Compound for treating acne
Patent Information
- Application Number
- PCT/EP2025/055954
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-06
- Filing Date
- 2025-03-05
- Publication Date
- 2025-10-02
AI Technical Summary
Current treatments for bacterial infections, particularly those caused by Cutibacterium acnes, are ineffective against antibiotic-resistant strains and often cause significant side effects, necessitating a need for novel, non-toxic compounds that can inhibit bacterial growth without relying on antibiotics.
The use of cysteine synthases, specifically Cysk-3 proteins, to reduce cysteine bioavailability in Cutibacterium acnes, thereby inhibiting bacterial growth and treating infections such as acne vulgaris by administering therapeutically effective amounts of these proteins in pharmaceutical compositions.
Cysk-3 proteins effectively inhibit Cutibacterium acnes growth without toxicity to human cells, offering a promising treatment for acne and other infections while reducing cysteine bioavailability, thus addressing antibiotic resistance and side effects.
Abstract
Description
[0001] Compound for treating acne
[0002] This application claims the benefit of European Patent Application EP24382244.2 filed March 6th 2024.
[0003] Technical Field
[0004] The present invention belongs to the field of medicine, in particular, treatments of bacterial infections. The compounds of the invention are particularly useful for treating infections related to Cutibacterium acnes, in particular acne vulgaris.
[0005] Background Art
[0006] Cutibacterium acnes (C. acnes) — known before as Propionibacterium acnes — is a Grampositive rod present mainly in the normal microbiota of the skin but also in the oral cavity, large intestine, conjunctiva, and external ear canal.
[0007] However, C. acnes is associated with pathologic conditions, such as acne vulgaris (acne), and is presented as an opportunistic pathogen. In this regard, C. acnes has been described to play a role in a wide variety of infections, such as dental, joint, central nervous system ocular, and heart infections and even sepsis. Additionally, C. acnes is known to cause several postoperative and device-related infections, such as infections related to joint prostheses, breast implants, and prosthetic heart valves.
[0008] Acne is, perhaps, the most prevalent skin disease affecting young adults. Nearly 80% of teenagers have presented with acne. Acne, although multifactorial, is characterized by C. acnes hyperproliferation, an increased secretion of sebum, and an aberrant growth of the epidermis and hair follicles. Acne causes important problems that frequently lead to anxiety, reduced self-esteem, difficulties in personal relationships, and, in extreme cases, depression.
[0009] Infections caused by C. acnes, including acne, are usually treated with antibiotics that, although safe, often generate side effects including nausea, fatigue, dizziness, vomiting, and photosensitivity. Also importantly, the worldwide prevalence of antibiotic-resistant C. acnes and other bacterial infections is rapidly increasing. Using antibiotics to treat a prevalent non-life-threatening disease is thought to lead to a reduction in the efficacy of current anti-C. acnes treatments and more importantly the antibiotic efficacy in other and more serious conditions. Therefore, despite the efforts made so far, there is still a need for novel treatments of bacterial infections, particularly those associated with C. acnes, which are effective, with limited secondary effects, and alleviate the antibiotic loss of efficiency.
[0010] Summary of Invention
[0011] The present inventors have surprisingly found that cysteine synthases that catalyze synthesis of L-cysteine from O-acetylserine (OAS) in the presence of S2-or SH2, also referred to as acetylserine sulfhydrylases, particularly Cysk-3 proteins (including homolog protein in Escherichia coli named Cysk), more particularly proteins consisting of SEQ ID NO. 4, SEQ ID NO. 12 or SEQ ID NO. 13, show antibacterial activity.
[0012] As shown in the examples below, a firstly identified Cysk-3 protein referred herein to as reference Cysk-3 (Cysk-3_ref, consisting of SEQ ID NO. 4), as well as its homolog Cysk-3 from Leptotrichia wadei (Cysk-3 (L. wadei), consisting of SEQ ID NO. 13) and their homolog in Escherichia coli Cysk from Escherichia coli (Cysk (E. coli), consisting of SEQ ID NO. 12), have a remarkable capacity to inhibit bacterial growth, in particular Cutibacterium acnes growth, which is an important opportunistic bacterium that causes a wide-range of infections. Importantly, C. acnes is one of the causative agents of acne vulgaris, one of the most common skin diseases.
[0013] As shown below, the inhibitory activity of Cysk3_refon bacterial growth appears to result from its effect on cysteine metabolism, and C. acnes is shown to be highly dependent on cysteine bioavailability, thus rendering the inhibitory effect of the protein particularly specific for C. acnes bacteria. This is especially important in anti-acne treatments, most of which currently entail undesired effects in the skin.
[0014] The bacterial growth inhibition is shown with recombinant Cysk-3 proteins (including recombinant Cysk3_ref, Cysk-3 from L. wadei and their homolog Cysk from E. coli), and it is lost when the active center of the enzyme of Cysk-3 ref is mutated, thus showing the efficacy of the recombinant protein. Furthermore, it is also shown in the examples below that the protein is non-toxic for different human cell lines, even at doses 100 higher than those showing inhibition activity. Therefore, the newly identified compound integrates several characteristics that make it particularly suitable for the synthesis, long-term storage, handling and use for the treatment of C. acnes infections.
[0015] Altogether, the present invention provides a great advance in the field of antibacterial agents and the treatment of bacterial infections. Thus, in a first aspect, the invention is addressed to a compound that reduces cysteine bioavailability, for use in the prevention and / or treatment of a bacterial infection, particularly of a bacterial infection caused by or associated with Cutibacterium acnes.
[0016] This aspect can also be formulated as the use of a compound that reduces cysteine bioavailability for the manufacture of a medicament for the treatment or prevention of a bacterial infection. This aspect can also be formulated as a method for treating or preventing a bacterial infection, the method comprising administering a therapeutically effective amount of a compound that reduces cysteine bioavailability together with pharmaceutically acceptable excipients or carriers to a subject in need thereof.
[0017] In a second aspect, the invention is addressed to a pharmaceutical composition comprising a therapeutically effective amount of a compound that reduces cysteine bioavailability, together with at least one pharmaceutically acceptable excipient and / or carrier.
[0018] A third aspect of the invention is addressed to the pharmaceutical composition according to the second aspect of the invention, for use as a medicament.
[0019] In a fourth aspect, the invention is addressed to the pharmaceutical composition according to the second aspect of the invention, for use in the prevention and / or treatment of a bacterial infection caused by or associated with Cutibacterium acnes.
[0020] This aspect can also be formulated as the use of the pharmaceutical composition of the invention for the manufacture of a medicament for the treatment or prevention of a disease, particularly a a bacterial infection, more particularly a bacterial infection caused by or associated with Cutibacterium acnes. This aspect can also be formulated as a method for treating or preventing disease, particularly a bacterial infection, more particularly a bacterial infection caused by or associated with Cutibacterium acnes, the method comprising administering a therapeutically effective amount of the pharmaceutical composition of the invention to a subject in need thereof.
[0021] The non-pathogenic growth of Cutibacterium species has also been related to cosmetic issues, such as body odor.
[0022] Thus, in a fifth aspect, the invention is addressed to a cosmetic composition comprising a cosmetically effective amount of a compound that reduces cysteine bioavailability, together with at least one cosmetically acceptable excipient and / or carrier. A sixth aspect of the invention is addressed to a non-therapeutic in vitro use of a compound that reduces cysteine bioavailability, in cosmetics.
[0023] Inhibition of bacterial growth by a compound that inhibits cysteine bioavailability as the Cysk-3_ref, Cysk-3 (L. wadei) and Cysk {E. coli) proteins identified by the inventors, also opens a window in industrial fields besides therapeutics. It is known that C. acnes can form biofilms, and that bacterial biofilms may be formed in many surfaces, in particular abiotic surfaces. Also, C. acnes has been found to live as an endophyte in plants.
[0024] Thus, in a seventh aspect, the invention provides a non-therapeutic use a compound that inhibits cysteine bioavailability, as an antibacterial agent.
[0025] Brief Description of Drawings
[0026] Figure 1 : Recombinant Cysk-3_ref inhibits C. acnes growth in vitro. C. acnes was embedded in a BMSA plate as described in Materials and Methods. 10pl (2 mg / ml) of recombinant GST-Cysk-3_ref and GST-Fda (as a control protein) were spotted on the plate and incubated for 2 to 3 days at 37°C in anaerobic conditions. Additionally, GST was eliminated by pre-scission protease treatment. 10 pl of the composition in which cysk- 3_ref with SEQ ID NO. 4 was identified (reference composition) was included as a positive control. The dark zones around the dots correspond with C. acnes growth inhibition zones. Cysk3 in this figure specifically corresponds to Cysk3_ref as indicated herein, and “recombinant cysk3” thus specifically refers to recombinant Cysk3_ref.
[0027] Figure 2: Enzymatic activity of Cysk-3_ref is needed for C. acnes inhibition. C. acnes was embedded in a BMSA plate as described in Materials and Methods. The dark zones around the dots correspond with C. acnes growth inhibition zones. 10pl containing decreasing amounts of recombinant GST-Cysk-3_ref wild-type and K42A mutant version were spotted on the plate and incubated for 2 to 3 days at 37°C in anaerobic conditions. GST protein was included as a negative control. Cysk3 in this figure specifically corresponds to Cysk3_ref as indicated herein, and GST-Cysk3 and GST-Cysk3 K42A labels in this figure, thus specifically refer to GST-Cysk3_ref and GST-Cysk3_ref K42A, respectively.
[0028] Figure 3: Cysk-3_ref is not toxic. 10pl of recombinant Cysk-3_ref (2mg / ml) were added to the following cell lines: HEK293T (Human Embryonic Kidney cell line), RPE1 (immortalized Retinal Pigment Epithelial cells) and HDFa (primary Human Dermal Fibroblast cell line). After 12h, mitochondrial activity, as an indication of vitality, was measured using the MTT system. Values were normalized to the not treated. DMSO and GST were added as negative positive controls respectively. Recombinant proteins were obtained from two different E. coli strains, (BL21) and a low lipopolysaccharide-containing E. coli strain (CC). HDFa data is the mean±SD of three independent experiments. Cysk3 in this figure specifically corresponds to Cysk3_ref, as indicated herein. Labels with cysk3 in the figure thus specifically refer to Cysk3_ref.
[0029] Figure 4: Mechanism of action. Cysk-3_ref inhibition activity is reverted by adding L-cysteine. A) 10pl of 1M L-cysteine or D-cysteine (and ten-fold dilutions) were added to BMSA plates containing C. acnes (see Materials and Methods). The white area surrounding the place where the dot was deposited is C. acnes overgrowth. Note that the effect can be appreciated at 1M and 0.1M L-cysteine. The dark circle at 1M could be the result of the osmotic effect of adding 1M cysteine. B) Inhibition halo assays of BMSA plates containing the noted concentration of L-cysteine or D-cysteine. 10pl of decreasing concentrations of recombinant Cysk-3_ref were spotted. Note the reduction in the inhibition concomitant with the amount of L-cysteine in the plate while the inhibition zone remains constant when D-cysteine is added. C) as in A) but adding reduced glutathione instead of L-cysteine. D) as in B) but adding reduced glutathione instead of L-cysteine. Cysk3 in this figure corresponds to Cysk3_ref, as indicated herein. Cysk3 labels in the figure thus specifically refer to Cysk3_ref.
[0030] Figure 5: The homologs of Cysk-3_ref from E. coli (Cysk (E. Coli)) (panel A) and L. wadei (Cysk-3 (L. Wadei)) (panel B) inhibit C. acnes growth. C. acnes was embedded in a BMSA plate as described in Materials and Methods. 10 pl containing the noted amount of the different recombinant proteins from the noted species (and controls, wherein GST-control protein (E. Coli) is a control protein from E. coli with no inhibitory activity for C. acnes growth) were spotted on the plates and incubated for 2 to 3 days at 37°C in anaerobic conditions. The dark zones around the dots correspond with C. acnes growth inhibition zones.
[0031] Detailed description of the invention
[0032] All terms as used herein in this application, unless otherwise stated, shall be understood in their ordinary meaning as known in the art. Other more specific definitions for certain terms as used in the present application are as set forth below and are intended to apply uniformly throughout the specification and claims unless an otherwise expressly set out definition provides a broader definition.
[0033] As used herein, the indefinite articles “a” and “an” are synonymous with “at least one” or “one or more.” Unless indicated otherwise, definite articles used herein, such as “the” also include the plural of the noun.
[0034] The term “cysteine”, as used herein, refers to the amino acid well-known by an expert in the field and with IUPAC name Cysteine, also known as 2-Amino-3-sulfhydrylpropanoic acid.
[0035] In a particular embodiment, the term “cysteine” refers to cysteine in a form suitable for C. acnes growth.
[0036] The term “cysteine in a form suitable for C. acnes growth”, refers to cysteine in a chemical form in which it can be used by C. acnes for its growth, or in a form that promotes an environment suitable for C. acnes growth. As shown in the examples below, C. acnes is a bacterial species that appears to be particularly dependent on environmental cysteine bioavailability. Cysteine is an amino acid required for protein synthesis in general, as being part of most proteins synthesized by living organisms, including bacteria such as C. acnes. It is incorporated into newly synthesized proteins by living organisms in its L- configuration, i.e. as L-cysteine. Cysteine is also a well-known reducing agent, or antioxidant agent, due to the presence of a thiol group (-SH) in the amino acid which is prone to be oxidized. In its protonated form it is referred to as thiolate (-S') which is even more prone to oxidation than the thiol group. This high tendency of cysteine to be oxidized confers to the amino acid a high capacity to reduce the medium in which it is comprised, referred to as its antioxidant activity.
[0037] Non-limiting examples of methods for determining the configuration of an amino acid, in particular of cysteine, include Ultra-violet visible (UV-vis) spectroscopy or fluorescence detection, liquid chromatography-mass spectromety (LC-MS) or High-performance liquid chromatography-mass spectrometry (HPLC-MS) (see for instance Kato M. and Takatsu A. “Amino Acid Analysis by Hydrophilic Interaction Chromatography Coupled with Isotope Dilution Mass Spectrometry”, Amino Acid Analysis: Methods and Protocols, Methods in Molecular Biology, 2012, vol. 828, Chapter 6, DOI 10.1007 / 978-1 -61779-445-2_6). Methods to determine if cysteine comprises a thiol or thiolate group are also well-known by an expert in the field. Non-limiting examples of such methods include LC-MS, HPLC- MS, or any of the methods described in Borges C. R. and Sherma N. D., “Techniques for the Analysis of Cysteine Sulfhydryls and Oxidative Protein Folding”, Antioxid Redox Signal. 2014; 21 (3): 511-531.
[0038] In a particular embodiment, the term “cysteine in a form suitable for C. acnes growth” refers to cysteine in its L- configuration (i.e. L-cysteine), cysteine with a thiol group, cysteine with thiolate group, L-cysteine with a thiol group, or L-cysteine with a thiolate group, particularly, L-cysteine.
[0039] The term “cysteine bioavailability”, as used herein, refers to the extent cysteine is completely available to its intended biological destination(s). Particularly, the intended biological destination is C. acnes bacteria, i.e. cysteine bioavailability refers to cysteine bioavailability for C. acnes growth. In the context of the present invention, the term refers to the amount or concentration of cysteine, particularly of cysteine in a form suitable for C. acnes growth. It also simply refers to the amount or concentration of cysteine, in a certain volume or surface, that C. acnes is capable to use for its growth. In the context of the present invention the term refers to cysteine bioavailability in a tissue or body fluid of a subject, such as the skin, mucosa, a follicle or group of follicles, ocular tissue, eyelids, intraocular fluid, cerebrospinal fluid, synovial fluid, or bone. In the context of the non- therapeutic use of the compound of the invention as an antibacterial agent, the term refers to cysteine bioavailability on an abiotic surface or in a plant tissue or fluid. Methods to determine cysteine concentration or amount in a particular tissue, fluid or surface, are well-known by an expert in the field. Non-limiting examples of such methods include obtaining a sample from the biological material or surface to be analyzed, by any known method part of common general knowledge, and determining the concentration of cysteine in said sample using an anti-cysteine antibody, for instance by Western-blot, ELISA, Immunohistochemistry using control samples with known cysteine concentrations, or using commercial kits for determining cysteine concentration, such as fluorometric cysteine kits (see for instance Cysteine assay kit A319672 from Anitbodies.com, or Cysteine Assay Kit MAK255 from Sigma-Aldrich). As well-understood by a skilled person, in order to determine the amount or concentration of L-cysteine comprised in a sample include determining the concentration of cysteine, for instance with any of the methods provided herein and then determining the configuration of cysteine in the sample analyzed, for instance with any of the methods provided in the definition of “cysteine in a form suitable for C. acnes growth.” As well understood by a skilled person, examples of methods to determine if a compound reduces cysteine bioavailability comprise comparing cysteine bioavailability in a sample in the absence of the compound, for instance with any of the methods listed above, with cysteine bioavailability in a comparable sample that comprises the compound. Other non-limiting examples of well-known methods to determine if a compound reduces cysteine bioavailability in a certain volume or surface, particularly for C. acnes growth, include comparing the reduction in cysteine concentration in a volume or surface comprising C. acnes, in the presence and absence of the compound, using for instance any of the methods referred above. If the reduction in cysteine concentration in the volume or surface (i.e. the use of cysteine) is lower in the presence of the compound than in the absence of the compound, it is indicative that the compound reduces cysteine bioavailability, specifically for C. acnes growth.
[0040] The term “reduces cysteine bioavailability”, as used herein, refers to the fact that cysteine bioavailability is reduced in the presence of the compound of the invention, as compared to in the absence of the compound of the invention.
[0041] The term “degrades cysteine”, as used herein, refers to the fact the compound of the invention performs a reaction that results in that cysteine is transformed into a product different from cysteine. Such reaction can for instance consist in an enzymatic reaction, such as an enzymatic reaction that transforms (L-)cysteine into (L-)lanthionine and H2S, into (L-)serine and H2S, or into Pyruvate, NH3 and H2S. As well understood by a skilled person, when a compound degrades cysteine, the amount or concentration of cysteine in the presence of the compound is reduced as compared to in the absence of the compound. Methods to determine whether a compound degrades cysteine thus include those provided above to determine whether the compound of the invention reduces cysteine bioavailability.
[0042] The term “impairs protein synthesis by C. acnes", as used herein, refers to the fact that C. acnes bacteria have a reduced protein synthesis rate, or synthesize a lower amount of proteins, in the presence of the compound of the invention, as compared to in the absence of the compound of the invention. Non-limitative examples of methods allowing to determine if a compound impairs protein synthesis by C. acnes include measuring the rate of protein synthesis or amount of proteins synthesized by a cell culture of C. acnes in the presence and in the absence of the compound, by any known technique by an expert in the field, such as ribosome profiling or using a radiolabeled amino acids such as35S- Methionine in the culture media, resolving bacterial cell lysates in SDS-Page gels visualized Coomassie staining and Phosphorimager.
[0043] The term "bacterial infection" refers to a condition or disease associated with the proliferation of a pathogenic bacteria on or inside the body. Pathogenic bacteria can be opportunistic bacteria, that is bacteria that are normally commensal in the body — such as C. acnes — but that can cause disease under particular circumstances — such as acne when hair follicles get clogged.
[0044] As used herein, "acne vulgaris" or "acne" refers to a skin condition that occurs when dead skin cells and oil from the skin clog hair follicles. Acne may be classified as noninflammatory acne — when there is no bacterial infection — and inflammatory acne — when the clogged pores have become infected with bacteria, in particular C. acnes. The term "pharmaceutically acceptable" as used herein pertains to compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of a subject (e.g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Each carrier, excipient, etc., must also be “acceptable" in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, excipients, etc. can be found in standard pharmaceutical texts, and include, as a way of example preservatives, agglutinants, humectants, emollients, and antioxidants.
[0045] The term "effective amount" as used herein, means an amount of an active agent high enough to deliver the desired benefit (either the treatment or prevention of the illness), but low enough to avoid serious side effects within the scope of medical judgment.
[0046] The terms “cosmetically acceptable” or “dermatological acceptable” have the same meaning and are herein used interchangeably. They refer to that excipients or carriers suitable for use in contact with human skin without undue toxicity, incompatibility, instability, allergic response, among others. The excipients or carriers used have affinity for the skin, are well tolerated, stable, and are used in an amount adequate to provide the desired consistency, and ease application. The appropriate excipients and / or carriers, and their amounts, can readily be determined by those skilled in the art according to the type of formulation being prepared to provide the desired consistency and ease application. Examples of appropriate excipients or carriers can include, but not limited to, surfactant, vehicle, preservative, propellant, pH-regulating agent, stabilizing agents, viscosity agent, skin conditioning agent, antioxidant and mixture thereof. The bacterium, lysate or supernatant of the invention can also be cosmetic in case that the skin is not considered to suffer any disease, but due to the presence, for example, of comedo or whiteheads (without inflammation) an unaesthetic appearance is made evident.
[0047] As indicated above, the invention provides in a first aspect a compound that reduces cysteine bioavailability, for use in the prevention and / or treatment of a bacterial infection. In a particular embodiment, the compound of the first aspect reduces cysteine bioavailability in at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or in 100%, wherein 100% corresponds to the amount of cysteine in the absence of the compound of the first aspect. Methods to determine if a compound reduces cysteine bioavailability have been provided above in the definition of cysteine bioavailability and can be used to determine if the compound of the first aspect reduces cysteine bioavailability, and in which percentage.
[0048] In a particular embodiment, the term “reduces cysteine bioavailability” used in the present disclosure, is substituted herein by “is capable of reducing cysteine bioavailability”, more particularly the term “a compound that reduces cysteine bioavailability” used in the present disclosure, is substituted herein by “a compound capable of reducing cysteine bioavailability”. Thus, in another particular embodiment, all the embodiments addressed to a compound that reduces cysteine bioavailability are equally applicable to a compound capable of reducing cysteine bioavailability.
[0049] In another embodiment, the compound of the first aspect degrades cysteine. Particularly, the compound of the first aspect degrades at least 1 %, at least 3%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or in 100% of cysteine, wherein 100% corresponds to the amount of cysteine in the absence of the compound of the invention. Methods to determine if a compound degrades cysteine have been provided above in the definition of “degrades cysteine”.
[0050] In another particular embodiment, the compound of the first aspect degrades cysteine into serine, particularly L-cysteine into L-serine. More particularly, the compound of the first aspect degrades cysteine into serine in a percentage selected from those provided in the paragraph above for cysteine degradation, wherein 100% corresponds to the amount of cysteine in the absence of the compound of the invention. Non-limitative examples of methods to determine the amount of cysteine degraded into serine by a compound comprise the methods provided to determine the amount of cysteine degraded by a compound, and optionally, also similar methods addressed to determine the amount of serine synthesized, for instance using an antibody against serine instead of against cysteine, or a commercial kit such as DL-Serine Assay Kit from Sigma-Aldrich.
[0051] In a particular embodiment, the term “degrades cysteine” used in the present disclosure, is substituted herein by “is capable of degrading cysteine”, more particularly the term “a compound that degrades cysteine” used in the present disclosure, is substituted herein by “a compound capable of degrading cysteine”. Thus, in another particular embodiment, all the embodiments addressed to a compound that degrades cysteine are equally applicable to a compound capable of degrading cysteine.
[0052] In another embodiment, the compound of the first aspect impairs protein synthesis by C. acnes. In a particular embodiment, the compound of the invention reduces protein synthesis by C. acnes, or reduces the amount of proteins synthesized by C. acnes, in at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or in 100%, wherein 100% corresponds to the rate of protein synthesis or the amount of proteins synthesized by C. acnes in the absence of the compound of the invention. Methods to determine if a compound reduces protein synthesis by C. acnes have been provided above in the definition of “impairs protein synthesis”.
[0053] In a particular embodiment, the term “impairs protein synthesis by C. acnes" used in the present disclosure, is substituted herein by “is capable of impairing protein synthesis by C. acnes", more particularly the term “a compound that impairs protein synthesis by C. acnes" used in the present disclosure, is substituted herein by “a compound capable of impairing protein synthesis by C. acnes". Thus, in another particular embodiment, all the embodiments addressed to a compound that impairs protein synthesis by C. acnes are equally applicable to a compound capable of impairing protein synthesis by C. acnes.
[0054] In another embodiment, the compound of the first reduces the antioxidant activity in a medium, particularly in a medium comprising growing bacteria, particularly growing C. acnes bacteria. In particular embodiment, the compound of the first aspect reduces in at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or in 100% the antioxidant activity in the medium, wherein 100% consist in the antioxidant activity of the medium in the absence of the compound of the first aspect. In a particular embodiment, “reducing the antioxidant activity in a medium” refers to reducing the antioxidant activity provided by cysteine to the medium. Methods to determine the antioxidant activity in a medium are well-known by an expert in the field. Non-limiting examples of such methods include those addressed to determine the redox potential of a medium, such as permanganometry or iodometry. Additional methods are provided in Baranowska M. et al., “The relationship between standard reduction potentials of catechins and biological activities involved in redox control”, Redox Biology, 2018, 17: 355-366.
[0055] In a particular embodiment, the term “reduces the antioxidant activity” used in the present disclosure, is substituted herein by “is capable of reducing the antioxidant activity”, more particularly the term “a compound that reduces the antioxidant activity” used in the present disclosure, is substituted herein by “a compound capable of reducing the antioxidant activity”. Thus, in another particular embodiment, all the embodiments addressed to a a compound that reduces the antioxidant activity are equally applicable to a compound a compound capable of reducing the antioxidant activity.
[0056] In another embodiment, the compound of the first aspect is a protein, particularly an enzyme. Particularly, the compound of the first aspect is a protein from the pyridoxal phosphate-dependent family of proteins. More particularly, it is a protein from the pyridoxal phosphate-dependent family of proteins involved in the cysteine metabolism pathways. The term “pyridoxal phosphate-dependent family of proteins”, as used herein, refers to enzymes that use the cofactor pyridoxal phosphate (PLP). Enzymes falling within said family of proteins are well-known by an expert in the field.
[0057] In a more particular embodiment, the compound of the first aspect is a Cysk enzyme, more particularly a Cysk-3 enzyme. The term “Cysk”, as used herein refers to a cysteine synthase, or cysteine desulphydrase. In a more particular embodiment, the compound of the first aspect is a cysteine desulphydrase. In a particular embodiment, a cysk referred herein as a cysteine desulphydrase (as well as a compound referred herein as a cysteine desulphydrase) refers to the fact that the enzyme (or the compound) has the capacity to act as a cysteine desulphydrase, has cysteine desulphydrase activity, or has the capacity to catalyze the reaction commonly catalyzed by cysteine desulphydrases. In a particular embodiment, the “Cysk” enzyme as used herein, refers to a Cysk3 enzyme. In another particular embodiment of the first aspect, the compound of the first aspect is a Cysk3 enzyme. In a more particular embodiment, “Cysk”, particularly “Cysk3”, refers to a cysteine synthase, more particularly to an acetylserine sulfhydrylase. In another particular embodiment, the compound of the first aspect is an acetylserine sulfhydrase. In a particular embodiment, the “cysk” enzyme as used herein, refers to an acetylserine sulfhydrase.
[0058] The term “Cysk-3” refers to cysk3_ref and any protein homolog thereof, particularly to a protein selected from the list consisting of cysk3_ref, cysk (E. coli), cysk3 (L. wadei). More particularly, Cysk_3 referred herein corresponds to Cysk3_ref.
[0059] The term “Cysk3_ref”, or “reference Cysk3” corresponds to the protein consisting of SEQ ID NO. 4.
[0060] The term “Cysk (E. Coli)", “Cysk from E. coli’, or “E. Coli Cysk”, as used herein, refers to the protein consisting of SEQ ID NO. 12. As well understood by a skilled person the term “E. Colli’ refers to the bacteria species Escherichia coli.
[0061] The term “Cysk3 (L.wadei), “Cysk3 from L. Wadei’, “L . wadei Cysk3”, as used herein, refers to protein consisting of SEQ ID NO. 13. As well understood by a skilled person the term “L. wader refers to the bacteria species Leptotrichia wadei.
[0062] In another particular embodiment, the compound of the first aspect is a protein, particularly from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly a Cysk-3 enzyme, that comprises at least one sequence selected from the list consisting of:
[0063] (i) a sequence at least 70% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1 ,
[0064] (ii) a sequence at least 70% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.2, and
[0065] (iii) a sequence at least 70% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0066] In another particular embodiment, the compound of the first aspect is a protein from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, that comprises at least one sequence selected from the list consisting of:
[0067] (i) a sequence at least 70% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1,
[0068] (ii) a sequence at least 70% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.2, and
[0069] (iii) a sequence at least 70% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0070] In a particularly preferred embodiment, the protein as defined in the previous embodiment is a cysk enzyme. In another particularly preferred embodiment, the protein defined in said previous paragraph is an acetylserine sulfhydrase.
[0071] In another particular embodiment, the compound of the first aspect is a protein, particularly from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly a cysk-3 enzyme, that comprises at least one sequence selected from the list consisting of:
[0072] (i) a sequence at least 80% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1 ,
[0073] (ii) a sequence at least 80% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO. 2, and (iii) a sequence at least 80% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to
[0074] SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0075] In another particular embodiment, the compound of the first aspect is a protein from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism that comprises at least one sequence selected from the list consisting of:
[0076] (i) a sequence at least 80% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1,
[0077] (ii) a sequence at least 80% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO. 2, and
[0078] (iii) a sequence at least 80% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii). In a particularly preferred embodiment, the protein as defined in the previous embodiment is a cysk enzyme. In another particularly preferred embodiment, the protein defined in said previous paragraph is an acetylserine sulfhydrase.
[0079] In another particular embodiment, the compound of the first aspect is a protein, particularly from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly a Cysk-3 enzyme, that comprises at least one sequence selected from the list consisting of:
[0080] (i) a sequence at least 90% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1 ,
[0081] (ii) a sequence at least 90% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.2, and
[0082] (iii) a sequence at least 90% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0083] In another particular embodiment, the compound of the first aspect is a protein from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism that comprises at least one sequence selected from the list consisting of:
[0084] (i) a sequence at least 90% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.1,
[0085] (ii) a sequence at least 90% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.2, and
[0086] (iii) a sequence at least 90% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0087] In a particularly preferred embodiment, the protein as defined in the previous embodiment is a cysk enzyme. In another particularly preferred embodiment, the protein defined in said previous paragraph is an acetylserine sulfhydrase.
[0088] In another particular embodiment, the compound of the first aspect is a protein, particularly from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a cysk enzyme, even yet more particularly a cysk-3 enzyme, that comprises at least one sequence selected from the list consisting of :
[0089] (i) SEQ ID NO. 1 or SEQ ID NO. 5, particularly SEQ ID NO.1,
[0090] (ii) SEQ ID NO. 2 or SEQ ID NO. 6, particularly SEQ ID NO.2, and
[0091] (iii) SEQ ID NO. 3 or SEQ ID NO. 7, particularly SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0092] In another particular embodiment, the compound of the first aspect is a protein from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism that comprises at least one sequence selected from the list consisting of:
[0093] (i) SEQ ID NO. 1 or SEQ ID NO. 5, particularly SEQ ID NO.1,
[0094] (ii) SEQ ID NO. 2 or SEQ ID NO. 6, particularly SEQ ID NO.2, and
[0095] (iii) SEQ ID NO. 3 or SEQ ID NO. 7, particularly SEQ ID NO.3, particularly a protein comprising the three sequences indicated in (i)-(iii). In a particularly preferred embodiment, the protein as defined in the previous embodiment is a cysk enzyme. In another particularly preferred embodiment, the protein defined in said previous paragraph is an acetylserine sulfhydrase.
[0096] In a particular embodiment, the compound of the first aspect is a protein that comprises at least one sequence selected from the list consisting of:
[0097] (i) a sequence at least 70% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.5,
[0098] (ii) a sequence at least 70% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.6, and
[0099] (iii) a sequence at least 70% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.7, particularly a protein comprising the three sequences indicated in (i)-(iii). In another particular embodiment, the compound of the first aspect is a protein that comprises at least one sequence selected from the list consisting of:
[0100] (i) a sequence at least 90% identical to SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.5,
[0101] (ii) a sequence at least 90% identical to SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.6, and
[0102] (iii) a sequence at least 90% identical to SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.7, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0103] In another particular embodiment, the compound of the first aspect is a protein that comprises at least one sequence selected from the list consisting of:
[0104] (i) SEQ ID NO. 1 or to SEQ ID NO. 5, particularly to SEQ ID NO.5,
[0105] (ii) SEQ ID NO. 2 or to SEQ ID NO. 6, particularly to SEQ ID NO.6, and
[0106] (iii) SEQ ID NO. 3 or to SEQ ID NO. 7, particularly to SEQ ID NO.7, particularly a protein comprising the three sequences indicated in (i)-(iii).
[0107] In a particular embodiment, the compound of the first aspect as defined in the previous 3 paragraphs is a protein from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism. In a more particular embodiment, the compound of the first aspect as defined in the previous 3 paragraphs is a cysk protein, more particularly a cysk3 protein. In a yet more particularly preferred embodiment, the protein as defined in the previous 3 paragraphs is an acetylserine sulfhydrase.
[0108] In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% at least 99% sequence identity with SEQ ID NO. 4. In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 95%, at least 97%, at least 99% sequence identity with SEQ ID NO. 4, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a cysk-3 enzyme. In a more particular embodiment, the compound of the first aspect is the protein consisting of SEQ ID NO. 4. In a particularly preferred embodiment, the compound of the first aspect is a protein that has at least 90% sequence identity with SEQ ID NO. 4, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even is a Cysk enzyme, yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 95% sequence identity with SEQ ID NO. 4, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even is a Cysk enzyme, yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 97% sequence identity with SEQ ID NO. 4, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a Cysk-3 enzyme. In a particularly preferred embodiment, the protein as defined in the present paragraph is an acetylserine sulfhydrase.
[0109] In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% sequence identity with SEQ ID NO. 12. In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% sequence identity with SEQ ID NO. 12, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphatedependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a Cysk3- enzyme. In a more particular embodiment, the compound of the first aspect is the protein consisting of SEQ ID NO. 12. In a particularly preferred embodiment, the compound of the first aspect is a protein that has at least 90% sequence identity with SEQ ID NO. 12, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 95% sequence identity with SEQ ID NO. 12, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 97% sequence identity with SEQ ID NO. 12, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly is a Cysk-3 enzyme. In a particularly preferred embodiment, the protein as defined in the present paragraph is an acetylserine sulfhydrase.
[0110] In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% sequence identity with SEQ ID NO. 13. In another particular embodiment, the compound of the first aspect is a protein that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% sequence identity with SEQ ID NO. 13, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphatedependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even yet more particularly a Cysk-3 enzyme. In a more particular embodiment, the compound of the first aspect is the protein consisting of SEQ ID NO. 13. In a particularly preferred embodiment, the compound of the first aspect is a protein that has at least 90% sequence identity with SEQ ID NO. 13, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even is a Cysk enzyme, yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 95% sequence identity with SEQ ID NO. 13, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even is a Cysk enzyme, yet more particularly is a Cysk-3 enzyme. In another particularly preferred embodiment, the compound of the first aspect is a protein that has at least 97% sequence identity with SEQ ID NO. 13, particularly wherein the protein is from pyridoxal phosphate-dependent family of proteins, more particularly from pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism, yet more particularly a Cysk enzyme, even is a Cysk enzyme, yet more particularly is a Cysk-3 enzyme. In a particularly preferred embodiment, the protein as defined in the present paragraph is an acetylserine sulfhydrase.
[0111] In a particular embodiment, the compound of the first aspect comprises or consists of a protein selected from the list consisting of Cysk3_ref, Cysk3 (L. Wadei), Cysk (E.Coli) and combinations thereof, particularly from the list consisting of Cysk3_ref, Cysk3 (L. Wadei), and Cysk (E.Coli).
[0112] In the present invention the term "identical" or "identity" refers to the percentage of residues that are identical in the two sequences when the sequences are optimally aligned. If, in the optimal alignment, a position in a first sequence is occupied by the same amino acid residue as the corresponding position in the second sequence, the sequences exhibit identity with respect to that position. The percentage of identity determines the number of identical residues over a defined length in a given alignment. Thus, the level of identity between two sequences or ("percent sequence identity") is measured as a ratio of the number of identical positions shared by the sequences with respect to the number of positions compared (i.e., percent sequence identity = (number of identical positions / total number of positions compared) x 100). A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other, is regarded as a position with nonidentical residues and is counted as a compared position.
[0113] As an illustration, by a protein having an amino acid sequence being at least, for example, 95% identical to a reference amino acid sequence of SEQ ID NO:4 is intended that the amino acid sequence of the protein is identical to the reference sequence except that the protein sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of SEQ ID NO: 4. In other words, to obtain a protein having an amino acid sequence of at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
[0114] A number of mathematical algorithms for rapidly obtaining the optimal alignment and calculating identity between two or more sequences are known and incorporated into a number of available software programs. For purposes of the present invention, the sequence identity between two amino acid sequences is preferably determined using algorithms based on global alignment, such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), preferably implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277); or the BLAST Global Alignment tool (Altschul et al., “Basic local alignment search tool”, 1990, J. Mol. Biol, v. 215, pages 403-410), using default settings. Local alignment also can be used when the sequences being compared are substantially the same length.
[0115] In a particular embodiment of the first aspect, “cysteine” refers to L-cysteine, cysteine with a thiol group, cysteine with thiolate group, L-cysteine with a thiol group, or L-cysteine with a thiolate group, particularly, L-cysteine with a thiolate group. In a more particular embodiment of the first aspect, cysteine refers to L-cysteine. Thus, in a yet more particular embodiment, the term “cysteine” used in any of the definitions and embodiments of the first aspect is substituted by L-cysteine, cysteine with a thiol group, cysteine with thiolate group, L-cysteine with a thiol group, or L-cysteine with a thiolate group, particularly, by L- cysteine.
[0116] In another particular embodiment, the compound of the first aspect of the invention substantially retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium. As used herein, by "substantially retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium " is meant that the the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis, to reduce antioxidant activity in a medium of the reference protein and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, "substantially retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium" is meant that the the compound has at least 99 % of the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium of the reference protein, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, the compound of the first aspect of the invention retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium.
[0117] In another particular embodiment, the compound of the first aspect of the invention substantially retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium. As used herein, by "substantially retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium " is meant that the the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis, to reduce antioxidant activity in a medium of the reference protein and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, "substantially retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium" is meant that the the compound has at least 99 % of the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium of the reference protein, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, the compound of the first aspect of the invention retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium.
[0118] In another particular embodiment, the compound of the first aspect of the invention substantially retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium. As used herein, by "substantially retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium " is meant that the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis, to reduce antioxidant activity in a medium of the reference protein and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, "substantially retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium" is meant that the the compound has at least 99 % of the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium of the reference protein, particularly the antioxidant activity provided by cysteine to the medium, measured by any suitable method known in the art, particularly the methods disclosed above. In another particular embodiment, the compound of the first aspect of the invention retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium.
[0119] In another particular embodiment, the compound of the first aspect substantially retains or enhances the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth. As used herein by “substantial retains or enhances the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth. In a particular embodiment, by “substantial retains or enhances the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 99% of the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth. In another particular embodiment, the compound of the first aspect retains or enhances the capacity of protein with SEQ ID NO. 4 to inhibit C. acnes growth
[0120] In another particular embodiment, the compound of the first aspect substantially retains or enhances the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth. As used herein by “substantial retains or enhances the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth. In a particular embodiment, by “substantial retains or enhances the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 99% of the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth. In another particular embodiment, the compound of the first aspect retains or enhances the capacity of protein with SEQ ID NO. 12 to inhibit C. acnes growth
[0121] In another particular embodiment, the compound of the first aspect substantially retains or enhances the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth. As used herein by “substantial retains or enhances the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 95% of the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth. In a particular embodiment, by “substantial retains or enhances the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth”, it is meant that the compound has at least 90 %, more particularly at least 99% of the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth. In another particular embodiment, the compound of the first aspect retains or enhances the capacity of protein with SEQ ID NO. 13 to inhibit C. acnes growth
[0122] Methods to determine if a compound inhibits the growth of C. acnes are well-known by an expert in the field and include those provided in the examples below, which can also be used to compare the capacity of two compounds to inhibit C. acnes growth, by simply performing two of such assays in parallel, each one with one of the two compounds, and subsequently measuring and comparing the inhibitory zone obtained with each compound.
[0123] In another particular embodiment, the compound of the first aspect of the invention is for use in the prevention and / or treatment of a bacterial infection caused by or associated with a bacteria dependent on cysteine bioavailability. In other words, the compound of the first aspect of the invention is for use in the prevention and / or treatment of a bacterial infection caused by or associated with bacteria that requires external supply of cysteine for its growth.
[0124] As well known by an expert in the field, a bacteria dependent of cysteine bioavailability is bacteria that requires external supply of cysteine for its growth. Such bacteria are well- known by an expert in the field. Non-limiting examples include those disclosed in Shanson D. C., Singh J., “Effect of adding cysteine to brain-heart infusion broth on the isolation of Bacteroides fragilis from experimental blood cultures”. J Clin Pathol 1981;34:221-223 or in Ewann F. and Hoffman P. S., Cysteine Metabolism in Legionella pneumophila: Characterization of an l-Cystine-Utilizing Mutant, Appl Environ Microbiol. 2006; 72(6): 3993-4000. In a particular embodiment of the first aspect of the invention, the compound that reduces cysteine bioavailability is for use in the treatment of a bacterial infection caused or associated with bacteria that requires external supply of cysteine for its growth, particularly a bacteria that requires external supply of cysteine for its growth selected from those listed in the documents provided just above. Thus, in a particular embodiment of the first aspect, all the embodiments of the first aspect regarding “C. acnes" are equally applicable to bacteria that require external supply of cysteine for their growth, particularly selected from those known by an expert in the field, more particularly from those listed in the documents referred above. Thus, in a particular embodiment, the term “C. acnes" in the embodiments of the present invention, is substituted by “bacteria that require external supply of cysteine for their growth”. In another particular embodiment, the term “C. acnes" in the embodiments of present invention is substituted by any bacteria selected from those listed in the documents referred above in the present paragraph.
[0125] In a particular embodiment of the first aspect, the bacterial infection is caused by or associated with Cutibacterium acnes. In other words, the bacterial infection is related to the pathogenic growth of Cutibacterium acnes. In a particular embodiment, the bacterial infection is caused by Cutibacterium acnes. In another particular embodiment, the bacterial infection is a C. acnes bacterial infection In a more particular embodiment, the bacterial infection caused by or associated with Cutibacterium acnes is selected from the group consisting of acne vulgaris, ocular infection (e.g. blepharitis and endophthalmitis), dental infection, skin infection (e.g. fatal bacteria granuloma after trauma), endocarditis, bone infection, joint infection, central nervous system infection (e.g. spondylodiscitis or cerebrospinal fluid shunt infection), sepsis, postoperative infection, cerebrospinal fluid shunt infection, device-related infection, and combinations thereof. Thus, in a particular embodiment, the compound of the first aspect is for use in the treatment and / or prevention of acne vulgaris, particularly wherein acne vulgaris is inflammatory acne.
[0126] In a particular embodiment of the first aspect, the compound that inhibits cysteine bioavailability, is for the prevention and / or treatment of acne vulgaris. In a more particular embodiment, acne vulgaris is inflammatory acne.
[0127] In a particular embodiment of the first aspect, the compound of the first aspect, particularly wherein the compound is a protein, is concentrated, freeze and / or freeze-dried. In a more particular embodiment, it is freeze.
[0128] In a particular embodiment of the first aspect, the compound that inhibits cysteine bioavailability, is for use in combination therapy with an antibiotic or an anti-inflammatory agent. Antibiotics and anti-inflammatory agents that can be used in the present invention, in particular for treating C. acnes infections, are well known to the skilled person and form part of the common general knowledge.
[0129] In a further aspect, the invention provides a compound that reduces cysteine bioavailability, for use in the treatment of a disease or condition caused by or associated with Cutibacterium acnes, particularly acne vulgaris.
[0130] In a further aspect, the invention provides a compound that reduces cysteine bioavailability, for use in the treatment of a disease or condition caused by or associated with Cutibacterium acnes, particularly a Cutibacterium acnes infection.
[0131] In a further aspect, the invention provides a compound for use in the prevention and / or treatment of a bacterial infection caused by or associated with Cutibacterium acnes, particularly for the treatment of acne vulgaris. In a particular embodiment, the compound of this aspect is a compound as defined in any of the embodiments of the first aspect, more particularly is a protein as defined in any of the embodiments of the first aspect. In a more particular embodiment, all the embodiments and definitions of the first are equally applicable to this aspect. In another particular embodiment, reference to a compound that reduces cysteine bioavailability, or to the compound of the first aspect, in the rest of aspects, including the second, third, fourth, fifth, sixth and seventh aspect, is substituted by reference to the compound of the present aspect. In another particular embodiment, the compound that reduces cysteine bioavailability, or the compound of the first aspect, referred in the rest of aspects of the invention, including the second, third, fourth, fifth, sixth and seventh aspect, is substituted by the compound of the present aspect. In another particular embodiment, all the embodiments of the compound of the present aspect are equally applicable to the compound of the rest of aspects, including of the second, third, fourth, fifth, sixth and seventh aspect.
[0132] In an even further aspect, the invention provides a compound that reduces antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, for use in the treatment of a bacterial infection, particularly in the treatment or prevention of a disease or condition caused by or associated with Cutibacterium acnes, more particularly a Cutibacterium acnes infection, yet more particularly acne vulgaris. In a particular embodiment, the medium comprises growing bacteria from the species that caused or that is associated with the infection, particularly, growing C. acnes bacteria.
[0133] Methods to determine the antioxidant activity in a medium have been provided above and also apply to determine if a compound reduces said antioxidant activity. In a particular embodiment, the compound that reduces antioxidant activity in a medium does not necessarily abrogates the antioxidant activity in the medium. In a particular embodiment, the compound that reduces antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, reduces the activity in at least 1%, at least 3%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or in 100%, wherein 100% corresponds to the antioxidant activity in the medium in the absence of the compound.
[0134] In a particular embodiment, all the embodiments and definitions of the first aspect of the invention are equally applicable to the rest of aspects of the invention. All the embodiment and definitions of the first aspect of the invention regarding the compound of the first aspect are equally applicable to the compounds referred in the rest of aspects of the invention.
[0135] As above described, the invention also provides in a second aspect a pharmaceutical composition comprising a therapeutically effective amount of a compound that reduces cysteine bioavailability together with at least one pharmaceutically acceptable excipient and / or carrier. All embodiments described above for the first aspect are also meant to apply to this second aspect. Particularly, all embodiments described above for the first aspect regarding the compound that reduces cysteine bioavailability, are also meant to apply to this second aspect. In a particular embodiment, the compound that reduces cysteine bioavailability referred in the second aspect consists in the compound as defined in the first aspect.
[0136] As above described, in a third aspect the invention provides the pharmaceutical composition as defined in the second aspect for use as a medicament. In a fourth aspect, the invention provides the pharmaceutical composition as defined in the second aspect for use in the prevention and / or treatment of a bacterial infection, particularly a bacterial infection caused by or associated with Cutibacterium acnes. In a particular embodiment, all the embodiments and definition of the first and second aspect are also meant to apply to the third or fourth aspects of the invention. In another particular embodiment, the embodiments and definitions of the first aspect relating the compound of the first aspect, are equally applicable to the third and fourth aspects. In another particular embodiment, the embodiments and definitions of the first and second aspect relating to the bacterial infection are equally applicable to the fourth aspect. All the embodiments and definition of the first aspect regarding prevention and / or treatment of a bacterial infection are also meant to apply to the third and fourth aspects of the invention. In a particularly preferred embodiment of the fourth aspect, the pharmaceutical composition is for use in the treatment of acne vulgaris.
[0137] In a particular embodiment of the fourth aspect, the prevention and / or treatment comprises administering the pharmaceutical composition at a dose causing the inhibition or reduction of C. acnes growth.
[0138] As above indicated, in a fifth aspect, the invention provides a cosmetic composition comprising a cosmetically effective amount of a compound that reduces cysteine bioavailability, together with at least one cosmetically acceptable excipient and / or carrier. In a particular embodiment, the cosmetic composition is a deodorant cosmetic composition. In a particular embodiment, all the embodiments and definition of the first aspect are also meant to apply to the fifth aspect of the invention. All the embodiments and definitions of the first aspect regarding the compound of the first aspect are also meant to apply to the fifth aspect of the invention. In a particular embodiment, the compound that reduces cysteine bioavailability referred in the fifth aspect consists in the compound as defined in the first aspect.
[0139] In a particular embodiment of the second and fifth aspects, the pharmaceutical or cosmetical composition is formulated for topical use, particularly in a form selected from the group consisting of cream, gel, oil, emulsion, spray, gauze, patch, bandage, lotion, mousse, ointment, paste, liquid formulation for extemporaneous preparations, and mixtures thereof.
[0140] In a particular embodiment of the second or fifth aspects, the pharmaceutical or cosmetical composition is formulated for oral administration, particularly as a solid formulation, optionally in the form of a pill, capsule, table, granular powder.
[0141] As indicated before, the invention also provides in a sixth aspect a non-therapeutic use of a compound that reduces cysteine bioavailability, in cosmetics.
[0142] In a particular embodiment of the sixth aspect, the non-therapeutic use is for treating noninflammatory acne. In another particular embodiment of the sixth aspect, the non- therapeutic use is for reducing body odor.
[0143] In a seventh aspect, the invention provides a non-therapeutic use of a compound that reduces cysteine bioavailability, as an antibacterial agent.
[0144] In a particular embodiment of the seventh aspect, the use of a compound that reduces cysteine bioavailability, is an in vitro non-therapeutic use.
[0145] In a particular embodiment of the seventh aspect, the use of a compound that reduces cysteine bioavailability, is for inhibiting C. acnes growth.
[0146] In a particular embodiment of the seventh aspect, the use of a compound that reduces cysteine bioavailability is as antibacterial agent in an abiotic surface or in a plant.
[0147] In a particular embodiment, all embodiments of the first aspect are also meant to apply to the seventh aspect of the invention. All embodiments of the first aspect regarding the compound of the first aspect are meant to apply to the seventh aspect of the invention. In a particular embodiment, the compound that reduces cysteine bioavailability referred in the sixth or seventh aspect consists in the compound as defined in the first aspect. Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Furthermore, the word “comprise” encompasses the case of “consisting of”. In a particular embodiment, a protein referred herein as a protein with a SEQ ID NO. or having a SEQ ID NO., as used herein, is to be understood as a protein consisting of said SEQ ID NO. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration, and they are not intended to be limiting of the present invention. Reference signs related to drawings and placed in parentheses in a claim, are solely for attempting to increase the intelligibility of the claim and shall not be construed as limiting the scope of the claim. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.
[0148] For reasons of completeness, various aspects of the invention are set out in the following numbered embodiments:
[0149] 1- A compound, particularly a compound that reduces cysteine bioavailability or antioxidant activity in a medium, more particularly the antioxidant activity provided by cysteine to the medium, for use in the prevention and / or treatment of a bacterial infection.
[0150] 2- The compound for use according to embodiment 1, wherein the bacterial infection is caused by or associated with bacteria that requires external supply of cysteine for its growth.
[0151] 3- The compound for use according to any one of embodiments 1 or 2, wherein the bacterial infection is caused by or associated with Cutibacterium acnes, particularly caused by Cutibacterium acnes, more particularly is a Cutibacterium acnes bacterial infection
[0152] 4- The compound for use according to any one of embodiments 1-3 which is a compound that reduces cysteine bioavailability for C. acnes growth, or that degrades cysteine.
[0153] 5- The compound for use according to any one of embodiments 1-4 which is a compound that impairs the synthesis of proteins by the bacteria that caused or that is associated with the infection, particularly by Cutibacterium acnes.
[0154] 6- The compound for use according to any one of embodiments 1-4, wherein the compound reduces the antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine to the medium, reduces said activity in a medium comprising growing bacteria, particularly growing bacteria from the same species that caused or that is associated with the infection, particularly growing Cutibacterium acnes bacteria. 7- The compound for use according to any one of embodiments 1-6, wherein the compound is a protein.
[0155] 8- The compound for use according to embodiment 7, wherein the protein is from the pyridoxal phosphate-dependent family of proteins, particularly from the pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism.
[0156] 9- The compound for use according to any one of embodiments 7-8, wherein the protein is a Cysk protein.
[0157] 10- The compound for use according to any one of embodiments 7-9, wherein the protein is a Cysk3 protein.
[0158] 11- The compound for use according to any one of embodiments 7-10, wherein the protein is an acetylserine sulfhydrylase.
[0159] 12- The compound for use according to any one of embodiments 7-11 , wherein the protein has at least 45% sequence identity with SEQ ID NO. 4, particularly has at least 48% sequence identity with SEQ ID NO. 4.
[0160] 13- The compound for use according to any one of embodiments 7-12, wherein the protein has at least 50% sequence identity with SEQ ID NO. 4.
[0161] 14- The compound for use according to any one of embodiments 7-13, wherein the protein has at least 60% sequence identity with SEQ ID NO. 4.
[0162] 15- The compound for use according to any one of embodiments 7-14, wherein the protein has at least 70% sequence identity with SEQ ID NO. 4.
[0163] 16- The compound for use according to any one of embodiments 7-15, wherein the protein has at least 90% sequence identity with SEQ ID NO. 4.
[0164] 17- The compound for use according to any one of embodiments 7-16 wherein the protein consists of SEQ ID NO. 4.
[0165] 18- The compound for use according to any one of embodiments 7-11 , wherein the protein has at least 70% sequence identity with SEQ ID NO. 12.
[0166] 19- The compound for use according to any one of embodiments 7-11 , wherein the protein has at least 90% sequence identity with SEQ ID NO. 12.
[0167] 20- The compound for use according to any one of embodiments 7-11 wherein the protein consists of SEQ ID NO. 12.
[0168] 21- The compound for use according to any one of embodiments 7-11 , wherein the protein has at least 70% sequence identity with SEQ ID NO. 13.
[0169] 22- The compound for use according to any one of embodiments 7-11 , wherein the protein has at least 90% sequence identity with SEQ ID NO. 13.
[0170] 23- The compound for use according to any one of embodiments 7-11 wherein the protein consists of SEQ ID NO. 13.
[0171] 24- The compound for use according to any one of embodiments 1-23, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine in the medium.
[0172] 25- The compound for use according to any one of embodiments 1-24, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine in the medium.
[0173] 26- The compound for use according to any one of embodiments 1-25, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, to impair protein synthesis and / or to reduce antioxidant activity in a medium, particularly the antioxidant activity provided by cysteine in the medium.
[0174] 27- The compound for use according to any one of embodiments 1-26, wherein the compound substantially retains or enhances the capacity of protein with SEQ ID NO. 4, to inhibit C- acnes growth, particularly retains or enhances the capacity of protein with SEQ ID NO. 4, to inhibit C- acnes growth.
[0175] 28- The compound for use according to any one of embodiments 1-27, wherein the compound substantially retains or enhances the capacity of protein with SEQ ID NO. 12, to inhibit C- acnes growth, particularly retains or enhances the capacity of protein with SEQ ID NO. 12, to inhibit C- acnes growth.
[0176] 29- The compound for use according to any one of embodiments 1-28, wherein the compound substantially retains or enhances the capacity of protein with SEQ ID NO. 13, to inhibit C- acnes growth, particularly retains or enhances the capacity of protein with SEQ ID NO. 13, to inhibit C- acnes growth.
[0177] 30- The compound for use according to any of the preceding embodiments, wherein the bacterial infection caused by or associated with a bacteria that requires external supply of cysteine for its growth, particularly Cutibacterium acnes, is selected from the group consisting of acne vulgaris, pneumonia, legionnaires’ disease, ocular infection, dental infection, skin infection, endocarditis, bone infection, joint infection, central nervous system infection, sepsis, postoperative infection, device-related infection, and combinations thereof.
[0178] 31- The compound for use according to any one of the preceding embodiments which is for the prevention and / or treatment of acne vulgaris, particularly inflammatory acne.
[0179] 32- A pharmaceutical composition comprising a therapeutically effective amount of the compound as defined in any one of embodiments 1-31, together with at least one pharmaceutically acceptable excipient and / or carrier.
[0180] 33- The pharmaceutical composition according to embodiment 32, which is for use in the prevention and / or treatment of a bacterial infection.
[0181] 34- The pharmaceutical composition for use according to embodiment 33, wherein the bacterial infection is caused by or associated with bacteria that requires external supply of cysteine for its growth, particularly by Cutibacterium acnes.
[0182] 35- The pharmaceutical composition for use according to any one of embodiments 32-34 wherein the bacterial infection is selected from the group consisting of acne vulgaris, pneumonia, legionnaires’ disease, ocular infection, dental infection, skin infection, endocarditis, bone infection, joint infection, central nervous system infection, sepsis, postoperative infection, device-related infection, and combinations thereof.
[0183] 36- The pharmaceutical composition according to any one of embodiments 32-35 wherein the composition is for use in the treatment and / or prevention of acne vulgaris.
[0184] 37- A cosmetic composition comprising a cosmetically effective amount of the compound as defined in any one of embodiments 1-31, together with at least one cosmetically acceptable excipient and / or carrier.
[0185] 38- A non-therapeutic in vitro use of the compound as defined in any of embodiments 1-31, as an antibacterial agent; particularly, for inhibiting growth of a bacteria that requires external supply of cysteine for its growth.
[0186] 39- The non-therapeutic in vitro use according to embodiment 38, wherein the bacteria that requires external supply of cysteine for its growth is Cutibacterium acnes.
[0187] Examples
[0188] Example 1 Materials and methods
[0189] Cell lines and media
[0190] Cell lines were all obtained from the ATCC type collection. Particularly, HEK293T (authenticated by ATCC cell authentication service by STR profile report. FTA barcode: STRA6311), RPE1 (ATCC, CRL-4000), and HDFa (ZenB io DF-F). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Sigma-Aldrich) containing 10% FBS (fetal bovine serum) purchased to Sigma-Aldrich, 1% glutamax (Biowest) and 1% penicillin / streptomycin (Sigma-Aldrich). Cells were grown in humidified air at 37°C and 5% CO2. Cells were used for a maximum of five passages after thawing. Mycoplasma absence was periodically checked.
[0191] Bacteria species and media
[0192] BHI (Brain Heart Infusion broth) was from Conda ref 1048. R-2A (Reasoner’s 2A) was from Condalab ref: 1071.00. Nissui is a generally used nickname for GAM Broth Modified produced by Nissui ref 05433. BM (Bob Medium): yeast extract 2.5 g / l (Condalab ref: 1702.00), meat peptone 2.5 g / l (Condalab ref: 1616.05), casein hydrolysate 2.5 g / l (Merck ref: 22090), glucose 2.5 g / l, dipotassium hydrogen phosphate 1.5 g / l (Panreac ref 121512.1211) and sodium pyruvate 1.5 g / l (Gibco ref: 11840-048)). HEPES (VWR ref: 0511) was added to a final concentration of 75 mM. pH was adjusted to 7 by adding NaOH (Panreac ref: 141687.1211). MRS medium was from Scharlau ref:01 -135-500.
[0193] BMSA was BM containing 0.7% agar-agar (BM Soft Agar). BMSA was autoclaved and kept at 45°C, to include C. acnes at a final concentration of 0.0025 ODeoo / ml (1OD is the number of bacteria that when in 1 ml produces 1 unit of absorbance). The medium was laid in Petri dishes for solidification and ulterior use. When noted, filtered L-cysteine (Sigma-Aldrich ref 168149), D-cysteine (Sigma -Aldrich ref 30095) or reduced glutathione (Merck ref 1.04090) at the indicated concentration were included in the plates after autoclavation.
[0194] Inhibition zone assay
[0195] All different bacteria strains were thawed from the glycerol stock stored at -80°C. Particularly, C. acnes was streaked on agar-BHI plates. Bacteria were grown for 2 to 3 days at 37°C into an anaerobic jar (AnaeroGen, OXOID 2004AN0025A). C. acnes cells were scraped and placed in 1 ml of BM medium. Optical density was measured using a spectrophotometer at a wavelength of A=600 nm. To embed C. acnes in the BMSA plates, C. acnes at a final concentration of 0.0025 ODA6oo / ml was added to the medium kept in a water bath at 45°C and disposed of in empty 10 cm Petri plates, and let them solidify into a hood for 15 min. The Petri plate lids were partially open to avoid excess water condensation.
[0196] To check the inhibition capability by the formation of inhibition zones, 10 pl of recombinant proteins Cysk3_ref, Cysk3 from L. Wadei and Cysk from E. coli, were purified following the conditions indicated below and pipetted over the embedded C. acnes plate described above. The plates were left for 15-30 min in the hood for the liquid to be absorbed. Plates were kept at 37°C in anaerobic conditions for 2 to 3 days.
[0197] Cysk-3 ref (SEQ ID NO. 4), Cysk3 (L. wadei) (SEQ ID NO. 13) and Cysk (E. coli) (SEQ ID NO. 12) cloning, expression, and purification
[0198] Genes encoding Cysk-3_ref, Cysk3 (L. wadei) and Cysk (E. coli) were obtained by PCR using the following oligonucleotides:
[0199] - Cysk-3_ref:
[0200] Forward
[0201] TTCCAGGGGCCCCTGGGATCCATGATATACAATAATTTATTAGATTTAATTGGAAACA
[0202] CAC (SEQ ID NO. 18)
[0203] Reverse 5’TCGACCCGGGAATTCTTATTTTGTTAGAAATGCTTCAACTGATAG 3’ (SEQ ID NO. 9)
[0204] A template DNA comprising the nucleotide sequence encoding the protein with SEQ ID NO. 4 was PCR amplified with said oligos.
[0205] - Cysk (E. co / / ): Forward: TTCCAGGGGCCCCTGGGATCCATGAGTAAGATTTTTGAAGATAACTCGC
[0206] (SEQ ID NO. 19)
[0207] Reverse: TCGACCCGGGAATTCTTACTGTTGCAATTCTTTCTCAGTG.(SEQ ID NO. 20)
[0208] - Cysk3 (L. wadei): Forward:TTCCAGGGGCCCCTGGGATCCATGATTTACGAAAATATCTTAGACTTAATTG G (SEQ ID NO. 21) Reverse:TCGACCCGGGAATTCTTATAAACTGTTTCTAAATGCTTCAATTGATAAG.
[0209] (SEQ ID NO. 22)
[0210] In these last two cases (E. coli Cysk and L. wadei Cysk-3) whole cells were used as template. The genes were cloned in the pGEX-6P-1 plasmid (Merk, Cytiva ref 28-9546- 48). For expression in E. coli, the strain BL21 (DE3) (Stratagene) was transformed with the corresponding plasmids. Protein expression was induced with 1 mM isopropyl p-D- thiogalactopyranoside (IPTG) for 5 h at 25 °C. Cells were collected by centrifugation, resuspended in 10 ml of cold extraction buffer A (50 mM Tris, pH: 8, 15 mM EDTA, 15 mM EGTA, and 0.1% Triton X-100) containing protease inhibitors (2 mg / ml of pepstatin, 2 mg / ml of leupeptin, 1 mM pepstatin leupeptin phenylmethylsulfonyl fluoride, or PMSF, and 1 mM benzamidine), phosphatase inhibitors (10 mM sodium orthovanadate, 25 mM p- glycerophosphate, 1 mM sodium pyrophosphate, and 10 mM sodium fluoride), and 2 mM DTT. Cells were ruptured by sonication on ice, lysates were removed by centrifugation (1000 rpm for 1 min at 4 °C), and the supernatants were purified using glutathionesepharose column chromatography. After incubation for 1 h at 4 °C with rotation, the beads were collected by centrifugation (1000 rpm for 1 min at 4 °C) and washed with buffer A 3 times. The elution was performed by adding 10 mM glutathione.
[0211] Cysk-3 ref mutant generation pGEX-6P-1 plasmid containing wild-type Cysk-3_ref gene was PCR amplified using oligonucleotide primers including the mutation leading to the change of lysine 42 residue to alanine: forward 5’AGTGGAAGTGTTGCAGATAGAGCTGCACTTGGAATG3’ (SEQ ID NO: 10) and reverse
[0212] 5’TGCAGCTCTATCTGCAACACTTCCACTTAAATTAAATTTTTCAAG3’ (SEQ ID NO. 11). The new plasmid was sequenced to confirm the presence of the desired mutation.
[0213] MTT assays
[0214] Cell viability was evaluated by MTT assay. Cells were grown in 48 well plates at a density of 1 ,500 cells per well. 72 h later, the compound to be evaluated was added and after 12 h the cells were incubated with MTT solution (Sigma) for 1 h, at 37 °C. Formazan crystals were dissolved in DMSO and quantitated by measuring the absorbance in a Synergy HT plate reader at 570 nm. The reduction of MTT is expressed as a percentage of the absorbance value obtained in the control which was considered 100%. Example 2. Results
[0215] A protein has been identified that inhibits the growth of C. acnes (Fig. 1).
[0216] By using mass spectrometry analysis, we have identified Cysk-3 with SEQ ID NO. 4, referred herein as Cysk_ref, as the protein responsible for the inhibition activity. For simplicity, the identified protein with SEQ ID NO. 4 is referred in the examples section and in the figures as the Cysk-3_ref protein (in figures 1-4 as Cysk3).
[0217] By using molecular biology methods, we have cloned the Cysk-3_ref gene (encoding the protein sequence SEQ ID NO. 4) in the pGEX-6P-1 plasmid and included it in an E. coli protein expression system. Taking advantage of the intrinsic characteristics of the system (GST fusion) we have purified the recombinant Cysk-3_ref protein (consisting of SEQ ID NO. 14) and we have confirmed the inhibition activity on C. acnes (Fig. 1). Importantly, the inhibition activity is lost when a mutation is included in the Cysk-3_ref active center of the protein, particularly the mutation K42A (Lysine 42 to Alanine) (Fig. 2). Said mutant protein, GST-Cysk3_ref K42A, consists of SEQ ID NO. 15.
[0218] Cysk-3_ref is a member of the pyridoxal phosphate-dependent family of proteins that are involved in the cysteine metabolism pathways, more specifically, it is known to be involved in synthesis of L-cysteine from O-acetylserine (OAS) in the presence of S2' or hydrogen sulfide and is commonly referred to as an acetylserine sulfhydrylase We have cloned Cysk-3_ref homologs from Escherichia coli (known as Cysk sharing 48% protein identity, referred herein as Cysk (E. Coli) and consisting of SEQ ID NO. 12) and Leptotrichia wadei (Known as Cysk-3 sharing 74% protein identity, referred herein as Cysk3 (L.wadei) consisting of SEQ ID NO. 13) and checked their activity against C. acnes in the same conditions as those for Cysk-3_ref (GST-Cysk (E.Coli) consisting of SEQ ID NO. 16, and GST-Cysk3 (L. Wadei) consisting of SEQ ID NO. 17). The homolog proteins inhibit C. acnes growth indicating a general effect for Cysk-3 proteins and homologs, specifically for acetylserine sulfhydrylases (Fig. 5).
[0219] A preliminary dose-response analysis shows that Cysk-3-ref is not toxic to different human cell lines, including dermal fibroblasts, even when tested at concentrations 100 times higher than those showing inhibition activity on C. acnes (Fig. 3).
[0220] Mechanisms of action
[0221] Cysk-3_ref is thought to be involved in the cysteine metabolism, however, all the enzymatic activities of the protein have not been unequivocally determined so far. To test whether the enzymatic activity could be responsible for the inhibition activity on C. acnes, we added extra cysteine to the C. acnes culture media and found a remarkable overgrowth (Fig. 4A) suggesting that cysteine is a limiting factor for C. acnes growth. Next, we checked the inhibition activity of Cysk-3_ref on C. acnes in a medium containing extra amounts of cysteine and found that the addition of 1-2 mM cysteine is sufficient to avert the Cysk-3_ref inhibition (Fig. 4B), suggesting that the C. acnes growth inhibition could be produced for the cysteine clearing by Cysk-3_ref.This effect is not present when D- cysteine (which can not be included in proteins) is added to the plates (Figs 4A and B) suggesting that the action of Cysk-3_ref on C. acnes involves the bioavailability of cysteine as an anabolic element.
[0222] Cysteine, besides being a protein-building element, has a remarkable antioxidant character. To check whether C. acnes growth relies on cysteine as an anabolic element or as an antioxidant, we tested the ability of different antioxidants to promote C. acnes growth and found that reduced glutathione promotes C. acnes growth (as cysteine) but this effect is only partially averted when Cysk-3_ref is present, suggesting that the cysteine anabolic role is more relevant than the antioxidant function in promoting C. acnes growth (Fig. 4C and D). In sum, our experiments suggest eliminating cysteine from the skin of acne patients will determine a reduction in C. acnes growth and, in consequence, a reduction in the inflammatory response leading to acne.
[0223] There are chemical-based methods to eliminate cysteine, but the advantage of an enzymatic approach to eliminate cysteine is based on the fact that the enzyme will eliminate cysteine as long as the protein is active while the chemical-based methods will determine a punctual elimination that could, eventually, be rapidly recovered by the continuous keratinization process responsible for the cysteine.
Claims
Claims1- A compound that reduces cysteine bioavailability, for use in the prevention and / or treatment of a bacterial infection caused by or associated with Cutibacterium acnes.2- The compound for use according to claim 1 which is a compound that degrades cysteine.3- The compound for use according to any one of claims 1-2 which is a compound that impairs the synthesis of proteins by Cutibacterium acnes.4- The compound for use according to any one of claims 1-3, wherein the compound is a protein.5- The compound for use according to claim 4, wherein the protein is from the pyridoxal phosphate-dependent family of proteins, particularly from the pyridoxal phosphate-dependent family of proteins involved in cysteine metabolism.6- The compound for use according to any one of claims 4-5, wherein the protein is an acetylserine sulfhydrylases, particularly a Cysk-3 protein.7- The compound for use according to any one of claims 4-6, wherein the protein has at least 70% sequence identity with SEQ ID NO. 4.8- The compound for use according to claim 7, wherein the protein has at least 90% sequence identity with SEQ ID NO. 4.9- The compound for use according to any one of claims 4-6, wherein the protein has at least 70% sequence identity with SEQ ID NO. 12.10- The compound for use according to claim 9, wherein the protein has at least 90% sequence identity with SEQ ID NO. 12.11- The compound for use according to any one of claims 4-6, wherein the protein has at least 70% sequence identity with SEQ ID NO. 13.12- The compound for use according to claim 11 , wherein the protein has at least 90% sequence identity with SEQ ID NO. 13.13- The compound for use according to anyone of claims 1-10, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 4 to reduce cysteine bioavailability, to degrade cysteine, and / or to impair protein synthesis.14- The compound for use according to anyone of claims 1-10, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 12 to reduce cysteine bioavailability, to degrade cysteine, and / or to impair protein synthesis.15- The compound for use according to anyone of claims 1-12, wherein the compound retains or enhances the capacity of protein with SEQ ID NO. 13 to reduce cysteine bioavailability, to degrade cysteine, and / or to impair protein synthesis.16- The compound for use according to any of the preceding claims, wherein the bacterial infection caused by or associated with Cutibacterium acnes is selected from the group consisting of acne vulgaris, ocular infection, dental infection, skin infection,endocarditis, bone infection, joint infection, central nervous system infection, sepsis, postoperative infection, device-related infection, and combinations thereof.17- The compound for use according to any one of the preceding claims which is for the prevention and / or treatment of acne vulgaris, particularly inflammatory acne. 18- A pharmaceutical composition comprising a therapeutically effective amount of the compound as defined in any one of claims 1-15, together with at least one pharmaceutically acceptable excipient and / or carrier.19- The pharmaceutical composition according to claim 18, which is for use in the prevention and / or treatment of a bacterial infection caused by or associated with Cutibacterium acnes.20- A cosmetic composition comprising a cosmetically effective amount of the compound as defined in any one of claims 1-15, together with at least one cosmetically acceptable excipient and / or carrier.21- A non-therapeutic in vitro use of the compound as defined in any of claims 1-15, as an antibacterial agent, particularly, for inhibiting Cutibacterium acnes growth.