Methods of diagnosing and treating inflammatory bowel disorder

Abstract

Provided herein are methods of identifying a subject as having an inflammatory bowel disorder, wherein a method includes (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder.

Description

[0001] METHODS OF DIAGNOSING AND TREATING INFLAMMATORY BOWEL

[0002] DISORDER

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims priority to U.S. Provisional Patent Application No. 63 / 561 ,636, filed on March 5, 2024, which is incorporated herein by reference in its entirety.

[0005] SEQUENCE LISTING

[0006] This application contains a Sequence Listing that has been submitted electronically as an XML file named 44807-0481W01_SL_ST26.xml. The XML file, created on February 28. 2025. is 33,032 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0007] BACKGROUND

[0008] Since its discovery in 1946, pathologists have used periodic acid Schiff staining (PAS) to look for mucins, proteins that are heavily glycosylated and a large constituent of mucus, in various human tissues. A major constituent of the terminal end of glycosylated proteins is sialic acid, which, in turn, often contains the post-translational modification of O- acet lation. These acetyl modifications are important as they can abrogate or encourage different binding events depending on the context of the interaction in question. This can have consequences for a number of processes, including host-pathogen interactions or cell differentiation during development. If s well established that a variant of PAS staining, namely mild periodic acid Schiff staining (mPAS), can distinguish between O-acetylated (mPAS negative) and non-O-acetylated (mPAS positive) sialic acids in colon tissue. A number of studies demonstrate that mPAS staining patterns, and thus acetylated sialic acid status, follow Hardy-Weinberg principles in normal human colon tissue, and that the number of sporadically positive crypts in otherwise negatively staining individuals increases with age, location (more common in the left colon than right), a history of radiation therapy or during chronic inflammatory states. Uniform positive staining is also sensitive to racial variation, with individuals of Asian descent staining positive more frequently than those of European or African descent. Inbred murine models do not demonstrate variable staining and are uniformly mPAS positive. These observations support that an unknown autosomal dominant human gene drives this phenoty pe. To date, the only known human sialic acid O- acetyltransferase (SOAT) is encoded by the gene CASD1, but its correlation with human colon mPAS staining has not been investigated. If one considers that acetylation modification occurs at many sites on sialic acid in different tissues, many enzymes likely remain to be discovered.

[0009] SUMMARY

[0010] Provided herein are methods of identifying a subject as having an inflammatory bowel disorder that include (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subj ect has an inflammatory bowel disorder.

[0011] Also provided herein are methods of treating an inflammatory bowel disorder in a subject that include administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of aNXPEl gene, thereby treating the inflammatory bowel disorder.

[0012] Also provided herein are methods of treating an inflammatory bowel disorder in a subject that include (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory' bowel disorder; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of a NXPE1 gene, thereby treating the inflammatory bowel disorder. In some embodiments, the inflammatory' bowel disorder comprises Crohn’s disease, irritable bowel syndrome (IBS), ulcerative colitis, or an inflammation of the gastrointestinal system.

[0013] In some embodiments, the therapeutic agent comprises an inhibitor of NXPE1. In some embodiments, the inhibitor of NXPE1 comprises an inhibitory nucleic acid, or a small molecule inhibitor. In some embodiments, the inhibitory nucleic acid inhibits NXPE1 by reducing NXPE1 expression. In some embodiments, the inhibitor ofNXPEl comprises a CRISPR / Cas9 complex targeting the NXPE1 gene.

[0014] In some embodiments, the administering comprises intravenous administration, subcutaneous administration, intraperitoneal administration, rectal administration, oral administration, or combinations thereof. Also provided herein are methods of identifying a subject as having a cancer that include (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer.

[0015] Also provided herein are methods of treating a cancer in a subject that include administering a therapeutic agent to the subject, wherein the therapeutic agent treats the cancer.

[0016] Also provided herein are methods of treating a cancer in a subject that include (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent treats the cancer.

[0017] In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a colorectal cancer. In some embodiments, the administering compnses intravenous administration, subcutaneous administration, intraperitoneal administration, rectal administration, oral administration, or combinations thereof.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0019] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0020] BRIEF DESCRIPTION OF DRAWINGS FIG. 1A is an exemplary schematic showing samples and NGS strategy employed to identify regions associated with colon mPAS staining. Negative staining samples with a rare positive crypt were presumed to be of heterozygous genotype, where a spontaneous loss of heterozygosity in a stem cell caused positive staining of a crypt (right).

[0021] FIG. IB is a bar plot showing the number of SNPs correlated with the rnPAS phenofype by chromosome as evaluated by WGS. Only SNPs on chromosome 11 contained perfect matches between genotype and phenotype in all samples.

[0022] FIG. 1C is a map showing region on chromosome 11 q23.2 identified by whole genome sequencing as highly associated with mPAS staining. Samples that largely stain negative but contain rare positive crypts are suspected of having a heterozy gous genotype and are listed separately (right side). SNPs are shown on the y-axis based on their location on chromosome 1 1. Formal linkage disequilibrium analysis of this region is shown in FIGs. 7A-7C.

[0023] FIG. ID shows independent validation of WGS results. 3x3 table showing genotype for SNP rs661946 (located in the promoter of NXPE1) and mPAS staining phenofype on a set of 91 normal colon tissue samples. Allele frequencies are consistent with Hardy-Weinberg equilibrium (Haldane Exact = 0.45). Fisher’s Exact Test for the genotype-phenotype relationship yields a p < 2.2e-16. Note that SNP rsl0891692 located in the coding region of NXPE1 displayed identical results.

[0024] FIGs. 2A-2D show NXPEl protein sequence and 3D structure have close homology to known sialic acid-O-acetyltransferases. NXPE1 and NXPE4 are part of a small family of proteins known as neurexophilin / NXPE, with 4 known members. The NXPE1 gene codes for a 547 amino acid protein predicted to contain a N-terminal transmembrane domain, with the ma ority of the protein residing on the extracellular portion of the cell. FIG. 2A shows multiple sequence alignment of amino acid sequences near the serine and FIG. 2B shows aspartate-histidine catalytic sites of NXPE family members with known sialic acid-O- acetyltransferases. NXPE1 (Q8N323.2) was compared to human proteins neurexophilin and PC-esterase domain family member 2 (NXPE2) (Q96DL1.2), neurexophilin and PC-esterase domain family member 3 (NXPE3) (Q969Y0.1), NXPE4 (Q6UWF7.1) and CASD1 (Q96PB1.1). as well as viral and bacterial SOAT proteins from influenza C virus (C / Johannesburg / 1 / 66) (P07975.1), Isavirus salaris (AAL34465.1), Breda virus (CAA71819.1), Human coronavirus OC43 (P30215.1), and known SGNH / GDSL hydrolase family members rhamnogal acturonan acetylesterase (Q00017), photobacterium sp. J15 (AKQ62669.1). The active site residues are indicated with an *. Conservation shown above is a quantification of the alignment of residues as determined by pre-defined physio-chemical properties. Consensus refers to the percentage of which the most common residue was conserved. FIG. 2C shows in silico predicted structure of CASD1 and FIG. 2D shows NXPE1 showing co-localization of catalytic site serine from the Gly-Asp-Ser (GDS) motif with catalytic site histidine from the DXXH motif.

[0025] FIG. 3 A shows mPAS, NXPE1 IHC and NXPE4 IHC on adjacent sections from FFPE normal colon tissue with the indicated genotypes for SNP rs661946. Heterozygous samples were primarily negative by rnPAS, and positive for NXPE1 and NXPE4. but the images chosen show rare spontaneously mPAS positive crypts. Images are representative examples from more than 20 unique patients, and are shown at 20x.

[0026] FIG. 3B shows adjacent sections of normal colon FFPE tissue heterozygous for rs661946 containing spontaneous mPAS positive crypts stained by IHC for NXPE1, NXPE4 or known sialic acid O-acetyltransferase CASD1. Circles highlight the same crypt in each sample. Note that the crypt in patient 1 denoted with a * is positive only in bottom half of the cr pt. NXPE1 protein appears only in the portion of the crypt that is negative for mPAS. Images are representative examples of 10 patients with similar results and are shown at 20x.

[0027] FIG. 3C shows adjacent sections from the same samples in B now stained with SIGLEC-15 and detected by immunofluorescence and DAPI. SIGLEC-15 staining matches the mPAS staining pattern. All images are shown at 20x.

[0028] FIG. 3D shows adjacent sections stained with mPAS or immunofluorescence with SIGLEC- 15 on normal FFPE colon tissue heterozygous for the NXPE1 promoter SNP rs661946. mPAS and SIGLEC-15 stain the same cells / crypts. All images are 20x.

[0029] FIG. 4A shows results of flow cytometry with biotinylated SIGLEC-15 conjugated to APC on a pooled population of Jurkat cells infected with lentiviral clones containing aNXPEl expression cassette. FIG. 4B shows Sialyl-Tn IHC staining on Jurkat wildtype and a pooled population of Jurkat cells overexpressing NXPE1. FIG. 4C shows GTEx eQTL data for NXPE1 RNA expression and variant rs661946 by tissue type. Normalized Effect Size (NES), which is the same as the beta coefficient (regression slope), is calculated by looking at the effect of the variant allele (T / T) relative to the refences allele (C / C), and negative values indicating less expression from the variant (minor) allele. FIG. 4D shows an exemplary schematic describing CRISPR-Cas9 knock in approach to change rs661946 in LSI 80 cells from T / T (homozy gous VAR) to C / T (heterozygous) or C / C (homozygous REF). FIG. 4E shows mPAS and NXPE1 IHC staining on LSI 80 cells with the indicated genotypes for rs661946, with heterozygous (C / T) and homozygous REF (C / C) being created by CRISPR- Cas9 knock in. Cells positive for mPAS staining are circled. FIG. 4F show s counts of the number of mPAS positive LS180 cells with the three possible genotypes for rs661946 as created by knock-in. Quantitation was performed using ImageJ on three different random images from each cell plug at lOx.

[0030] FIG. 5A shows DMB-based HPLC readout of an enzymatic reaction containing CMP- Neu5Ac and acetyl coenzyme A, with or without the predicted extracellular domain of NXPE1 (AA 60-547) or a catalytically inactive mutant NXPE1S355A. Note that the Sialic Acid Standard represents a panel of sialic acid derivatives that were identified per manufacturer's instructions. FIG. 5B shows an exemplary schematic summarizing proposed NXPE1 activity in colorectal tissue. Note that the targeted sialylated glycans shown, GalNAc and GlcNAc, are based on previously published data describing SIGLEC-15's preferred binding partners. FIG. 6A shows a Manhattan plot showing SNP association with normal colon mPAS staining genome-wide. FIG. 6B shows same as FIG. 6A but showing only chromosome 11. SNPs with perfect genot pe-phenotype concordance are highlighted in green, and cluster in a suspected haplot pe near 1 lq23.2.

[0031] FIG. 7A shows linkage disequilibrium plotted as r2values for 300kb surrounding the most significant SNP identified in the genome wide association study of mPAS staining near SNP rsl 12621410 on chromosome 8 and FIG. 7B shows rs678170 on chromosome 11. The highlighted area indicates the region with SNPs demonstrating a perfect concordance between genotype and mPAS phenotype. FIG. 7C shows a map showing a zoomed in view of the highlighted region in FIG. 7B and noting the location of SNPs with perfect concordance between genotype and mPAS staining phenotype.

[0032] FIG. 8 show s in silico predicted 3D structures for NXPE family members NXPE1 (Q8N323.2), NXPE2 (Q96DL1.2), NXPE3 (Q969Y0.1) and NXPE4 (Q6UWF7.1). Active site serines and their corresponding histidines are shown (top). All family members are predicted to contain a single transmembrane alpha helix, with the majority of protein in the extracellular (intra-Golgi / ER) space, consistent with glycan location inside and outside the cell. All 4 members contain a conserved Gly-Asp-Ser (GDS) motif, which is also present in known sialic acid acetyltransferase active sites (FIG. 2A), with the serine predicted to collocate near a histidine (top). This figure redisplays NXPE1 structural data from FIG. 2D. FIG. 9A shows mPAS, NXPE1 IHC and NXPE4 IHC staining on FFPE normal colon tissue with heterozygous (C / T) and FIG. 9B shows homozygous-VAR (T / T) genotypes for SNP rs661946. Heterozy gous samples were primarily negative by mPAS, and positive for NXPEl and NXPE4, but the images chosen show rare cases of spontaneously mPAS positive crypts (circled). Images are shown at lOx. This figure provides additional images supporting FIG. 3A

[0033] FIG. 10 shows SIGLEC-7 (top), SIGLEC-15 (middle) and SIGLEC-1 (bottom) IF staining on normal FFPE colon tissue. The homozygous VAR (T / T) genotype is expected to stain positive for lectin. Arrows show examples of specific staining in goblet cells. SIGLEC-7 displays specific staining of crypt goblet cells, but not as robustly as SIGLEC-15. SIGLEC-1 is shown as a control and does not stain.

[0034] FIG. 11 shows IHC of NXPE1 protein on Jurkat parent cells and a pool of Jurkat cells transfected with an NXPE1 open reading frame.

[0035] FIGs. 12A-12B show results of flow cytometry on a pooled population of Jurkat cells infected with lentiviral clones containing a NXPEl expression cassette using (FIG. 12A) an anti-Sialyl-Tn mouse antibody followed by an anti-Mouse IgG Alexa Fluor 647 secondary antibody and (FIG. 12B) anti-Mouse IgG Alexa Fluor 647 secondary' antibody only. Note that immunostaining and flow cytometry' were performed on the same pool of cells as in FIGs. 4A and 4B

[0036] FIG. 13 shows mPAS staining on various colon cancer cell lines. SNP rs661946 genotype is noted in parenthesis next to cell line name, T / T genotype is expected to stain positive.

[0037] FIG. 14 shows Sanger sequencing of NXPE1 promoter site for LSI 80 knock in clones where SNP rs661946 (indicated by blue arrow, Hg38 chrl 1 : 114.559,887) has been converted to C / T (heterozygous) and C / C (homozygous REF). LSI 80 parent cell line is T / T (homozygous VAR) and is shown on top.

[0038] FIG. 15 shows full HPLC spectra showing DMB-based HPLC readout of an enzymatic reaction containing CMP-Neu5Ac and acety l coenzy me A, with or without the predicted extracellular domain of NXPE1 (AA 60-547). N-glycolylneuraminic acid (Neu5Gc) is a sialic acid that is not synthesized in humans and is show n as a control. Note that some of the images above are also shown in FIG. 5A, and that the scale on the y axis changes between spectra.

[0039] FIG. 16 shows a representative image of tissues with varying NXPE1 staining patterns. Left is tissue with tumor and the right is normal tissue.

[0040] FIG. 17 shows an exemplary simplified schematic of scoring NXPE1 immunohistochemistry staining. Scoring ranges from 0 to 3, where a score of 0 represents an absence of staining and 3 represents intense, widespread staining. A score of 1 and 2 are on a gradient (where ‘ 1 ’ represents a lesser degree of positivity) and were distinguished based on both staining intensity and distribution. FIG. 18 shows a summary of NXPE1 immunohistochemistry staining on a colon cancer tissue microarray.

[0041] FIG. 19 shows a representative image of matched tissue displaying phenotype indicative of loss of NXPE1. Left is tissue from the tumor and the right is normal adjacent tissue, both from the same patient. Staining patterns are suggestive of a patient with high expression of NXPE1 in normal tissue and loss of NXPE1 in the tumor. This subpopulation may represent patients with loss of Llq23 or with other cancer specific somatic epigenetic or genetic events. FIG. 20 shows analysis of publicly available survival data on The Cancer Genome Atlas, using data compiled through OncoDB (Tang G et al. Nucleic Acids Res. 2022, 5O(D1): D1334-D1339). Patients were categorized as either high- or low-expressers ofNXPEl using a cutoff of median expression for each cancer type.

[0042] FIG. 21 shows an exemplary schematic of a Siglec-antibody conjugate.

[0043] FIG. 22 shows limited killing of cancer cells (LSI 80) with or without addition of T-cells, in the absence of SAC construct.

[0044] FIG. 23 shows differential killing of wells with T-cells and SAC1 construct, compared to wells with only SAC 1. Some of this difference is restored by addition of SAC1 1. which has a SIGLEC-15 arm but not an anti-CD3 arm.

[0045] FIG. 24 shows slightly reduced grow th in wells with both T-cells and SAC 7 included compared to wells with only SAC7, but SAC 11 is unable to rescue this difference, suggesting that these are mediated by random T-cell activation and killing events.

[0046] FIG. 25 shows slightly reduced growth in wells with both T-cells and SAC8 included compared to wells with only SAC 8.

[0047] DETAILED DESCRIPTION

[0048] Sialic acids have critical functions relating to host-pathogenic interactions and the immune microenvironment. Subsequent post-translational O-acetyl modifications add an extra layer of control by modulating many of these interactions in both normal and transformed colorectal cells. The processes through which this modification is added to sialic acids are not completely understood. As described herein, using w hole-genome sequencing (WGS) on normal human colon tissue, a haplotype strongly associated with colorectal sialic acid O-acetylation has been identified, and further confirmed by histopathological mPAS staining. Only SNPs of a single candidate gene, NXPE1, within the haploty pe correlated in a 91-sample validation set, and CRISPR-Cas9 editing of this gene in 2D cell line and 3D normal colon organoid models yielded changes to modified sialic acid levels. These findings support that the NXPE1 gene functions as a novel sialic acid O-acetyltransferase in colorectal tissue and has implications as a diagnostic tool for patients with inflammatory diseases of the bowel or as an indicator for therapeutic targets in cancer.

[0049] Several methods are described herein, including methods of identifying a subject as having an inflammatory bowel disorder, wherein a method includes (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder. Also provided herein are methods of treating an inflammatory bowel disorder in a subject, wherein a method includes (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of a NXPE1 gene, thereby treating the inflammatory bowel disorder.

[0050] Also provided herein are methods of identifying a subject as having a cancer, wherein the method includes (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer. Also provided herein are methods of treating a cancer in a subject, wherein the method includes (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent treats the cancer.

[0051] Various non-limiting aspects of these methods and compositions are described herein and can be used in any combination without limitation. Additional aspects of various components of the methods and compositions described herein are known in the art.

[0052] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0053] As used herein, the term “about”, when used in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context. For example, in some embodiments, the term ‘‘about” may encompass a range of values that are within 25%, 20%, 19%, 18%. 17%. 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0054] As used herein, the term “biological sample” refers to a sample obtained from a subject for analysis using any of a variety of techniques including, but not limited to, biopsy, surgery, and laser capture microscopy (LCM), and generally includes cells and / or other biological material from the subject. A biological sample can be obtained from a eukaryote, such as a patient derived organoid (PDO) or patient derived xenograft (PDX). The biological sample can include organoids, a miniaturized and simplified version of an organ produced in vitro in three dimensions that shows realistic micro-anatomy. Subjects from which biological samples can be obtained can be healthy or asymptomatic individuals, individuals that have or are suspected of having a disease (e.g., inflammatory bowel disorder or cancer) or a pre-disposition to a disease, and / or individuals that are in need of therapy or suspected of needing therapy. In some embodiments, biological samples can include one or more diseased cells. A diseased cell can have altered metabolic properties, gene expression, protein expression, and / or morphologic features. Examples of diseases include inflammatory disorders, metabolic disorders, nervous system disorders, and cancer.

[0055] The biological sample can include any number of macromolecules, for example, cellular macromolecules and organelles (e.g., mitochondria and nuclei). In some embodiments, the biological sample can be a nucleic acid sample and / or protein sample. In some embodiments, the biological sample can be a carbohydrate sample or a lipid sample. The biological sample can be obtained as a tissue sample, such as a tissue section, biopsy, or a core biopsy. The sample can be a colon sample, a rectum sample, an appendix sample, a testis sample, a small intestine sample, a smooth muscle sample, an epididymis sample, a salivary gland sample, a prostate sample, a pancreas sample, or a duodenum sample. In some embodiments, the biological sample can be a sample from colorectal tissue.

[0056] As used herein, a “cell” can refer to a eukary otic cell, optionally obtained from a subject or a commercially available source.

[0057] As used herein, the term “expression” refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. In some embodiments, if the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample; further, the expression level of multiple genes can be determined to establish an expression profile for a particular sample.

[0058] As used herein, “nucleic acid” or “nucleic acid molecule” is used to include any compound and / or substance that comprise a polymer of nucleotides. In some embodiments, a polymer of nucleotides is referred to as polynucleotides. Exemplary' nucleic acids or polynucleotides can include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs). threose nucleic acids (TNAs), glycol nucleic acids (GNAs). peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a P-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2’-amino- LNA having a 2’-amino functionalization, and 2’-amino-a-LNA having a 2’-amino functionalization) or hybrids thereof. Naturally occurring nucleic acids generally have a deoxyribose sugar (e.g., found in deoxyribonucleic acid (DNA)) or a ribose sugar (e.g., found in ribonucleic acid (RNA)).

[0059] A nucleic acid can contain nucleotides having any of a variety’ of analogs of these sugar moieties that are known in the art. A deoxyribonucleic acid (DNA) can have one or more bases selected from the group consisting of adenine (A), thymine (T), cytosine (C), or guanine (G), and a ribonucleic acid (RNA) can have one or more bases selected from the group consisting of uracil (U), adenine (A), cytosine (C), or guanine (G).

[0060] In some embodiments, the term “nucleic acid” or “nucleic acid molecule” refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or a combination thereof, in either a single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses complementary sequences as well as the sequence explicitly indicated. In some embodiments of any of the isolated nucleic acids described herein, the isolated nucleic acid is DNA. In some embodiments of any of the isolated nucleic acids described herein, the isolated nucleic acid is RNA.

[0061] As used herein, the term "subject” refers to an organism, typically a mammal (e.g., a human). In some embodiments, a subject is suffering from a relevant disease, disorder, or condition. In some embodiments, the relevant disease, disorder, or condition is inflammatory' bowel syndrome. In some embodiments, the relevant disease, disorder, or condition is cancer. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered. In some embodiments, the subject can be an animal, human or non-human. Non-limiting examples of non-human subjects can include mice, rats, hamsters, rabbits, cats, dogs, horses, pigs, donkeys, monkeys, and / or other non-human primates such as apes and lemurs. In some embodiments, the subject is a human.

[0062] Methods of identifying an inflammatory bowel disorder or a cancer in a subject

[0063] Provided herein are methods of identifying a subject as having an inflammatory bowel disorder that include (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subj ect has an inflammatory bowel disorder.

[0064] Also provided herein are methods of identifying a subject as having a cancer that include (a) determining a level of NXPE1 in a biological sample from the subject; and (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below7the reference level indicates that the subject has a cancer.

[0065] As used herein, the term “inflammatory bowel disease” refers to a chronic inflammatory disease in a gastrointestinal tract that causes intestinal inflammation. In some embodiments, inflammatory bowel disease can be roughly classified into ulcerative colitis and Crohn's disease, wherein the symptoms can include repeated severe abdominal pain and diarrhea. In some embodiments, an inflammatory bowel disorder can include Crohn’s disease, irritable bowel syndrome (IBS), ulcerative colitis, or an inflammation of the gastrointestinal system.

[0066] As used herein, the terms “cancer”, “tumor”, and “carcinoma” refer to cells that exhibit relatively abnormal, uncontrolled, and / or autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In some embodiments, a tumor may be or comprise cells that are precancerous (e g., benign), malignant, pre-metastatic, metastatic, and / or non-metastatic. The present disclosure specifically identifies certain cancers to which its teachings may be particularly relevant. In some embodiments, a relevant cancer may be characterized by a solid tumor. In some embodiments, a relevant cancer may be characterized by a metastatic solid tumor. In general, examples of different types of cancers known in the art include, for example, a colon cancer, rectal cancer, appendix cancer, testicular cancer, small intestine cancer, smooth muscle cancer, epididymal cancer, salivary gland cancer, pancreatic cancer, prostate cancer, and duodenal cancer. In some embodiments, a cancer is a solid tumor. In some embodiments, a cancer is a colorectal cancer. In some embodiments, a cancer is a rectal cancer.

[0067] Methods of treating an inflammatory bowel disorder or a cancer in a subject

[0068] Provided herein are methods of treating an inflammatory bowel disorder in a subj ect that include administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of aNXPEl gene, thereby treating the inflammatory bowel disorder. Also provided herein are methods of treating an inflammatory bowel disorder in a subject that include (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of aNXPEl gene, thereby treating the inflammatory7bowel disorder.

[0069] Also provided herein are methods of treating a cancer in a subject that include (a) determining a level of NXPE1 in a biological sample from the subject; (b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer; and (c) administering a therapeutic agent to the subject, wherein the therapeutic agent treating the cancer.

[0070] As used herein, the term '‘treating” means a reduction in the number, frequency, severity, or duration of one or more (e.g., two, three, four, five, or six) symptoms of a disease or disorder in a subject (e.g., any of the subjects described herein), and / or results in a decrease in the development and / or worsening of one or more symptoms of a disease or disorder in a subject.

[0071] As used herein, the term '‘administration” typically refers to the administration of a composition to a subject or system to achieve delivery' of an agent that is, or is included in, the composition. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be oral, enteral, parenteral, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, enteral, intra-arterial, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, intracistemal, within a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), by patch, etc. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time. In some embodiments, administration may involve methods of deliver}' that include, but are not limited to, use of external and / or implanted infusion pumps, liquid formulation, capsulated formulation, or slow-release encapsulation.

[0072] In some embodiments, a therapeutic agent can include an inhibitor ofNXPEl. In some embodiments, an inhibitor ofNXPEl comprises an inhibitory' nucleic acid, or a small molecule inhibitor. In some embodiments, an inhibitor ofNXPEl inhibits expression of a NXPE1 gene. In some embodiments, an inhibitory nucleic acid inhibits NXPE1 by reducing NXPE1 expression. In some embodiments, an inhibitor of NXPE1 comprises a CRISPR / Cas9 complex targeting the NXPE1 gene. In some embodiments, a CRISPR / Cas9 complex targeting the NXPE1 gene includes a Cas9 editing enzyme and one or more guide RNAs directing the editing enzyme to NXPE1. and can be delivered as nucleic acids encoding the editing enzyme and the guide RNAs, or as ribonucleoprotein complexes (RNPs).

[0073] In some embodiments, a therapeutic agent can target a loss of heterozygosity event in chromosome 11 or 1 lq23. In some embodiments, a therapeutic agent can target loss of NXPE1 protein. In some embodiments, a therapeutic agent can target loss of sialic acid O- acetylation. In some embodiments, a therapeutic agent can target loss of sialic acid O- acetylation by using Siglec-15. In some embodiments, a therapeutic agent comprises Siglec- 15 or a single-chain variable fragment using Siglec-15 as a prototype, wherein the Siglec-15 or a single-chain variable fragment is bound to a cytotoxic drug. In some embodiments, a therapeutic agent comprises a bispecific T-cell engager, wherein the therapeutic agent is linked to an anti-CD3 single-chain variable fragment. In some embodiments, the therapeutic agent can be edited into a T-cell in the form of a CAR T-cell.

[0074] EXAMPLES

[0075] Mammalian cell lines and cell culture

[0076] Jurkat, HEK293T, and LSI 80 cells were purchased from The American Type Culture Collection (Virginia, USA). Jurkat cells (ATCC, Cat# TIB-152) are male in origin and were grown in RPMI 1640 Medium (ATCC, Cat #30-2001), supplemented with 10% fetal bovine serum (HyClone. Utah, USA, Cat #16777-006) and 1% Penicillin-Streptomycin (Gibco, USA, Cat #15140122). LS180 cells (ATCC, Cat #CL-187) are female in origin and were grown in EMEM (ATCC, Cat #30-2003), supplemented with 10% FBS (HyClone, Utah, USA, Cat #16777-006) and 1% Penicillin-Streptomycin (Gibco, USA, Cat #15140122). HEK-293T cells (ATCC, #CRL-3216) were grown in DMEM (Gibco, USA # 11965092) supplemented with 10% FBS (HyClone, Utah, USA, Cat #16777-006) and 1% Penicillin- Streptomycin (Gibco, USA, Cat #15140122). In vitro cells were maintained at 37°C with 5% CO2. Mycoplasma testing was performed by The Genetic Resources Core Facility at Johns Hopkins School of Medicine (Maryland, USA).

[0077] Whole genome sequencing (WGS) workflow

[0078] 21 samples, 8 rnPAS positive, 8 mPAS negative, and 5 mPAS negative with rare positive crypts, were selected for whole genome sequencing. Matched FFPE sections and plasma pellets were commercially obtained from ILSbio LLC (Chestertown MD) for each sample. DNA was purified from on average 5mL of plasma using a DNeasy Blood & Tissue Kit (Qiagen 69504), and quantified by Nanodrop 2000 (ThermoFisher Scientific). Library preparation w as performed using a ThruPLEX® DNA-Seq kit (Takara R400675) per manufacturer's instructions. Each sample was sequenced on 3 or 4 lanes of aHiseq 4000 (Illumina) with paired end 100 cycle settings per manufacturer’s instructions. Fastq files for each sample are publicly available at the European Genome-Phenome Archive under accession number EGAS00001007704. VCF files w ere created for each using the cancer genomics cloud (Seven Bridges). Briefly, alignment and VCF generation was performed with Whole Genome Analysis - BWA + GATK 2.3.9-Lite. VCF files were then moved into SQL for further analysis including genotype assignment and comparison. SNPs were considered a perfect genotype-phenotype match if one of two conditions were met: 1) all positive mPAS staining samples contained an alternate (VAR) genoty pe, negative staining with rare positive contained a heterozygous genoty pe, and negative staining contained either a heterozygous or homozygous reference genotype. 2) All mPAS positive staining samples contained a reference genotype, negative mPAS staining with rare positive contained a heterozygous genotype, and negative mPAS staining samples contained a heterozygous or homozygous alternate (VAR) genotype. Data was also analyzed in a less stringent form, allowing for 1-2 mismatches between genotype and phenotype. Variant consequence analysis was performed using Variant Effect Scoring Tool. Plot of perfectly concordant SNPs (FIGs. 6A-6B) was performed using the package mapsnp in R. GW AS and association case-control analysis was performed on 10,421,023 variants using PLINK v2.00a6 64-bit with the following settings: gender set as a covariate, eliminated SNPs with a minor allele frequency below 0. 1, assumed dominant genotype, only considered biallelic SNPs, and removed SNPs not in Hardy Weinberg Equilibrium. Linkage disequilibrium (LD) and haplotype block analysis was performed using PLINK vl.90b7.2 64-bit, pairwise LD comparisons were made between all SNPs within 1Mb of each other on chromosome 8 and 11.

[0079] Targeted sequencing workflow

[0080] Targeted sequencing validation was performed using normal colon or normal adjacent tumor FFPE samples obtained commercially from ILSbio LLC (Chestertown, MD). Six 5pm sections were pooled together into a single tube for each of the 91 samples. DNA was extracted using a QIAamp DNA FFPE Tissue Kit (Qiagen 56404). DNA was quantitated using nanodrop 2000 (ThermoFisher Scientific). PCR was performed on target locations using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific F548L) following manufacturer’s instruction and primers listed below. Sanger sequencing of the product was performed by Genewiz.

[0081] Multiple Sequence Alignment and in-silico 3D structure prediction Multiple sequence alignment was done using NCBI- BLASTp, COBALT and Jalview. 3D structure prediction was accomplished using AlphaFold.

[0082] Overexpression of cell lines

[0083] Overexpression cassettes (NXPEl in pLenti-C-mGFP-P2A-Puro Vector #RC206474L4, REX02 in pLenti-C-mGFP-P2A-Puro Vector #RC211236L4, RBM7 in pLenti-C-mGFP- P2A-Puro Vector #RC206461L4 all from Origene) were transfected into HEK-293T cells with MegaTran 2.0 (Origene TT210002) with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) in a 10:3:1 ratio (30pg of total plasmid DNA per well) respectively following manufacturer’s instructions. Lentivirus was harvested after 48hrs, and a second time at 72hrs. Harvests were combined, run through a 0.45 PES filter (Millipore- SLHPM33RS), and concentrated with Lenti-X concentrator (Takara #631232). Virus stocks were stored in ImL of DMEM (Gibco, USA # 11965092) with 10% FBS (HyClone, USA, Cat #16777-006) and concentrations determined by p24 ELISA (Takara #632200). Nontreated 48 well plates were treated with RetroNectin, according to manufacturer’s instructions (Takara #T100). Using RetroNectin-treated plates, 50,000 target cells were transduced by spinoculation at 800xg for 2hrs at 37°C with 300pL, lOOpL, lOpL, IpL, or empty virus with lOug / mL polybrene (Sigma Aldrich #TR-1003-G). Cells were washed and then monitored for GFP and target gene expression. Selection for 14 days was performed with Ipg / mL of puromycin (InvivoGen ant-pr-1).

[0084] CRISPR KI of cell lines gRNA was obtained from Integrated DNA Technologies (IDT) (#CD.HC9.KDJS8530.AA), repair template was also obtained from IDT (#CD.HC9.QPVN2588). gRNA complex was performed by mixing gRNA (50pM final concentration) and Alt-R® CRISPR-Cas9 tracrRNA (IDT #1072533)( 50pM final concentration), heating to 95°C for 5min then allowing to cool to room temperature on benchtop. RNP complex w as performed by mixing 3pL of the above gRNA complex with 2.4 pL of Alt-R™ S.p. Cas9-GFP V3 (IDT #10008161) (final concentration 30pM for each) and incubating at room temperature for 15min. LSI 80 cells were trypsinized (Gibco # 25200056), pelleted and washed twice with PBS (Gibco # 10010023), then suspended in SG Nucleofection buffer (Lonza, #V4XC-3024) at 25e6cells / mL. A total of 5e5 cells w ere electroporated by mixing 5pL of RNP complex from above, 1.2pL of HDR Donor Oligo, 1.2pL of Alt-R™ HDR Enhancer V2 (IDT #10007910), 20pL of the LSI 80 cell suspension in SG buffer (see above), and 0.1 pL of PBS (all reagents final concentration of 5pM). Cells were immediately electroporated on a 4D Nucleofector X-Unit (Lonza, AAF-1003X) using pulse code DS-150A. Cells were then removed and plated into complete media and incubated for 5 days. Once enough cells were present, cells were clonally selected by limited dilution as previously described. Accurate knock in was confirmed by PCR using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher #Scientific F548L) following manufacturer's instruction and primers listed below. Sanger sequencing of the product was performed by Genewiz.

[0085] Immunohistochemistry (IHC) analysis

[0086] Immunostaining was performed at the Oncology Tissue Services Core of Johns Hopkins University School of Medicine. Immunolabeling was performed on formalin-fixed, paraffin embedded sections on a Ventana Discovery Ultra autostainer (Roche Diagnostics). Briefly, following dewaxing and rehydration on board, epitope retrieval was performed using Ventana Ultra CC1 buffer (Roche Diagnostics, Cat #6414575001,) at 96°C for 64 minutes. Primary antibody, anti-CASDl (1: 100 dilution; Invitrogen, Cat #PA5-60700, Lot #Xi3700359), anti- NXPE4 (1 : 1000 dilution; Sigma-Aldrich, Cat #HPA042801, Lot #R39941), anti-NXPEl (1 :200 dilution; Santa Cruz Biotechnology, Cat #sc-514349,) diluted in Antibody Diluent with Casein (Roche Diagnostics, Cat #6440002001,); was applied at 36°C for 60 minutes. Primary' antibodies were detected using an anti-rabbit HQ detection system (Roche Diagnostics, Cat #7017936001 and 7017812001,) followed by Chromomap DAB IHC detection kit (Roche Diagnostics, Cat #5266645001), counterstaining with Mayer’s hematoxylin, dehydration and mounting.

[0087] Immunolabeling for NXPE1 was performed on formalin-fixed, paraffin embedded sections on a Ventana Discovery Ultra autostainer (Roche Diagnostics). Briefly, following dewaxing and rehydration on board, epitope retrieval was performed using Ventana Ultra CC1 buffer (catalog# 6414575001, Roche Diagnostics) at 96°C for 64 minutes. Primary antibody, anti- NXPE1 (1 : 100 dilution; catalog# HPA049133, Lot# R59143, Sigma-Aldrich) was applied at 36°C for 60 minutes. Primary antibodies were detected using an anti-rabbit HQ detection system (catalog# 7017936001 and 7017812001, Roche Diagnostics) followed by Chromomap DAB IHC detection kit (catalog # 5266645001, Roche Diagnostics), counterstaining with Mayer’s hematoxylin, dehydration and mounting.

[0088] Mild periodic acid Schiff staining

[0089] Staining for mPAS was performed by the Johns Hopkins Reference Pathology Lab. Briefly, slides were dewaxed and hydrated in distilled water. We then washed in 0. IM acetate buffer, pH 5.5 (Thermo Fisher, Cat #AM9740), at 2°C for five minutes. Treated with 1 mM (0.02%) NalCh (Sigma Aldrich, Cat #P7875-100G) in 0.1M acetate buffer, pH 5.5, at 4°C for 2min. Washed in 1 % aqueous glycerol (Sigma Aldrich, Cat #G5516) for five minutes. Washed in distilled water for five minutes. Treated with Schiff s reagent (Sigma Aldrich, Cat #3952016- 500ML) at room temperature for 15 minutes. Washed three times in 0.5% K2S2O5 (Sigma Aldrich, Cat #60508) in 0.05M hydrochloric acid (Sigma Aldrich, Cat #2104-50ML) for five minutes. Washed in running tap water for five minutes. Washed in distilled water for five minutes. Dehydrated, clear, mounted and coverslipped.

[0090] Immunofluorescence (IF) analysis

[0091] Blocking was performed by incubating paraffin-embedded tissue samples using 1% BSA with 2% FBS in PBS-T, for a total of 30 minutes. Immunostaining was performed by incubating samples with both primary and secondary antibodies overnight at 4°C using the following reagents: recombinant human Siglec-15-Fc (5p.g / mL; R&D Systems, USA, Cat #9227-SL-050) and Anti-Human IgG Alexa 488 (3pg / mL; Jackson ImmunoResearch, USA, Cat # 109-545-170). Samples were thoroughly washed with PBS and mounted in Prolong Gold Antifade Reagent with 4’, 6-diamidino-2-phenylindole, dihydrochloride (DAPI). Other SIGLEC constructs tested were also obtained from R&D Systems and used at an equivalent concentration.

[0092] Organoid culture media Organoid culture media (WENRAS), transport media, and rE differentiation media were formulated using components described below. Basal components include 213mL of Advanced DMEM / F12 (Gibco, USA, Cat #12634010) and 250mL of complete WRN media derived from L-WRN cells (ATCC CRL-3276). These were supplemented with B-27 (Thermo Fisher, USA, Cat #17504044), N-2 (Thermo Fisher, USA, Cat #17502048), Nicotinamide (Sigma Aldrich, Missouri, USA, Cat #N0636), Penicillin-Streptomycin (Gibco, USA, Cat #15140122), HEPES (Thermo Fisher, USA, Cat #15630080), GlutaMAX (Thermo Fisher, USA, Cat #35050061), Primocin (InvivoGen, California, USA, Cat #ant-pm-l l), Amphotericin B (Gibco, USA, Cat #15290018), N-Acetylcysteine (Sigma Aldrich, Missouri, USA, Cat #A9165), SB 202190 (Sigma Aldrich, Missouri, USA, Cat #S7067), [Leu- 15]- Gastrin I (Sigma Aldrich, Missouri, USA, Cat #G9145), recombinant human EGF (PeproTech, USA, Cat #AF-100-15), and A 83-01 (Tocns, UK, Cat #2939).

[0093] Organoid culture

[0094] Human normal colon organoid cells were cultured as previously described. Briefly, organoids were cultured in a 12-well plate, each containing 2mL of WENRAS media and seeded in 75pL of Matrigel basement matrix (Coming, USA, Cat #356231). Media was replaced once every 2 days and passaged once every 2 weeks or as needed. In vitro organoids were maintained at 37°C with 5% CO2. Organoids were passaged routinely via the following protocol. Supernatant was aspirated from each well and ImL of PBS (Thermo Fisher, USA, Cat #10010-049) was added to each well. Matrigel domes were disrupted using a P1000 tip and transferred to a conical tube. Wells were subsequently washed with another ImL of PBS (Gibco, USA, Cat #10010-049) and transferred to the same tube. The tubes were then centrifuged at 600xg for 5 minutes at RT, after which the supernatant was aspirated and resuspended in ImL of 0.25% Trypsin-EDTA (Gibco, USA, Cat #25200056) supplemented with lOmM Y-27632 2HC1 (Selleck Chem, Texas, USA, Cat #S1049). Organoids were incubated at 37°C for 120 seconds. Following incubation, the organoid-Trypsin mixture was pipetted vigorously using a Pl 000 tip (60-80 times). Trypsin was quenched by the addition of 5mL of transport media, prepared as described above, and centrifuged at 600xg for 5 minutes at RT. Supernatant was aspirated from each conical, and the organoid pellets were resuspended in an appropriate amount of Matrigel basement matrix for a 1 :4 split (75pL per well; Coming, USA. Cat #356231). After plating, organoids were incubated at 37°C for 15 minutes to allow for solidification of basement matrix. 2mL of WENRAS media supplemented with lOmM Y-27632 2HC1 (Selleck Chem, Texas, USA, Cat #S1049) was added to each well for two subsequent media changes.

[0095] Organoid fixation for immunostaining

[0096] Organoids were prepared for IHC and IF by pre-treating cells with rE differentiation media for 3 days (as described above), cross-linking with 4% paraformaldehyde (Thermo Scientific, USA, Cat #28906) and embedding in paraffin. Organoids were washed twice with PBS (Thermo Fisher, USA. Cat #10010-049). Following aspiration of the second wash, Matrigel domes were disrupted gently using 500pL of lU / mL Dispase (STEMCELL Technologies, Canada, Cat #07923). Wells were incubated at 37°C for 10 minutes or until the basement matrix was depolymerized. Cells were subsequently moved to a 1.5mL Eppendorf tube and wells were washed with PBS. Tubes were centrifuged at 200xg for 30 seconds at RT. Supernatant was removed and pellets were fixed in ImL of 4% PFA (Thermo Scientific, USA, Cat #28906) for an hour. Fixed cells were resuspended in 30pL of pre-warmed 1-2% agarose. The resuspension was quickly centrifuged at 500xg for 30 seconds at RT to remove bubbles. The organoid agarose plug was then stored at 4°C for 10 minutes. Following solidification, the agarose plug was transferred onto a cassette for paraffin embedding.

[0097] CRISPR KO of organoids

[0098] LentiCRISPR v2 was cloned with an NXPE1 targeting gRNA containing the sequence GAGACTCTACACTACGTCAG (Hgl9 chrl l :114393632-114393651) (SEQ ID NO: 13) as previously described. Lentiviral production was performed as described above (see Ov erexpression of cell lines). Viral transduction of normal organoid cells from one donor was performed on 2.2e5 healthy appearing organoids and were transduced by spinoculation at 800xg for 2hrs at 37°C with virus (targeting an MOI of 0. 1) in 4mL of WENRAS media supplemented with 10 pg / mL polybrene (Sigma Aldrich #TR-1003-G), lOpM Rocki (Y - 27632 2HC1 (Selleck Chem, Texas, USA, Cat S1049)), and 2.5pM GSK-3 inhibitor (Selleck Chem, #CHIR99021) in 12-well plates (Coming #3513). Post inoculation cells were washed with transport media and resuspended in 450pL of Matrigel. Organoids were then plated by placing 75pL of Matrigel / cell mix into each well of a 12 well plate and WENRAS media supplemented with 5pM of GSK-3 inhibitor and lOpM Rocki(Y -27632). After 10 days, selection with 0.5pg / mL of puromycin (InvivoGen ant-pr-1) was performed until an untransduced organoid population control was noted to be completely dead (about 7-10 days). Cells were then placed back into normal WENRAS media and expanded as needed.

[0099] Cell staining and flow cytometr

[0100] Jurkat cells with NXPE1 overexpression were suspended at IxlO6cells / mL in staining buffer and incubated with constructs at relevant concentrations for 30 minutes on ice, in the dark. Primary staining was performed with SIGLEC-15 (Aero Biosystems, Cat #SG5-H82E9) monomer at a concentration of 5pg / mL. Secondary staining was performed with APC- conjugated streptavidin (BioLegend, Cat #405207) at a concentration of 2pg / mL. For anti- Sialyl Tn antibody staining, primary staining was performed with anti-Sialyl Tn antibody (Abeam, Cat #abl 15957) at a concentration of 2pg / mL followed by an anti-mouse IgG- Alexa Fluor 647 secondary antibody (Cell Signaling, Cat #4410) at a concentration of lOpg / mL. Single, live cells were isolated using forward and side scatter characteristics. Flow cytometry data was analyzed using FlowJo v. 10.1 software.

[0101] Allele expression on colon tissue

[0102] Fresh frozen normal colon tissue was obtained from BioIVT (Westbury, NY). Samples were from different individuals than those previously screened by WGS or targeted sequencing. RNA was purified from on average 10-20mg of tissue using a RNeasy Mini Kit (Qiagen 74104) following manufacturer’s instructions, and quantified by 4200 Tapestation (Agilent). RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific #4368814) following manufacturer’s instructions. PCR was performed using primers listed below and Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher #Scientific F548L) following manufacturer’s instruction for 35 cycles. PCR products were then purified with AMPure beads (Beckman Coulter, California, USA, Cat #A63880) and run on a second round (2-6 cycles) of PCR to add barcodes. Libraries were pooled, cleaned up with AMPure beads (Beckman Coulter, California, USA, Cat #A63880) and sequenced on an Illumina Miseq using manufacturer’s instructions (150 cycle single read). Allele fractions were determined by processing fastq files using HISAT2 (version 2.0.5) and aligning to a pseudo reference genome consisting of only the mutant or wild-type amplicon sequences for targeted regions. The allele fraction was determined by taking a ratio of the number of transcripts from the alternative allele to the total number of transcripts from the region in question. Initial data processing was performed in MSSQL and Excel.

[0103] In vitro NXPE1 biochemical assay using DMB-based HPLC

[0104] Enzymatic assays to determine sialic acid O-acetyltransferase activity' in vitro were adapted from. 50mM MES pH 6.5 (Thermo Scientific Chemicals, Cat #J61587.AK), lOmM MnCh (Sigma-Aldrich, Cat #M1787). lOmM acetyl-CoA (Sigma- Aldrich, Cat #A2056). and 1.25mM CMP-Neu5Ac (Sigma-Aldrich, Cat #5.05223) or 1.25mM CMP-Neu5Gc (Chemily Glycoscience, Cat #SN02020) were incubated with or without 5pg recombinant NXPE1 (AA 60-547) or its mutant variants (S355A and D526A) in a 20pL reaction volume for 3h at 37°C. Sialic acids were then released via acid hydrolysis by adding 2M propionic acid (Sigma- Aldrich, Cat #402907) to each sample for Ih at 80°C. Released sialic acid samples were subsequently labelled with 4,5-methylenedioxy-l,2-phenylenediamine dihydrochloride (DMB) following manufacturer’s instructions (Agilent, Cat #GKK-407). DMB-labelled samples, reference panel, Neu5Gc standard (Ludger / QA-Bio, Cat #CM-NEU-GC-01), and Neu5,9Ac2 standard (Ludger / QA-Bio. Cat #CM-NEU5.9AC2-01) were analyzed on a GlykoSep R HPLC column (Agilent) via an Agilent 1260 Infinity HPLC system fitted with a 1260 Infinity Multiple Wavelength Detector. Isocratic elution with acetonitrile / methanol / water (9:7:84, v / v) was performed at a flow rate of 0.7mL / min and absorbance was measured at the excitation wavelength of DMB (373nm).

[0105] Example 1- Whole genome sequencing identifies a haplotype on chromosome 11 associated with colon sialic acid mPAS staining status

[0106] Whole genome next generation sequencing was performed on matched plasma DNA from 21 normal colon additional formalin fixed paraffin embedded (FFPE) samples: 8 that were negative by mPAS staining, 8 that were positive, and another 5 that were negative with at least one spontaneously positive crypt (presumed to be of heterozygous genotype for the unknown gene of interest) (FIG. 1A). A moderate depth level of coverage was targeted, averaging 15x, to allow for identification of any microdeletions or single nucleotide polymorphisms (SNPs) that may be contributing to the observed phenotype. mPAS staining was primarily localized to goblet cells within normal colorectal crypts (FIG. 1A). An initial genome-wide review identified 202 SNPs with two or fewer genotype / phenotype mismatches, with chromosome 11 harboring the most at 90 SNPs (FIGs. IB and 6A-6B). A more stringent analysis revealed that all 17 SNPs that showed perfect concordance with the mPAS phenotype were on chromosome 11 (FIG. IB). All 17 of the SNPs were confined to a small region (chrl 1 : 114,298,921 to chrl 1: 114,446,104). Consistent with the above observations, an expanded analysis of this chromosome with all WGS detected variants yielded a 173kb haplotype near 1 lq23.2 with strong association to the staining phenotype (FIG. 1C)

[0107] Example 2 - Targeted sequencing implicates NXPE1 as the gene associated with colorectal sialic acid mPAS staining status

[0108] Four protein coding genes reside in the haplotype discovered in the WGS: NXPE1, PC-Esterase Domain Family Member 4 (NXPE4), RNA binding motif protein 7 (RBM7) and RNA exonuclease 2 (REXO2). A review of the 17 perfectly correlated SNPs showed none lie in coding regions, but 4 are classified as located in upstream gene variant regions, consistent with a gene promoter. The remainder fall in intergenic, intronic, or downstream regions of genes and are not predicted to alter any protein function (FIGs. 7A-7C). To determine if one of these four SNPs is most closely associated with the phenotype. 91 additional FFPE normal colon mucosa samples were obtained. After confirming the mPAS status of each sample targeted sequencing was performed on each of the four promoter SNPs (covering the protein coding genes REX02 and NXPE1). Only rs661946. in the promoter region of NXPE1, maintained a perfect match (91 / 91) between the observed phenotypic staining by mPAS and genotype (FIG. ID). rsl0891692 resides in the coding region of NXPEE and rs661946 is only 6 bp upstream of the transcriptional start site, presumably part of its promoter, and exists as part of or immediately adjacent to at least three transcription factor binding motifs (ETS-2, SOX1 and GR-a). The observed frequencies for this SNP in these samples. C base 0.53 and T base 0.47, are consistent with Hardy -Weinberg equilibrium (Haldane's Exact Test) and the published minor allele frequency (MAF) of mPAS positive staining for individuals of East Asian descent, the location from which most of these samples originated. The only other SNP significantly associated with the phenotype based on Fisher’s Exact Test with Bonferroni correction was rs561722 (NXPE2P1) but it still contained 3 / 91 mismatches between mPAS staining and the noted genotype, and is predicted to be a pseudogene and not translated. These findings, although not conclusive, supported NXPE1 as the top candidate and rs661946 as the potentially causative SNP.

[0109] Example 3 - Structural similarities and expression patterns support NXPE1 and NXPE4 as candidates for mediators of sialic acid O-acetylation

[0110] Although little has been published about NXPE1 or NXPE4 (a family member of the top candidate NXPE1, and also within the haplotype found on chromosome 11), there are three additional lines of evidence that support them as strong candidates for causing the mPAS phenotype in colon tissue. First, NXPE1 and NXPE4 have been reported as containing structural similarities to known sialic acid O-acetyltransferases from many species, the biochemical enzymatic function expected to mediate variation in mPAS staining. More specifically, NXPE1 and NXPE4 have been reported as containing secondary structural similarities to known sialic acid O-acetyltransferases from other species. NXPE1 contains two motifs, Gly-Asp-Ser (GDS) and Asp-X-X-His (DXXH), with identical amino acid sequence to the catalytic active site of the only known human SO AT, the protein CASD1 (expect value=0.004. 23.9% identity )(FIGs. 2A-2B). Like CASD1. NXPE1 protein lacks the canonical glycine and asparagine in the GDSL / SGNH fold present in SOATs from other species, such as rhamnogalacturonan acetylesterase (Q00017) and photobacterium sp. JI 5 (AKQ62669.1), making it part of the GDSL / SGNH-like acyl-esterase family. That said, the catalytic sites do contain similarities to the viral homologs of SOAT proteins observed in influenza C / JHG / 66 virus, Isavirus salaris, bovine torovirus strain Breda 2. and human coronavirus OC43. These sequence similarities are also conserved among other members of the neurexophilin / NXPE family including NXPE4, though they display a different, His-Pro- Pro, sequence for their histidine containing motif. In silico 3D structure prediction of NXPE1 co-locates Asp526 and His529 adjacent to the Ser355, creating a hydrogen bond between the histidine and serine residues similar to the catalytic active serine (Ser94) in CASD1 (FIGs. 2C-2D and FIG. 8). NXPE1 Ser355 is exposed to solvent and also resides in what would be the intra-endoplasmic reticulum / Golgi space (where glycan addition and modification occurs), suggesting these may be the residues responsible for catalytic activity of the protein.

[0111] Second, RNA as well as protein expression for NXPEl is almost exclusively isolated to the colon and rectum. Likewise, NXPE4 expression is largely confined to the colon and rectum but also shows significant expression in the salivary gland, kidney tubules, and liver. In contrast, other candidates in the haplotype (REX02 and RBM7) display diffuse expression in many tissues, and low expression in the gastrointestinal tract.

[0112] Finally, the limited publications reporting on NXPE1 include a genome wide association study describing NXPE1 variants associated with inflammatory bowel disease and a transcriptome study associating its expression with poor outcomes in colorectal cancer. Similarly, NXPE4 has been described in only three publications, implicating its importance as a potential prognostic biomarker for colorectal cancer and as a gene associated with ulcerative colitis. These publications establish that the expression of this family is likely an important indicator of GI tissue health.

[0113] Example 4 - NXPE1 protein levels correlate with sialic acid mPAS status and with the staining pattern of sialic acid binding lectins SIGLEC-7 and SIGLEC-15 in colon tissue

[0114] Although the genetic data establish NXPE1 as the top candidate, additional evidence was sought to support NXPE1 over NXPE4 given their related structures and expression patterns. An IHC assay was developed for NXPE1, NXPE4, and CASD1 (the only known human SOAT) and their expression in colon tissue was observed. All 3 proteins showed a cytoplasmic granular immunostaining pattern limited to colon epithelium. Tissues with a homozygous T variant of the rs661946 SNP displayed no NXPE1 protein (by IHC) and robust mPAS staining, while heterozygous samples showed NXPE1 immunolabeling but no mPAS staining (FIG. 3A and FIGs. 9A-9B). More impressively, there were some heterozygous samples with spontaneous gain of mPAS staining in select crypts, representing focal loss of sialic acid modification, displayed total loss of NXPE1 protein (by IHC) in the same locations. NXPE4 and CASD1 staining was present and appeared unchanged regardless of the sialic acid modification status. This inverse concordance of crypts that have somatically gained mPAS staining with focal cry pt loss of NXPE1 expression while conserving NXPE4 and CASD1 expression was interpreted as strong evidence implicating NXPE1 as the gene responsible for colorectal mPAS status.

[0115] To confirm that the effects of NXPE1 were indeed related to sialic acid modifications, independent evidence was sought that altered mPAS staining was due to modifications to sialic acid. It is well established that the sialic acid-binding immunoglobulin-like lectin (SIGLEC) family bind to sialylated glycoproteins. Importantly. O-acetylation modifications are capable of controlling sialic acid-SIGLEC interactions. Of 20 SIGLEC / sialic acid binding proteins tested, sialic acid-binding Ig-like lectin 15 (SIGLEC-15) consistently stained the same regions and samples as mPAS staining (FIGs. 3B-3D). SIGLEC-15 is a lectin known to bind Ser / Thr N-acetylgalactosamine (O-GalNAc) bound sialic acids as well as N- acetylglucosamine (GlcNAc) but with lower affinity'. SIGLEC-15’s binding sensitivity in the presence of an O-acetylation mark is not established. Functionally, SIGLEC-15 has been described as a regulator of osteoclast differentiation as well as a potential immune checkpoint. SIGLEC-7 also showed some specificity for mPAS positive colon tissue, but the signal was not as consistently robust as SIGLEC-15. This observation is supported by previous evidence showing that SIGLEC-7 and SIGLEC-15 bind to similar clusters of O- glycan bound sialic acids. Taken together, the structural relatedness of the NXPE1 family to known SOATs and the genetic and protein correlation of NXPE1 levels with sialic acid modification status, as determined by both mPAS and SIGLEC-15 staining, suggests that NXPE1 may be acetylating sialic acids on glycoproteins in colon tissue (FIG. 10).

[0116] Example 5 - Manipulation of NXPE1 protein expression alters modified sialic acid status

[0117] To confirm that these effects w ere directly related to NXPE1 expression and overcome any unforeseen biases introduced by correlative lines of evidence, a NXPE1 expression cassette w as introduced under CMV promoter control in the Jurkat cell line via lentivirus. This line was chosen as it was noted to express sialyl-Tn, a truncated sialic acidcontaining O-glycan known to bind to SIGLEC-15 and commonly found in cancer cells, but has low' expression of NXPE1 (FIG. 11). In distinct pools of cells infected with tw'O independent viral clones, increased amounts of NXPE1 protein led to decreased SIGLEC-15 binding by flow cytometry, consistent with our hypothesis that increased NXPE1 activity' would increase the number of modified sialic acids and lower binding of SIGLEC-15 (FIG. 4A). To confirm these results, IHC and flow' cytometry were then performed using an anti- sialyl-Tn antibody and marked reduction in staining was observed for Jurkat cells with NXPE1 overexpression, presumably due to NXPE1 -mediated sialyl-Tn O-acetylation (FIGs. 4B and FIG. 12)

[0118] While 2D cultures are useful for their ease, it was acknowledged that they do not sen e as the best models for processes requiring structural hierarchy. To address this, NXPE1 was knocked out in normal human colorectal organoids grown in 3D culture. It was again observed that loss of NXPE1 protein led to gain of SIGLEC-15 IF signal, suggesting loss of acetylated sialic acid, in goblet cells.

[0119] Example 6 - Molecular basis of SNP rs661946 allelic effects on sialic acid modification

[0120] NXPE1 and NXPE4 are highly expressed in normal human colon tissues, averaging 50 and 100 transcripts per million respectively in publicly available databases. Using normal colon organoid lines and normal fresh frozen colon samples, the RNA expression levels of each allele of NXPE1 was assessed by targeted RNA sequencing. This was accomplished by comparing the transcript levels of each allele using coding region heterozygous SNPs in NXPE1 that were highly correlated with the promoter SNP rs661946. The WGS data indicate that the C and A variants of rs524911 and rs!0891692, respectively, are tightly linked with the T allele of rs661946, which lacked detectable NXPE1 expression above. The results demonstrate that transcripts of NXPE1 associated with the T allele of rs661946 were expressed at lower levels than the C allele in the same colon sample tissues. A SNP in the coding region of NXPE4 (rsl0891705) served as a control and did not show reproducible allele specific expression. Review of publicly available data on the GTEx portal supports these results, with significantly lower NXPE1 transcript expression associated with the T allele for rs661946 noted in colon-transverse, colon-sigmoid and prostate tissue. Testis also shows allelic expression, but in the opposite direction (more expression from T allele). The majority of SNPs located near the NXPE1 gene display a significant allele specific expression pattern for NXPEl as would be expected for closely linked SNPs. In contrast those from RBM7 and REXO2 generally show minimal to no difference in expression.

[0121] Finally, it was established whether the SNP rs661946 in the promoter of NXPE1 was responsible for the inherited changes in protein expression noted earlier in this study (FIG. 4D). mPAS staining w as performed on a number of colon cancer cell lines and found positive staining in LSI 80 cells, which also contains a homozygous VAR (T base) genoty pe for the rs661946 SNP and would thus be expected to stain positive. CRISPR and a repair template to change the NXPE1 promoter SNP rs661946 genotype from VAR (T / T) to heterozygous (C / T) or homozygous REF (C / C) was used in LS180 colon cancer cells. A robust increase was noted in NXPE1 protein and decrease in mPAS staining, following the change to either heterozygous (C / T) or homozygous REF (C base) (FIG. 4F). This is consistent with the allelic expression data, where the majority of RNA comes from the REF (C base) allele. This evidence supports that the SNP rs661946 may control NXPE1 expression in the colon, and consequently the amount of modified sialic acid present on glycoproteins in colorectal tissue.

[0122] Example 7 - Variation in NXPE1 across 90 patients with colorectal cancer

[0123] A NXPE1 immunohistochemistry assay was developed and used on a commercially- available tissue microarray to assess phenotypic variation across 90 normal-matched colon cancer cases. NXPE1 immunohistochemistry staining was primarily localized within goblet cells of colon crypts in normal tissue and less well-defined in tumor tissue due to loss of polarity' (FIG. 16). Subsequent semi-quantitative analyses were performed using a scoring metric that was developed based on the intensity and distribution of staining within the tissue (FIG. 17). Staining revealed distinct loss of NXPE1 in the tumor context among 29 / 90 patients (32.2%) (FIG. 18) and asymmetric diversity in NXPE1 expression among both normal and tumor samples (FIG. 19). It was further assessed whether the loss of NXPE1 may represent a valuable prognostic marker to patients with colorectal cancer by analyzing publicly available survival data from The Cancer Genome Atlas. Patients with higher expression of NXPE1 generally had a higher likelihood of overall survival (FIG. 20). Using tools and insights provided herein, it is possible that NXPE1 can sen e as a useful prognostic marker and indicator for benefit from therapeutic agents targeting loss of 1 lq23 or SIGLEC- 15-like agents targeting deacetylated (or low-NXPEl) cancers.

[0124] Example 8 - Siglec-Antibody Conjugates

[0125] A bispecific T-cell engager comprising (1) Siglec-15 or a single-chain variable fragment (scFv) using Siglec-15 as its prototype (red end of construct) linked to (2) an anti- CD3 scFv (blue end of construct) - hereon noted as “SAC” - can be used to treat cancers with loss of sialic acid O-acetylation due to loss of NXPE1 through loss of 1 lq23 or with other cancer specific somatic epigenetic or genetic events (FIG. 21). There was limited killing of cancer cells (LSI 80) with or without addition of T-cells, in the absence of SAC construct (FIG. 22).

[0126] For LS180 cells, which have a T / T genotype at rs661946 and thus have non-O- acetylated sialic acids, there was differential killing of wells with T-cells and SAC1 construct, compared to wells with only SAC1. Some of this difference was restored by addition of SAC11, which has a SIGLEC-15 arm but not an anti-CD3 arm. This presumably helps saturate SIGLEC-15 ligands on LSI 80 cells to prevent formation of an immune synapse between T-cells and LSI 80 cells by SAC1. Differential growth was not observed among any experimental arms for LSI 80 NXPE1 KI clone QE2, which has a C / C genotype at rs661946 and thus have O-acetylated sialic acids. This suggested that SAC constructs will only kill cancer cells w hen there are non-O-acetylated sialic acids that the SIGLEC-15 arm can recognize (FIG. 23)

[0127] Similar trends were found with SAC7, a construct with reversed direction of the anti- CD3 and SIGLEC15 ends. For LS180 NXPE1 KI clone QE2, slightly reduced growth was observed in wells with both T-cells and SAC7 included compared to wells with only SAC7, but SAC11 was unable to rescue this difference, suggesting that these are mediated by random T-cell activation and killing events (FIG. 24).

[0128] Example 9 - NXPE1 displays differential allelic expression

[0129] A review of the literature suggests that expression of NXPE1 protein is largely confined to the colon and rectum. Consistent with this, the RNA expression levels of NXPE1 were queried in the GTEx database and found to be highly expressed in normal human colon tissues, averaging 50 transcripts per million. It was next sought to address the differences in the expression of the two alleles of NXPE1. For this purpose, SNPs within the transcribed region of NXPE1 that were in linkage with rs661946 were used, including rsl0891692. This revealed lower expression of transcripts linked to the T allele in colon-transverse, colonsigmoid and prostate (FIG. 4C). Testis also showed an imbalance of allelic expression, but in the opposite direction (more expression from the T, rather than the C allele). With the low total transcripts per million noted in this tissue for NXPE1, the relevance of this is not clear (FIG. 4C top). Similarly, NXPE4 also showed fewer transcripts from the variant allele of SNPs in linkage disequilibrium with rs661946. In contrast, the alleles from RBM7 and REXO2 in colon-transverse and colon-sigmoid generally showed minimal to no difference in expression.

[0130] Finally, it was analyzed whether the SNP rs661946 in the promoter of NXPE1 is contributing to the inherited changes in protein expression noted earlier in this study. To directly evaluate the effects of changing the T allele to a C allele, colorectal cancer cell lines were surv eyed to find one that stained positively with mPAS (FIG. 13). One such cell line (LSI 80) was identified, and the genotype for this cell line was confirmed as homozygous for the T allele at rs661946, as expected from its mPAS staining (FIG. 13). CRISPR was used to change the T / T genotype in this line to either the heterozy gous C / T or homozygous C / C (FIG. 4D and FIG. 14). A robust increase in NXPE1 protein and decrease in mPAS staining was observed in the engineered lines with T / T to C / T or C / C change, an observation further supporting the autosomal dominant behavior of NXPE1 (FIGs. 4E-4F).

[0131] Example 10 - NXPE1 transfers acetyl to cytidine-5-monophospho-N-acetylneuraminic acid It was determined if NXPE1. like CASD1. is able to biochemically transfer an acetyl group from acetyl coenzyme A onto cytidine-5-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac), a modified sialic acid used for biosynthesis of sialic acid derivatives. Coincubation of the predicted extracellular domain of NXPE1 (AA 60-547) with required cofactors and CMP-Neu5Ac led to a modified sialic acid product running at ~11 minutes, suggesting that NXPE1 mediates addition of acetyl groups to sialic acids at the ninth carbon position (FIG. 5A and FIG. 15). Additional minor products at ~7 minutes likely suggest the formation of other acetylated sialic acid derivatives, including at the seventh carbon position (FIG. 5A and FIG. 15). To further pinpoint the enzymatic mechanism of NXPE1, NXPE1 was co-incubated with co-factors and CMP-Neu5Ac, but without acetyl coenzy me A. Expectedly, a complete absence of modified sialic acid product was observed, verifying that acetyl coenzyme A is a necessary co-factor for NXPEl’s enzymatic function (FIG. 5A and FIG. 15). Additionally, the presumed catalytic serine residue S355 (FIGs. 2A and 2D) was mutated to an alanine (S355A) in an effort to create a catalytically inactive NXPE1 mutant (NXPE1S355A). Encouragingly, complete abrogation of NXPE1 -mediated O-acetylation was noted, demonstrating the essentiality of S355 for enzymatic activity (FIG. 5A and FIG. 15). Analogous alanine mutation of a spatially proximal aspartic acid residue D526A reduced, but did not completely eliminate, NXPE1 activity7(FIG. 15). Lastly, CMP-N-glycolylneuraminic acid (CMP-Neu5Gc) was obtained, a modified sialic acid that is primarily present in human tissue through dietary exposure, and performed similar biochemical assays were performed with NXPE1 . A small amount of modified product was observed running at ~9 minutes, in alignment with Neu5Gc,9Ac from the sialic acid reference, suggesting thatNXPEl may weakly accept CMP-Neu5Gc as a substrate (FIG. 15). These observations support a model where (1) rs661946 SNP directly modulates the expression of NXPE1 resulting in variation in NXPE1 activity and (2) NXPE1 mediates sialic acid O-acetylation (FIG. 5B).

Claims

WHAT IS CLAIMED IS:1 . A method of identifying a subject as having an inflammatory bowel disorder, the method comprising:(a) determining a level of NXPE1 in a biological sample from the subject; and(b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder.

2. A method of treating an inflammatory bowel disorder in a subject, the method comprising: administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of aNXPEl gene, thereby treating the inflammatory' bow el disorder.

3. A method of treating an inflammatory bowel disorder in a subject, the method comprising:(a) determining a level of NXPE1 in a biological sample from the subject;(b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample above the reference level indicates that the subject has an inflammatory bowel disorder; and(c) administering a therapeutic agent to the subject, wherein the therapeutic agent inhibits expression of aNXPEl gene, thereby treating the inflammatory' bowel disorder.

4. The methods of any one of claims 1-3, wherein the inflammatory bowel disorder comprises Crohn’s disease, irritable bowel syndrome (IBS), ulcerative colitis, or an inflammation of the gastrointestinal system.

5. The method of claim 2 or 3, wherein the therapeutic agent comprises an inhibitor of NXPE1.

6. The method of claim 5, wherein the inhibitor of NXPE1 comprises an inhibitory nucleic acid, or a small molecule inhibitor.

7. The method of claim 6, wherein the inhibitory nucleic acid inhibits NXPE1 by reducing NXPE1 expression.

8. The method of claim 5, wherein the inhibitor of NXPE1 comprises a CRISPR / Cas9 complex targeting the NXPE1 gene.

9. The method of any one of claims 2-8. wherein the administering comprises intravenous administration, subcutaneous administration, intraperitoneal administration, rectal administration, oral administration, or combinations thereof.

10. A method of identifying a subject as having a cancer, the method comprising:(a) determining a level of NXPE1 in a biological sample from the subject; and(b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer.

11. A method of treating a cancer in a subject, the method comprising: administering a therapeutic agent to the subject, wherein the therapeutic agent treats the cancer.

12. A method of treating a cancer in a subject, the method comprising:(a) determining a level of NXPE1 in a biological sample from the subject;(b) comparing the level of NXPE1 in the biological sample to a reference level, wherein the presence of a level of NXPE1 in the biological sample below the reference level indicates that the subject has a cancer; and(c) administering a therapeutic agent to the subject, wherein the therapeutic agent treats the cancer.

13. The method of any one of claims 10-12. wherein the cancer is a solid tumor.

14. The method of claim 13, wherein the cancer is a colorectal cancer.

5. The method of any one of claims 10-14, wherein the administering comprises intravenous administration, subcutaneous administration, intraperitoneal administration, rectal administration, oral administration, or combinations thereof.

Images