown, the support backing may be a polymer mesh.
[0022] FIGs. 11A-11C depict protein-based sheets imprinted with patterns. FIG.11A depicts a hydrated 10 ml 3% by weight (~600 μM) protein-based sheet with an imprinted mesh pattern. The protein-based sheet was made by preparing a POP solution, adding a crosslinking mixture, and then pouring it into a gel mold as a thin layer. While still liquid, a piece of mesh support backing was placed on top, rather than submerged within, and the mixture was allowed to cure at 37°C. After full curing (~10 minutes at 37°C, followed by 30 minutes at room temperature), the mesh support backing was lifted off the top of the cured protein-based sheet. This resulted in the imprinted pattern observed. The magnified view (inset) depicts this hatch pattern. FIG. 11B depicts a dehydrated fragment of an imprinted 3% by weight protein-based sheet. This shows that the microstructure achieved after curing, while still hydrated, is maintained after the protein-based sheet is fully dehydrated. As shown in FIG.11C, even when rehydrated, the pattern is maintained and visible when applied to the skin.
[0023] FIGs. 12A-12E depict the ability of the composition to be formed into a shape for e.g., implantation. FIG. 12A depicts a cured, hydrated molded skull made from 10 ml of a 6% by weight (~1.2 mM) POP solution. To fabricate the skull, a solution of 6% by weight POP (60 mg / ml) in PBS was prepared on ice. After resuspension, a crosslinker was added to the solution, on ice. Once mixed, the resulting composition was poured into a silicone mold. The cured mixture was true to the shape of the mold but did lose certain finer details. With reference to FIG. 12B and FIG.12C, a 10 ml 3.5% by weight protein-based sheet was fabricated in a non-flat mold (a breast mold), highlighting the ability of the protein-based sheet to maintain structure. FIG.12B depicts a dried protein-based sheet coating the inner lining of a small breast mold, where the protein-based sheet is nearly imperceptible. FIG. 12C depicts a hydrated protein-based sheet coating the inner wall of the breast mold. FIG.12D and FIG.12E depict the protein-based sheet removed from the breast mold and held on a hand. In FIG.12D, the protein-based sheet is shown upside down and, in FIG.12E, the protein-based sheet is shown right side up. These structures highlight the ability of the protein-based sheets to maintain a non-flat structure.
[0024] FIG.13A and FIG.13B depict ultrathin protein-based sheets. High concentrations of POP at low composition volumes result in dried sheets having less than 1 μm in thickness. Such protein-Attorney Docket No.: INSO-006 / 01WO 344681-2029 based sheets may also be translucent. FIG.13A depicts a top view of the protein-based sheet and FIG.13B shows a side view of the protein-based sheet.
[0025] FIGs.14A-14C depict a fragment of a 6% by weight (~1.2 mM) protein-based sheet that has been fully dried, rehydrated with PBS, and then fully dried again. All drying was done at room temperature, leaving the protein-based sheet exposed to the air for 48 hours. After multiple drying events, the fragment takes on a more transparent yellow hue. Higher concentration sheets are denser and, when dried, are less brittle, feeling more like a hard plastic such as, for example, poly vinyl chloride. FIG. 14A depicts is a top-down view of the fragment of FIG. 14B. FIG. 14C depicts a side view of the fragment of FIG.14B.
[0026] FIG. 15 depicts thicker protein-based sheets that have been rehydrated. As shown, rehydrating thicker protein-based sheets creates a material that is less fragile and can be folded, stretched, and shaped, while being able to return to its original shape. FIG.15 depicts this thicker protein-based sheet at baseline, when stretched, and when folded.
[0027] FIGs. 16A-16C depict a protein-based sheet as a biological rubber. As shown, protein- based sheets are deformable, and elastic given their protein composition. They can be easily manipulated without loss of structure or conformation.
[0028] FIG.17 is a flow diagram of a sub process of the Primary Drying (113, FIG.7B) method. Process 113 can be performed in one of three ways: either by 133a, 113b, OR 113c. One method must be selected to reach 113e. The box with dashed lines outline that 2 of the 3 options can be classified as freeze-drying or lyophilization.
[0029] FIG.18A and FIG.18B depict a POP film fully dried after lyophilization. The film was prepared by crosslinking 750 µM material with glutaraldehyde at a 2:1 stoichiometric ratio (2 aldehydes to each lysine). The mixture was poured into a 5x12cm silicone mold and allowed to aggregate and crosslink at ambient temperature. The aggregated composition was frozen at -80 C and subsequently lyophilized. FIG.18A depicts a horizontal view of the POP film and FIG.18B depicts a vertical view of the POP film.
[0030] FIGs.19A-19C depict the dried POP film from FIG.18A and FIG.18B rehydrated. The dried film was placed in a solution of saline for 5 minutes before handling. The resuspended film shows a high degree of flexibility when handling (FIG.19A, frontal view; FIG.19B, side view; FIG.19C, perspective view).Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0031] FIG.20A and FIG.20B depict the elasticity when handling a rehydrated POP film (from FIG 18A and FIG.18B). FIG.20A shows an unstretched POP and FIG.20B shows a stretched POP.
[0032] FIG.21A and FIG.21B depict a dried (e.g., lyophilized) (FIG.21A) and rehydrated (FIG. 21B) POP film trimmed using scissors.
[0033] FIG. 22 shows polymer films can be produced to bear various surface topographies including a micro-texture, macro-texture, or completely smooth surface (left to right). Macroscopic (top) and scanning electron microscopy images (bottom) are shown for each topography. Films produced with different crosslinkers, including tetrakis (hydroxymethyl)phosphonium chloride (THPC) (left) and glutaraldehyde (GA) (right) are shown.
[0034] FIG. 23 shows POP film solutions can be cast into a mold with varied crosslinker to polymer ratios (top figure). Stoichiometric ratios are indicated as X:Y where X is the number of crosslinker reactive sites and Y is the number of polymer reactive sites (lysine). Various crosslinkers can be used such as GA or THPC to create polymer films (bottom figure).
[0035] FIGs.24A-24H show tensile testing indicating that changing crosslinker to polymer ratio can alter the mechanical properties of POP sheets. Stress-strain curves are shown for three ratios up to the point of yield strength (FIG.24A). The peak load (FIG.24B), modulus (FIG.24C), and strain (FIG. 24D) at the yield strength of each film is also shown. Tensile tested samples were prepared by casting formulations into dog bone molds and drying (FIG. 24E). After hydration, samples underwent tensile loading until material failure (FIGs.24F-24H).
[0036] FIG. 25A and FIG. 25B depict a rehydrated POP film sutured in place on surgically discarded abdominal skin. FIG.25A shows a film partially suture on top on the skin one sutured into a skin defected created to simulate suturing for skin replacement after a wound. FIG. 25B depicts a zoomed in image of the same. Sutures are evident surrounding the film. DETAILED DESCRIPTION Definitions
[0037] The term “a” or “an” refers to one or more of that entity, i.e. can refer to plural referents. As such, the terms “a,” “an,” “one or more,” and “at least one” are used interchangeably herein. In addition, reference to “an element” by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0038] Throughout this application, the term “about” is used to indicate that a value includes the variation of error for the device or the method being employed to determine the value, or the variation that exists among the samples being measured. In embodiments, the term “about” means within 10% above or below the reported numerical value (except where such number would exceed 100% of a possible value or go below 0%). When used in conjunction with a range or series of values, the term “about” applies to the endpoints of the range or each of the values enumerated in the series, unless otherwise indicated. As used in this application, the terms “about” and “approximately” are used as equivalents.
[0039] All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1-2.0 includes 0.1, 0.2, 0.3, 0.4 ... 2.0, including all values therebetween (e.g., 0.15). If the end points are modified by the term "about," the range specified is expanded by a variation (e.g., up to ±10% of any value) within the range or within 3 or more standard deviations, including the end points.
[0040] As used herein, the terms "control," or "reference" are used herein interchangeably. A "reference" or "control" level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. "Control" also refers to control experiments or control cells.
[0041] A "peptide" or "polypeptide" is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a combination of natural and synthetic amino acids. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms "polypeptide," "protein," and "peptide" are used interchangeably herein. "Primary structure" refers to the amino acid sequence of a particular peptide. "Secondary structure" refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains, e.g., enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tall domains. "Domains" are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Typical domains are made up of sections of lesser organization such as stretches of beta- sheet and alpha-helices. "Tertiary structure" refers to the complete three- dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three- dimensional structure formed by the noncovalent association of independent tertiary units. A "motif" is a portion of a polypeptide sequence and includes at least two amino acids. A motif may be 2 to 20, 2 to 15, or 2 to 10 aminoAttorney Docket No.: INSO-006 / 01WO 344681-2029 acids in length, in embodiments, a motif includes 3, 4, 5, 6, or 7 sequential amino acids. A domain may be comprised of a series of motifs, which may be similar or different.
[0042] As used herein the term “sequence identity” refers to the extent to which two optimally aligned polynucleotides or polypeptide sequences are invariant throughout a window of alignment of residues, e.g. nucleotides or amino acids. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical residues which are shared by the two aligned sequences divided by the total number of residues in the reference sequence segment, i.e. the entire reference sequence or a smaller defined part of the reference sequence. “Percent identity” is the identity fraction times 100. Comparison of sequences to determine percent identity can be accomplished by a number of well-known methods, including for example by using mathematical algorithms, such as, for example, those in the BLAST suite of sequence analysis programs. Unless noted otherwise, the term “sequence identity” in the claims refers to sequence identity as calculated by Clustal Omega® using default parameters. Variant" as used herein with respect to a polynucleotide means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a polynucleotide that is substantially identical to a referenced polynucleotide or the complement thereof; or (iv) a polynucleotide that hybridizes under stringent conditions to the referenced polynucleotide, complement thereof, or a sequences substantially identical thereto.
[0043] As used herein, the term "subject" refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In embodiments, the subject is a primate. In embodiments, the subject is a human. As used herein, a subject is "in need of treatment" if such subject would benefit biologically, medically, or in quality of life from such treatment.
[0044] A "variant" can further be defined as a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity. Representative examples of "biological activity" include the ability to be bound by a specific antibody or polypeptide or to promote an immune response. Variant can mean a substantially identical sequence. Variant can mean a functional fragment thereof. Variant can also mean multiple copies of a polypeptide. The multiple copies can be in tandem or separated by a linker. Variant can also mean a polypeptide with an amino acid sequence that is substantiallyAttorney Docket No.: INSO-006 / 01WO 344681-2029 identical to a referenced polypeptide with an amino acid sequence that retains at least one biological activity.
[0045] A variant can be a polynucleotide sequence that is substantially identical over the full length of the full gene sequence or a fragment thereof. The polynucleotide sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 88%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the gene sequence or a fragment thereof. A variant can be an amino acid sequence that is substantially identical over the full length of the amino acid sequence or fragment thereof. The amino acid sequence can be 80%, 81%, 82%, 83%, 84%, 85%, 88%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino acid sequence or a fragment thereof.
[0046] As used herein “crosslinked” and the like, refer to a covalent bond formed between the side chains of two amino acids. In embodiments, the crosslinked amino acids are located on the same polypeptide. In embodiments, the crosslinked amino acids are located on different polypeptides.
[0047] As used herein “amine reactive site” refers to a functional group that is capable of reacting with an amine. Such functional groups include carboxylic acids.
[0048] As used herein “carboxylic group reactive site” refers to a functional group that is capable of reacting with a carboxylic acid. Such functional grounds include an amine or an alcohol.
[0049] As noted above, to improve treatment outcomes, biological treatments are required for injuries including burns and wounds, abdominal wall procedures, reconstructive breast procedures, cosmetic breast procedures, and head and neck procedures. For instance, while grafting has long been a staple for the replacement of lost skin, acellular dermal matrix (ADM) has become increasingly popular in these cases over the past 20 years for coverage of open soft tissue defects. While skin grafting is significantly less expensive, ADM placement can help prevent a painful and displeasing donor site. ADM products are effective in wound coverage and allow for sufficient elasticity to prevent contracture. Aside from burn wounds, ADM has been shown to be effective in the treatment of diabetic foot ulcers. As it relates to abdominal wall procedures, many surgeons have found themselves operating in the abdomen with poor fascia for closure, combined with contamination from enteric sources. There has always been interest in an implant material that would add strength to the abdominal closure while resisting infection. Permanent mesh is unusable in these situations, and temporary synthetic meshes often do not provide adequate or lasting tensile strength to prevent hernia formation. ADM has been shown toAttorney Docket No.: INSO-006 / 01WO 344681-2029 be effective in decreasing hernia recurrence rates in infected fields when compared to primary closure without mesh. Similarly, in the setting of permanent mesh infection, removal of the infected implant often leaves a large defect in a contaminated operative field. Biological mesh provides an opportunity to bolster the closure without the risk of permanent infection requiring reoperation. Not all studies have had overwhelmingly positive results with ADM for abdominal wall reconstruction, due to high recurrence rates, extrusion, and infection. Regarding reconstructive breast procedures, reconstruction with tissue expanders and implants is a multistage process that can be exhausting to patients already coping with a difficult diagnosis. The limitation of immediate one-stage reconstruction has always been the inability to completely cover an implant with sufficient soft tissue to ensure a tension-free closure and avoid implant extrusion. Typically, with placement of a subpectoral expander, the taut muscle is the limiting factor for implant size and thus requires expansion. ADM has been increasingly used as an internal support and cover for single-stage operations. In many cases, this allows for single-stage reconstruction with placement of the final implant at the time of initial reconstruction. Overall, materials with a high elastin content are desirable in this application, due to their ability to stretch. Although ADM products have been utilized extensively in breast reconstruction, similar techniques have been applied in cosmetic breast surgery. ADM placement can yield a natural contour for significant irregularities. One significant deterrent from widespread application in cosmetic procedures is the need for patients to absorb the cost of the ADM. As it relates to head and neck procedures including, for example, eyelid and periorbital surgery, the surgeon is often in need of a biological construct that will provide enough structure for support while simultaneously offering an aesthetically natural, soft contour. ADM has been used successfully in these cases to bolster lid structure and fill volume deficits. Secondary rhinoplasty is often plagued by insufficient structural support to establish the desired optimal cosmetic outcome. In these patients, many surgeons have found ADM useful for filling space while maintaining a soft contour in either saddle nose deformities or irregularities of the alar rim. In addition, nasal septal perforations have been successfully treated with ADM. In children with cleft palate, there is often insufficient soft tissue to provide stable, tension-free closure. ADM has been useful for adding bulk to this closure, whether primarily, in revisional surgery, or for treatment of a fistula. In addition, ADM has been useful in the healing process of nasoalveolar bone grafting by providing additional nasal-oral mucosal lining where it is otherwise deficient. Similarly, ADM has been successfully placed toAttorney Docket No.: INSO-006 / 01WO 344681-2029 line the oral cavity following intraoral cancer extirpation with similar quality of life to split- thickness skin grafts, at a lower cost, and without donor defects.
[0050] Nevertheless, despite promising early results in each of these areas, the drawbacks of biologically-derived ADM, such as cost, lack of elasticity, risks of infection, and the like, have limited the widespread adoption of these materials. Accordingly, the present disclosure presents a protein-based material for use in tissue engineering, including as an ADM for burns and wounds, abdominal wall procedures, reconstructive breast procedures, cosmetic breast procedures, head and neck procedures, and the like, that addresses each of the drawbacks of naturally-, or biologically-derived ADM. Partially Ordered Polypeptides
[0051] The term "Fractomer", “partially ordered polypeptide,” “partially ordered polymer,” and “POP” are used interchangeably herein to refer to the class of recombinant, artificial proteins that are designed to mimic native elastin. Partially ordered polypeptides (POPs) are thermally responsive, allowing them to be injected as a liquid, yet rapidly form a porous, solid network at body temperature. Alternatively, a POP can be prepared as a liquid, formed into a desired shape, and then heated to form a solid which is then implanted or applied. Examples of POPs are described in International Patent Application Publication No. WO2019006374A1, which is incorporated by reference herein in its entirety.
[0052] Each POP may include a plurality of disordered domains and a plurality of structured domains. A POP may exhibit phase transition behavior by changing solubility and aggregate dissolution / formation with temperature.
[0053] Provided herein are protein-based articles comprising films comprising a crosslinked network of POPs. In embodiments, the film has a thickness of about 0.1 μm to about 10 mm. In embodiments, each POP independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif. In embodiments, each ordered domain independently comprises an alpha helix. In embodiments, each ordered domain independently comprises a polyalanine motif or a polyproline motif. In embodiments, the firm comprises the reaction product of a plurality of POPs and a plurality of cross-linkers. The POPs and crosslinkers may be the same or different.
[0054] Provided herein are systems and methods for deploying a composition comprising a POP as a pre-formed sheet. In this way, biological capability of the composition is extended to, for example, use in a topical application (e.g., burn dressing). Further, the composition, or protein-Attorney Docket No.: INSO-006 / 01WO 344681-2029 based sheet formed therefrom, can be incorporated with a support backing, such as a mesh, to be used in conjunction with internal support / wound care (e.g., hernia repair, internal breast support). In embodiments, the method of forming the protein-based sheets of the present disclosure includes at least one cycle of dehydration and rehydration. In embodiments, the protein-based sheets are provided to a user in a hydrated state or in a dehydrated state, based on the end use case. For instance, when provided in a dehydrated state, the protein-based sheet can be rehydrated either by a patient’s own moisture (e.g., when used in a wound dressing) or prior to implantation. As will be described herein, the protein-based sheets of the present disclosure can also be patterned or imprinted and can be formed into and maintain a pre-molded shape, as required by the desired end use (e.g., breast tissue support).
[0055] The presently disclosed protein-based articles, which contain POPs, are advantageous materials because they can be produced in E. coli at a large scale easily and for a low-cost. The shape and mechanical properties of the presently disclosed protein-based articles can also be altered, which makes these articles ideal acellular matrices. i. Disordered Domains
[0056] The POP may include a plurality of disordered domains. The disordered domain may comprise any polypeptide that (i) has minimal or no secondary structure as observed by circular dichroism (CD) and (ii) has phase transition behavior. Phase transition behavior occurs when the disordered polypeptide alters between a soluble and aggregated state depending on environmental conditions. In embodiments, the environmental condition is the temperature or salt concentration. The disordered domain may include an amino acid sequence of repeated amino acids, non- repeated amino acids, or a combination thereof.
[0057] In embodiments, each disordered domain independently comprises a PG or GP motif. PG or GP motifs comprise the dipeptide proline-glycine or the dipeptide glycine-proline separated by one or more additional amino acids. In embodiments, the primary structure of a disordered domain comprising a PG or GP motif comprises from about 5 % to about 50 % of proline and from about 5 % to about 50 % of glycine based on the total number of amino acids in the disordered domain. In embodiments, an unstructured domain comprising a PG or a GP motif comprises a primary structure having from about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, aboutAttorney Docket No.: INSO-006 / 01WO 344681-2029 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, or about 50 % proline and / or glycine based on the total number of amino acids in the disordered domain.
[0058] Exemplary PG and GP motifs include elastin-like polypeptides (ELPs). ELPs exhibit lower critical solution temperature (LCST) phase behavior, reversibly alternating between soluble and aggregated states at a critical threshold temperature, which may be tuned at the genetic level through variation of the guest residue.
[0059] In embodiments, a PG motif comprises an amino acid sequence selected from PG, P(X)nG, and (B)mP(X)nG(Z)p, or a combination thereof, wherein m, n, and p are independently an integer from 1 to 15, and wherein B, X, and Z are independently any amino acid.
[0060] In embodiments, the PG or GP motif comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif. In embodiments, each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 1 to 50. In embodiments, each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 1 to 50, wherein a ratio of Ala to Val in the amino acid sequence of (VPGCG)n(SEQ ID NO: 66) ranges from 10:1 to 1:10. In embodiments, at least one disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO:2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1.
[0061] In embodiments, about 20% to about 99%, such as about 25% to about 97%, about 35% to about 95% or about 50% to about 94% of the POP comprises disordered domains. At least about 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the POP may comprise disordered domains.
[0062] In embodiments, a disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 2), wherein X is any amino acid and n is an integer greater than or equal to 1. In embodiments, n is an integer from 1 to 500. In embodiments, n is at least, at most, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365,Attorney Docket No.: INSO-006 / 01WO 344681-2029 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In embodiments, n may be less than 500, less than 400, less than 300, less than 200, or less than 100. In embodiments, n is from 1 to 500, from 1 to 400, from 1 to 300, from 1 to 200, or from 60 to 180. In embodiments, n is 60, 120, or 180. In embodiments, X is any amino acid except proline. In embodiments, X is Val, or Ala, or an alternating iteration of Ala and Val. In embodiments, X is Val. In embodiments, X is Ala. In embodiments, X is an alternating iteration of Ala and Val. In embodiments, X is an alternating iteration of Ala and Val in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In embodiments, X is a mixture of Ala and Val in a ratio of 1:1 or 1:4. In embodiments, X is an alternating iteration of Ala and Val in a ratio from 10:1 to 1:10 (Ala:Val), such as from 5:1 to 1:5 or from 1:1 to 1:4.
[0063] In embodiments, a disordered domain has an amino acid sequence with at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 %, or 100 % identity to a polypeptide of any one of SEQ ID NOS: 1, 2, 43, 48-51, and 80. ii. Structured Domains
[0064] The POP may include a plurality of structured domains (i.e. ordered domains). The structured domains (i.e. ordered domains) may have a secondary structure as observed by CD, such as, for example, an alpha helix. In embodiments, at least one structured domain independently comprises an alpha helix. In embodiments, each ordered domain independently comprises an alpha helix. In embodiments, at least one structured domain independently comprises a beta sheet. In embodiments, each ordered domain independently comprises a beta sheet. In embodiments, the ordered domain comprises an alpha helix comprising (Ala)25 (SEQ ID NO: 8).
[0065] The structured domain may comprise at least one of a polyproline domain and a polyalanine domain. In embodiments, the POP comprises alternating disordered domains and structured domains. In embodiments, at least one structured domain comprises a polyalanine domain. In embodiments, the structured domain comprises only polyalanine domains. In embodiments, at least one structured domain comprises a polyproline domain. In embodiments, the structured domain comprises only polyproline domains.
[0066] In embodiments, about 4% to about 75%, such as about 5% to about 70%, about 6% to about 60% or about 7% to about 50% of the POP comprises structured domains. At least aboutAttorney Docket No.: INSO-006 / 01WO 344681-2029 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the POP may comprise structured domains.
[0067] In embodiments, the structured domain comprises a polyalanine domain. Each polyalanine domain may include at least 4 or at least 5 alanine residues (e.g., 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, including all values and ranges therein). In embodiments, the polyalanine domain comprises from about 4 alanines to about 500 alanines, from about 4 alanines to about 400 alanines, from about 4 alanines to about 300 alanines, from about 4 alanines to about 200 alanines, from about 4 alanines to about 100 alanines, or from about 4 alanines to about 50 alanines.
[0068] In embodiments, a structured domain comprises a polyalanine domain (Ala)m wherein m is an integer from 5 to 500 (SEQ ID NO: 69). In embodiments, a polyalanine domain comprises of one or more of: (A)25(SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
[0069] In embodiments, each polyalanine domain comprises an amino acid sequence of [Bp(A)qZr]n(SEQ ID NO: 46) or [(BAs)tZr]n(SEQ ID NO: 47), wherein B is Lys, Arg, Asp, or Glu; A is Ala; Z is Lys, Arg, Asp, or Glu; n is an integer from 1 to 50; p is an integer from 0 to 2; q is an integer from 1 to 50; r is an integer from 0 to 2; s is an integer from 1 to 5; and t is an integer from 1 to 50. In another embodiment, a structured domain comprises one or more of (A)25(SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12). In another embodiment, about 4% to about 75% of the POP comprises structured domains. In embodiments, each ordered domain comprises a polyalanine motif comprising at least 4 alanine residues. In embodiments, the at least 4 alanine residues are consecutive. In embodiments, from about 50 % to about 100 % of the amino acids in each polyalanine motif are in an alpha-helical conformation, including all values and ranges therebetween. In embodiments, at least about 50%, at least about 55 %, at least about 60 %, at least about 65 %, at least about 70 %, at least about 75 %, at least about 80 %, at least about 85 %, about least about 90 %, or at least 95 % of the amino acids in each polyalanine motif are in an alpha-helical conformation. In embodiments, the at least about 50% of the amino acids in the polyalanine motif are alanine residues.
[0070] In embodiments, a structured domain comprises a polyproline domain (Pro)m, wherein m is an integer from 5 to 500. Each polyproline domain may include at least 4 or at least 5 proline residues (e.g., 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,Attorney Docket No.: INSO-006 / 01WO 344681-2029 100, 150, 200, 250, 300, 350, 400, 450, 500, including all values and ranges therein). In embodiments, the polyalanine domain comprises from about 4 prolines to about 500 prolines, from about 4 prolines to about 400 prolines, from about 4 prolines to about 300 prolines, from about 4 prolines to about 200 prolines, from about 4 prolines to about 100 prolines, or from about 4 prolines to about 50 prolines.
[0071] In embodiments, a structured domain has an amino acid sequence with at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 %, or 100 % identity to a polypeptide of any one of SEQ ID NOS: 3-13, 42, 46, and 47. iii. Cross-Linking within POPs
[0072] In embodiments, provided herein are protein-based articles comprising a cross-linked network of POPs. In embodiments, cross-linking between a first POP and a second POP is covalent (e.g., via a disulfide bond, an enamine bond, a carbon-carbon bond, an amide bond, or via an ester linkage). In embodiments, cross-linking between a first POP and a second POP is non-covalent (e.g., by charge interaction, metal ion coordination, or hydrogen bonding interactions).
[0073] In embodiments, cross-linking between a first POP and a second POPs occurs between one or more amino acid side chains of the POP. In embodiments, cross-linking occurs between a side chain of lysine, cysteine, arginine, glutamic acid, aspartic acid, tyrosine, histidine, serine, threonine, tryptophan, glutamine, and asparagine on a first POP and a side chain of lysine, cysteine, arginine, glutamic acid, aspartic acid, tyrosine, histidine, serine, threonine, tryptophan, glutamine, and asparagine on a second POP. In embodiments, the first and / or second POP comprises a crosslinkable amino acid derivative. Non-limiting examples of crosslinkable amino acid derivatives include azidohomoalanine, homopropargylglycine, p-benzoylphenylalanine, p- azidophenylalanine, p-iodophenylalanine, p-acetylphenylalanine, ε-azidolysine, N6-(2- azidoethoxycarbonyl)-L-lysine, Nε-propargyloxycarbonyl-L-lysine, Nε-biotinyl-L-lysine, hydroxyproline, allo-threonine.
[0074] In embodiments, a first POP and a second POP are covalently linked via a disulfide bond, an enamine bond, a carbon-carbon bond, a thioether bond, an amide bond, an ester linkage, an imine bond, a dityrosine bond, a thiol-maleimide bond, or a triazole bond.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0075] In embodiments, cross-linking between a first POP and a second POP occurs when a crosslinkable amino acid derivative within the first POP or second POP is exposed to UV light. In embodiments, a UV-crosslinkable amino acid derivative is any amino acid that has been functionalized with an azide group. In embodiments, the amino acid derivative is para- azidophenylalanine.
[0076] In embodiments, a UV-crosslinkable amino acid is included in a POP sequence at varying amounts without affecting the POP's ability to transition at different temperatures. For example, the POP may comprise from about 0.1 % to about 20%, from about 0.5% to about 15%, or from about 1% to about 10% of a UV-crosslinkable amino acid.
[0077] While the POP may form an aggregate above the Tt-heating due to physical crosslinks from helical domain swapping, this does not preclude the use of additional chemical crosslinking techniques to further modulate mechanical properties.
[0078] In embodiments, provided herein are protein-based articles comprising a cross-linked network of POPs, which are produced by reacting a POP described herein with a crosslinker. In embodiments, the crosslinker is a covalent crosslinker. In embodiments, the covalent crosslinker is a chemical crosslinker, a pH-based crosslinker, may utilize click chemistry, ultraviolet light, or a combination thereof. When ultraviolet light is used, a UV functionalized POP may be used. In embodiments, the chemical crosslinker is an amine reactive crosslinker. In embodiments, the chemical crosslinker is configured to crosslink residues, motifs, and the like of the POPs. Non- limiting examples of chemical crosslinkers include tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester crosslinkers, NHS-maleimide, NHS-pyridyldithiol, (1R,8S,9s)- Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N- hydroxysuccinimidyl ester, propargyl-N-hydroxysuccinimidyl ester, maleimide-PEG2- succinimidyl ester, Azido-dPEG4-NHS ester, 3-(2-Pyridyldithio)propionic acid N- hydroxysuccinimide ester, 3-Maleimidobenzoic acid N-hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N- Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8-succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N-hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N-hydroxysuccinimide ester, LC- SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), azido- dPEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl- 6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-Attorney Docket No.: INSO-006 / 01WO 344681-2029 pyridyldithio)propionamido]hexanoate), O-[N-(3-maleimidopropionyl)aminoethyl]-O’-[3-(N- succinimidyloxy)-3-oxopropyl]triethylene glycol, O-[N](3-Maleimidopropionyl)aminoethyl]-O’- [3-(N-succinimidyloxy)-3-oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3- bromoacetamido)propionate), SPDP-dPEG4-NHS ester, acid-dPEG5-NHS ester, O,O’-Bis[2-(N- succinimidyl-succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl- alpha-methyl-alpha(2-pyridyldithio)toluene), phthalimidooxy-dPEG4-NHS ester, acid-dPEG9- NHS ester, Fmoc-N-amido-dPEG8-NHS ester, SPDP-dPEG8-NHS ester, glutaraldehyde (aka 1,5 pentanedial), paraformaldehyde, and Fmoc-N-amido-dPEG4-NHS ester. It will be appreciated that these crosslinking groups are described in terms of its structure prior to incorporation into the crosslinked POP. Upon incorporation and formation of covalent bonds with amino acid side chains, the structure of the crosslinker changes. The present application encompasses the structure of the crosslinker upon incorporation into the POP and formation of covalent bonds with the side chains of amino acids in the POP. Reference to a crosslinker also includes the modified structure of the crosslinker upon incorporation into the POP and formation of covalent bonds with the side chains of amino acids in the POP. In embodiments, the crosslinking may be performed on ice. In embodiments, the crosslinking may be performed above Tt-heating of the POPs. In embodiments, the chemical crosslinker may be added to the solution at a ratio of POP molecules to chemical crosslinker molecules. In embodiments, the ratio of POP molecules to chemical crosslinker molecules is from 1:12 to 8:3 POP molecules to crosslinker molecules. In embodiments, the ratio of POP molecules to chemical crosslinker molecules is about 1 to about 10, about 2 to about 10, about 3 to about 10, about 4 to about 10, about 5 to about 10, about 1 to about 1, about 2 to about 1, about 3 to about 1, about 4 to about 1, about 5 to about 1, about 10 to about 1, about 20 to about 1, about 30 to about 1, about 40 to about 1, about 50 to about 1, about 100 to about 1, about 200 to about 1, about 300 to about 1, about 400 to about 1, about 500 to about 1, about 1,000 to about 1, about 2,000 to about 1, about 3,000 to about 1, about 4,000 to about 1, about 5,000 to about 1, and / or about 10,000 to about 1.
[0079] In embodiments, the chemical crosslinker is added to the composition at a ratio of number of crosslinking sites on a chemical crosslinker to the number of available crosslinking sites on each partially ordered polypeptide. In embodiments, the ratio of number of crosslinking sites on a chemical crosslinker to the number of available crosslinking sites on each partially ordered polypeptide is from 10:1 to 1:4. In embodiments the ratio of number of crosslinking sites on aAttorney Docket No.: INSO-006 / 01WO 344681-2029 chemical crosslinker to the number of available crosslinking sites on each partially ordered polypeptide is 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:4.
[0080] In embodiments, each crosslinking site is a lysine residue, an aspartic acid residue, an amine reactive site, or a carboxylic group reactive site. In embodiments, each crosslinking site is a lysine residue or an aspartic acid residue. In embodiments, the ratio of chemical crosslinker to the composition is about 6 to about 1. In embodiments, the crosslinking comprises adding a crosslinker to the composition and periodically inverting the composition.
[0081] In embodiments, the chemical crosslinker is added to the composition at a ratio of number of crosslinking sites on a chemical crosslinker to the number of available crosslinking sites on each partially ordered polypeptide. One skilled in the art can determine the number of crosslinking sites on the chemical crosslinker. In embodiments, the crosslinking sites on the partially ordered peptide comprise amino acid side chains comprising amine groups. In embodiment, the amino acid side chains comprising amine groups are lysine side chains. In embodiments, crosslinking occurs as a result of a chemical reaction between a carboxylic acid on a crosslinker (i.e., the reactive site on the crosslinker) and an amine group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker (i.e., the reactive site on the crosslinker) and a carboxyl group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, the ratio of carboxyl group on the crosslinker to amine group on the partially ordered peptide ranges from 10:1 to 1:4 (e.g., 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:4, including all values and ranges therein). In embodiments, the ratio of carboxyl group to amine group is 2:1.
[0082] In embodiments, crosslinking occurs as a result of a chemical reaction between a carbonyl group on a crosslinker (i.e., the reactive site on the crosslinker) and an amine group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker (i.e., the reactive site on the crosslinker) and a carbonyl group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, the ratio of carbonyl group on the crosslinker to amine group on the partially ordered peptide ranges from 10:1 to 1:4 (e.g., 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:4, including all values and ranges therein). In embodiments, the ratio of carbonyl group to amine group ranges from 4:1 to 2:3, including 4:1, 2:1, or 2:3.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0083] In embodiments, crosslinking occurs as a result of a chemical reaction between a hydroxyl group on a crosslinker (i.e., the reactive site on the crosslinker) and an amine group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker (i.e., the reactive site on the crosslinker) and a hydroxyl group on the partially ordered polypeptide (i.e., the reactive site on the partially ordered polypeptide). In embodiments, the ratio of hydroxyl group to amine group ranges from 10:1 to 1:4 (e.g., 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:4, including all values and ranges therein). In embodiments, the ratio of hydroxyl group to amine group ranges from 4:1 to 2:3, including 4:1, 2:1, or 2:3.
[0084] In some embodiments, no crosslinker is added to the POP solution. iv. Exemplary POPs
[0085] The disordered domains and the structured domains of the POP can be arranged in any number of possible ways, in embodiments, one or more disordered domains are positioned between at least two adjacent structured domains of the POP. In embodiments, the POP includes a plurality of structured domains repeated in tandem and a plurality of disordered domains repeated in tandem, in embodiments, the plurality of structured domains repeated in tandem are positioned C-terminal to the plurality of disordered domains repeated in tandem, in embodiments, the plurality of structured domains repeated in tandem are positioned N-terminal to the plurality of disordered domains repeated in tandem. In embodiments, the POP is arranged as [disordered domain]q- [structured domain]r -[disordered domain]s-[structured domain]t, wherein q, r, s, and t are independently an integer from 0 to 100, such as from 1 to 100, from 2 to 100, from 1 to 50 or from 2 to 50. In embodiments, the POP is arranged as [disordered domain]q-[structured domain]r, wherein q and r are independently an integer from 1 to 100. In embodiments, q, r, s, and t are independently an integer from 0 to 10, from 0 to 20, from 0 to 30, from 0 to 40, from 0 to 50, from 0 to 60, from 0 to 70, from 0 to 80, from 0 to 90, from 0 to 100, from 1 to 10, from 1 to 20, from 1 to 30, from 1 to 40, from 1 to 150, from 1 to 60, from 1 to 70, from 1 to 80, from 1 to 90 or from 1 to 100.
[0086] In embodiments, provided herein is a POP comprising a plurality of disordered domains comprising an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and a plurality of ordered domains comprising a polyalanine motif. In embodiments, the polyalanine motif comprises (Ala)mwhereinAttorney Docket No.: INSO-006 / 01WO 344681-2029 m is an integer from 5 to 50. In embodiments, the polyalanine motif comprises one or more of (A)n(SEQ ID NO: 3), K(A)nK (SEQ ID NO: 4), D(A)nK (SEQ ID NO: 5), GD(An)K (SEQ ID NO: 6), or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100. In embodiments, the polyalanine motif comprises one or more of (A)25 (SEQ ID NO: 8), K(A)25K (SEQ ID NO: 9), D(A)25K (SEQ ID NO: 10), GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
[0087] In embodiments, provided herein is a POP comprising a plurality of disordered domains, each comprising a PG motif comprising an amino acid sequence selected from PG, P(X)nG, and (B)mP(X)nG(Z)p, or a combination thereof, wherein m, n, and p are independently an integer from 1 to 15, and wherein B, X, and Z are independently any amino acid; and a plurality of structured domains, each comprising a polyalanine domain. In embodiments, each polyalanine domain comprises at least five alanine residues and has at least about 50% of the amino acids in an α- helical conformation. In embodiments, at least one disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO:2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1. In embodiments, at least about 60% of the amino acids in each polyalanine domain are in an a-helical conformation.
[0088] In embodiments, the structured domain comprises an alpha helix, wherein the alpha helix is periodically inserted into a disordered domains of unstructured elastin-like polypeptide (ELP) that is composed of typically 80-120 total repeats of a VPGXG pentapeptide (~30-50 kDa; FIG. 1). In embodiments, the ELP is composed of typically 90-120 total repeats of a GXGVP pentapeptide (~30-50 kDa). This combination of controlled ordered and disordered domains within a protein sequence allows control over handling and material properties. By altering the composition of these POPs and their segment organization, POPs can form mechanically stable, interpercolated networks (i.e., porous networks) with high surface to volume ratios and fractal dimensions similar to native elastin (FIG.1).
[0089] In embodiments, the POP comprises a plurality of disordered domains; and a plurality of structured domains. In one embodiment, the POP has the general structure of [(GXGVP)n-α- helix]m (SEQ ID NO: 67), where X can be any amino acid except proline and a-helix is any polyalanine based α-helix having about 5 to 50 Alanine residues. In another embodiment, the POP has the structure [(GXGVP)n-GX1(A)25X1]m(SEQ ID NO: 68); where X is A or V; X1is K or D; n is an integer from 10 to 20; and m is an integer from 4 to 8 (e.g., [(SEQ ID NO: 2)n-(SEQ ID NO: 11 or 12)]m).Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0090] In embodiments, provided herein is a POP comprising a structured domain of oligoalanine amino acids (from 5 to 500 (SEQ ID NO: 69), but typically A25(SEQ ID NO: 8)) that form α- helices and are periodically inserted into an unstructured elastin-like polypeptide (ELP) that is composed of typically 80-120 total repeats of a (GXGVP)n pentapeptide motif (~30-50 kDa) (SEQ ID NO: 2), where X is any standard amino acid except proline. In embodiments, the unstructured polypeptide or “disordered domain’’ is a (GXGVP)nmotif (SEQ ID NO: 2), wherein X is Val (SEQ ID NO: 48), or Ala (SEQ ID NO: 49), or mixture of Ala and Val, and wherein n is an integer from 1 to 50. In embodiments, X is an alternating iteration of Ala and Val in a ratio from 10:1 to 1:10 (Ala:Val). In embodiments, X is an alternating iteration of Ala and Val in a ratio of 1:1 (SEQ ID NO: 50) or 1:4 (SEQ ID NO: 51).
[0091] In another embodiment, the POP comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of: M[(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 52); M[(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 53); M[(GVGVP)15-GK(A25)K]6-GWP (SEQ ID NO: 54); M[(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 55); M[(G[A1:V1]GVP)16- GD(A25)K]6-GWP (SEQ ID NO: 56); M[(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 57); M[(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 58); and M[(G[V4:A1]GVP)15- GD(A25)K]4-GWP (SEQ ID NO: 59).
[0092] In one embodiment, the POP comprises a sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to M[(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 52) or M[(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 58).
[0093] A complete listing of exemplary sequences, sequence motifs, and POP constructs is provided herein. In embodiments, a POP has an amino acid sequence with at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 %, or 100 % identity to a polypeptide of any one of SEQ ID NOS: 52-59. In embodiments, a POP has an amino acid sequence with at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 %, or 100 % identity to a polypeptide of any one of SEQ ID NOS: 52 or 58.Attorney Docket No.: INSO-006 / 01WO 344681-2029 v. Properties of POPS
[0094] In embodiments, the POP may phase transition at a variety of temperatures. In embodiments, the POP may have a transition temperature (Tt) from about 0 °C to about 100 °C, from about 10 °C to about 50 °C, or from about 20 °C to about 42 °C. The transition temperature of heating (Tt-heating) and transition temperature of cooling (Tt-cooling) may be identical. As used herein, temperatures may be "identical" when the temperatures are within 2.0 °C, 1.0 °C, 0.5 °C, or 0.1 °C of each other. In embodiments, the transition temperature of heating (Tt-heating) is greater than the transition temperature of cooling (Tt-cooling). In embodiments where the POP has a Tt-heating greater than the Tt-cooling, the difference between the two transition temperatures may be referred to as a hysteresis. In embodiments, the POP has a hysteresis of about 5 °C to about 70 °C, such as about 5 °C to about 60 °C or about 10 °C to about 50 °C.
[0095] Phase separation of a POP solution upon increasing the temperature above its transition temperature (Tt) can lead to formation of a physically crosslinked porous network that is reminiscent of crosslinked elastin networks (FIG. 2A). By tuning the composition and segment organization of POPs, mechanically stable, interpercolated networks with a high surface to volume ratio and a fractal dimension (D) of ~1.7, similar to native elastin, can be designed. By modulating POP concentration, molecular weight, and density of physically crosslinking the ordered domains (e.g., alpha helices), network pore sizes from 500 nm–20 μm (FIG.2B), and mechanical stability, with elastic moduli (G’) ranging from 10Pa to 10 kPa (FIG.2C) can be controlled.
[0096] As noted above, despite the solid, microporous architecture, POP networks are thermally responsive. When heated, POPs will spontaneously form a network at a tunable Tt-heating and, unlike traditional thermally responsive materials, POP networks will dissolve at a separate, lower Tt-cooling. Thus, a POP coacervate is stable within the hysteretic range between Tt-cooling and Tt-heating, which provides an unusually wide operating range of temperatures (Fig. 3). In embodiments, networks formed in a cell incubator will not dissolve at room temperature, thus allowing easy (and cheaper) culture handling and media changes.
[0097] In embodiments, the POP may form an aggregate when the temperature is greater than the Tt-heating. The aggregate may resolubilize when cooled to below a temperature less than the Tt- cooling.
[0098] The aggregate formed from a plurality of POPs may be a variety of sizes and dimensions. In embodiments, the aggregate is a stable three-dimensional matrix. In embodiments, theAttorney Docket No.: INSO-006 / 01WO 344681-2029 aggregate is fractal-like. In embodiments, the aggregate is gel-like. In embodiments, the aggregate is porous with a void volume, e.g., the nonprotein rich phase of the aggregate. In embodiments, the void volume is tunable. For example, the aggregate may have a void volume from about 60% to about 90% (of the volume of the aggregate), in addition, the aggregate may comprise pores having a diameter of about 1 µm to about 100 µm, such as about 1 µm to about 10 µm, about 3 µm to about 5 µm, about 25 µm to about 60 µm, about 30 µm to about 50 µm, or about 3 µm to about 50 µm. In embodiments, the aggregate may comprise pores having a diameter of about 1 pm to about 100 pm, such as about 1 pm to about 10 pm, about 3 pm to about 5 pm, about 25 pm to about 60 pm, about 30 pm to about 50 pm, or about 3 pm to about 50 pm.
[0099] In embodiments, the solid aggregate is a stable three-dimensional matrix. This three- dimensional matrix may encapsulate the tissue matrix. In embodiments, the solid aggregate comprises a plurality of micropores. In embodiments, the composition comprises between about 200 µM and about 2.5 mM of the POP. In embodiments, the composition comprises between about 300 µM and about 2.4 mM, about 400 µM and about 2.3 mM, about 500 µM and about 2.2 mM, about 600 µM and about 2.1 mM, about 700 µM and about 2.0 mM, about 800 µM and about 1.9 mM, about 900 µM and about 1.8 mM, about 1.0 mM and about 1.7 mM, about 1.1 mM and about 1.6 mM, about 1.2 mM and about 1.5 mM, or about 1.3 mM and about 1.4 mM.
[0100] The aggregate formed by a plurality of POPs may have advantageous properties that can arise from the structure of the POPs. For example, the aggregate may have physical, non-covalent crosslinks. These physical, non-covalent crosslinks may arise from helical bundling of the structured domain(s) interacting with each other. The aggregate may also have covalent crosslinks (e.g., chemical crosslinks) in addition to physical, non-covalent crosslinks. Covalent crosslinks can be included in the aggregate in order to increase their mechanical stability without altering their porous architecture. In embodiments, the aggregate can be formed from a plurality of POPs and can then be further stabilized by covalent crosslinking (after the formation of the aggregate). Covalent crosslinks can be introduced via a UV crosslinkable amino acid derivative having an azide functionality as described herein. Further examples of crosslinks that can be incorporated into the aggregate include, but are not limited to, small molecule crosslinks and cysteine disulfide bridges. An example of a chemical, small molecule crosslink is tetrakis(hydroxymethyl)phosphonium chloride (TMPC), which can crosslink lysines within POPs.
[0101] In addition, the aggregate formed by a plurality of POPs may have solid-like properties that distinguish it from liquid-like coacervate structures. For example, the aggregate may have aAttorney Docket No.: INSO-006 / 01WO 344681-2029 storage modulus (C) that is greater than its loss modulus (G"), such as having a G' 2* greater, 5x greater, 10x greater, 15x greater, 20x greater, 25x greater, 30x greater, 35x greater, 50x greater or 100x greater than its G”. In embodiments, the aggregate has a G' from 2x greater to 100x greater than its G", such as from 10x greater to 50x greater or from 20x greater to 35x greater than its G”.
[0102] Further provided are polynucleotides encoding the POPs described herein. A vector may include the polynucleotide encoding the POPs detailed herein. To obtain expression of a polypeptide, one may subclone the polynucleotide encoding the polypeptide into an expression vector that contains a promoter to direct transcription, a transcription / translation terminator, and if for a nucleic acid encoding a protein, a ribosome binding site for translational initiation. An example of a vector is pET24. Suitable bacterial promoters are well known in the art. Further provided is a host cell transformed or transfected with an expression vector comprising a polynucleotide encoding a POP as described herein. Bacterial expression systems for expressing the protein are available in, e.g., E. coli, Bacillus species., and Salmonella. See Paiva et al., Gene 22: 229-235 (1983); Mosbach et al., Nature 302: 543-545 (1983). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. Retroviral expression systems can be used in the present invention. Polymer Library Design
[0103] In embodiments, the general design of POPs is based on alternating groups of disordered ELP domains and ordered polyalanine domains (FIG. 1). In an exemplary procedure, these sequences can be optimized to include either 12.5 or 25% total helical content to insure proper network formation. A subset of the optimized POPs can be further modified with integrin binding domains to better control interactions with cells cultured within the POP networks. These domains can then be added to the N and / or C terminus, or within the disordered ELP region of the polypeptide chains to determine the optimal conformation to promote cell adhesion and viability within the POP networks. In addition, a subset of POPs can be further modified to be photo- crosslinked with ultraviolet (UV) light via the incorporation of an unnatural amino acid (UAA), paraazidophenylalanine (pAzF), within the disordered ELP regions of the polymer chain. An example of specific domain organization and the name use for each polymer are shown in FIG.4.Attorney Docket No.: INSO-006 / 01WO 344681-2029 Production of POPs Synthesis of POP Genes
[0104] In embodiments, POPs are cloned as previously described. In embodiments, POPs are recombinantly synthesized in E. coli by overexpression of a plasmid-borne gene that encodes the POPs. As a result, they can take advantage of the protein fermentation and scale-up process used already by the biopharmaceutical industry for inexpensive recombinant protein production. In certain embodiments, POPs are synthesized within yeast, a cell-free mammalian system, or other protein expression systems or bacterial hosts.
[0105] In embodiments, polymers are cloned into a modified pet24 vector using a process known as recursive directional ligation by plasmid reconstruction (PRe-RDL). In an exemplary protocol, single-stranded oligomers encoding the desired sequences can be annealed into cassettes with CC and GG overhangs, allowing concatemerization and ligation into the pet24 vector. This can be used to create a library of ELP and polyalanine cassettes which could be strung together through multiple cycles of PRe-RDL to form the final compositions. In embodiments, plasmids are transfected into chemically competent EB5a cells for cloning and BL21(DE3) cells for protein expression. Expression and Purification of POPs
[0106] In embodiments, protein expression is performed in E. coli using fermentation to achieve high density cell culture, followed by protein isolation and purification. In an exemplary protocol, starter cultures of a semi-complex medium can be inoculated from cryostocks of recombinant E. coli (BL21 derived) containing POPs producing genes and grown overnight. In embodiments, the starter culture is used to inoculate a larger volume primary culture of the same medium, which is grown for 6 to 8 hours and then used to inoculate the fermenter containing the same medium. The E. coli culture can then be grown as a fed batch fermentation using a glucose feed as the provided carbon source, at a high agitation speed with supplied oxygen and pH control, in order to yield high density cell culture. The E. coli can be induced to turn on protein expression during exponential phase of growth. In embodiments, the E. coli culture is grown under induction conditions to allow for high levels of protein production. In embodiments, the E. coli culture is harvested and remaining medium is removed by centrifugation. In embodiments, resulting cell paste is resuspended with 1x phosphate buffered saline (PBS) at a 5:1 vol / wt ratio. In embodiments, the resuspension is run through two passes in a microfluidizer at 10,000 psi in orderAttorney Docket No.: INSO-006 / 01WO 344681-2029 to lyse cells. In embodiments, cell lysate is treated with 0.5% polyethyleneimine (PEI) to remove contaminating DNA and insoluble cell waste and centrifuged at 12,000 x g for 10min at 4°C to remove cell waste. The resulting supernatant containing the soluble protein target can then be collected. Protein can be purified from this solution using four rounds of hot / cold centrifugation. In an exemplary protocol, the solution can be heated at 45°C for 1 hour, causing the desired protein to aggregate and fall out of solution as an insoluble fraction. Once aggregated, the mixture can be centrifuged at 5,000 x g for 10 minutes at 37°C in order to form a protein pellet of the target protein. The supernatant can then be discarded. In embodiments, the protein pellet is resuspended in 1x PBS (5:1 vol / wt) and incubated at 4°C, while shaking, for 4 hours in order to solubilize the protein back into solution. Once fully resuspended, the soluble protein solution can be centrifuged at 12,000x g for 10 minutes at 4°C to remove insoluble waste. After centrifugation the cold supernatant containing the target protein can be collected. In embodiments, the cycle of hot / cold centrifugation is repeated at least 3 times, achieving a 95% purity of our target protein, as determined by SDS-PAGE. In embodiments, the purified protein solution is then treated for endotoxin removal using a chemical treatment and filtration. In embodiments, protein solution is brought into a salt free water background using dialysis with multiple buffer exchanges. In embodiments, the final, salt free, protein solution is filtered sterilized and then lyophilized for final storage. Production of Protein-Based Articles Comprising Films (also called “Sheets”) Comprising POPS
[0107] With reference first to FIG. 5A through FIG. 5C, protein-based sheets according to the methods disclosed below can form recombinant skin grafts (FIG. 5A), flexible protein “rubber” (FIG. 5B), and / or translucent thin films (FIG. 5C), among other variations of the protein-based sheets. As shown in FIG. 5A, the protein-based sheet can be used alone (left) or with a support backing (right), such as a polymer mesh. In an example, FIG.5C depicts protein-based sheets as translucent films having a thickness of less than 300 nm.
[0108] These and other protein-based sheets can be formed according to method 100 of FIG.6.
[0109] At step 102 of method 100, a solution comprising partially ordered peptides (POPs) can be prepared. The solution may comprise POPs in a buffer solution. The buffer solution may comprise phosphate buffered saline (PBS), Dulbecco’s Phosphate Buffered Saline, HEPES, Trizma®base, sodium bicarbonate, Tris-EDTA buffer solution, water, distilled water, and / or double distilled water. As introduced above, the POPs used in method 100 can include a pluralityAttorney Docket No.: INSO-006 / 01WO 344681-2029 of disordered domains and a plurality of ordered domains, where each disordered domain independently may comprise a PG or GP motif and each ordered domain independently may comprise a polyalanine motif or a polyproline motif. In embodiments, each disordered domain may comprise an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X may be any amino acid except proline and n may be an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif. In embodiments, each disordered domain may comprise an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X may be independently Val or Ala, and wherein n may be an integer from 2 to 50, from 10 to 40, from 15 to 35, and / or from 20 to 30. X may be an alternating iteration of Ala to Val in a ratio from 10:1 to 1:10. The polyalanine motif may comprises (Ala)m (SEQ ID NO: 65), wherein m may be an integer from 5 to 50. In embodiments, each disordered domain may comprise an amino acid sequence of (GXGVP)n(SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain may comprise a polyalanine motif. Each disordered domain may comprise an amino acid sequence of (GXGVP)n (SEQ ID NO: 70), X may be independently Val or Ala, and n may be an integer from 2 to 50, from 10 to 40, from 15 to 35, and / or from 20 to 30. In either pentapeptide sequence, the polyalanine motif may comprise one or more of (A)n (SEQ ID NO: 3), K(A)nK (SEQ ID NO: 4), D(A)nK (SEQ ID NO: 5), GD(An)K (SEQ ID NO: 6), or GK(An)K (SEQ ID NO: 7), wherein n may be an integer from 2 to 100. In an example, the polyalanine motif may comprise one or more of (A)25(SEQ ID NO: 8), K(A)25K (SEQ ID NO: 9), D(A)25K (SEQ ID NO: 10), GD(A25)K (SEQ ID NO: 11), or GK(A25)K (SEQ ID NO: 12). In embodiments, the POP may have a transition temperature of heating (Tt-heating). The Tt-cooling may be dependent on the concentration of the POP in the solution. The Tt-heating and the Tt-cooling may range from about 10 °C to about 45 °C. The POP may form a solid aggregate above the Tt-heating.
[0110] The POP solution prepared at step 102 of method 100 may comprise POP in buffer solution at about 100 μM to about 3 mM, about 150 μM to about 2 mM, about 200 μM to about 1.5 mM, about 250 μM to about 1.25 mM, about 500 μm to about 1 mM, about 600 μM to about 900 μM, and / or about 700 μm to about 800 μM. In other words, the solution prepared at step 102 of method 100 may comprise at least about 0.1% by weight POP to about 100% by weight POP, about 0.1% by weight POP to about 85% by weight POP, and / or about 50% by weight POP to about 90% by weight POP. The solution can comprise a variety of concentrations of POPs, where higher concentrations result in greater rigidity and stability.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0111] While the POP may form an aggregate above the Tt-heating due to physical crosslinks from helical domain swapping, this does not preclude the use of additional chemical crosslinking techniques to further modulate mechanical properties. In embodiments, a crosslinker may be added to the POP solution at step 104 of method 100 to form a composition. The crosslinker may be a covalent crosslinker. The covalent crosslinker may by a chemical crosslinker, a pH-based crosslinker, may utilize click chemistry, ultraviolet light, or a combination thereof. When ultraviolet light is used, a UV functionalized POP may be used. In embodiments, the chemical crosslinker may be an amine reactive crosslinker. In embodiments, the chemical crosslinker may be configured to crosslink residues, motifs, and the like of the POPs. To this end, the chemical crosslinker may comprise at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), N-hydroxysuccinimide (NHS), ester, NHS- maleimide, NHS-pyridyldithiol, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N- hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG4-NHS ester, 3-(2- Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N- hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8- succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N- hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N- hydroxysuccinimide ester, LC-SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amidocaproate)), azido-PEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl-6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-pyridyldithio)propionamido]hexanoate), O-[N-(3- maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3-oxopropyl]triethylene glycol, O- [N](3-Maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3- oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3-bromoacetamido)propionate), SPDP-PEG4-NHS ester, acid-PEG5-NHS ester, O,O’-Bis[2-(N-succinimidyl- succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl-alpha-methyl- alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG4-NHS ester, acid-PEG9-NHS ester, Fmoc- N-amido-PEG8-NHS ester, SPDP-PEG8-NHS ester, glutaraldehyde (aka 1,5 pentanedial), paraformaldehyde, and Fmoc-N-amido-PEG4-NHS ester. In embodiments, the crosslinking may be performed on ice. In embodiments, the crosslinking may be performed above Tt-heating of theAttorney Docket No.: INSO-006 / 01WO 344681-2029 POPs. In embodiments, the chemical crosslinker may be added to the solution at a ratio of the reactive sites on the crosslinker to the reactive sites on the POP of about 1 to about 10, about 2 to about 10, about 3 to about 10, about 4 to about 10, about 5 to about 10, about 1 to about 1, about 2 to about 1, about 3 to about 1, about 4 to about 1, about 5 to about 1, about 10 to about 1, about 20 to about 1, about 30 to about 1, about 40 to about 1, about 50 to about 1, about 100 to about 1, about 200 to about 1, about 300 to about 1, about 400 to about 1, about 500 to about 1, about 1,000 to about 1, about 2,000 to about 1, about 3,000 to about 1, about 4,000 to about 1, about 5,000 to about 1, and / or about 10,000 to about 1. Generally, the chemical crosslinker may be added to the solution at a ratio of chemical crosslinker to the POP based on a number of available crosslinking sites on each POP. Each crosslinking site may be a lysine residue, an aspartic acid residue, an amine reactive site, or a carboxylic group reactive site on each POP. In an example, the ratio of chemical crosslinker to the POP may be about 6 to about 1 (e.g., 4:1, 2:1, 2:3, including any values or ranges therebetween). In embodiments, crosslinking may comprise adding a crosslinker to the solution and periodically inverting the resulting composition.
[0112] At sub process 106 of method 100, the composition formed at step 104 can be applied to, or poured into, a mold to be formed into a final, desired shape (FIG.7A). When the final, desired shape is a sheet, a corresponding mold shape can be used. Similarly, if the final, desired shape is a thicker sheet, a shape with more complex features (e.g., a skull), and the like, corresponding mold shapes or forms can be used. With reference to FIG. 7B, sub process 106 is described in more detail. Sub process 106 includes two optional steps. Neither optional step 107 nor optional step 109 need be performed.
[0113] At optional step 107 of sub process 106, a support backing may be positioned within a cavity of the mold. The support backing may comprise a mesh backing. The support backing may be naturally-derived or may be a synthetic backing. For instance, the support backing, or support structure, may comprise at least one material selected from the group consisting of polypropylene, polycaprolactone, and cellulose. The composition may then be poured into the cavity of the mold at step 108 of sub process 106. By positioning the support backing within the cavity of the mold before pouring the composition, the support backing can be incorporated within the protein-backed sheet in its final form. If optional step 107 is performed, optional step 109 can be (optionally) skipped. In this instance, sub process 106 proceeds to step 110 and the filled mold can be cured. Step 110 will be described below.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0114] If optional step 109 is performed, sub process 106 may begin with step 108. The composition may be poured into the cavity of the mold. A support backing may then be positioned in contact with a surface of poured composition at step 110 of sub process 106. The support backing may comprise a mesh backing. The support backing may be naturally-derived or may be a synthetic backing. For instance, the support backing, or support structure, may comprise at least one material selected from the group consisting of polypropylene, polycaprolactone, and cellulose. By positioning the support backing within the cavity of the mold after pouring the composition, the support backing can be used to form patterns or other forms within a surface of the protein- backed sheet in its final form. If optional step 109 is performed, optional step 109 can be (optionally) skipped. In either instance, sub process 106 proceeds to step 110 and the filled mold can be cured.
[0115] Curing the filled mold at step 110 of sub process 106 generates the protein-based sheet. The curing may include incubating the filled mold at a temperature greater than the Tt-heating of the POP for a predetermined time period. The predetermined time period may be about 1 minute to about 6 hours, about 2 minutes to about 4 hours, about 3 minutes to about 2 hours, about 4 minutes to about 1 hour, about 5 minutes to about 30 minutes, about 6 minutes to about 20 minutes, about 7 minutes to about 15 minutes, about 8 minutes to about 14 minutes, about 9 minutes to about 13 minutes, and / or about 10 minutes to about 12 minutes. The incubating may be performed under exposure to a controlled gas mixture (e.g., ambient air), at a controlled humidification, and at a controlled temperature (e.g., 37°C). In embodiments, curing includes crosslinking the POP. Though crosslinker may be added before curing at step 104 of method 100, covalent crosslinking of the POP is performed after raising the temperature of the resulting composition above Tt- heating. Heating the resulting composition above Tt-heating of the POP causes the POP to aggregate, thus exposing lysine residues, aspartic acid residues, amine reactive sites, and / or carboxylic group reactive sites to the crosslinker. In other words, the POP is crosslinked concurrently with and / or after curing (e.g., aggregation) of the POP at step 110 of sub process 106. As the POP aggregates, crosslinkable domains become accessible to the crosslinker. For example, as the POP aggregates, lysine residues become accessible to an amine-reactive crosslinker that was added to the POP solution of step 102 to form the composition at step 104.
[0116] As noted above, the shape of the mold in sub process 106 can be dictated by the final, desired shape of the protein-based sheet. The shape can include a topography and / or can include a thickness of the protein-based sheet. In embodiments, the shape of the mold can be such that aAttorney Docket No.: INSO-006 / 01WO 344681-2029 thickness of the protein-based sheet, or protein-based film, is about 0.2 mm to about 5 mm. The thickness of the protein-based sheet can further be defined by a volume of the composition that is deposited into the mold. In embodiments, the mold is a more complex shape, as in FIG.12A. In such an embodiment, the mold may be referred to as a three-dimensional form and may comprise a support structure modified to include features and / or topology desired of a final, desired shape. The support structure may be configured to hold a final, desired volume of the composition. In embodiments, the support structure may define a fillable volume. As shown in FIG. 12A, the fillable volume may be a skull. In embodiments, the support structure may comprise a positive structure and a negative structure and the fillable volume may be defined therebetween. As shown in FIG.12B-E, the positive structure and the negative structure may be offset such that a fillable volume therebetween has the shape of a boat hull. It can be appreciated by one of ordinary skill in the art that more complex shapes and objects may also be formed, as desired, using the methods presented herein.
[0117] After curing of the protein-based sheet at step 110 of sub process 106, method 100 proceeds to sub process 112 and the cured, protein-based sheet can be dried. Drying can result in a protein-based sheet with an infinite shelf life. Drying the cured, protein-based sheet can include one or more stages of drying and / or rehydration. In embodiments, sub process 112 of method 100 includes a primary drying at step 113. The primary drying may comprise one or more of air drying and lyophilizing. In embodiments, the air drying may comprise exposing the protein-based sheet to ambient air at a predetermined temperature and for a predetermined time period. The predetermined temperature may be about 10°C to about 95°C, about 20°C to about 90°C, about 30°C to about 85°C, about 40°C to about 80°C, about 50°C to about 75°C, and / or about 60°C to about 70°C. The predetermined time period may be about six hours to about ten days. In embodiments, the lyophilizing may comprise performing lyophilization for a predetermined time period. The predetermined time period may be about 24 hours to about 72 hours. After the primary drying, the dried, protein-based sheet may have a buffer solution content of about 0.5% to about 70% w / v, about 1% to about 30%, about 1.5% to about 15% w / v, about 2% to about 10%w / v, and / or about 3% to about 5% w / v.
[0118] In embodiments, sub process 113 of method 100 further comprises a method of lyophilizing and storing the protein-based sheets. In embodiments, the protein-based sheet undergoes flash freezing in a cryogenic system / device or a dry ice bath in step 113a to initiate lyophilization in step 113d. In embodiments, the protein-based sheet undergoes a controlled freezeAttorney Docket No.: INSO-006 / 01WO 344681-2029 using conventional freezing elements in step 113b to initiate lyophilization in step 113d. In embodiments, steps 113a and 113d and / or steps 113b and 113d are repeated. In embodiments, sub process 113 further comprises evaporative drying of the protein-based sheet using heat, air flow, or critical point drying in step 113c. In embodiments, following lyophilization or evaporative drying, the protein-based sheet undergoes storages until ready for primary hydration in step 113e.
[0119] In embodiments, sub process 112 of method 100 includes an optional primary rehydration step at step 114. The optional primary rehydration may comprise submerging the dried, protein- based sheet in an aqueous buffer for a predetermined time period. The predetermined time period may be about 1 minute to about 5 days, about 2 minutes to about 4 days, about 3 minutes to about 3 days, about 4 minutes to about 2 days, about 5 minutes to about 1 day, about 6 minutes to about 12 hours, about 7 minutes to about 6 hours, about 8 minutes to about 1 hour, about 9 minutes to about 30 minutes, and / or about 10 minutes to about 15 minutes.
[0120] In embodiments, sub process 112 of method 100 includes an optional secondary drying at step 115. The secondary drying may comprise one or more of air drying and lyophilizing. In embodiments, the air drying may comprise exposing the protein-based sheet to ambient air at a predetermined temperature and for a predetermined time period. The predetermined temperature may be about 10°C to about 95°C, about 20°C to about 90°C, about 30°C to about 85°C, about 40°C to about 80°C, about 50°C to about 75°C, and / or about 60°C to about 70°C. The predetermined time period may be about six hours to about ten days. In embodiments, the lyophilizing may comprise performing lyophilization for a predetermined time period. The predetermined time period may be about 24 hours to about 72 hours. After the secondary drying, the dried, protein-based sheet may have a buffer solution content of at least about 0.5% to about 70% w / v, about 1% to about 30%, about 1.5% to about 15% w / v, about 2% to about 10% w / v, and / or about 3% to about 5% w / v.
[0121] In embodiments, sub process 112 of method 100 includes an optional secondary rehydration step at step 116. The optional secondary rehydration may comprise submerging the dried, protein-based sheet in an aqueous buffer for a predetermined time period. The predetermined time period may be about 1 minute to about 5 days, about 2 minutes to about 4 days, about 3 minutes to about 3 days, about 4 minutes to about 2 days, about 5 minutes to about 1 day, about 6 minutes to about 12 hours, about 7 minutes to about 6 hours, about 8 minutes to about 1 hour, about 9 minutes to about 30 minutes, and / or about 10 minutes to about 15 minutes.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0122] In embodiments, the optional secondary drying at step 115 and / or the optional secondary rehydration at step 116 may be performed iteratively as desired to achieve a particular property of the protein-based sheet or as required by a particular use case (e.g., the particular use case requires the protein-based sheet to be hydrated or dehydrated).
[0123] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 may comprise at least about 0.1% by weight POP to about 100% by weight POP, about 0.1% by weight POP to about 85% by weight POP, and / or about 50% by weight POP to about 90% by weight POP. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 comprise a ratio of crosslinker reactive sites: polymer reactive sites. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 comprise a ratio of crosslinker reactive sites: polymer reactive sites comprising 4:1, 2:1, or 2:3, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 comprise a 4:1 ratio of crosslinker reactive sites: polymer reactive sites. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 comprise a 2:1 ratio of crosslinker reactive sites: polymer reactive sites. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 comprise a 2:3 ratio of crosslinker reactive sites: polymer reactive sites. Properties of Protein-Based Articles
[0124] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for structural properties comprising peak load, peak modulus, strain, and stress. In an exemplary protocol the structural properties can be assessed using TA Instruments RSA-G2 Solids Analyzer. In embodiments, to measure structural properties the POP film formulations can be cast into dog-bone shaped molds with a minimum neck width of 5 mm and a thickness of 2 mm. Samples can then be subjected to a tensile force at a constant linear rate of 0.05 mm / s until complete material failure.
[0125] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for peak load. Peak load is the maximum stress a material can withstand before it experiences failure or permanent deformation. It represents the highest point on the material’s stress-strain curve. In embodiments, the hydrated and / or dehydrated protein- based sheets have a peak load comprising between at least about 0.01 newton (N) to about 1.0 N (e.g., 0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0, including any values or rangesAttorney Docket No.: INSO-006 / 01WO 344681-2029 therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak load comprising between at least about 0.01 newton (N) to about 1.0 N, about 0.1 N to about 1 N, about 0.2 N to about 1 N, about 0.3 N to about 1 N, about 0.4 N to about 1 N, about 0.5 N to about 1 N, about 0.6 N to about 1 N, about 0.7 N to about 1 N, about 0.8 N to about 1 N, about 0.9 N to about 1 N, about 0.01 N to about 0.8 M, about 0.1 N to about 0.8 N, about 0.2 N to about 0.8 N, about 0.3 N to about 0.8 N, about 0.4 N to about 0.8 N, about 0.5 N to about 0.8 N, about 0.6 N to about 0.8 N, about 0.7 N to about 0.8 N, about 0.01 N to about 0.7 N, about 0.1 N to about 0,7 N, about 0.2 N to about 0.7 N, about 0.3 N to about 0.7 N, about 0.4 N to about 0.7 N, about 0.5 N to about 0.7 N, about 0.6 N to about 0.7 N, about 0.01 N to about 0.6 N, about 0.1 N to about 0.6 N, 0.2 N to about 0.6 N, about 0.3 N to about 0.6 N, about 0.4 N to about 0.6 N, about 0.5 N to about 0.6 N, about 0.01 N to about 0.5 N, about 0.1 N to about 0.5 N, about 0.2 N to about 0.5 N, about 0.3 N to about 0.5 N, about 0.4 N to about 0.5, about 0.01 N to about 0.4 N, about 0.1 N to about 0.4 N, about 0.2 N to about 0.4 N, about 0.3 N to about 0.4 N, about 0.01 N to about 0.3 N, about 0.1 N to about 0.3 N, about 0.2 N to about 0.3 N, about 0.01 N to about 0.2 N, about 0.1 N to about 0.2 N, or about 0.01 N to about 0.1 N, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak load comprising between at least about 0.01 N to about 0.3 N, about 0.05 N to about 0.3 N, about 0.1 N to about 0.3 N, about 0.15 N to about 0.3 N, about 0.2 N to about 0.3 N, about 0.25 N to about 0.3 N, about 0.01 N to about 0.25 N, about 0.05 N to about 0.25 N, about 0.1 N to about 0.25 N, about 0.15 N to about 0.25 N, about 0.2 N to about 0.25 N, about 0.01 N to about 0.2 N, about 0.05 N to about 0.2 N, about 0.1 N to about 0.2 N, about 0.15 N to about 0.2 N, about 0.01 N to about 0.15 N, about 0.05 N to about 0.15 N, about 0.1 N to about 0.15 N, about 0.01 N to about 0.1 N, about 0.05 N to about 0.1 N, or about 0.01 N to about 0.05 N, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak load comprising between at least about 0.2 N and about 0.3 N.
[0126] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for peak modulus. Peak modulus is the maximum value of the material’s modulus of elasticity (also known as “Young's modulus” or “tensile modulus”) during its deformation. It represents the highest stiffness a material exhibits before reaching the point of yielding, significant plastic deformation, or failure. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between at least about 1 kPa to about 300 kPA (e.g., 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170,Attorney Docket No.: INSO-006 / 01WO 344681-2029 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 kPa, including any values or ranges therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between at least about 1 kPa to about 300 kPa, about 25 kPa to about 300 kPa, about 50 kPa to about 300 kPa, about 75 kPa to about 300 kPa, about 100 kPa to about 300 kPa, about 125 kPa to about 300 kPa, about 150 kPa to about 300 kPa, about 175 kPa to about 300 kPa, about 200 kPa to about 300 kPa, about 225 kPa to about 300 kPa, about 250 kPa to about 300 kPa, about 275 kPa to about 300 kPa, about 1 kPa to about 250 kPa, about 25 kPa to about 250 kPa, about 50 kPa to about 250 kPa, about 75 kPa to about 250 kPa, about 100 kPa to about 250 kPa, about 125 kPa to about 250 kPa, about 150 kPa to about 250 kPa, about 175 kPa to about 250 kPa, about 200 kPa to about 250 kPa, about 225 kPa to about 250 kPa, about 1 kPa to about 200 kPa, about 25 kPa to about 200 kPa, about 50 kPa to about 200 kPa, about 75 kPa to about 200 kPa, about 100 kPa to about 200 kPa, about 125 kPa to about 200 kPa, about 150 kPa to about 200 kPa, about 175 kPa to about 200 kPa, about 1 kPa to about 150 kPa, about 25 kPa to about 150 kPa, about 50 kPa to about 150 kPa, about 75 kPa to about 150 kPa, about 100 kPa to about 150 kPa, about 125 kPa to about 150 kPa, about 1 kPa to about 100 kPa, about 25 kPa to about 100 kPa, about 50 kPa to about 100 kPa, about 75 kPa to about 100 kPa, about 1 kPa to about 50 kPa, or about 25 kPa to about 50 kPa, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising about 150 kPa.
[0127] In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between at least about 30 kPa to about 50 kPa (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 kPa, including any values or ranges therebetween). In embodiment the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between at least about 30 kPa to about 50 kPa, 35 kPa to about 50 kPa, about 40 kPa to about 50 kPa, about 45 kPa to about 50 kPa, about 30 kPa to about 45 kPa, about 35 kPa to about 45 kPa, about 40 kPa to about 45 kPa, about 30 kPa to about 40 kPa, about 35 kPa to about 40 kPa, or about 30 kPa to about 35 kPa, including and values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between about 30 kPa to about 50 kPa.
[0128] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for compressive modulus. In embodiments, the hydrated and / or dehydrated protein-based sheets have a compressive modulus comprising between at least aboutAttorney Docket No.: INSO-006 / 01WO 344681-2029 0.01 N / cm to about 25 N / cm (e.g., 0.25, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 N / cm, including any values or ranges therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets have a compressive modulus comprising between at least about 0.01 N / cm to about 25 N / cm, 1 N / cm to about 25 N / cm, about 5 N / cm to about 25 N / cm, about 10 N / cm to about 25 N / cm, about 15 N / cm to about 25 N / cm, about 20 N / cm to about 25 N / cm, about 0.01 N / cm to about 20 N / cm, about 1 N / cm to about 20 N / cm, about 5 N / cm to about 20 N / cm, about 10 N / cm to about 20 N / cm, about 15 N / cm to about 20 N / cm, about 0.01 N / cm to about 15 N / cm, about 1 N / cm to about 15 N / cm, about 5 N / cm to about 15 N / cm, about 10 N / cm to about 15 N / cm, about 0.01 N / cm to about 10 N / cm, about 1 N / cm to about 10 N / cm, about 5 N / cm to about 10 N / cm, about 0.01 N / cm to about 5 N / cm, about 1 N / cm to about 5 N / cm, about 0.01 N / cm to about 5 N / cm, about 1 N / cm to about 5 N / cm, or about 0.01 N / cm to about 1 N / cm, including any ranges or vales therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a peak modulus comprising between at least about 0.25 N / cm to about 7.5 N / cm (e.g., 0.25, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 19 N / cm, including any values or ranges therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets have a compressive modulus comprising between at least about 0.25 N / cm to about 7.5 N / cm, about 1 N / cm to about 7.5 N / cm, about 2 N / cm to about 7.5 N / cm, about 3 N / cm to about 7.5 N / cm, about 4 N / cm to about 7.5 N / cm, about 5 N / cm to about 7.5 N / cm, about 6 N / cm to about 7.5 N / cm, about 7 N / cm to about 7.5 n / cm, about 0.25 N / cm to about 6 N / cm, about 1 N / cm to about 6 N / cm, about 2 N / cm to about 6 N / cm, about 3 N / cm to about 6 N / cm, about 4 N / cm to about 6 N / cm, about 5 N / cm to about 6 N / cm, about 6 N / cm to about 6 N / cm, about 7 N / cm to about 6 n / cm, about 0.25 N / cm to about 5 N / cm, about 1 N / cm to about 5 N / cm, about 2 N / cm to about 5 N / cm, about 3 N / cm to about 5 N / cm, about 4 N / cm to about 5 N / cm, about 5 N / cm to about 5 N / cm, about 0.25 N / cm to about 4 N / cm, about 1 N / cm to about 4 N / cm, about 2 N / cm to about 4 N / cm, about 3 N / cm to about 4 N / cm, about 0.25 N / cm to about 3 N / cm, about 1 N / cm to about 3 N / cm, about 2 N / cm to about 3 N / cm, about 0.25 N / cm to about 2 N / cm, about 1 N / cm to about 2 N / cm, or about 0.25 N / cm to about 1 N / cm, including any values or ranges therebetween.
[0129] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for strain. Strain is the measure of the deformation or change in shape that occurs when a material is subjected to stress. It can quantify how much the material stretches, compresses, or deforms under an applied force. In embodiments, the hydrated and / or dehydratedAttorney Docket No.: INSO-006 / 01WO 344681-2029 protein-based sheets have a maximum percent strain comprising between at least about 1% to about 250% (e.g., 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250%, including any values or ranges therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising between at least about 1% to about 250%, about 25% to about 250%, about 50% to about 250%, about 75% to about 250%, about 100% to about 250%, about 125% to about 250%, about 150% to about 250%, about 175% to about 250%, about 200% to about 250%, about 225% to about 250%, about 1% to about 225%, about 25% to about 225%, about 50% to about 225%, about 75% to about 225%, about 100% to about 225%, about 125% to about 225%, about 150% to about 225%, about 175% to about 225%, about 200% to about 225%, about 1% to about 200%, about 25% to about 200%, about 50% to about 200%, about 75% to about 200%, about 100% to about 200%, about 125% to about 200%, about 150% to about 200%, about 175% to about 200%, about 1% to about 175%, about 25% to about 175%, about 50% to about 175%, about 75% to about 175%, about 100% to about 175%, about 125% to about 175%, about 150% to about 175%, about 1% to about 150%, about 25% to about 150%, about 50% to about 150%, about 75% to about 150%, about 100% to about 150%, about 125% to about 150%, about 1% to about 125%, about 25% to about 125%, about 50% to about 125%, about 75% to about 125%, about 100% to about 125%, about 1% to about 100%, about 25% to about 100%, about 50% to about 100%, about 75% to about 100%, about 1% to about 75%, about 25% to about 75%, about 50% to about 75%, about 1% to about 50%, about 25% to about 50%, or about 1% to about 25%, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising between at least about 240% to about 260%, about 245% to about 260%, about 250% to about 260%, about 255% to about 260%, about 240% to about 255%, about 245% to about 255%, about 250% to about 255%, about 240% to about 250%, or about 245% to about 250%, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising about 250%.
[0130] In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising between at least about 80% to about 120%, about 85% to about 120%, about 90% to about 120%, about 95% to about 120%, about 100% to about 120%, about 105% to about 120%, about 110% to about 120%, about 115% to about 120%, about 80% to about 115%, about 85% to about 115%, about 90% to about 115%, about 95% to about 115%, about 100% toAttorney Docket No.: INSO-006 / 01WO 344681-2029 about 115%, about 105% to about 115%, about 110% to about 115%, about 80% to about 110%, about 85% to about 110%, about 90% to about 110%, about 95% to about 110%, about 100% to about 110%, about 105% to about 110%, about 80% to about 105%, about 85% to about 105%, about 90% to about 105%, about 95% to about 105%, about 100% to about 105%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 95% to about 100%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95%, about 80% to about 90%, about 85% to about 90%, or about 80% to about 85%, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising between at least about 90% to about 110%, about 95% to about 110%, about 100% to about 110%, about 105% to about 110%, about 90% to about 105%, about 95% to about 105%, about 100% to about 105%, about 90% to about 100%, or about 95% to about 100%, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising at least about 100%. In embodiments, the hydrated and / or dehydrated protein-based sheets have a maximum percent strain comprising at least about 100% to about 250%.
[0131] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 are measured for stress. Stress is the internal resistance of a material to deformation when subjected to an external force or load. It quantifies the force per unit area within materials and indicates how much force is applied to a material and how the material responds to that force. In embodiments, the hydrated and / or dehydrated protein-based sheets withstand stress comprising between at least about 1,000 Pa to about 4,000 Pa (e.g., 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,250, 3,500, 3,750, or 4,000 Pa, including any ranges or values therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets undergo a stress comprising between at least about 1,000 Pa to about 4,000 Pa, about 1,500 Pa to about 4,000 Pa, about 2,000 Pa to about 4,000 Pa, about 2,500 Pa to about 4,000 Pa, about 3,000 Pa to about 4,000 Pa, about 3,500 Pa to about 4,000 Pa, about 1,000 Pa to about 3,500 Pa, about 1,500 Pa to about 3,500 Pa, about 2,000 Pa to about 3,500 Pa, about 2,500 Pa to about 3,500 Pa, about 3,000 Pa to about 3,500 Pa, about 1,000 Pa to about 3,000 Pa, about 1,500 Pa to about 3,000 Pa, about 2,000 Pa to about 3,000 Pa, about 2,500 Pa to about 3,000 Pa, about 1,000 Pa to about 2,500 Pa, about 1,500 Pa to about 2,500 Pa, about 2,000 Pa to about 2,500 Pa, about 1,000 Pa to about 2,000 Pa, about 1,500 Pa to about 2,000 Pa, or about 1,000 Pa to about 1,500 Pa, including any ranges or vales therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheetsAttorney Docket No.: INSO-006 / 01WO 344681-2029 withstand stress comprising between at least about 1,700 Pa to about 2,900 Pa (e.g., 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 2,600, 2,700, 2,800, or 2,900 Pa, including any ranges or values therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets withstand stress comprising between at least about 1,700 Pa to about 2,900 Pa, 1,900 Pa to about 2,900 Pa, about 2,100 Pa to about 2,900 Pa, about 2,300 Pa to about 2,900 pa, about 2,500 Pa to about 2,900 Pa, about 2,700 Pa to about 2,900 Pa, about 1,700 Pa to about 2,700 Pa, about 1,900 Pa to about 2,700 Pa, about 2,100 Pa to about 2,700 Pa, about 2,300 Pa to about 2,700 Pa, about 2,500 Pa to about 2,700 Pa, about 1,700 Pa to about 2,500 Pa, about 1,900 Pa to about 2,500 Pa, about 2,100 Pa to about 2,500 Pa, about 2,300 Pa to about 2,500 Pa, about 1,700 Pa to about 2,300 Pa, about 1,900 Pa to about 2,300 Pa, about 2,100 Pa to about 2,300 Pa, about 1,700 Pa to about 2,100 Pa, about 1,900 to about 2,100 Pa, or about 1,700 Pa to about 1,900 Pa, including values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 have a thickness comprising between at least about 0.1 μm to about 20 mm (e.g., 0.1 μm, 0.2 μm, 0.3 μm, 0.4 μm, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, 0.1 mm, 0.2 mm, 0.3 mm, 0.4 mm, 0.5 mm, 0.6 mm, 0.7 mm, 0.8 mm, 0.9 mm, 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, 15 mm, 16 mm, 17 mm, 18 mm, 19 mm, or 20 mm including any values or ranges therebetween). In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 have a thickness comprising between at least about 0.1 μm to about 10 mm, about 0.5 μm to about 10 mm, about 1mm to about 10 mm, about 2 mm to about 10 mm, about 4 mm to about 10 mm, about 6 mm to about 10 mm, about 8 to about 10 mm, about 0.1 μm to about 8 mm, about 0.5 μm to about 8 mm, about 1 mm to about 8 mm, about 2 mm to about 8 mm, about 4 mm to about 8 mm, about 6 mm to about 8 mm, about 0.1 μm to about 6 mm, about 0.5 μm to about 6 mm, about 1mm to about 6 mm, about 2 mm to about 6 mm, about 4 mm to about 6 mm, about 0.1 μm to about 4 mm, about 0.5 μm to about 4 mm, about 1 mm to about 4 mm, about 2 mm to about 4 mm, about 0.1 μm to about 2 mm, about 0.5 μm to about 2 mm, about 1 mm to about 2 mm, about 0.1 μm to about 1 mm, about 0.5 μm to about 1 mm, or about 0.1 μm to about 05 mm, including any values or ranges therebetween. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 have a thickness comprising between at least about 1mm to about 10 mm. In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 have a thickness comprising between about 0.2 mm to about 5mm.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0132] In embodiments, the hydrated and / or dehydrated protein-based sheets prepared according to method 100 may be degradable over a predetermined time period. In embodiments, the predetermined time period is between about seven days to about two years. In embodiments, the predetermined time period is at least about 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months or 24 months, including any values or ranges therebetween.
[0133] In embodiments, step 104 of method 100 may be omitted. Instead, crosslinking may occur after curing of the POP solution at step 110 of sub process 106.
[0134] Protein-based sheets (e.g., film) formed according to the methods described herein can be configured for topical application to a skin surface of a user or implantation and / or as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, repair holes or defects in soft tissue walls, hernia repair, dura repair around the brain or spinal cord, and / or peripheral nerve repair. In embodiments, the protein-based sheets (e.g., film) are configured as an acellular matrix for soft tissue repair. In embodiments, the protein-based sheets (e.g., film) are configured as an acellular matrix to repair holes or defects in soft tissue walls. In embodiments, the soft tissue walls comprise the spleen, kidneys, heart, lungs, or gastrointestinal system. Examples
[0135] For each Example below, the following methods, based on method 100 described above, were followed. Materials and Methods
[0136] Partially ordered polypeptides (POPS) were produced and purified using biological fermentation. For the below examples, a POP was generated having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77). The disordered domain of the POP of SEQ ID NO: 77 exhibited a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and the structured domain had a sequence of GD(A25)K (SEQ ID NO: 11). A POP solution to a target concentration (100 μM to 3,000 μM) was generated by resuspending the appropriate amount of lyophilized cake in aqueous buffer (1x PBS) in a 50 mL conical tube. After ~15 minutes on ice, the lyophilized POP should be fully resuspended in solution with no noticeable solids. As a particular example, for a 1 mM POP solution of E36 (MW 49,172), 49.2 mg / ml is added to aqueous buffer. After full resuspension, the POP solution was chemically crosslinked. The solution was mixed by inversionAttorney Docket No.: INSO-006 / 01WO 344681-2029 to avoid air bubbles. The crosslinking was performed on ice for 5 minutes. A variety of crosslinkers (e.g, tetrakis (hydroxymethyl) phosphonium chloride (THPC) and glutaraldehyde (GA)) were used to crosslink lysines. The crosslinker was added based on a ratio of crosslinker reactive sites to POP reactive sites, crosslinker:POP (e.g., 6:1, 12:2, 2:1, 4:1 or 2:3). The crosslinked POP solution was poured into an appropriate mold and heated above the Ttof the POP to allow scaffold formation of a protein-based sheet (e.g., film). For instance, the crosslinked POP solution was incubated at 37°C for 10-12 minutes to initiate curing. In certain embodiments, where a support backing was used, the support backing was added to the mold cavity before or after pouring of the crosslinked POP solution. After incubation at 37°C, the mold is brought out to dry. In certain embodiments, the protein-based sheet (e.g., film) was dried by air drying. After heating, the POP solution continued to aggregate / dry at room temperature. Depending on the size, thickness, and concentration of POP solution in the protein-based sheet, it may take 24 hours up to 1 week to fully dry. In certain embodiments, the protein-based sheet (e.g., film) was dried by lyophilization. The protein-based sheet (e.g., film) was placed in the lyophylizer for 24 to 48 hours. Protein-based sheets have different physical properties depending on method of drying and method of rehydration. Serial dehydration and rehydration can also change physical properties. For a single, primary rehydration, a dried, protein-based sheet (e.g., film) can be rehydrated in aqueous buffer. Fully submerged, the protein-based sheet (e.g., film) fully rehydrates at room temperature in about 5-10 minutes. When a secondary drying / rehydration cycle is performed, the resulting dried, protein-based sheet (e.g., film) is a more translucent film with further reduced final buffer solution content. The protein-based sheet (e.g., film) can be rehydrated, as above, by submerging the protein-based sheet (e.g., film) in aqueous buffer for 5-10 minutes at room temperature. Example 1
[0137] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). FIGs.8A-8C show a protein-based sheet (e.g., film), comprising 3% by weight POP, prepared as a skin graft. Prior to rehydration for use as skin graft, as shown in FIG. 8C, the protein-based sheet (e.g., film) was dried according to the above, at room temperature (25°C) or at 37°C, resulting in a very thin material with a rubbery-like texture.Attorney Docket No.: INSO-006 / 01WO 344681-2029 Similar to the protein-based sheets of FIGs.8A-8C, FIGs.9A-9D depicts additional protein-based sheets. FIG.9A depicts a protein-based sheet (e.g., film) comprising 3.5% by weight POP (~750 μM). 7 ml of the POP was crosslinked with THPC and dried at room temperature for 48 hours. FIG.9B depicts a protein-based sheet (e.g., film) comprising 3.5% by weight POP (~750 μM).7 ml of the POP was deposited into a mold and cured at room temperature for 48 hours. FIG. 9C depicts a protein-based sheet (e.g., film) comprising 5% by weight POP (~1 mM).7 ml of the POP was crosslinked with THPC, dried, rehydrated, and dried, again. FIG.9D depicts a protein-based sheet (e.g., film) comprising 750 μM POP.7 ml of the POP was cured, dried, rehydrated, and then dried again. As shown, the protein-based sheet (e.g., film) in FIG. 9D is more transparent after the secondary drying event when compared with the protein-based sheet (e.g., film) of FIG.9B. Example 2
[0138] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with THPC. To give the protein-based sheets (e.g., films) a more defined shape, reduce shrinking, and provide a stronger rigidity for manipulation, supporting backing, such as a mesh, was incorporated into the protein-based sheets, as shown in FIGs.10A-10D. FIG.10A illustrates a support backing for use with the protein-based sheet. The support backing, which was introduced prior to curing and is enmeshed with the composition, is a polypropylene mesh. FIG. 10B and FIG.10C depict a support-backed protein-based sheet (e.g., film) from a top view and a from a side view. As shown, a protein-based sheet (e.g., film) comprising 3.5% by weight POP (~750 μM).7 ml of the POP was cured, dried, and rehydrated. The support-backed protein-based support of FIG.10B and FIG.10C is applied as a skin graft in FIG.10D. Example 3
[0139] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). The protein-based sheets (e.g. films) can be imprintedAttorney Docket No.: INSO-006 / 01WO 344681-2029 and retain microshapes. As shown in FIGs. 11A-11C, imprinted shapes and patterns can be retained within the protein-based sheets (e.g., films) after curing, drying, and rehydration. FIG. 11A depicts an imprinted protein-based sheet (e.g., film) comprising 3% by weight POP (~600 μM), where 10 ml of the POP was crosslinked with THPC and poured into a mold. To this end, before the composition had cured, a piece of support backing was placed on top of the composition, rather than submerged within. The sheet was then allowed to cure at 37°C. After fully curing (10 minutes at 37°C, followed by 30 minutes at room temperature), the support backing was lifted off the top of the protein-based sheet. This resulted in the imprinted pattern observed in FIGs.11A- 11C. The inset box of FIG.11A is a magnified image of the pattern. FIG.11B depicts a fragment of the imprinted 3% by weight POP protein-based sheet, after fully drying. FIG.11B demonstrates the microstructure achieved after curing and its continued presence after the sheet is fully dried. FIG.11C depicts the imprinted, protein-based sheet (e.g., film) after it has been rehydrated. The pattern is maintained and visible when applied to the skin. Example 4
[0140] Protein-based material, including sheets (e.g., films), were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). FIG.12A depicts a skull made from a protein-based material comprising 6% by weight POP (~1.2 mM). To this end, 60 mg / ml of the 6% by weight POP was prepared on ice. After resuspension, a THPC crosslinker was added (as described) on ice. Once mixed, the crosslinked POP solution was poured into a silicone mold. While retraining general contours, the cured, protein-based sheet (e.g., film) does lose some detail of the skull. With reference to FIG. 12B and FIG. 12C, a 10 ml 3.5% by weight protein-based sheet (e.g., film) was fabricated in a non-flat mold (a breast mold), highlighting the ability of the protein-based sheet (e.g., film) to maintain structure. FIG.12B depicts a dried protein-based sheet (e.g., film) coating the inner lining of a small breast mold, where the protein-based sheet (e.g., film) is nearly imperceptible. FIG.12C depicts a hydrated protein-based sheet (e.g., film) coating the inner wall of the breast mold. FIG. 12D and FIG. 12E depict the protein-based sheet (e.g., film) removed from the breast mold and held on a hand. In FIG. 12D, the protein-based sheet (e.g., film) is shown upside down and, in FIG.12E, the protein-based sheet (e.g., film) is shownAttorney Docket No.: INSO-006 / 01WO 344681-2029 right side up. These structures highlight the ability of the protein-based sheets to maintain a non- flat structure. Example 5
[0141] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15 (SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with THPC. FIG.13A and FIG.13B depict ultrathin protein-based sheets (e.g., films). High concentrations of POP at low composition volumes result in dried sheets having less than 100 μm in thickness. Such protein-based sheets (e.g., films) may also be translucent. Example 6
[0142] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with THPC. FIGs. 14A-14C depict a fragment of a 6% by weight (~1.2 mM) protein-based sheet (e.g., film) that has been fully dried, rehydrated with PBS, and then fully dried again. All drying was done at room temperature, leaving the protein-based sheet (e.g., film) exposed to the air for 48 hours. After multiple drying events, the fragment takes on a more transparent yellow hue. Higher concentration sheets are denser and, when dried, are less brittle, feeling more like a hard plastic such as, for example, poly vinyl chloride. FIG.14A depicts is a top-down view of the fragment of FIG. 14B. FIG. 14C depicts a side view of the fragment of FIG.14B. Example 7
[0143] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15 (SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with THPC. FIG.15 depicts thicker protein-based sheets (e.g., films) thatAttorney Docket No.: INSO-006 / 01WO 344681-2029 have been rehydrated. As shown, rehydrating thicker protein-based sheets creates a material that is less fragile and can be folded, stretched, and shaped, while being able to return to its original shape. FIG.15 depicts this thicker protein-based sheet (e.g., film) at baseline, when stretched, and when folded. Example 8
[0144] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with THPC. FIGs. 16A-16C depict a protein-based sheet (e.g., film) as a biological rubber. As shown, protein-based sheets are deformable and elastic given their protein composition. They can be easily manipulated without loss of structure or conformation. Example 9
[0145] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). Preparation and resuspension of large lyophilized protein-based sheets (e.g., films) was performed. A protein-based sheet (e.g., film) was prepared by crosslinking 750 μM of the polymer material with glutaraldehyde at a stoichiometric ratio of 2:1 (two aldehyde groups per lysine residue). The polymer-glutaraldehyde mixture was poured into a silicone mold (5 × 12 cm) and allowed to aggregate and crosslink under ambient temperature conditions for 4 hours. Once crosslinking was complete, the aggregated composition was frozen at -80°C to maintain structural integrity and subsequently lyophilized (FIG. 17) to remove moisture, resulting in a dried film with a partially ordered structure, as depicted in FIG.18A and FIG.18B. The resulting dried film has the consistency of light Styrofoam. To rehydrate the dried polymer was submerged in a saline solution (0.9% NaCl) for 5 minutes. Following rehydration, the film demonstrated significant flexibility, enabling easy handling without cracking or structural compromise. This flexibility is evident in FIGs. 19A-19C, which illustrates the hydrated film's appearance, pliability, and even foldability. Flexibility when handling is depicted in FIG.20A andAttorney Docket No.: INSO-006 / 01WO 344681-2029 FIG.20B, where the protein-based sheet (e.g., film) displays a high degree of elasticity, allowing for stretching and bending without loss of integrity. Example 10
[0146] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with glutaraldehyde. Protein-based sheets (e.g., films) can be cut to refine shape. FIG.21A and FIG.21B depict both a dried (lyophilized) (FIG.21A) and rehydrated (FIG. 21B) protein-based sheet (e.g., film). In both states, the material is easily trimmed using scissors. Example 11
[0147] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). Using the various methods of drying, as depicted in FIG.17, protein-based sheets (e.g., films) can present various topographies. High heat or ambient drying can result in a smooth appearance with minimal porosity as seen in FIG.22 (left). Protein- based sheets (e.g., films) can also be prepared using lyophilization where flash freezing prior to drying results in a microporosity present throughout, as seen in FIG. 22 (middle). In contrast, controlled or slow freezing before lyophilization presents both microporosity and macroscopic topographical features, as seen in FIG.22 (right). These protein-based sheets (e.g., films) can also be produced with various crosslinkers such as glutaraldehyde and tetrakis(hydroxymethyl)phosphonium chloride, as shown in FIG.23. Example 12
[0148] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15(SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with glutaraldehyde. Protein-based sheets (e.g., films) can present various mechanical properties by controlling variables such as crosslinker concentration or the ratio ofAttorney Docket No.: INSO-006 / 01WO 344681-2029 crosslinker reactive sites to polymer reactive sites. This variability is shown in FIG.24A, where stress-strain curves are shown for polymer sheets composed of different ratios of crosslinker reactive sites to polymer reactive sites (e.g., 4:1, 2:1, 2:3). At the material yield point (last data point for each curve in FIG.24A) peak force (load) (FIG.24B), modulus of elasticity (modulus) (FIG. 24C), and peak strain (FIG. 24D) are shown for each ratio. Mechanical testing samples were prepared by casting protein-based sheet (e.g., film) formulations into dog bone shaped silicone molds, as seen in FIGs.24E-24H. Example 13
[0149] Protein-based sheets (e.g., films) were generated that comprised of POP having a sequence of [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77), including disordered domains having a sequence of (G[V4:A1]GVP)15 (SEQ ID NO: 80) and structured domains having a sequence of GD(A25)K (SEQ ID NO: 11). A protein-based sheet (e.g., film) was prepared by crosslinking the POP with glutaraldehyde. FIG.25A and FIG.25B depict a protein-based sheet (e.g., film) that has been cut to a desired shape and sutured into simulated skin wounds. Discarded human abdominal tissue (from an abdominoplasty) was used as a test material. Non-absorbable sutures (3-0) were used to place a film either on top of the skin (no created wound) or within a simulated wound. In the latter case, the film was cut to the final desired shape of the wound before placement.
[0150] While embodiments of the present invention have been shown and described herein, those skilled in the art will understand that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby. NUMBERED EMBODIMENTS
[0151] In addition to the appended claims, the following numbered embodiments also form part of the instant disclosure.
[0152] 1. A protein-based article comprising: a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, whereinAttorney Docket No.: INSO-006 / 01WO 344681-2029 each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
[0153] 2. The article of claim 1, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0154] 3. The article of claim 1, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0155] 4. The article of claim 3, wherein each n is an integer from 15 to 35.
[0156] 5. The article of claim 3, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:10.
[0157] 6. The article of claim 2, wherein the polyalanine motif comprises (Ala)m, wherein m is an integer from 5 to 50.
[0158] 7. The article of claim 2, wherein the polyalanine motif comprises one or more of: (A)n (SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100.
[0159] 8. The article of claim 7, wherein the polyalanine motif comprises one or more of: (A)25 (SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
[0160] 9. The article of claim 1, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.
[0161] 10. The article of claim 9, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
[0162] 11. The article of claim 9, wherein the film comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
[0163] 12. The article of claim 1, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
[0164] 13. The article of claim 12, wherein the Tt-heating ranges from about 10 °C to about 45 °C.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0165] 14. The article of claim 12, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.
[0166] 15. The article of claim 1, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
[0167] 16. The article of claim 15, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester crosslinkers, NHS-maleimide crosslinkers, NHS- pyridyldithiol crosslinkers, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N- hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG®4-NHS ester, 3-(2- Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N- hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8- succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N- hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N- hydroxysuccinimide ester, LC-SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amidocaproate)), azido-PEG®8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl-6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-pyridyldithio)propionamido]hexanoate), O-[N-(3- maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3-oxopropyl]triethylene glycol, O- [N](3-Maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3- oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3-bromoacetamido)propionate), SPDP-PEG®4-NHS ester, acid-PEG®5-NHS ester, O,O’-Bis[2-(N-succinimidyl- succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl-alpha-methyl- alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG®4-NHS ester, acid-PEG®9-NHS ester, Fmoc-N-amido-PEG®8-NHS ester, SPDP-PEG®8-NHS ester, and Fmoc-N-amido-PEG®4-NHS ester.
[0168] 17. The article of claim 1, wherein the film is shapeable or moldable into a shape.
[0169] 18. The article of claim 1, wherein the film has a buffer solution content of about 1% to about 5% w / v.
[0170] 19. The article of claim 18, wherein the buffer solution comprises buffered saline.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0171] 20. The article of claim 1, wherein the film has a buffer solution content of about 0.5% to about 70% w / v.
[0172] 21. The article of claim 20, wherein the buffer solution comprises buffered saline.
[0173] 22. The article of claim 1, wherein the film is configured for topical application to a skin surface of a user or implantation.
[0174] 23. The article of claim 1, wherein the film is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, and / or peripheral nerve repair.
[0175] 24. The article of claim 1, wherein the film is patterned.
[0176] 25. The article of claim 1, wherein the film comprises a tensile modulus of about 15 N / cm to about 70 N / cm or a compressive modulus of about 0.25 N / cm to about 7.5 N / cm.
[0177] 26. The article of claim 1, wherein the film is degradable over a time period of about seven days to about two years.
[0178] 27. The article of claim 1, wherein the thickness of the film is about 0.2 mm to about 5 mm.
[0179] 28. The article of claim 1, wherein
[0180] each disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0181] 29. The article of claim 1, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0182] 30. The article of claim 29, wherein n is an integer from 15 to 35.
[0183] 31. A system, comprising: a protein-based article comprising a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or a GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; and a support structure.
[0184] 32. The system of claim 31, wherein the support structure comprises a mesh backing.
[0185] 33. The system of claim 31, wherein the support structure comprises at least one material selected from the group consisting of polypropylene, polycaprolactone, and cellulose.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0186] 34. The system of claim 31, wherein the support structure is within the protein-based article.
[0187] 35. The system of claim 31, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0188] 36. The system of claim 31, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0189] 37. The system of claim 36, wherein each n is an integer from 15 to 35.
[0190] 38. The system of claim 36, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:10.
[0191] 39. The system of claim 35, wherein the polyalanine motif comprises (Ala)m, wherein m is an integer from 5 to 50.
[0192] 40. The system of claim 35, wherein the polyalanine motif comprises one or more of: (A)n(SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100.
[0193] 41. The system of claim 40, wherein the polyalanine motif comprises one or more of: (A)25(SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
[0194] 42. The system of claim 31, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.
[0195] 43. The system of claim 42, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
[0196] 44. The system of claim 42, wherein the film comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
[0197] 45. The system of claim 31, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
[0198] 46. The system of claim 45, wherein the Tt-heating ranges from about 10 °C to about 45 °C.
[0199] 47. The system of claim 45, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0200] 48. The system of claim 31, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
[0201] 49. The system of claim 48, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester crosslinkers, NHS-maleimide crosslinkers, NHS- pyridyldithiol crosslinkers, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N- hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG®4-NHS ester, 3-(2- Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N- hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8- succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N- hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N- hydroxysuccinimide ester, LC-SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amidocaproate)), azido-PEG®8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl-6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-pyridyldithio)propionamido]hexanoate), O-[N-(3- maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3-oxopropyl]triethylene glycol, O- [N](3-Maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3- oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3-bromoacetamido)propionate), SPDP-PEG®4-NHS ester, acid-PEG®5-NHS ester, O,O’-Bis[2-(N-succinimidyl- succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl-alpha-methyl- alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG®4-NHS ester, acid-PEG®9-NHS ester, Fmoc-N-amido-PEG®8-NHS ester, SPDP-PEG®8-NHS ester, and Fmoc-N-amido-PEG®4-NHS ester.
[0202] 50. The system of claim 31, wherein the film is shapeable or moldable into a shape.
[0203] 51. The system of claim 31, wherein the film has a buffer solution content of about 1% to about 5% w / v.
[0204] 52. The system of claim 51, wherein the buffer solution is buffered saline.
[0205] 53. The system of claim 31, wherein the film has a buffer solution content of about 0.5% to about 70% w / v.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0206] 54. The system of claim 52, wherein the buffer solution is buffered saline.
[0207] 55. The system of claim 31, wherein the film is configured for topical application to a skin surface of a user or implantation.
[0208] 56. The system of claim 31, wherein the film is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, and / or peripheral nerve repair.
[0209] 57. The system of claim 31, wherein the film is patterned.
[0210] 58. The system of claim 31, wherein the film comprises a tensile modulus of about 15 N / cm to about 70 N / cm or a compressive modulus of about 0.25 N / cm to about 7.5 N / cm.
[0211] 59. The system of claim 31, wherein the film is degradable over a time period of about seven days to about two years.
[0212] 60. The system of claim 31, wherein the thickness of the film is about 0.2 mm to about 5 mm.
[0213] 61. The system of claim 31, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0214] 62. The system of claim 31, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0215] 63. The system of claim 62, wherein n is an integer from 15 to 35.
[0216] 64. A method, comprising: preparing a solution comprising a plurality of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; adding crosslinker to the solution to form a composition; applying the |composition to a mold and heating the mold to a predetermined temperature, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating) and the predetermined temperature is greater than the Tt-heating, wherein the partially ordered polypeptides aggregate at the predetermined temperature, wherein the aggregated partially ordered polypeptides are crosslinked; and drying the molded, crosslinked composition.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0217] 65. The method of claim 64, wherein a concentration of the partially ordered polypeptide within the solution is about 100 μM to about 3 mM.
[0218] 66. The method of claim 64, wherein the solution comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.
[0219] 67. The method of claim 66, wherein the solution comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
[0220] 68. The method of claim 66, wherein the solution comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
[0221] 69. The method of claim 64, wherein the aggregated partially ordered polypeptides are crosslinked at the predetermined temperature.
[0222] 70. The method of claim 64, wherein the crosslinker is a chemical crosslinker, pH, click chemistry functionalized proteins, ultraviolet light, or a combination thereof.
[0223] 71. The method of claim 70, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester crosslinkers, NHS-maleimide crosslinkers, NHS- pyridyldithiol crosslinkers, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N- hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG®4-NHS ester, 3-(2- Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N- hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8- succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N- hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N- hydroxysuccinimide ester, LC-SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amidocaproate)), azido-PEG®8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl-6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-pyridyldithio)propionamido]hexanoate), O-[N-(3- maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3-oxopropyl]triethylene glycol, O- [N](3-Maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3- oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3-bromoacetamido)propionate), SPDP-PEG®4-NHS ester, acid-PEG®5-NHS ester, O,O’-Bis[2-(N-succinimidyl- succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl-alpha-methyl-Attorney Docket No.: INSO-006 / 01WO 344681-2029 alpha(2-pyridyldithio)toluene), Phthalimidooxy-PEG®4-NHS ester, acid-PEG®9-NHS ester, Fmoc-N-amido-PEG®8-NHS ester, SPDP-PEG®8-NHS ester, and Fmoc-N-amido-PEG®4-NHS ester.
[0224] 72. The method of claim 70, wherein the chemical crosslinker is added to the solution at a ratio of the solution to chemical crosslinker of about 1 to about 10, about 2 to about 10, about 3 to about 10, about 4 to about 10, about 5 to about 10, about 1 to about 1, about 2 to about 1, about 3 to about 1, about 4 to about 1, about 5 to about 1, about 10 to about 1, about 20 to about 1, about 30 to about 1, about 40 to about 1, about 50 to about 1, about 100 to about 1, about 200 to about 1, about 300 to about 1, about 400 to about 1, about 500 to about 1, about 1,000 to about 1, about 2,000 to about 1, about 3,000 to about 1, about 4,000 to about 1, about 5,000 to about 1, and / or about 10,000 to about 1.
[0225] 73. The method of claim 70, wherein the chemical crosslinker is added to the solution at a ratio of chemical crosslinker to the solution based on a number of available crosslinking sites on each partially ordered polypeptide.
[0226] 74. The method of claim 73, wherein each crosslinking site is a lysine residue, an aspartic acid residue, an amine reactive site, or a carboxylic group reactive site.
[0227] 75. The method of claim 73, wherein the ratio of chemical crosslinker to the solution is about 6 to about 1.
[0228] 76. The method of claim 64, wherein adding the crosslinker to the solution comprises periodically inverting the composition.
[0229] 77. The method of claim 64, wherein the applying the composition to the mold comprises pouring the composition into a cavity of the mold.
[0230] 78. The method of claim 64, wherein the composition has a transition temperature of heating (Tt-heating), and the method further comprises incubating the mold at a temperature greater than the Tt-heating for a predetermined time period.
[0231] 79. The method of claim 78, wherein the predetermined time period is about 1 minute to about 6 hours, about 2 minutes to about 4 hours, about 3 minutes to about 2 hours, about 4 minutes to about 1 hour, about 5 minutes to about 30 minutes, about 6 minutes to about 20 minutes, about 7 minutes to about 15 minutes, about 8 minutes to about 14 minutes, about 9 minutes to about 13 minutes, and / or about 10 minutes to about 12 minutes.
[0232] 80. The method of claim 64, further comprising positioning a support structure against a surface of a cavity of the mold, wherein the applying the composition to the moldAttorney Docket No.: INSO-006 / 01WO 344681-2029 comprises pouring the composition into the cavity of the mold and into contact with the support structure.
[0233] 81. The method of claim 64, wherein the drying comprises one or more of air drying and lyophilizing.
[0234] 82. The method of claim 64, wherein the drying comprises exposing the molded, crosslinked composition to ambient air at a predetermined temperature and for a predetermined time period.
[0235] 83. The method of claim 82, wherein the predetermined temperature is about 10°C to about 95°C, about 20°C to about 90°C, about 30°C to about 85°C, about 40°C to about 80°C, about 50°C to about 75°C, and / or about 60°C to about 70°C.
[0236] 84. The method of claim 82, wherein the predetermined time period is about six hours to about ten days.
[0237] 85. The method of claim 64, wherein the dried composition has a buffer solution content of about 1% to about 5%.
[0238] 86. The method of claim 85, wherein the buffer solution comprises buffered saline.
[0239] 87. The method of claim 64, wherein the film has a buffer solution content of about 0.5% to about 70% w / v.
[0240] 88. The method of claim 87, wherein the buffer solution comprises buffered saline.
[0241] 89. The method of claim 81, wherein the lyophilizing comprises performing lyophilization for a predetermined time period.
[0242] 90. The method of claim 89, wherein the predetermined time period is about 24 hours to about 72 hours.
[0243] 91. The method of claim 64, further comprising rehydrating the dried composition.
[0244] 92. The method of claim, wherein the rehydrating comprises submerging the dried composition in an aqueous buffer for a predetermined time period.
[0245] 93. The method of claim 92, wherein the predetermined time period is about 1 minute to about 5 days, about 2 minutes to about 4 days, about 3 minutes to about 3 days, about 4 minutes to about 2 days, about 5 minutes to about 1 day, about 6 minutes to about 12 hours, about 7 minutes to about 6 hours, about 8 minutes to about 1 hour, about 9 minutes to about 30 minutes, and / or about 10 minutes to about 15 minutes.
[0246] 94. The method of claim 92, wherein the drying and the rehydrating are performed iteratively.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0247] 95. The method of claim 64, wherein the solution is a resuspension of lyophilized partially ordered polypeptide in an aqueous buffer.
[0248] 96. A protein-based article comprising: a crosslinked network of partially ordered polypeptides, the crosslinked network having a three-dimensional shape, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, and wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
[0249] 97. The article of claim 96, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0250] 98. The article of claim 96, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0251] 99. The article of claim 98, wherein each n is an integer from 15 to 35.
[0252] 100. The article of claim 98, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:10.
[0253] 101. The article of claim 97, wherein the polyalanine motif comprises (Ala)m, wherein m is an integer from 5 to 50.
[0254] 102. The article of claim 97, wherein the polyalanine motif comprises one or more of: (A)n (SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100.
[0255] 103. The article of claim 102, wherein the polyalanine motif comprises one or more of: (A)25 (SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
[0256] 104. The article of claim 96, comprising about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.
[0257] 105. The article of claim 104, comprising about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
[0258] 106. The article of claim 104, comprising about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0259] 107. The article of claim 96, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
[0260] 108. The article of claim 107, wherein the Tt-heating ranges from about 10 °C to about 45 °C.
[0261] 109. The article of claim 107, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.
[0262] 110. The article of claim 96, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
[0263] 111. The article of claim 110, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester crosslinkers, NHS-maleimide crosslinkers, NHS- pyridyldithiol crosslinkers, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N- hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG®4-NHS ester, 3-(2- Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N- hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8- succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N- hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N- hydroxysuccinimide ester, LC-SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1- carboxy-(6-amidocaproate)), azido-PEG®8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl-6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-pyridyldithio)propionamido]hexanoate), O-[N-(3- maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3-oxopropyl]triethylene glycol, O- [N](3-Maleimidopropionyl)aminoethyl]-O’-[3-(N-succinimidyloxy)-3- oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3-bromoacetamido)propionate), SPDP-PEG®4-NHS ester, acid-PEG®5-NHS ester, O,O’-Bis[2-(N-succinimidyl- succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl-alpha-methyl- alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG®4-NHS ester, acid-PEG®9-NHS ester, Fmoc-N-amido-PEG®8-NHS ester, SPDP-PEG®8-NHS ester, and Fmoc-N-amido-PEG®4-NHS ester.Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0264] 112. The article of claim 96, comprising a buffer solution content of about 1% to about 5% w / v.
[0265] 113. The article of claim 112, wherein the buffer solution comprises buffered saline.
[0266] 114. The article of claim 96, comprising a buffer solution content of about 0.5% to about 70% w / v.
[0267] 115. The article of claim 114, wherein the buffer solution comprises buffered saline.
[0268] 116. The article of claim 96, wherein the three-dimensional shape is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, and / or peripheral nerve repair.
[0269] 117. The article of claim 96, wherein the three-dimensional shape is patterned.
[0270] 118. The article of claim 96, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
[0271] 119. The article of claim 96, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
[0272] 120. The article of claim 119, wherein n is an integer from 15 to 35.
[0273] 121. The article of claim 96, further comprising a support structure.
[0274] 122. The system of claim 121, wherein the support structure comprises a mesh backing.
[0275] 123. The system of claim 121, wherein the support structure comprises at least one material selected from the group consisting of polypropylene, polycaprolactone, and cellulose.
[0276] 124. The system of claim 121, wherein the support structure is within the protein- based article. SEQUENCES
[0277] (VPGXG)n (SEQ ID NO: 1), X is any amino acid except proline and n is an integer greater than or equal to 1;
[0278] (GXGVP)n(SEQ ID NO: 2), X is any amino acid except proline and n is an integer greater than or equal to 1;
[0279] (A)n(SEQ ID NO: 3), n is an integer from 2 to 100;
[0280] K(A)nK (SEQ ID NO: 4), n is an integer from 2 to 100;Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0281] D(A)nK (SEQ ID NO: 5), n is an integer from 2 to 100;
[0282] GD(An)K (SEQ ID NO: 6), n is an integer from 2 to 100;
[0283] GK(An)K (SEQ ID NO: 7), n is an integer from 2 to 100;
[0284] (A)25 (SEQ ID NO: 8);
[0285] K(A)25K (SEQ ID NO: 9);
[0286] D(A)25K (SEQ ID NO: 10);
[0287] GD(A25)K (SEQ ID NO: 11);
[0288] GK(A25)K (SEQ ID NO: 12);
[0289] (KAAAA)5K (SEQ ID NO: 13);
[0290] PXXG;
[0291] PXXXG;
[0292] PXXXXG;
[0293] PXXXXXG;
[0294] PXXXXXXG;
[0295] PXXXXXXXG;
[0296] PXXXXXXXXG;
[0297] PXXXXXXXXXG;
[0298] PXXXXXXXXXXG;
[0299] PXXXXXXXXXXXG;
[0300] PXXXXXXXXXXXXG;
[0301] PXXXXXXXXXXXXXG;
[0302] PXXXXXXXXXXXXXXG;
[0303] PXXXXXXXXXXXXXXXG;
[0304] GTGTTCCTGGTGTCGGCGTGCCGGG (SEQ ID NO: 28);
[0305] CGGCACGCCGACACCAGGAACACCAACGCCCGGTACGCCCACACCTGGGAC ACCTACGCCCGGAACACCCACACC (SEQ ID NO: 29);
[0306] CGTGGGTGTTCCGGGCGTAGGTGTCCCAGGTGCGGGCGTACCGGGCGTTGG TGTTCCTGGTGTCGGCGTGCCGGG (SEQ ID NO: 30);
[0307] CGGCACGCCGACACCAGGAACACCAACGCCCGGTACGCCCGCACCTGGGAC ACCTACGCCCGGAACACCCACGCC (SEQ ID NO: 31);
[0308] CGCCGGAGTGCCAGGCGTGGGTGTTCCAGGAGCAGGCGTICCAGGTGTGGGT GTTCCTGG (SEQ ID NO: 32);Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0309] AGGAACACCCACACCTGGAACGCCTGCTCCIGGAACACCCACGCCTGGCACT CCGGCGCC (SEQ ID NO: 33);
[0310] TGCGGCCGCAGCTGCGGCGGCAGCCGCGGCTGCCGCGGCTGCAGCGGCAGC CGCGGCTGCGGCGGCCGCAGCTGCGGG (SEQ ID NO: 34);
[0311] CGCAGCTGCGGCCGCCGCAGCCGCGGCTGCCGCTGCAGCCGCGGCAGCCGC GGCTGCCGCCGCAGCTGCGGCCGCACC (SEQ ID NO: 35);
[0312] TAAAGCGGCCGCAGCTGCGGCGGCAGCCGCGGCTGCCGCGGCTGCAGCGGC AGCCGCGGCTGCGGCGGCCGCAGCTGCGAAAGG (SEQ ID NO: 36);
[0313] TTTCGCAGCTGCGGCCGCCGCAGCCGCGGCTGCCGCTGCAGCCGCGGCAGC CGCGGCTGCCGCCGCAGCTGCGGCCGCTTTACC (SEQ ID NO: 37);
[0314] TAAAGCGGCCGCAGCTAAAGCCGCGGCAGCGAAAGCAGCCGCGGCGAAAG CCGCAGCTGCGAAAGCGGCAGCCGCGAAGGG (SEQ ID NO: 38);
[0315] CTTCGCGGCTGCCGCTTTCGCAGCTGCGGCTTTCGCCGCGGCTGCTTTCGCTG CCGCGGCTTTAGCTGCGGCCGCTTTACC (SEQ ID NO: 39);
[0316] TGATGCGGCCGCAGCTGCGGCGGCAGCCGCGGCTGCCGCGGCTGCAGCGGC AGCCGCGGCTGCGGCGGCCGCAGCTGCGAAAGG (SEQ ID NO: 40);
[0317] TTTCGCAGCTGCGGCCGCCGCAGCCGCGGCTGCCGCTGCAGCCGCGGCAGC CGCGGCTGCCGCCGCAGCTGCGGCCGCATCACC (SEQ ID NO: 41);
[0318] AAAAA (SEQ ID NO: 42);
[0319] VPGVG (SEQ ID NO: 43);
[0320] P(X)nG, m, n, and p are independently an integer from 1 to 15, and B, X, and Z are independently any amino acid.
[0321] (B)mP(X)nG(Z)p, m, n, and p are independently an integer from 1 to 15, and B, X, and Z are independently any amino acid.
[0322] [Bp(A)qZr]n(SEQ ID NO: 46), B is Lys, Arg, Asp, or Glu; A is Ala; Z is Lys, Arg, Asp, or Glu; n is an integer from 1 to 50; p is an integer from 0 to 2; q is an integer from 1 to 50; r is an integer from 0 to 2; s is an integer from 1 to 5; and t is an integer from 1 to 50.
[0323] [(BAs)tZr]n(SEQ ID NO: 47, B is Lys, Arg, Asp, or Glu; A is Ala; Z is Lys, Arg, Asp, or Glu; n is an integer from 1 to 50; p is an integer from 0 to 2; q is an integer from 1 to 50; r is an integer from 0 to 2; s is an integer from 1 to 5; and t is an integer from 1 to 50.
[0324] GVGVP (SEQ ID NO: 48);
[0325] GAGVP (SEQ ID NO: 49);Attorney Docket No.: INSO-006 / 01WO 344681-2029
[0326] G[A1:V1]GVP (SEQ ID NO: 50);
[0327] [G[V4:A1]GVP] (SEQ ID NO: 51);
[0328] M[(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 52);
[0329] M[(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 53);
[0330] M[(GVGVP)15-GK(A25)K]6-GWP (SEQ ID NO: 54);
[0331] M[(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 55);
[0332] M[(G[A1:V1]GVP)16-GD(A25)K]6-GWP (SEQ ID NO: 56);
[0333] M[(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 57);
[0334] M[(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 58); or
[0335] M[(G[V4:A1]GVP)15-GD(A25)K]4-GWP (SEQ ID NO: 59);
[0336] [(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 71);
[0337] [(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 72);
[0338] [(GVGVP)15-GK(A25)K]6-GWP (SEQ ID NO: 73);
[0339] [(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 74);
[0340] [(G[A1:V1]GVP)16-GD(A25)K]6-GWP (SEQ ID NO: 75);
[0341] [(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 76);
[0342] [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77);
[0343] [(G[V4:A1]GVP)15-GD(A25)K]4-GWP (SEQ ID NO: 78);
[0344] AAAA (SEQ ID NO: 79); or
[0345] (G[V4:A1]GVP)15 (SEQ ID NO: 80).
Claims
Attorney Docket No.: INSO-006 / 01WO 344681-2029 CLAIMS What is claimed herein is:
1. A protein-based article comprising: a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
2. The article of claim 1, wherein each ordered domain comprises at least one alpha helix.
3. The article of claim 1, wherein at least one ordered domain comprises an alpha helix.
4. The article of claim 1, wherein the partially ordered polypeptide has an amino acid sequence with at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the polypeptide of SEQ ID NO:
77.
5. The article of any one of claims 1-4, wherein the film has a thickness of about 1 mm to about 10 mm or about 0.5 mm to about 5 mm.
6. The article of any one of claims 1-5, wherein the network of partially ordered polypeptides is initially produced by non-covalent interactions between each ordered domain.
7. The article of any one of claims 1-6, wherein additional covalent crosslinks are created between a first partially ordered polypeptide and a second partially ordered polypeptide by reacting the partially ordered polypeptides with a covalent crosslinker.
8. The article of claim 7, wherein the covalent crosslinker is glutaraldehyde or tetrakis (hydroxymethyl) phosphonium chloride (THPC).
9. The article of any one of claims 1-8, whereinAttorney Docket No.: INSO-006 / 01WO 344681-2029 each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
10. The article of any one of claims 1-9, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
11. The article of any one of claims 1-9, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 1 to 50.
12. The article of claim 10 or 11, wherein each n is an integer from 15 to 35.
13. The article of claim 10 or 11, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:
10.
14. The article of any one of claims 1-13, wherein each ordered domain comprises a polyalanine motif comprising at least 4 alanine residues.
15. The article of claim 14, wherein the at least 4 alanine residues are consecutive.
16. The article of claim 15, wherein at least about 50%, at least 60 %, at least 70%, at least 80%, or at least 90% of the amino acids in each polyalanine motif are in an alpha-helical conformation.
17. The article of claim 1, wherein the partially ordered polypeptide comprises an amino acid sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of: [(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 71); [(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 72); [(GVGVP)15-GK(A25)K]6-GWP (SEQ ID NO: 73); [(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 74); [(G[A1:V1]GVP)16-GD(A25)K]6-Attorney Docket No.: INSO-006 / 01WO 344681-2029 GWP (SEQ ID NO: 75); [(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 76); [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77); or [(G[V4:A1]GVP)15-GD(A25)K]4- GWP (SEQ ID NO: 78).
18. The article of claim 13, wherein at least about 50% of the amino acids in the polyalanine motif are alanine residues.
19. The article of any one of claims 1-18, wherein each ordered domain comprises a polyalanine motif comprising 25 alanines.
20. The article of any one of claims 9-18, wherein the polyalanine motif comprises (Ala)m, wherein m is an integer from 5 to 50.
21. The article of claim 9-18, wherein the polyalanine motif comprises one or more of: (A)n(SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100.
22. The article of claim 21, wherein the polyalanine motif comprises one or more of: (A)25 (SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
23. The article of any one of claims 1-22, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.Attorney Docket No.: INSO-006 / 01WO 344681-2029 24. The article of claim 23, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
25. The article of claim 23, wherein the film comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
26. The article of any one of claims 1-25, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
27. The article of claim 26, wherein the Tt-heating ranges from about 10 °C to about 45 °C.
28. The article of claim 26 or 27, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.
29. The article of any one of claims 1-28, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
30. The article of claim 29, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), N-hydroxysuccinimide (NHS) ester , NHS-maleimide , NHS- pyridyldithiol, (1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N-hydroxysuccinimidyl ester, propargyl-N-hydroxysuccinimidyl ester, maleimide-PEG2-succinimidyl ester, Azido-PEG4-NHS ester, 3-(2-Pyridyldithio)propionic acid N-hydroxysuccinimide ester, 3-Maleimidobenzoic acid N-hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N- Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8-succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N-hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N-hydroxysuccinimide ester, LC- SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), azido- PEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl- 6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-Attorney Docket No.: INSO-006 / 01WO 344681-2029 pyridyldithio)propionamido]hexanoate), O-[N-(3-maleimidopropionyl)aminoethyl]-O’-[3-(N- succinimidyloxy)-3-oxopropyl]triethylene glycol, O-[N](3-Maleimidopropionyl)aminoethyl]-O’- [3-(N-succinimidyloxy)-3-oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3- bromoacetamido)propionate), SPDP-PEG4-NHS ester, acid-PEG5-NHS ester, O,O’-Bis[2-(N- succinimidyl-succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl- alpha-methyl-alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG4-NHS ester, acid-PEG9-NHS ester, Fmoc-N-amido-PEG8-NHS ester, SPDP-PEG8-NHS ester, glutaraldehyde, paraformaldehyde, and Fmoc-N-amido-PEG4-NHS ester.
31. The article of any one of claims 1-30, wherein the film is shapeable or moldable into a shape.
32. The article of any one of claims 1-31, wherein the film is configured for topical application to a skin surface of a user or implantation.
33. The article of any one of claims 1-31, wherein the film is configured as an acellular matrix for soft tissue repair.
34. The article of claim 33, wherein the film is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, repair holes or defects in soft tissue walls, hernia repair, dura repair around the brain or spinal cord, and / or peripheral nerve repair.
35. The article of claim 34, wherein the film is configured as an acellular matrix to repair holes or defects in soft tissue walls, wherein the soft tissue walls comprise the spleen, kidneys, heart, lungs, or gastrointestinal system.
36. The article of any one of claims 1-35, wherein the film is patterned.
37. The article of any one of claims 1-36, wherein the film comprises a tensile modulus of about 1 kPa to about 250 kPa.Attorney Docket No.: INSO-006 / 01WO 344681-2029 38. The article of any one of claims 1-37, wherein the file comprises a compressive modulus of about 0.25 N / cm to about 7.5 N / cm.
39. The article of any one of claims 1-38, wherein the file comprises a strain deformation from about 5% to about 250%.
40. The article of any one of claims 1-39, wherein the film is degradable over a time period of about seven days to about two years.
41. The article of any one of claims 1-40, wherein the thickness of the film is about 0.2 mm to about 5 mm.
42. The article of any one of claims 1-8, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
43. The article of any one of claims 1-8 or 42, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
44. The article of claim 43, wherein n is an integer from 15 to 35.
45. A system, comprising: a protein-based article comprising a film having a thickness of about 0.1 μm to about 10 mm and comprising a crosslinked network of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or a GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; and a support structure.Attorney Docket No.: INSO-006 / 01WO 344681-2029 46. The system of claim 45, wherein the support structure comprises a mesh backing.
47. The system of claim 45, wherein the support structure comprises at least one material selected from the group consisting of polypropylene, polycaprolactone, poly(lactic acid), poly(lactic-co-glycolic acid), nylon, animal derived proteins and carbohydrates, and cellulose.
48. The system of claim 45 or 47, wherein the support structure is within the protein-based article.
49. The system of any one of claims 45-48, wherein each ordered domain comprises at least one alpha helix.
50. The system of any one of claims 45-48, wherein at least one ordered domain comprises an alpha helix.
51. The system of any one of claims 45-48, wherein the partially ordered polypeptide has an amino acid sequence with at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the polypeptide of SEQ ID NO:
77.
52. The system of any one of claims 45-51, wherein the film has a thickness of about 1 mm to about 10 mm or about 0.5 mm to about 5 mm.
53. The system of any one of claims 45-52, wherein the network of partially ordered polypeptides is initially produced by non-covalent interactions between each ordered domain.
54. The system of any one of claims 45-53, wherein additional covalent crosslinks are created between a first partially ordered polypeptide and a second partially ordered polypeptide by reacting the partially ordered polypeptides with a covalent crosslinker.
55. The system of claim 54, wherein the covalent cross-linker is glutaraldehyde or tetrakis (hydroxymethyl) phosphonium chloride (THPC).Attorney Docket No.: INSO-006 / 01WO 344681-2029 56. The system of any one of claims 45-55, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
57. The system of any one of claims 45-56, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
58. The system of any one of claims 1-9, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 1 to 50.
59. The system of claim 57 or 58, wherein each n is an integer from 15 to 35.
60. The system of claim 57 or 58, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:
10.
61. The system of any one of claims 45-60, wherein each ordered domain comprises a polyalanine motif comprising at least 4 alanine residues.
62. The system of claim 61, wherein the at least 4 alanine residues are consecutive.
63. The system of claim 62, wherein at least about 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the amino acids in each polyalanine motif are in an alpha-helical conformation.
64. The system of claim 45, wherein the partially ordered polypeptide comprises an amino acid sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of: [(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 71); [(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 72); [(GVGVP)15-GK(A25)K]6-Attorney Docket No.: INSO-006 / 01WO 344681-2029 GWP (SEQ ID NO: 73); [(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 74); [(G[A1:V1]GVP)16- GD(A25)K]6-GWP (SEQ ID NO: 75); [(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 76); [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77); or [(G[V4:A1]GVP)15-GD(A25)K]4- GWP (SEQ ID NO: 78).
65. The system of claim 60, wherein at least about 50% of the amino acids in the polyalanine motif are alanine residues.
66. The system of any one of claims 45-65, wherein each ordered domain comprises a polyalanine motif comprising 25 alanines (SEQ ID NO: 8).
67. The system of claim 45-65, wherein the polyalanine motif comprises (Ala)m(SEQ ID NO: 65), wherein m is an integer from 5 to 50.
68. The system of claim 45-65, wherein the polyalanine motif comprises one or more of: (A)n(SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7); wherein n is an integer from 2 to 100.
69. The system of claim 68, wherein the polyalanine motif comprises one or more of: (A)25 (SEQ ID NO: 8); K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
70. The system of any one of claims 45-69, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.Attorney Docket No.: INSO-006 / 01WO 344681-2029 71. The system of claim 70, wherein the film comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
72. The system of claim 70, wherein the film comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
73. The system of any one of claims 45-72 , wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
74. The system of claim 73, wherein the Tt-heating ranges from about 10 °C to about 45 °C.
75. The system of claim 73 or 74, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.
76. The system of any one of claims 45-75, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
77. The system of claim 76, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester, NHS-maleimide, NHS-pyridyldithiol, (1R,8S,9s)- Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N- hydroxysuccinimidyl ester, propargyl-N-hydroxysuccinimidyl ester, maleimide-PEG2- succinimidyl ester, Azido-PEG4-NHS ester, 3-(2-Pyridyldithio)propionic acid N- hydroxysuccinimide ester, 3-Maleimidobenzoic acid N-hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N- Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8-succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N-hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N-hydroxysuccinimide ester, LC- SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), azido- PEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl- 6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2-Attorney Docket No.: INSO-006 / 01WO 344681-2029 pyridyldithio)propionamido]hexanoate), O-[N-(3-maleimidopropionyl)aminoethyl]-O’-[3-(N- succinimidyloxy)-3-oxopropyl]triethylene glycol, O-[N](3-Maleimidopropionyl)aminoethyl]-O’- [3-(N-succinimidyloxy)-3-oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3- bromoacetamido)propionate), SPDP-PEG4-NHS ester, acid-PEG5-NHS ester, O,O’-Bis[2-(N- succinimidyl-succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl- alpha-methyl-alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG4-NHS ester, acid-PEG9-NHS ester, Fmoc-N-amido-PEG8-NHS ester, SPDP-PEG8-NHS ester, glutaraldehyde, paraformaldehyde, and Fmoc-N-amido-PEG4-NHS ester.
78. The system of any one of claims 45-77, wherein the film is shapeable, cuttable or moldable into a shape.
79. The system of any one of claims 45-78, wherein the film is configured for topical application to a skin surface of a user or implantation.
80. The system of any one of claims 45-78, wherein the film is configured as an acellular matrix for soft tissue repair.
81. The system of claim 80, wherein the film is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, repair of holes or defects in soft tissue walls, hernia repair, dura repair around the brain or spinal cord, and / or peripheral nerve repair.
82. The system of claim 81, wherein the film is configured as an acellular matrix to repair holes or defects in soft tissue walls, wherein the soft tissue walls comprise the spleen, kidneys, heart, lungs, or gastrointestinal system.
83. The system of any one of claims 45-82, wherein the film is patterned.
84. The system of any one of claims 45-83, wherein the film comprises a tensile modulus of about 1 kPa to about 250 kPa.Attorney Docket No.: INSO-006 / 01WO 344681-2029 85. The system of any one of claims 45-84, wherein the film comprises a compressive modulus of about 0.25 N / cm to about 7.5 N / cm.
86. The system of any one of claims 45-85, wherein the film comprises a strain deformation from about 5% to about 250%.
87. The system of any one of claims 45-86, wherein the film is degradable over a time period of about seven days to about two years.
88. The system of any one of claims 45-87, wherein the thickness of the film is about 0.2 mm to about 5 mm.
89. The system of any one of claims 45-55, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
90. The system of any one of claims 45-55 or 89, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
91. The system of claim 90, wherein n is an integer from 15 to 35.
92. A method, comprising: preparing a solution comprising a plurality of partially ordered polypeptides, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif; adding crosslinker to the solution to form a composition; applying the composition to a mold and heating the mold to a predetermined temperature, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating) andAttorney Docket No.: INSO-006 / 01WO 344681-2029 the predetermined temperature is greater than the Tt-heating, wherein the partially ordered polypeptides aggregate at the predetermined temperature, wherein the aggregated partially ordered polypeptides are crosslinked; and drying the molded, crosslinked composition.
93. The method of claim 92, wherein each ordered domain comprises at least one alpha helix.
94. The method of claim 92, wherein at least one ordered domain comprises an alpha helix.
95. The method of claim 92, wherein the partially ordered polypeptide has an amino acid sequence with at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the polypeptide of SEQ ID NO:
77.
96. The method of any one of claims 92-95, wherein the film has a thickness of about 1 mm to about 10 mm or about 0.5 mm to about 5 mm.
97. The method of any one of claims 92-96, wherein the network of partially ordered polypeptides is initially produced by non-covalent interactions between each ordered domain.
98. The method of any one of claims 92-97, wherein additional covalent crosslinks are created between a first partially ordered polypeptide and a second partially ordered polypeptide by reacting the partially ordered polypeptides with a covalent crosslinker.
99. The method of claim 98, wherein the covalent cross-linker is glutaraldehyde or tetrakis (hydroxymethyl) phosphonium chloride (THPC).
100. The method of any one of claims 92-99, wherein a concentration of the partially ordered polypeptide within the solution is from about 100 μM to about 3 mM.
101. The method of any one of claims 92-99, wherein the solution comprises about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.Attorney Docket No.: INSO-006 / 01WO 344681-2029 102. The method of claim 101, wherein the solution comprises about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
103. The method of claim 101, wherein the solution comprises about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
104. The method of any one of claims 92-103, wherein the aggregated partially ordered polypeptides are crosslinked at the predetermined temperature.
105. The method of any one of claims 92-103, wherein the crosslinker is a chemical crosslinker, pH, click chemistry functionalized proteins, ultraviolet light, or a combination thereof.
106. The method of claim 105, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester, NHS-maleimide, NHS-pyridyldithiol, (1R,8S,9s)- Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N- hydroxysuccinimidyl ester, propargyl-N-hydroxysuccinimidyl ester, maleimide-PEG2- succinimidyl ester, Azido-PEG4-NHS ester, 3-(2-Pyridyldithio)propionic acid N- hydroxysuccinimide ester, 3-Maleimidobenzoic acid N-hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N- Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8-succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N-hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N-hydroxysuccinimide ester, LC- SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), azido- PEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl- 6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2- pyridyldithio)propionamido]hexanoate), O-[N-(3-maleimidopropionyl)aminoethyl]-O’-[3-(N- succinimidyloxy)-3-oxopropyl]triethylene glycol, O-[N](3-Maleimidopropionyl)aminoethyl]-O’- [3-(N-succinimidyloxy)-3-oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3- bromoacetamido)propionate), SPDP-PEG4-NHS ester, acid-PEG5-NHS ester, O,O’-Bis[2-(N- succinimidyl-succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl- alpha-methyl-alpha(2-pyridyldithio)toluene), Phthalimidooxy-PEG4-NHS ester, acid-PEG9-NHSAttorney Docket No.: INSO-006 / 01WO 344681-2029 ester, Fmoc-N-amido-PEG®8-NHS ester, SPDP-PEG8-NHS ester, glutaraldehyde (aka 1,5 pentanedial), paraformaldehyde, and Fmoc-N-amido-PEG4-NHS ester.
107. The method of claim 105, wherein the chemical crosslinker is added to the solution at a stoichiometric ratio (the number of reactive groups in the crosslinker to the number of reactive groups in the polymer) of about 1 to about 10, about 2 to about 10, about 3 to about 10, about 4 to about 10, about 5 to about 10, about 1 to about 1, about 2 to about 1, about 3 to about 1, about 4 to about 1, about 5 to about 1, about 10 to about 1, about 20 to about 1, about 30 to about 1, about 40 to about 1, about 50 to about 1, about 100 to about 1, about 200 to about 1, about 300 to about 1, about 400 to about 1, about 500 to about 1, about 1,000 to about 1, about 2,000 to about 1, about 3,000 to about 1, about 4,000 to about 1, about 5,000 to about 1, and / or about 10,000 to about 1.
108. The method of claim 105, wherein the chemical crosslinker is added to the solution at a ratio of (i) the number of crosslink sites available on each crosslinker to the number of crosslink sites available on each polypeptide or (ii) the number of crosslinker molecules to the number of crosslink sites on each polypeptide.
109. The method of claim 108, wherein each crosslinking site is a lysine residue, an aspartic acid residue, an amino acid that reacts with an amine, or an amino acid that reacts with a carboxylic acid.
110. The method of claim 108, wherein the ratio of the number of crosslink sites available on each crosslinker to the number of crosslink sites available on each polypeptide is from 10:1 to 1:4 or wherein the ratio of the number of crosslinker molecules to the number of crosslink sites on each polypeptide is 20:1 to 3:
8.
111. The method of any one of claims 92-110, wherein adding the crosslinker to the solution comprises either / or inverting the composition, rapid mixing with a fluid handling device, vortexing, sonication, or stirring.
112. The method of any one of claims 92-111, wherein the applying the composition to the mold comprises pouring the composition into a cavity of the mold.Attorney Docket No.: INSO-006 / 01WO 344681-2029 113. The method of any one of claims 92-112, wherein the composition has a transition temperature of heating (Tt-heating), and the method further comprises incubating the mold at a temperature greater than the Tt-heating for a predetermined time period.
114. The method of claim 113, wherein the predetermined time period is about 1 minute to about 6 hours, about 2 minutes to about 4 hours, about 3 minutes to about 2 hours, about 4 minutes to about 1 hour, about 5 minutes to about 30 minutes, about 6 minutes to about 20 minutes, about 7 minutes to about 15 minutes, about 8 minutes to about 14 minutes, about 9 minutes to about 13 minutes, and / or about 10 minutes to about 12 minutes.
115. The method of any one of claims 92-114, further comprising positioning a support structure against a surface of a cavity of the mold, wherein the applying the composition to the mold comprises pouring the composition into the cavity of the mold and into contact with the support structure.
116. The method of any one of claims 92-115, wherein the drying comprises one or more of air drying or lyophilizing.
117. The method of any one of claims 92-116, wherein the drying comprises exposing the molded, crosslinked composition to ambient air at a predetermined temperature and for a predetermined time period.
118. The method of claim 117, wherein the predetermined temperature is about 10°C to about 95°C, about 20°C to about 90°C, about 30°C to about 85°C, about 40°C to about 80°C, about 50°C to about 75°C, and / or about 60°C to about 70°C.
119. The method of claim 117, wherein the predetermined time period is about six hours to about ten days.
120. The method of claim 116, wherein the lyophilizing comprises performing lyophilization for a predetermined time period.Attorney Docket No.: INSO-006 / 01WO 344681-2029 121. The method of claim 120, wherein the predetermined time period is about 4 hours to about 168 hours.
122. The method of any one of claims 92-121, further comprising rehydrating the dried composition.
123. The method of claim 122, wherein the rehydrating comprises submerging the dried composition in an aqueous buffer for a predetermined time period.
124. The method of claim 123, wherein the predetermined time period is about 1 minute to about 5 days, about 2 minutes to about 4 days, about 3 minutes to about 3 days, about 4 minutes to about 2 days, about 5 minutes to about 1 day, about 6 minutes to about 12 hours, about 7 minutes to about 6 hours, about 8 minutes to about 1 hour, about 9 minutes to about 30 minutes, about 10 minutes to about 15 minutes, about 1 minute to about 24 hours, or about 1 minute to about 48 hours.
125. The method of any one of claims 122-124, wherein the drying and the rehydrating are performed iteratively.
126. The method of any one of claims 92-125, wherein the solution is a resuspension of lyophilized partially ordered polypeptide in an aqueous buffer.
127. The method of any one of claims 92-126, wherein each ordered domain comprises a polyalanine motif comprising at least 4 alanine residues.
128. The method of claim 127, wherein the at least 4 alanine residues are consecutive.
129. The method of claim 128, wherein at least about 50%, at least 60 %, at least 70%, at least 80%, or at least 90% of the amino acids in each polyalanine motif are in an alpha-helical conformation.Attorney Docket No.: INSO-006 / 01WO 344681-2029 130. The method of claim 129, wherein the partially ordered polypeptide comprises an amino acid sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of: [(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 71); [(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 72); [(GVGVP)15-GK(A25)K]6- GWP (SEQ ID NO: 73); [(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 74); [(G[A1:V1]GVP)16- GD(A25)K]6-GWP (SEQ ID NO: 75); [(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 76); [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77); or [(G[V4:A1]GVP)15-GD(A25)K]4- GWP (SEQ ID NO: 78).
131. The method of claim 130, wherein at least about 50% of the amino acids in the polyalanine motif are alanine residues.
132. The method of any one of claims 92-131, wherein each ordered domain comprises a polyalanine motif comprising 25 alanines (SEQ ID NO: 8).
133. A protein-based article comprising: a crosslinked network of partially ordered polypeptides, the crosslinked network having a three-dimensional shape, wherein each partially ordered polypeptide independently comprises a plurality of disordered domains and a plurality of ordered domains, and wherein each disordered domain independently comprises a PG or GP motif and each ordered domain independently comprises a polyalanine motif or a polyproline motif.
134. The article of claim 133, wherein each ordered domain comprises at least one alpha helix.
135. The article of claim 133, wherein at least one ordered domain comprises an alpha helix.
136. The article of claim 133, wherein the partially ordered polypeptide has an amino acid sequence with at least 95 %, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the polypeptide of SEQ ID NO: 77.Attorney Docket No.: INSO-006 / 01WO 344681-2029 137. The article of any one of claims 133-136, wherein the film has a thickness of about 1 mm to about 10 mm or about 0.5 mm to about 5 mm.
138. The article of any one of claims 133-137, wherein the network of partially ordered polypeptides is initially produced by non-covalent interactions between each ordered domain.
139. The article of any one of claims 133-138, wherein additional covalent crosslinks are created between a first partially ordered polypeptide and a second partially ordered polypeptide by reacting the partially ordered polypeptides with a covalent crosslinker.
140. The article of claim 139, wherein the covalent cross-linker is glutaraldehyde or tetrakis (hydroxymethyl) phosphonium chloride (THPC).
141. The article of any one of claims 133-140, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n(SEQ ID NO: 1), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
142. The article of any one of claims 133-141, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
143. The article of any one of claims 133-141, wherein each disordered domain comprises an amino acid sequence of (VPGXG)n (SEQ ID NO: 64), wherein each X is independently Val or Ala, and wherein n is an integer from 1 to 50.
144. The article of claim 142 or 143, wherein each n is an integer from 15 to 35.
145. The article of claim 142 or 143, wherein X is an alternating iteration of Ala to Val in a ratio from 10:1 to 1:10.Attorney Docket No.: INSO-006 / 01WO 344681-2029 146. The article of any one of claims 133-145, wherein each ordered domain comprises a polyalanine motif comprising at least 4 alanine residues (SEQ ID NO: 79).
147. The article of claim 146, wherein the at least 4 alanine residues (SEQ ID NO: 79) are consecutive.
148. The article of claim 147, wherein at least about 50% of the amino acids in each polyalanine motif are in an alpha-helical conformation.
149. The article of claim 148, wherein at least about 90% of the amino acids in each polyalanine motif are in an alpha-helical conformation.
150. The article of claim 145, wherein at least about 50% of the amino acids in the polyalanine motif are alanine residues.
151. The article of any one of claims 133-150, wherein each ordered domain comprises a polyalanine motif comprising 25 alanines (SEQ ID NO: 8).
152. The article of any one of claims 141-151, wherein the polyalanine motif comprises (Ala)m(SEQ ID NO: 65), wherein m is an integer from 5 to 50.
153. The article of any one of claims claim 141-151, wherein the polyalanine motif comprises one or more of: (A)n (SEQ ID NO: 3); K(A)nK (SEQ ID NO: 4); D(A)nK (SEQ ID NO: 5); GD(An)K (SEQ ID NO: 6); or GK(An)K (SEQ ID NO: 7), wherein n is an integer from 2 to 100.
154. The article of claim 153, wherein the polyalanine motif comprises one or more of: (A)25(SEQ ID NO: 8);Attorney Docket No.: INSO-006 / 01WO 344681-2029 K(A)25K (SEQ ID NO: 9); D(A)25K (SEQ ID NO: 10); GD(A25)K (SEQ ID NO: 11); or GK(A25)K (SEQ ID NO: 12).
155. The article of any one of claims 133-154, comprising about 0.1% by weight partially ordered polypeptide to about 100% by weight partially ordered polypeptide.
156. The article of any one of claims 155, comprising about 0.1% by weight partially ordered polypeptide to about 85% by weight partially ordered polypeptide.
157. The article of claim 155, comprising about 50% by weight partially ordered polypeptide to about 90% by weight partially ordered polypeptide.
158. The article of any one of claims 133-157, wherein the partially ordered polypeptide has a transition temperature of heating (Tt-heating).
159. The article of claim 158, wherein the Tt-heating ranges from about 10 °C to about 45 °C.
160. The article of claim 158 or 159, wherein the partially ordered polypeptide forms a solid aggregate above the Tt-heating.
161. The article of any one of claims 133-160, wherein the crosslinked partially ordered polypeptide is covalently crosslinked by a chemical crosslinker, pH, click chemistry, ultraviolet light, or a combination thereof.
162. The article of claim 161, wherein the chemical crosslinker comprises at least one crosslinker or a derivative thereof selected from the group consisting of tetrakis (hydroxymethyl) phosphonium chloride (THPC), NHS ester, NHS-maleimide, NHS-pyridyldithiol, (1R,8S,9s)- Bicyclo[6.1.0]non-4-yn-9-ylmethyl-N-succinimidyl carbonate, dibenzyocyclooctyne-N- hydroxysuccinimidyl ester, propargyl-N-hydroxysuccinimidyl ester, maleimide-PEG2- succinimidyl ester, Azido-PEG4-NHS ester, 3-(2-Pyridyldithio)propionic acid N-Attorney Docket No.: INSO-006 / 01WO 344681-2029 hydroxysuccinimide ester, 3-Maleimidobenzoic acid N-hydroxysuccinimide ester, methyltetrazine-NHS ester, bromoacetic acid N-hydroxysuccinimide ester, O,O’-Bis[2-(N- Succinimidyl-succinylamino)ethyl]polyethylene glycol, maleimide-PEG8-succinimidyl ester, iodoacetic acid N-hydroxysuccinimide ester, alkyne-PEG5-N-hydroxysuccinimidyl ester, maleimide-PEG6-succinimidyl ester, 6-maleimidohexanoic acid N-hydroxysuccinimide ester, LC- SMCC (succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)), azido- PEG8-NHS ester, PEG4-SPDP (PEGylated, long-chain SPDP crosslinker), SMPH (succinimydl- 6-((b-maleimidoproprionamido)hexanoate), LC-SPDP (succinimidyl 6-[3(2- pyridyldithio)propionamido]hexanoate), O-[N-(3-maleimidopropionyl)aminoethyl]-O’-[3-(N- succinimidyloxy)-3-oxopropyl]triethylene glycol, O-[N](3-Maleimidopropionyl)aminoethyl]-O’- [3-(N-succinimidyloxy)-3-oxopropyl]heptacosaethylene glycol, SBAP (succinimidyl 3- bromoacetamido)propionate), SPDP-PEG4-NHS ester, acid-PEG5-NHS ester, O,O’-Bis[2-(N- succinimidyl-succinylamino)ethyl]polyethylene glycol, SMPT (4-succinimidyloxycarbonyl- alpha-methyl-alpha(2-pyridyldithio)toluene), phthalimidooxy-PEG4-NHS ester, acid-PEG9-NHS ester, Fmoc-N-amido-PEG8-NHS ester, SPDP-PEG8-NHS ester, glutaraldehyde (aka 1,5 pentanedial), paraformaldehyde, and Fmoc-N-amido-PEG4-NHS ester.
163. The article of any one of claims 133-162, wherein the film is configured as an acellular matrix for soft tissue repair.
164. The article of claim 163, wherein the three-dimensional shape is configured as an acellular matrix for breast reconstruction, fat grafting, skin replacement, tendon repair, repair of holes or defects in soft tissues, hernia repair, dura repair around the brain or spinal cord, and / or peripheral nerve repair.
165. The article of claim 164, wherein the film is configured as an acellular matrix to repair holes or defects in soft tissue walls, wherein the soft tissue walls comprise the spleen, kidneys, heart, lungs, or gastrointestinal system.
166. The article of any one of claims 133-165, wherein the three-dimensional shape is patterned.
167. The article of any one of claims 133-166, whereinAttorney Docket No.: INSO-006 / 01WO 344681-2029 each disordered domain comprises an amino acid sequence of (GXGVP)n (SEQ ID NO: 2), wherein X is any amino acid except proline and n is an integer greater than or equal to 1, and each ordered domain comprises a polyalanine motif.
168. The article of any one of claims 133-167, wherein each disordered domain comprises an amino acid sequence of (GXGVP)n(SEQ ID NO: 70), wherein each X is independently Val or Ala, and wherein n is an integer from 2 to 50.
169. The article of claim 168, wherein n is an integer from 15 to 35.
170. The article of any one of claims 133-169, further comprising a support structure.
171. The article of claim 170, wherein the support structure comprises a mesh backing.
172. The article of claim 170, wherein the support structure comprises at least one material selected from the group consisting of polypropylene, polyester, polycaprolactone, poly(lactic acid), poly(lactic-co-glycolic acid), nylon, animal derived proteins and carbohydrates, and cellulose.
173. The article of claim 170, wherein the support structure is within the protein-based article.
174. The article of claim 133, wherein the partially ordered polypeptide comprises an amino acid sequence with at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any one of: [(GVGVP)15-GD(A25)K]6-GWP (SEQ ID NO: 71); [(GVGVP)15-GD(A25)K]4-GWP (SEQ ID NO: 72); [(GVGVP)15-GK(A25)K]6- GWP (SEQ ID NO: 73); [(GVGVP)15-GK(A25)K]4-GWP (SEQ ID NO: 74); [(G[A1:V1]GVP)16- GD(A25)K]6-GWP (SEQ ID NO: 75); [(G[A1:V1]GVP)16-GD(A25)K]4-GWP (SEQ ID NO: 76); [(G[V4:A1]GVP)15-GD(A25)K]6-GWP (SEQ ID NO: 77); or [(G[V4:A1]GVP)15-GD(A25)K]4- GWP (SEQ ID NO: 78).Attorney Docket No.: INSO-006 / 01WO 344681-2029 175. The method of claim 92, wherein the crosslinker added to the solution to form a composition is a chemical crosslinker.
176. The method of claim 175, wherein the chemical crosslinker is added to the composition at a ratio of number of crosslinking sites on a chemical crosslinker to the number of available crosslinking sites on each partially ordered polypeptide.
177. The method of claim 176, wherein the crosslinking sites on the partially ordered peptide comprise amino acid side chains comprising amine groups.
178. The method of claim 177, wherein the amino acid side chains comprising amine groups are lysine side chains.
179. The method of claim 178, wherein the crosslinking occurs as a result of a chemical reaction between a carboxylic acid on a crosslinker and an amine group on the partially ordered polypeptide.
180. The method of claim 178, wherein crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker and a carboxyl group on the partially ordered polypeptide.
181. The method of claim 179, comprising a ratio of the carboxyl group on the crosslinker to amine group on the partially ordered peptide of about 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:
4.
182. The method of claim 181, wherein the ratio of carboxyl group to amine group is about 2:
1.
183. The method of claim 178, wherein crosslinking occurs as a result of a chemical reaction between a carbonyl group on a crosslinker and an amine group on the partially ordered polypeptide.
184. The method of claim 178, wherein crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker and a carbonyl group on the partially ordered polypeptide.Attorney Docket No.: INSO-006 / 01WO 344681-2029 185. The method of claim 183, comprising a ratio of the carbonyl group on the crosslinker to amine group on the partially ordered peptide of about 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:
4.
186. The method of claim 185, wherein the ratio of carbonyl group to amine group comprises about 4:1 to about 2:
3.
187. The method of claim 178, wherein crosslinking occurs as a result of a chemical reaction between a hydroxyl group on a crosslinker and an amine group on the partially ordered polypeptide.
188. The method of claim 178, wherein crosslinking occurs as a result of a chemical reaction between an amine on a crosslinker and a hydroxyl group on the partially ordered polypeptide.
189. The method of claim 187, comprising a ratio of hydroxyl group on the crosslinker to amine group on the partially ordered polypeptide of about 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, or 1:
4.
190. The method of claim 189, wherein the ratio of hydroxyl group to amine group comprises about 4:1 to about 2:3.
Citation Information
Patent Citations
Visual assays for coatings incorporating bioactive enzymes for catalytic functions
US20140196631A1
Compositions and methods for augmenting autologous fat grafts
US20230233738A1
Cited By
A protein matrix composition for hard and soft tissue matrix repair, reconstruction, and / or augementation
WO2026042053A1