Size thresholding of DNA fragments
Patent Information
- Application Number
- PCT/US2025/018927
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-04
- Filing Date
- 2025-03-07
- Publication Date
- 2025-10-02
AI Technical Summary
Existing DNA sequencing methods face issues with redundancy and over-representation of certain genomic areas due to DNA fragments smaller than a minimum length, leading to waste of sequencing reagents and time.
The use of molecular scaffolds and tagmentation apparatuses to generate DNA fragments that are at least 210 base pairs long, preventing sequencing reactions from extending beyond genomic fragments and reducing the over-amplification of smaller fragments.
This approach reduces redundancy in sequencing reactions, conserves reagents, and optimizes sequencing efficiency by ensuring that only fragments within a defined size range are processed, thereby minimizing waste and time.
Smart Images

Figure US2025018927_02102025_PF_FP_ABST
Abstract
Description
SIZE OF DNA FRAGMENTS CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application S.N. 63 / 716,142, filed November 4, 2024, and U.S. Provisional Application S.N. 63 / 715,981, filed November 4, 2024, and U.S. Provisional Application S.N. 63 / 563,294, filed March 8, 2024, the content of each of which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted herewith is hereby incorporated by reference in its entirety. The name of the file is ILI277BPCT_IP-2753- PCT_Sequence_Listing.xml, the size of the file is 14,949 bytes, and the date of creation of the file is March 3, 2025. BACKGROUND
[0003] Deoxyribonucleic acids (DNA) can be analyzed using a variety of methods, such as gene sequencing, genotyping, etc. In some methods, it is desirable to generate a library of fragmented and tagged DNA molecules from double-stranded DNA (dsDNA) target molecules. Often, the purpose is to generate smaller DNA molecules (e.g., DNA fragments) from larger dsDNA molecules for use as templates in DNA sequencing reactions. The templates may enable short read lengths to be obtained. During data analysis, overlapping short sequence reads can be aligned to reconstruct the longer nucleic acid sequences. In some instances, pre-sequencing steps (such as barcoding of particular nucleic acid molecules) can be used to simplify the data analysis. SUMMARY
[0004] The molecular scaffolds, the tagmentation apparatus, and the methods disclosed herein are used in DNA library preparation. The DNA fragments that are formed are at least 210 base pairs long. DNA fragments greater than this minimumlength can reduce redundancy in the reaction, and prevent the sequencing reaction from extending beyond the genomic fragment into adapters and beyond. Additionally, preferential amplification of DNA fragments smaller than this minimum length, which can lead to over-representation of certain areas of the genome, is avoided. Overall then, the molecular scaffolds, the tagmentation apparatuses, and the methods disclosed herein can reduce waste of sequencing reagents and time. BRIEF DESCRIPTION OF THE DRAWINGS
[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0006] Fig.1A and Fig.1B respectively depict different examples of the transposomes that can be used in different examples of the molecular scaffolds, tagmentation apparatuses, and / or methods disclosed herein;
[0007] Fig.2A is a schematic illustration of one example of a molecular scaffold;
[0008] Fig.2B is a schematic illustration of another example of a molecular scaffold;
[0009] Fig.2C is a schematic illustration of still another example of a molecular scaffold;
[0010] Fig.3 is a schematic illustration of a solution based tagmentation method involving one example of the molecular scaffold described herein;
[0011] Fig.4 is a schematic illustration of a surface based tagmentation method involving one example of the molecular scaffold described herein;
[0012] Fig.5 is a top view of an example of the flow cell used for amplification and sequencing of fully adapted DNA sample fragments;
[0013] Fig.6A is a cross-sectional view of one flow channel architecture of the flow cell of Fig.5, which includes a single lane;
[0014] Fig.6B is a cross-sectional view of another flow channel architecture of the flow cell of Fig.5, which includes depressions separated by interstitial regions;
[0015] Fig.7 is a schematic another surface based tagmentation method;
[0016] Fig.8A is a perspective view of one example of a tagmentation apparatus;
[0017] Fig.8B is a schematic view of another example of a tagmentation apparatus;
[0018] Fig.8C is an enlarged, perspective view of a DNA origami structure of the tagmentation apparatus of Fig.8B with a transposome dimer attached thereto;
[0019] Fig.8D is a schematic, cross-sectional view of yet another tagmentation apparatus including depressions;
[0020] Fig.8E is a schematic, cross-sectional view of still another tagmentation apparatus including depressions;
[0021] Fig.8F is a schematic, cross-sectional view of still a further tagmentation apparatus including depressions;
[0022] Fig.9A is a top view of two origami structures linked together via linking moieties;
[0023] Fig.9B is a top view of four origami structures, each of which is linked to an adjacent origami structure via two linking moieties;
[0024] Fig.10 is a perspective view of another example origami structure;
[0025] Fig.11A is a black and white reproduction of an originally colored image, obtained using Atomic Force Microscopy (ATM), of a mica substrate with a plurality of DNA origami structures attached thereto;
[0026] Fig.11B is a black and white reproduction of an enlarged portion of Fig. 11A, with the biotin / streptavidin attachment points identified with the label “B” in a circle;
[0027] Fig.12 depicts gel electrophoresis results for the supernatant of an example sample containing biotinylated DNA origami and streptavidin coated beads and for the supernatant of a comparative sample containing DNA origami and streptavidin coated beads;
[0028] Fig.13 depicts gel electrophoresis results for two different biotinylated DNA origami and a comparative DNA origami after exposed to fluorescently labeled and biotinylated transposome complexes; and
[0029] Fig.14 is a graph depicting units per microliter (AU / µL) (Y axis) for an example and a comparative example. DETAILED DESCRIPTION
[0030] Molecular scaffolds, tagmentation apparatuses, and methods are described herein for generating DNA fragments that meet a minimum size threshold. DNA fragments greater than the minimum size threshold can reduce overall waste by redundancy in the sequencing reaction, prevent the sequencing reaction from extending beyond the genomic fragment into adapters and beyond, and decreasing the over-amplification of very small fragments.
[0031] Definitions
[0032] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0033] As used herein, the singular forms “a,” “an,” and “the” refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0034] Reference throughout the specification to “one example,” “another example,” “an example,” and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0035] The terms “substantially” and “about” used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to ±5% from a stated value, such as less than or equal to ±2% from a statedvalue, such as less than or equal to ±1% a stated value, such as less than or equal to ±0.5% from a stated value, such as less than or equal to ±0.2% from a stated value, such as less than or equal to ±0.1% from a stated value, such as less than or equal to ±0.05% from a stated value.
[0036] Adapter: An oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths may range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. The adapter may include any combination of nucleotides and / or nucleic acids. In some examples, the adapter can include an amplification domain, e.g., having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, the adapter can include a sequence that is complementary to at least a portion of a flow cell surface bound primer (which includes the universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to the complementary flow cell surface bound primer during amplification and cluster generation. In some examples, the adapter can also include a sequencing primer sequence (i.e., sequencing binding site) and / or a sequencing sample index (i.e., a barcode sequence). Combinations of different adapters may be incorporated into the nucleic acid molecule, such as the DNA fragments generated via tagmentation.
[0037] Amplification: Replicating one or more nucleic acid templates, including fragments thereof, and thus creating multiple copies of the one or more nucleic acid templates. Amplification can include one or more of a bridge amplification reaction, an isothermal bridge amplification reaction, a rolling circle amplification (RCA) reaction, a modified rolling circle multiple displacement amplification, a helicase-dependent amplification reaction, a recombinase-dependent amplification reaction, a single- stranded DNA binding (SSB) protein mediated isothermal amplification, a polymerase chain reaction (PCR) reaction, a strand-displacement reaction, a ligase chain reaction, a transcription-mediated reaction, a loop-mediated amplification reaction, other suitable reactions, and combinations thereof.
[0038] Amplification Domain: A of an adapter having a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, that can serve as a starting point for template amplification and cluster generation.
[0039] Attachment / Attached / Affixed / Immobilized: These terms are used interchangeably herein. The terms refer to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly and either physically or chemically. As an example of chemical attachment, a nucleic acid can be attached to a polymeric hydrogel by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of pairs of electrons between atoms. As an example, a covalent attachment includes a bond resulting from the use of click chemistry techniques. A non-covalent bond is a physical bond that does not involve the sharing of pairs of electrons and can include, for example, non-specific interactions (e.g., hydrogen bonds, ionic bonds, van der Waals forces) or specific interactions (e.g. affinity interactions (e.g., hydrophilic interactions and hydrophobic interactions), receptor-ligand interactions, antibody-epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary attachments are set forth in U.S. Pat. Nos.6,737,236 B1; 7,259,258 B2; 7,375,234 B2 and 7,427,678 B2; and U.S. Pat. Pub.2011 / 0059865 A1, each of which is incorporated herein by reference in its entirety.
[0040] In certain examples, the molecules (e.g., nucleic acids, enzymes) remain immobilized or attached to the solid support under the conditions in which it is intended to use the solid support, for example in applications requiring nucleic acid amplification and / or sequencing. In other embodiments, the molecules are reversibly immobilized or attached and can be removed from the solid support through the use of cleavable sites, linkers, and the like.
[0041] Cluster / Cluster of oligonucleotides / Oligonucleotide cluster / Colony: A localized group or collection of DNA or RNA molecules on a nucleotide-sample support, such as a flow cell, particle, polymer scaffold, or other solid surface. In particular, a cluster includes tens, hundreds, thousands, or more copies of a cloned or the same DNA or RNA segment. For example, in one or more examples, a cluster includes a grouping of oligonucleotides immobilized in a section of a flow cell or othernucleotide-sample slide. In some the cluster can comprise one or more concatemers, such as, for example, a polony or a nanoball. In some examples, clusters are evenly spaced or organized in a systematic structure within a patterned flow cell. By contrast, in some cases, clusters are randomly organized within a non- patterned flow cell. In typical examples, a cluster is the product of an amplification reaction. A cluster of oligonucleotides can be imaged utilizing one or more light signals, changes in pH, changes in conductance, and other signals. For instance, an oligonucleotide-cluster image may be captured by a camera during a sequencing cycle. The image captures light emitted by irradiated fluorescent labeled nucleotides incorporated into oligonucleotides, fluorescent labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescent labeled complexes associated with incorporated or bound nucleotides from one or more clusters on a flow cell. Examples of other sequencing procedures are set forth herein. In some examples, a cluster can be monoclonal or polyclonal.
[0042] Corresponds with: When one primer “corresponds with” an amplification domain, the primer and amplification domain may have the same sequence, so that a copy of the amplification domain generates a sequence complementary to the primer; or they may have complementary sequences when the amplification domain is introduced as part of an adapter.
[0043] Depositing: Any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0044] Depression: A discrete concave or recessed feature in a substrate or a layer of a substrate (e.g., a patterned resin) having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate or the layer. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have more complex architectures, such as ridges, step features, etc.
[0045] DNA Origami: A technique that allows the synthesis of discrete and non- arbitrary two- and / or three-dimensionally shaped DNA structures at the nanoscale. The specificity of the interactions between complementary base pairs renders single stranded DNA as a useful construction material. DNA origami may be used to create structures (i.e., DNA origami structures) that hold other molecules in place or to create structures all on its own.
[0046] DNA Sample: Genetic material extracted from a cell, where the genetic material includes a DNA molecule. The DNA molecule is a polymeric form of nucleotides of any length that includes deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from an RNA (ribonucleic acid) sample. The DNA sample is double stranded. The DNA sample may include naturally occurring DNA, which includes a nitrogen containing heterocyclic base (a nucleobase such as adenine, thymine, cytosine and / or guanine), a sugar (specifically deoxyribose, i.e., a sugar lacking a hydroxyl group that is present at the 2’ position in ribose), and a backbone containing phosphodiester bonds. An analog structure can have an alternate backbone linkage including any of a variety known in the art.
[0047] The DNA sample may be genomic DNA (gDNA) that can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva) or tissues. gDNA can be prepared by lysing a cell that contains the DNA. The cell may be lysed under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis may be used to lyse a cell. In another particular example, exposure of a cell to alkaline pH can be used to lyse a cell while causing relatively little damage to gDNA. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, relatively undamaged gDNA can be obtained from a cell lysed by an enzyme that degrades the cell wall. Cells lacking a cell wall either naturally or due to enzymatic removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption,sonication heat, pressure differential as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in a cell lysate or isolated gDNA sample including, for example, nuclease inhibitors, chelating agents, salts, buffers and the like. A crude cell lysate containing gDNA may be used without further isolation of the gDNA. In one example, a whole blood sample may be lysed using an inorganic salt free lysis buffer, and the crude lysate may be exposed to specific processing steps to generate a complexed crude lysate. This complexed crude lysate can also be used as the DNA sample without further isolation or purification.
[0048] A DNA sample is one example of a nucleic acid sample. A nucleic acid sample is a sample, containing DNA and / or RNA, derived from any organism, including, for example, animals, plants, fungi, and microbes. Such samples may be derived from one or more biological fluids, cells, tissues, organs, or organisms, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence. Such samples may include, but are not limited to, sputum / oral fluid, amniotic fluid, blood, a blood fraction, fine needle biopsy samples (such as surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (such as a patient), the sample may be from any mammal, including, but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, the sample may be microbial such as bacteria, viral, or fungal. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (such as namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or“processed” samples are still considered be biological “test” samples with respect to the methods described herein. A “nucleic acid sample” may also include nucleic acid sequence information stored in a memory, and which was originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.
[0049] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0050] Flow Cell: A vessel having an enclosed flow channel where a reaction can be carried out, or a vessel having an area that is open to a surrounding environment and at which a reaction can be carried out. The vessel with an area may be referred to herein as an open wafer flow cell. Any example of the flow cell may include an inlet for delivering reagent(s) to the channel, and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0051] Flow channel: An area that is defined between two bonded or otherwise attached components or that is defined within a lane so that it is open to the surrounding environment. The flow channel can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned sequencing surfaces or a patterned sequencing surface and a lid, and thus may be in fluid communication with one or more components of the sequencing surface(s).
[0052] Fragment: A portion or piece of the DNA sample. A “partially adapted fragment” is a portion or piece of the DNA sample that has been tagmented, and thus includes an adapter ligated to the 5’ end of the DNA fragment. A “fully adapted fragment” is a portion or piece of the DNA sample that has adapters incorporated at both the 3’ and 5’ ends of the DNA fragment.
[0053] Fragmentation: The breaking of nucleic acid into shorter lengths. Fragmentation methods include enzymatic methods, physical methods (including sonication, nebulization, needle shearing, microwave, etc.), and chemical methods(including depurination, hydrolysis, etc.). The terms “fragmenting enzymes” or “enzyme-based fragmentation” or “enzyme fragmentation,” as used herein, refer to enzymes that fragment nucleic acids. The enzymes can be a single enzyme or two or more enzymes that work together to fragment the nucleic acid. Some enzymes work on single stranded nucleic acid whereas others work on double stranded nucleic acid and yet others work on one strand of a double stranded nucleic acid. Fragmenting enzymes can cut the nucleic acid randomly or specifically. Examples of fragmenting enzymes include transposase, restriction enzymes, Argonaute, CRISPR -associated nuclease (Cas), endonucleases, exonuclease, topoisomerase, FRAGMENTASETM(New England Biolabs, Ipswich, MA). Preferred fragmentation embodiments include methods that fragment while retaining proximity information of the fragments.
[0054] Nanoballs: A concatemer comprising multiple copies of a target nucleic acid molecule. Rolling circle amplification / replication can be used to form nucleic acid nanoballs. These nucleic acid copies may be arranged one after another in a continuous linear strand of nucleotides. These nucleic acid copies may result in a nanoball folding configuration. The multiple copies of the target nucleic acid molecule in a nucleic acid nanoball may each contain an adaptor sequence of known sequence to facilitate amplification or sequencing. The adaptor sequence of each target nucleic acid molecule may be the same or different. The nucleic acid nanoball can be loaded on the surface of a solid support. The nanoball can be attached to the surface of the solid support by any suitable method. Examples of such methods include nucleic acid hybridization, biotin streptavidin binding, thiol binding, photoactive binding, covalent binding, antibody-antigen, physical constraints via hydrogels or other porous polymers, etc., or combinations thereof. In some cases, the nanoball can be digested with an enzyme (nuclease, etc.) to produce a smaller nanoball or a fragment from the nanoball.
[0055] Orthogonal: When used to describe two functional groups or two cleaving chemistries, the term orthogonal means that the groups or chemistries are different from each other. Orthogonal functional groups, such as the focal point and the peripheral groups of the same dendron, are capable of reacting with different functional groups, e.g., an azide may be reacted with an alkyne or DBCO(dibenzocyclooctyne) while an amino reacted with an activated carboxylate group or an N-hydroxysuccinimide (NHS) ester. Orthogonal cleaving chemistries are susceptible to different cleaving agents so that the first cleaving chemistry is unaffected when exposed to the cleaving agent for the second cleaving chemistry, and the second cleaving chemistry is unaffected when exposed to the cleaving agent for the first cleaving chemistry.
[0056] Patterned / Random: In some examples, the solid support comprises a patterned surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in an ordered pattern. A “patterned surface” refers to an arrangement of different regions or features in or on an exposed layer of a solid support. The features can be separated by interstitial regions that contribute to the pattern. In some examples, the interstitial regions can be a different height, creating wells or raised platform patterns. In other examples, the interstitial regions can have different surface charges. In yet other examples, the interstitial regions can have different attachment moieties. In some examples, the pattern can be any suitable pattern, such as a grid patterns, radial patterns, and combinations thereof. In some examples, a patterned surface can contain pre-determined locations of features but the features are not arrayed in a repetitive pattern. Examples of grid patterns include rectangular patterns, hexagonal patterns, triangular patterns, and other suitable grid patterns. The regions for immobilization of molecules may be depressed regions, elevated regions, or planar regions relative to the interstitial regions. The regions may be fabricated as is generally known in the art using a variety of techniques, including, but not limited to, photolithography, stamping techniques, molding techniques, microetching techniques, and combinations thereof. As will be appreciated by those in the art, the technique used will depend on the composition and shape of the regions. For example, the regions for immobilization of molecules of a patterned surface may be wells, pits, channels, posts, pillars, ridges, stripes, swirls, lines, and other suitable topographies. For example, the wells may have any opening in any shape, such as circular, oval, polygonal (e.g., hexagonal, octagonal, square, rectangular, elliptical, etc.). Exemplary patterned surfaces that can be used in the methods andcompositions set forth herein are in U.S. Pat. No.8,778,849 B2, which is incorporated herein by reference in its entirety.
[0057] In some examples, the solid support comprises a surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in a random distribution over the solid support. Exemplary random distribution over a solid support is described in U.S. Pat. No.8,241,573 B2, which is incorporated herein by reference in its entirety.
[0058] Polonies: Some embodiments further comprise rolling circle amplification / replication used to form polonies. The term “polony” or “polonies” used herein refers to a nucleic acid library molecule clonally amplified in-solution or on- support to generate an amplicon that can serve as a template molecule for sequencing. In some aspects, a linear library molecule can be circularized to generate a circularized library molecule, and the circularized library molecule can be clonally amplified in-solution or on-support to generate a concatemer. In some aspects, the concatemer can serve as a nucleic acid template molecule which can be sequenced. The concatemer is sometimes referred to as a polony. In some aspects, a polony includes nucleotide strands.
[0059] Primer: A single stranded nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a fragment. As one example, a flow cell surface bound primer can serve as a starting point for fragment amplification and cluster generation. As another example, a flow cell surface bound primer can serve as a hybridization point for a spatial tag, and thus for targeting attachment of particular transposome complexes and DNA samples. As still another example, a primer (e.g., a sequencing primer) may be introduced that can hybridize to fragments or fragment amplicons in order to prime synthesis of a new strand that is complementary to the fragments or fragment amplicons. Any primer can include any combination of nucleotides or analogs thereof. In some examples, the primer is a single-stranded oligonucleotide or polynucleotide. The primer length can be any number of bases long. In an example, each of the flow cell surface bound primer and the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0060] Sequencing Procedures: term “read” or “sequence read” (or sequencing reads) refers to a sequence obtained from a portion of a nucleic acid sample. A read may be represented by a string of nucleotides sequenced from any part or all of a nucleic acid molecule. Typically, though not necessarily, a read represents a short sequence of contiguous base pairs in the sample. The read may be represented symbolically by the base pair sequence (in A, T, C, or G) of the sample portion. It may be stored in a memory device and processed as appropriate to determine whether it matches a reference sequence or meets other criteria. A read may be obtained directly from a sequencing apparatus or indirectly from stored sequence information concerning the sample. In some cases, a read is a DNA sequence of sufficient length (such as at least about 25 bp) that can be used to identify a larger sequence or region, for example, that can be aligned and specifically assigned to a chromosome or genomic region or gene. For example, a sequence read may be a short string of nucleotides (such as 20-150 bases) sequenced from a nucleic acid fragment, a short string of nucleotides at one or both ends of a nucleic acid fragment, or the sequencing of the entire nucleic acid fragment that exists in the biological sample. Sequence reads may be obtained by any method known in the art. For example, a sequence read may be obtained in a variety of ways, such as using sequencing techniques or using probes, such as in hybridization arrays or capture probes, or amplification techniques.
[0061] Embodiments described herein can be used with any suitable sequencing chemistry, such as sequencing by synthesis (SBS), sequencing by binding, sequencing by ligation, or nanopore sequencing.
[0062] SBS can be performed with or without the use of reversible terminators. For example, SBS can be initiated by contacting the target nucleic acids with one or more nucleotides (e.g., labeled, synthetic, modified, or a combination thereof), DNA polymerase, etc. Those features where a primer is extended using the target nucleic acid as the template will incorporate a labeled nucleotide that can be detected. The incorporation time used in a sequencing run can be significantly reduced using altered polymerases. Optionally, the labeled nucleotides can further include a reversible termination property that terminates further primer extension once a nucleotide hasbeen added to a primer. For example, a analog having a reversible terminator moiety can be added to a primer such that subsequent extension cannot occur until a deblocking agent is delivered to remove the moiety. Thus, for embodiments that use reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washes can be carried out between the various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with an array produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 2004 / 018497 A2; WO 1991 / 006678 A1; WO 2007 / 123744 A1; U.S. Pat. Nos.7,057,026 B2, 7,329,492 B2, 7,211,414 B2, 7,315,019 B2, 7,405,281 B2, and 8,343,746 B2. Sequence reads can be generated using instruments such as MINISEQ™, MISEQ™, NEXTSEQ™, HISEQX™, and NOVASEQ™ sequencing instruments from Illumina, Inc. (San Diego, CA).
[0063] One example of SBS is termed sequencing by binding. One implementation of sequencing by binding includes cycles of initiating sequencing of a template with a reversible blocker on the 3’ end to prevent additional bases from incorporating, interrogating the template by flooding the flow cell with fluorescently tagged bases that do not include a blocker and measuring an emitted signal of bound bases, activating the 3’ end via removal of the reversible blocker, and incorporating the complementary base from unlabeled, blocked nucleotides. Reads using sequencing by binding can be generated from using instruments such as OnsoTMsequencing instruments from Pacific Biosciences of California, Inc. (Menlo Park, CA). Another implementation of sequencing by binding could be sequencing by avidity. In sequencing by avidity, fluorescent dye labeled cores termed avidites are used. One potential cycle of sequencing by avidity includes providing a reagent of polymerase and reversibly terminated nucleotides to templates immobilized on a solid surface, de- blocking the incorporated nucleotides, flowing a set of four types of avidites, washing away unbound avidites, detecting the incorporated bases / nucleotides, and removing the bound avidites. The steps in the cycle of sequencing by avidity may be performedin other orders. Sequencing by avidity is in Arslan, S., Garcia, F.J., Guo, M. et al. “Sequencing by avidity enables high accuracy with low reagent consumption.” Nat Biotechnol 42, 132–138 (2024). https: / / doi.org / 10.1038 / s41587-023-01750-7, which is incorporated by reference in its entirety. Reads using sequencing by avidity can be generated using instruments such as AvitiTMsequencing instruments from Element Biosciences (San Diego).
[0064] One example of SBS using an open flow cell and without using reversible terminators is disclosed in Almogy, G. (2022) “Cost-efficient whole genome- sequencing using novel mostly natural sequencing-by-synthesis chemistry and open fluidics platform” https: / / doi.org / 10.1101 / 2022.05.29.493900, which is incorporation by reference in its entirety. Sequence reads using an open flow cell can be generated using instruments such as UG 100TM Sequencer from Ultima Genomics, Inc. (Fremont, CA).
[0065] Some SBS embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are described in U.S. Pat. Nos.8,262,900 B2, 7,948,015 B2, 8,349,167 B2, and U.S. Pat. Pub.2010 / 0137143 A1, each of which is incorporated by reference in its entirety.
[0066] Sequence reads can be generated using instruments such as DNBSEQTM sequencing instruments from MGI Tech Co., Ltd. (Shenzhen, China) and as SURFSeqTM, FASTASeqTM, and GenoLabTMsequencing instruments from GeneMind Biosciences Co., Ltd. (Shenzhen, China).
[0067] Some examples can use methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and γ-phosphate-labeled nucleotides, or with zeromode waveguides. Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett.33, 1026-1028 (2008); Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), each of which is incorporated by reference in its entirety.Techniques that sequence using waveguides are described in U.S. Pat. No. 6,917,726 B2, which is incorporated by reference in its entirety.
[0068] Solid Support: The terms “solid support,” “solid surface,” and other grammatical equivalents herein refer to any substrate that is appropriate for or can be modified to be appropriate for the attachment of enzymes, nucleic acids, and complexes thereof. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include, but are not limited to, glass and modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (e.g., TEFLONTMfrom Chemours), polyamides (i.e., nylon)) etc.), polysaccharides, nitrocellulose, ceramics, resins, silica or silica- based materials including silicon and modified silicon, carbon, metals, optical fiber bundles, quartz, metal oxides, inorganic oxides, other suitable transparent materials, other suitable non-transparent materials, other suitable translucent materials, and combinations thereof. The composition and geometry of the solid support can vary with its use.
[0069] In some embodiments, the solid support or solid surface is a planar structure, such as a flow cell, slide, chip, microchip, array, microarray, wafer, panel, charge pad, and / or web. The planar structure can be a single surface structure having a single surface of sample / reaction sites. The planar structure can be a dual surface structure. One example of a dual surface structure includes a top substrate having a top surface of sample / reactions sites, a bottom substrate having a bottom surface of sample / reactions sites, and a spacer layer separating the top substrate and the bottom substrate. The solid support or solid surface can be open to direct application of a fluid. One example of an open solid support or open solid surface is an open flow cell having a single surface structure without an inlet port. In some embodiments, the solid support is not necessarily planar, such as, for example, the surface of a well, tube, or other vessel. Nonlimiting examples include the surface of a microcentrifuge tube, a well of a multiwell plate, and the like.
[0070] In some embodiments, the solid support comprises one or more surfaces of a flowcell or flow cell. In accordance with definition set forth herein, the term“flowcell” or “flow cell” refers to a solid across which one or more fluid reagents can be flowed. Examples of flow cells and related fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 2004 / 018497 A2; U.S. Pat. No.7,057,026 B2; WO 1991 / 06678 A1; WO 2007 / 123744 A2; U.S. Pat. No.7,329,492 B2; U.S. Pat. No.7,211,414 B2; U.S. Pat. No.7,315,019 B2; U.S. Pat. No.7,405,281 B2, and U.S. Pat. Pub.2008 / 0108082 A1, each of which is incorporated herein by reference in its entirety. In some embodiments, the flow cells can be one or more flow lanes. For flow cells having a plurality of flow lanes, each of the flow lanes can be independently accessed or two or more flow lanes can be accessed as a group.
[0071] In some embodiments, the solid support or solid surface is a non-planar structure, such as beads, microspheres, and / or inner and / or outer surface of a tube or vessel. The terms “beads”, “microspheres,” or “particles” or grammatical equivalents herein refer to small discrete particles. Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphite, titanium dioxide, latex, polysaccharide (e.g., DEXTRANTM, SEPHAROSETM, cellulose), polyamides, cross- linked micelles, TEFLONTM, as well as any other materials outlined herein for solid supports may all be used. “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind. is a helpful guide. In certain embodiments, the microspheres are magnetic microspheres or beads. The beads need not be spherical; as irregular particles may be used. Alternatively or additionally, the beads may be porous. The bead sizes range from nanometers, i.e.100 nm, to millimeters, i.e.1 mm, with beads from about 0.2 micron to about 200 microns being preferred, and from about 0.5 to about 5 micron being particularly preferred, although in some embodiments smaller or larger beads may be used.
[0072] Tagmentation: A process in which the DNA sample is cleaved / fragmented and tagged (e.g., with the adapter(s)) for analysis. Tagmentation is an in vitro transposition reaction.
[0073] Transferred and Non- Strands: The term “transferred strand” refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term “non-transferred strand” refers to a sequence that includes the non- transferred portion of a transposon end. The 3’-end of a transferred strand is joined or transferred to a double stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to the double stranded fragment during tagmentation. In an example, the transferred and non-transferred strands include at least partially complementary portions that are covalently bound together.
[0074] Transposase or Transposase Enzyme: An enzyme that is capable of forming a functional complex with a transposon end-containing composition (e.g., transposons, transposon ends, transposon end compositions) and catalyzing insertion or transposition of the transposon end-containing composition into the double-stranded DNA sample with which it is incubated, for example, in the in vitro transposition reaction (i.e., tagmentation). A transposase as presented herein can also include integrases from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposase that is capable of inserting a transposon end with sufficient efficiency to 5’-tag and fragment the DNA sample for its intended purpose can be used.
[0075] Transposome or Transposome Complex: An entity formed between a transposase enzyme and a nucleic acid. Typically, the nucleic acid is a double stranded nucleic acid including a transposase integration recognition site. As an example, the transposome complex can be the product of incubating a transposase enzyme with double-stranded transposon DNA under conditions that support non- covalent complex formation. Double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions or other double-stranded DNAs capable of interacting with a transposase, such as the hyperactive Tn5 transposase.
[0076] Transposon End: A double-stranded nucleic acid strand that exhibits only the nucleotide sequences (the “transposon end sequences”) that are necessary to form the complex with the transposase that is functional in tagmentation. The double-stranded nucleic acid strand of the end can include any nucleic acid or nucleic acid analogue suitable for forming the functional complex with the transposase. For example, the transposon end can include natural DNA or DNA analogs (with modified bases and / or backbones), and can include nicks in one or both strands. Transposases, transposomes and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Pat. Pub. 2010 / 0120098 A2, which is incorporated herein by reference in its entirety. Although many embodiments described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposition system that is capable of inserting a transposon element with sufficient efficiency to tag a target nucleic acid can be used. In particular examples, a preferred transposition system is capable of inserting the transposon element in a random or in an almost random manner to tag the target nucleic acid.
[0077] Transposomes
[0078] Some of the examples set forth herein utilize tagmentation to generate fully adapted DNA sample fragments that are then amplified. During tagmentation, transposomes are used to fragment and ligate adapters to a DNA sample. Different example transposomes are depicted in Fig.1A and Fig.1B.
[0079] The transposomes 10A shown in Fig.1A or the transposomes 10B and 10C shown in Fig.1B used in the examples disclosed herein form dimers in solution. An example of the dimer 90 is shown in Fig.1B, although it is to be understood that the transposome 10A shown in Fig.1A is also capable of forming a dimer with another transposome 10A. In any of the examples set forth herein, at least one of the transposomes 10A, 10B, 10C in the dimer formation is capable of attaching to the dendron or the DNA origami as described herein. The dimers 90 that form may include a mixture of homo-dimers (e.g., 10A-10A or 10B-10B or 10C-10C) or hetero- dimers (10B-10C, as shown in Fig.1B). The dimers that will form depend upon the method used. In one example, the transposome complexes 10A or 10B and 10C are mixed in solution to form the dimers. Depending upon the complexes 10A or 10B and 10C included in the solution, homo-dimers and / or hetero-dimers may be formed. For example, if the complexes 10A or 10B or 10C are included in solution, homo-dimers ofthe complex 10A or 10B or 10C will if the complexes 10B and 10C are included in solution, homo-dimers of each complex 10B or 10C and hetero-dimers of both complexes 10B and 10C will form. The pre-formed dimers are then used in the methods disclosed herein. It is to be further that some transposome complexes 10A, 10B, 10C in any given solution may not dimerize, and these individual transposome complexes 10A, 10B, 10C can attach to the solid support. The monomeric transposome complex(es) 10A, 10B, 10C will not participate in tagmentation.
[0080] In the example of Fig.1A, the transposome 10A includes a transposase enzyme 12 non-covalently bound to a transposon end 14A. Each transposon end 14A is a double-stranded nucleic acid strand, one strand ME of which is part of a transferred strand 16A and the other strand ME’ of which is part of a non-transferred strand 18A. In other words, the transposon end 14A includes a portion of the transferred strand 16A that is hybridized to a portion of the non-transferred strand 18A.
[0081] In this example, the hybridized transferred and non-transferred strands 16A, 18A form a forked adapter.
[0082] In the example shown in Fig.1A, the transferred strand 16A includes a 5’ end functional group 20 or a 5’ end attachment tag 44. While not shown, it is to be understood that in an alternate example, the transposome 10A could instead include a 3’ end functional group or a 3’ end attachment tag at the 3’ end of the non-transferred strand 18A. While the 5’ end functional group 20 and the 5’ end attachment tag 44 are discussed herein, it is to be understood that any examples of the 5’ end functional group 20 or the 5’ end attachment tag 44 may be used as the 3’ end functional group or the 3’ end attachment tag at the 3’ end of the non-transferred strand 18A. In some of the examples set forth herein, the 5’ end functional group 20 (or 3’ end functional group) is any functional group that is capable of covalently or non-covalently attaching to a single focal point of a dendron (see Fig.2A) or to an attachment point of a DNA origami structure (see Fig.8C). In one example, the focal point or attachment point is an azide or tetrazine group, and the 5’ end group 20 is a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). In another example, the focal point or attachment point is biotin, and the 5’ end functional group 20 is also biotin. In these examples,additional streptavidin or avidin is added indirectly attach the biotin groups to one another. In other of the examples set forth herein, the 5’ end attachment tag 44 is a nucleic acid sequence that is complementary to a flow cell surface primer (e.g., 28, 30, shown in Fig.6A and Fig.6B), and thus can attach the transposome 10A to the flow cell surface through hybridization.
[0083] In this example, the transferred strand 16A also includes a first amplification domain 22A, and a sequencing primer sequence 24 that is attached to one strand ME of the transposon end 14A. The strand ME of the transposon end 14A is positioned at the 3’ end of the transferred strand 16A.
[0084] In this example, the non-transferred strand 18A further includes a sequencing primer sequence 24’ (attached to the strand ME’) and a second amplification domain 26A.
[0085] The first amplification domain 22A has a different sequence than the second amplification domain 26A, but has the same sequence as one primer 28, 30 that is immobilized on the flow cell surface and that is used in amplification of the fully adapted DNA sample fragments described herein. The second amplification domain 26A is complementary to the other primer 30, 28 that is immobilized on the flow cell surface. It is to be understood that the first amplification domain 22A and the primer 28, together with the second amplification domain 26A and the primer 30, enable the amplification of the fully adapted DNA sample fragments generated during tagmentation.
[0086] Examples of the first amplification domain 22A and the primer 28 include the P5 and P15 sequences set forth herein, and examples of the second amplification domain 26A and the primer 30 include the P7 sequence and its complement P7’.
[0087] The P5 sequence is one of: P5 #1: 5’ → 3’ AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO.1); P5 #2: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.2)where “n” is inosine in SEQ. ID. NO.2; P5 #3: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.3) where “n” is alkene-thymidine (i.e., alkene-dT) in SEQ. ID. NO.3. The P5’ sequence is the complement of any of the P5 examples. The P7 sequence may be any of the following: P7 #1: 5’ → 3’ CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO.4); P7 #2: 5’ → 3’ CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO.5); or P7 #3: 5’ → 3’ CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO.6), where “n” is 8-oxoguanine in each of SEQ. ID. NOS.4-6. The P7’ sequence is the complement of any of the P7 examples.
[0088] It is to be understood that other sequences may be used for the amplification domains 22A, 26A (e.g., P5, P7’) and for the primers 28, 30 (e.g., P5, P7), as long as the combination enables the desired amplification. As such, the designations P5, P7’, and P7 are provided as examples, and the corresponding domains 22A, 26A and / or primers 28, 30 are not limited to the specific sequences set forth herein. As other examples, a P15, PA, PB, PC, or PD sequence may be used. The P15 sequence is: P15: 5’ → 3’(SEQ. ID. NO.7) where “n” is allyl-T (i.e., a thymine nucleotide analog having an allyl functionality). The other sequences (PA-PD) mentioned above include: PA 5’ → 3’ GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO.8) PB 5’ → 3’ CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO.9) PC 5’ → 3’ ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO.10) PD 5’ → 3’ GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO.11)
[0089] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site 32, such as uracil, 8- oxoguanine, allyl-T, diols, etc. at any point in the strand. The sequences for the first amplification domain 22A / primer 28 and for the second amplification domain 26A / primer 30 may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not susceptible to the cleaving agent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.
[0090] The primers 28, 30 may also include a polyT sequence at the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0091] Referring back to the 10A of Fig.1A, the sequencing primer sequences 24, 24’ have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell after the fully adapted DNA fragments have been introduced, seeded, and amplified. As examples, the sequencing primer sequences 24 may bind a sequencing primer that primes synthesis of a new strand that is complementary to forward strand fragments / fragment amplicons and the sequencing primer sequence 24’ may bind a sequencing primer that primes synthesis of a new strand that is complementary to reverse strand fragments / fragment amplicons.
[0092] The transposon end 14A of each transposome complex 10A includes the strands ME respectively hybridized to the strands ME’. As such, the strands ME, ME’ are complementary. The double stranded transposon end 14A is capable of complexing with the transposase 12. As examples, the strands ME, ME’ of the transposon end 14A may be the related but non-identical 19-base pair (bp) outer end (e.g., strand ME) and inner end (e.g., strand ME’) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strand ME) and the R2 end (strand ME’) recognized by the MuA transposase.
[0093] In Fig.1B, each of the transposomes 10B, 10C includes a transposase enzyme 12B, 12C non-covalently bound to a transposon end 14B, 14C. Each transposon end 14B, 14C is a double-stranded nucleic acid strand, one strand ME of which is part of a transferred strand 16B, 16C and the other strand ME’ of which is the non-transferred strand 18B, 18C. In this example then, the transposon end 14B, 14C includes a portion of the transferred strand 16B, 16C that is hybridized to the non- transferred strand 18B, 18C.
[0094] The transferred strand 16B is similar to the transferred strand 16A, in that it includes the strand ME positioned at the 3’ end, a sequencing primer sequence 24B attached to the strand ME, a first amplification domain 22B attached to the sequencing primer sequence 24B, and the 5’ end functional group 20 or the 5’ end attachment tag 44 attached to the first amplification domain 22B.
[0095] The transferred strand 16C the strand ME positioned at the 3’ end and a sequencing primer sequence 24C attached to the strand ME. The transferred strand 16C includes a second amplification domain 26C. In the depicted example, the transferred strand 16C does not include the 5’ end functional group 20. While a specific example of the positioning of the 5’ end functional group 20 or the 5’ end attachment tag 44 is shown in Fig.1B, it is to be understood that one or both of the transferred strands 16B or 16C could include the 5’ end functional group 20 or the 5’ end attachment tag 44. It is to be further understood that in an alternate example, the transposome 10B and / or 10C could instead include a 3’ end functional group or a 3’ end attachment tag at the 3’ end of the non-transferred strand 18B and / or 18C. Any of the example functional groups (for 20) or sequences (for 44) described in reference to Fig.1A may be used.
[0096] In the example of Fig.1B, the first and second amplification domains 22B, 26C of the respective transposomes 10B, 10C have different sequences from each other (e.g., P5 and P7), but have the same sequence, respectively, as first and second primers 28, 30 on the flow cell surface. The first amplification domain 22B and the primer 28 together with the second amplification domain 26C and the primer 30 enable the amplification of fully adapted DNA sample fragments. Examples of suitable sequences for the first amplification domain 22B and for the second amplification domain 26C may include any of the examples set forth herein for the primers 28, 30, as long as they form an amplification primer set. Each of the domains 22B, 26C includes a cleavage site 32B, 32C, such as uracil, 8-oxoguanine, allyl-T, diols, etc. at any point in the strand.
[0097] The sequencing primer sequences 24B, 24C have different sequences from each other that respectively bind to sequencing primers introduced into the flow cell after the fully adapted DNA fragments have been introduced, seeded, and amplified. As examples, the sequencing primer sequence 24B, 24C may bind a sequencing primer that primes synthesis of a new strand that is complementary to forward or reverse strand fragments / fragment amplicons.
[0098] As mentioned, the transposon end 14B, 14C includes the strands ME respectively hybridized to the strands ME’. Any examples of the strands ME, ME’ setforth herein may be used. In these 10B, 10C, the strands ME’ make up the respective non-transferred strands 18B, 18C.
[0099] While not shown in Fig.1A and Fig.1B, still other examples of the transposomes do not include either the 5’ end functional group or the 5’ end attachment tag 44. Rather, an attachment sequence may be incorporated into the non-transferred strand 18B or 18C (e.g., at the 3’ end). The attachment sequence is selected to be complementary to a sequence that is covalently attached to a focal point 36 of a dendron 34. The attachment sequence enables the transposome 10B, 10C to be hybridized to the dendron 34.
[0100] Molecular Scaffolds
[0101] Some of the methods disclosed herein use molecular scaffolds 40A, 40B, 40C as shown in Fig.2A, Fig.2B, and Fig.2C, respectively.
[0102] In the examples shown in Fig.2A and Fig.2B, the molecular scaffold 40A includes a dendron 34 having a single focal point 36 and a plurality of peripheral groups 38 opposed to the single focal point 36; a transposome dimer 90 attached to the single focal point 36; and a polymer chain 42 respectively attached to each of the plurality of peripheral groups 38. In one example, the transposome dimer 90 includes two of the transposomes 10A, or two of the transposomes 10B or 10C, or one of each of the two transposomes 10B and 10C.
[0103] The dendron 34 is a branched molecule that includes the single focal point 36 and repeating units, i.e., monomers, which extend, like branches or arms, from the single focal point 36. The repeating units form a tree-like or dendritic structure. At the end of each of the repeating units is the peripheral group 38. In Fig.2A and Fig.2B, the dendron 34 includes eight peripheral groups 38. It is to be understood, however, that the number of peripheral groups 38 included in the dendron 34 may range from 2 to 32. In these particular examples, the number of peripheral groups 38 depends, at least in part, on the desired number of polymer chains 42 to be attached, the size of the polymer chains 42, and the desired distance between adjacent molecular scaffolds 40A, 40B during tagmentation. Any dendrons 34 that are commercially available fromPolymer Factory may be used, as long single focal point 36 and the peripheral groups 38 are orthogonal as defined herein.
[0104] The repeating units of the dendron may be any suitable monomer or combination of monomers, such as those including amines, secondary amides, esters, ethers, acrylates, methacrylates (e.g., methoxypropyl acrylate), poly(ethylene glycol)s, or the like. In one example, the repeating units are peptides.
[0105] The chemical functionality of the focal point 36 of the dendron 34 is selected to be orthogonal to the chemical functionality of the peripheral groups 38. The orthogonality of the focal point 36 and the peripheral groups 38 enables the focal point 36 to be attached to the transposome 10A, 10B, or 10C without having any affinity to the polymer chains 42, and enables the peripheral groups 38 to be attached to the polymer chains 42 without having any affinity to the transposome 10A, 10B, or 10C.
[0106] As examples, the focal point 36 may include a functional group that is selected from the group consisting of an azide, an aryl azide, an amine, a norbornene, a tetrazole, a tetrazine, a sulfonyl fluoride, a thiol, an epoxy, a phosphine having at least two phenyl groups that are capable of undergoing a Staudinger reaction, an acrylate, an alkyne, a cyclooctyne based molecule that is capable of undergoing a strain-promoted alkyne-azide cycloaddition reaction, a cyclooctene based molecule that is capable of undergoing a strain-promoted alkyne-azide cycloaddition reaction or an inverse electron demand Diels Alder reaction, a terminal alkene, an activated ester, and an aryl fluorosulfate. In another example, biotin is added to the focal point 36 of the dendron 34. In any of these examples, each of the plurality of peripheral groups 38 includes a functional group that is selected from the group consisting of an azide, an aryl azide, an amine, a norbornene, a tetrazole, tetrazine, a sulfonyl fluoride, a thiol, an epoxy, a phosphine having at least two phenyl groups that are capable of undergoing a Staudinger reaction, an acrylate, an alkyne, a cyclooctyne based molecule that is capable of undergoing a strain-promoted alkyne-azide cycloaddition reaction, a cyclooctene based molecule that is capable of undergoing a strain- promoted alkyne-azide cycloaddition reaction or an inverse electron demand Diels Alder reaction, a terminal alkene, an activated ester, and an aryl fluorosulfate, as long as it is orthogonal to the focal point 36. It is to be understood that when one of thefocal point 36 or the peripheral groups (s) the cyclooctene based molecule, the focal point 36 or the peripheral groups 38 may be capable of undergoing the inverse electron demand Diels Alder reaction when the other of the peripheral groups 38 or the focal point 36 includes a tetrazine functionality.
[0107] In a specific example, the focal point 36 is, or has attached thereto, an azide or methyl tetrazine, the plurality of peripheral functional groups 38 is a plurality of amines, and the 5’ end functional group 20 of the transposome 10A, 10B, or 10C includes a BCN functional group that attaches to the focal point 36 via a click reaction. In another specific example, the focal point 36 has biotin or dual biotin attached thereto, the plurality of peripheral groups 38 is a plurality of azides, and the 5’ end functional group 20 of the transposome 10A, 10B, or 10C includes biotin that attaches to focal point 36 through added streptavidin.
[0108] As described, the focal point 36 of the dendron 34 is selected to be orthogonal to the plurality of peripheral groups 38 included in the dendron 34. Several suitable examples of orthogonal functionalities (e.g., for the focal point 36 and for the peripheral groups 38) are set forth in Table 1 below. For each of the given focal points 36, any of the peripheral groups 38 marked with an “X” may be used. The following key corresponds with Table 1 and / or Table 2: Az = azide; Am = amine; Tet = tetrazine; SuFl = sulfonyl fluoride (SuFEx reagent); T = thiol; E = epoxy; AE = activated ester; AF = aryl fluorosulfate; Alk = alkyne; PCP = phenyl-containing phosphine (Staudinger reagent); CO = cyclooctyne or cyclooctyne derivative (SPAAC reagent); Ac = acrylate; N = norbornene; and TA = terminal alkene. Table 1 Dendron Corresponding Orthogonal Peripheral Functional Group FocalAXXXAlk X X X X X X X X X XCO X X X X X X XAE X X X X X X X Xselected to be compatible (i.e., capable of bonding) with the polymer chain 42. Several suitable examples of compatible functionalities (e.g., for the peripheral groups 38 and for one end of the polymer chain 42) are set forth in Table 2. For each of the given peripheral groups 38, any of the end groups marked with an “X” may be used. Table 2 Peripheral End of Polymer Chain FunctionalAz Am N Tet SuFl T E PCP Alk CO AE AF
[0110] In some examples (see Fig.4), the opposed end of each polymer chain 42 (i.e., the end opposite the end that attaches to the peripheral group 38) includes a binding pair member. In this example, the binding pair member at the polymer chain end is capable of attaching to its corresponding binding pair member, which is attached at a surface of a non-patterned substrate 52. Any of the binding pairs disclosed herein may be used in this example.
[0111] The polymer chains 42 are selected to have a particular molecular weight. In an example, each polymer chain 42 has a molecular weight ranging from about 100 Daltons to about 110,000 Daltons. In other examples, each polymer chain 42 has a molecular weight ranging from about 100 Daltons to about 50,000 Daltons or from about 100 Daltons to about 1,000 Daltons. Such polymer chains 42 may becopolymers formed by reversible- chain-transfer (RAFT) polymerization. In one example, the polymer chains 42 are copolymers of dimethylacrylamide and PAG (propargyl acrylate).
[0112] The reaction by which the polymer chains 42 are attached to the peripheral groups 38 of the dendron 34 will depend upon the groups that are selected.
[0113] The size (or hydrodynamic radius) of the dendron 34 with the polymer chains 42 attached will depend upon the desired size of the DNA sample fragments after tagmentation. As an example, the size (or hydrodynamic radius) of the dendron 34 with the polymer chains 42 attached ranges from about 100 nm to about 1000 nm. To obtain a 600mer DNA sample fragment, the hydrodynamic radius of the dendron 34 with the polymer chains 42 attached may be about 200 nm.
[0114] In the example shown in Fig.2A, the transposome dimer 90 is attached to the focal point 36 through the 5’ end functional group 20 (or the 3’ end functional group, if used). This attachment may be covalent or non-covalent depending upon the focal point 36 and the 5’ end functional group 20. If both the focal point 36 and the 5’ end functional group 20 are biotin, avidin or streptavidin may be added to achieve the non-covalent attachment. Any of the example binding pairs set forth herein may be used as the focal point 36 and the 5’ end functional group 20. As some specific examples, the focal point 36 and 5’ end functional group 20 may be azide – alkyne, trans-cyclooctyne (TCO) – tetrazine, antibody – antigen, antibody – antibody, amine – NHS Ester, or EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) – NHS.
[0115] The covalent or non-covalent attachment between the focal point 36 and the 5’ end functional group 20 forms the molecular scaffold 40A.
[0116] In the example shown in Fig.2B, the transposome dimer 90 is hybridized to the single focal point 36. In this example, one of the transposomes 10A, 10B, 10C includes the attachment tag 44 rather than the 5’ end functional group 20. The length of the attachment tag 44 is at least 15 bases. The attachment tag 44 is an oligonucleotide sequence that is complementary to a target sequence 46, which is attached to the focal point 36. The hybridization of the attachment tag 44 and the target sequence 46 attaches the transposome dimer 90 to the dendron 34 to form the molecular scaffold 40B. While not shown in Fig.2B, it is to be understood that thetarget sequence 46 can attach to a attachment sequence other than the attachment tag 44, e.g., if the attachment sequence is incorporated into the non- transferred strand 18B or 18C (e.g., at the 3’ end) as opposed to as the attachment tag 44.
[0117] Referring now to Fig.2C, still another example of the molecular scaffold 40C is depicted. This example does not include the transposome dimer 90, but rather includes a nucleic acid adapter 48. As such, in this particular example, the molecular scaffold 40C includes the dendron 34’ having the single focal point 36’ and a plurality of peripheral groups 38’ opposed to the single focal point 36’; the nucleic acid adapter 48 attached to the single focal point 36’, the nucleic acid adapter 48 including an amplification domain sequence 22 or 26 and a sequencing primer sequence 24; and the polymer chain 42’ respectively attached to each of the plurality of peripheral groups 38’.
[0118] The dendron 34’, the single focal point 36’, the plurality of peripheral groups 38’, and the polymer chains 42’ may be, respectively, any of the examples set forth herein for the dendron 34, the single focal point 36, the plurality of peripheral groups 38, and the polymer chains 42’. Thus, the hydrodynamic radius and the polymer chain molecular weight may be any of the examples set forth herein.
[0119] The nucleic acid adapter 48 is a double stranded nucleic acid sequence that includes sequences similar to the transferred strands 16A, 16B, 16C described herein, such as sequencing primer sequences and amplification domain sequences (e.g., P5, P7 or complements thereof). The nucleic acid adapter 48 may also include index sequences. The amplification domain sequences of the nucleic acid adapter 48 may be selected based, in part, on the primers 28, 30 that are to be used in amplification of the fully adapted DNA sample fragments that are formed. In the example shown, the sequencing primer sequences are the complementary portions and the amplification domain sequences are non-complementary portions. Because the amplification domain sequences are not complementary, the nucleic acid adapter 48 is forked. The index sequences are positioned between the sequencing primer sequences and the respectively attached amplification domain sequences.
[0120] As shown in Fig.2C, the acid adapter 48 can be covalently or non- covalently attached to the single focal point 36’, for example, in a similar manner as described in reference to Fig.2A. Alternatively, the nucleic acid adapter 48 can be hybridized to the single focal point 36’, for example, in a similar manner as described in reference to Fig.2B.
[0121] This molecular scaffold 40C can be used in ligation-based library preparation methods.
[0122] Methods Involving Molecular Scaffolds
[0123] Two example methods disclosed herein utilize the molecular scaffold 40A or 40B. These examples are respectfully shown and described in reference to Fig.3 and Fig.4.
[0124] The method shown in Fig.3 is a solution based tagmentation method. This example method generally involves forming a suspension by introducing a plurality of molecular scaffolds 40A or 40B to a tagmentation buffer and introducing a DNA sample to the tagmentation buffer; and bringing the suspension to a tagmentation temperature, thereby tagmenting the DNA sample to form a plurality of partially adapted sample fragments.
[0125] Prior to forming the suspension, the method of Fig.3 may involve first generating the transposomes 10A or 10B and 10C and / or generating the molecular scaffold 40A or 40B.
[0126] To form the transposomes 10A or 10B and 10C, the respective transferred and non-transferred strands 16A, 18A or 16B, 18B and 16C, 18C may be formed using any suitable nucleic acid synthesis technique (where at least one of the strands 16A, 16B or 16C includes the group 20). The transferred and non-transferred strands 16A, 18A or 16B, 18B and 16C, 18C may be mixed together at a suitable hybridization temperature to hybridize the ME, ME’ strands. In one example, the hybridization temperature ranges from about room temperature (e.g., 18°C-22°C) to about 90°C. In another example, the hybridization temperature ranges from about 30°C to about 75°C. The transposase enzyme 12 or 12B and 12C may be added to form thetransposome 10A or 10B and 10C. The 90 will form when the completed transposomes 10A or 10B and / or 10C are mixed in solution.
[0127] To form the molecular scaffold 40A, the transposomes 10A or 10B and / or 10C (including the 5’ end functional group 20) or pre-formed dimers thereof are mixed with the dendron 34 having the polymer chains 42 attached thereto. In some instances, the focal point 36 is capable of covalently bonding to the 5’ end functional group 20, and thus this mixture is brought to conditions at which the covalent reaction can take place. In other instances, a suitable functional group is added to the focal point 36 of the dendron 34 via a suitable chemical reaction, and then the mixture is made and brought to conditions at which the reaction can take place between the added functional group at the focal point 36 and the 5’ end functional group 20. As one example, an azide or methyl tetrazine may be added to the focal point 36 and BCN may be used as the 5’ end functional group 20, and suitable conditions for covalently bonding these groups may include a copper (Cu) free click reaction. This is the example depicted in Fig.3. As another example, biotin may be added to the focal point 36 and biotin may be used as the 5’ end functional group 20, and suitable conditions for non-covalently bonding these groups may include adding streptavidin to the mixture and allowing it to incubate at room temperature.
[0128] To form the molecular scaffold 40B, the transposomes 10A or 10B and / or 10C (including the attachment tag 44) or pre-formed dimers thereof are mixed with the dendron 34 having the polymer chains 42 attached thereto and including the target sequence 46 attached to the focal point 36. The mixture is brought to a suitable hybridization temperature so that the complementary attachment tag 44 and target sequence 46 are able to hybridize.
[0129] A suspension is then formed by combining the plurality of the molecular scaffolds 40A or 40B with a tagmentation buffer. The tagmentation buffer may include water, an optional co-solvent (e.g., dimethylformamide), a metal co-factor for the transposase enzyme 12, 12B, 12C (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate salt, pH 7.6). In an example, the optional co-solvent may be present in an amount up to about 11%, the metal co-factor (Mg2+) may be present in a concentration ranging from about 3 mM to about 10 mM, and the buffer salt may be present in aconcentration ranging from about 7 mM 12 mM. In another example, the optional co-solvent may be present in an amount up to about 10%, the metal co-factor may be present in a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 10 mM.
[0130] The DNA sample 62 is also added to the tagmentation buffer.
[0131] The molecular scaffolds 40A or 40B and the DNA sample 62 may be added to the tagmentation buffer simultaneously or in any desired sequential order. Alternatively, the tagmentation buffer may be added to a mixture of the molecular scaffolds 40A or 40B and the DNA sample 62.
[0132] The suspension is then brought to the tagmentation temperature to initiate fragmentation and ligation of the DNA sample 62. Tagmentation, including fragmentation and ligation, may take place at a temperature at or above 30°C. In one example, the tagmentation temperature may range from 30°C to about 55°C. In another example, the tagmentation temperature may range from 35°C to about 45°C. In the presence of the tagmentation buffer and with the temperature brought to the tagmentation temperature, the DNA sample 62 is fragmented and the 5’ ends of both strands of the duplex fragment are ligated to respective 3’ ends of the transferred strands 16B, 16C of the transposomes 10B, 10C (or the transferred strands 16A when the transposome 10A is utilized). Tagmentation forms partially adapted DNA sample fragments because adapters (from the transferred strands 16A, 16B, 16C) are introduced to only the 5’ ends of the fragmented strands. As depicted in Fig.3, multiple tagmentation events can take place along the DNA sample 62.
[0133] As depicted in Fig.3, the dendrons 34 with the polymer chains 42 attached introduce steric hindrance such that the transposome dimers 90 are separated by a minimal threshold distance that is defined by the size of the dendron 34 and the polymer chains 42. The dendron 34 acts as a steric barrier to prevent two or more of the transposome dimers 90 from juxtaposing any closer than the minimum threshold distance, which is determined, at least in part, by the size of the dendron 34 with the polymer chains 42. Such an array of transposome dimers 90 reduces the likelihood that undesirably small, partially adapted DNA sample fragments will form, thusincreasing the yield of larger partially DNA sample fragments and reducing the dispersity of the suspension.
[0134] When tagmentation has been allowed to proceed for a desirable amount of time (e.g., from about 2 minutes to about 15 minutes), the method further includes introducing a reaction inhibitor to the solution, thereby stopping tagmentation of the DNA sample 62. In an example, the reaction inhibitor is sodium dodecyl sulfate (SDS). In an example, a 0.1% SDS solution is used. The reaction inhibitor can remove the transposase enzyme 12, 12B, 12C.
[0135] The liquid components of the suspension can then be replaced with a reagent that facilitates the generation of fully adapted DNA sample fragments. The fully adapted DNA sample fragments have adapters at both ends of the fragment strands.
[0136] When the transposome 10A is used, the formation of the fully adapted DNA sample fragments is accomplished using gap fill ligation. As such, some examples of the method further include initiating a gap fill ligation reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments. Gap fill ligation may be performed with any suitable gap fill ligation enzyme (e.g., tTaq608 polymerase, T7 exo minus polymerase, etc.) and any suitable ligase (e.g., E. coli DNA ligase, T4 DNA ligase, etc.), in combination with a solution of nucleotides. Gap fill ligation may take place at a temperature ranging from about 37°C to about 50°C for about 5 minutes.
[0137] When the transposomes 10B and 10C are used, the formation of the fully adapted DNA sample fragments is accomplished using an extension reaction. The extension reaction may be performed with an extension mix including nucleotides, a polymerase, and a buffer agent. The buffer agent may include any neutral buffer (e.g., Tris(hydroxymethyl) aminomethane (Tris or TRIS) buffers, such as Tris-HCl or Tris- EDTA, or a carbonate buffer (e.g., 0.25 M to 1 M)), as well as a stabilizer (e.g., ammonium sulfate and / or betaine), a metal co-factor (e.g., Mg2+), a surfactant (e.g., TWEEN polysorbates, TRITON™ X-100 (a non-ionic surfactant from Dow)), and / or a co-solvent (e.g., dimethylsulfoxide). An example extension mix includes from about 0.1 mM to about 0.5 mM of the nucleotides, from about 155 U / mL to about 165 U / mLof the polymerase, from about 15 mM to 25 mM of the neutral buffer, from about 1.8 M to about 2.2 M of the stabilizer(s) (e.g., about 10 mM ammonium sulfate and / or about 2M betaine), from about 2 mM to about 5.5 mM of the metal co-factor, from about 0.1% to about 0.4% of the surfactant, and from about 1.0% to about 2.0% of the co-solvent.
[0138] To initiate the extension reaction, the extension mix is added to the tagmented DNA sample 62. The temperature for the extension reaction may be about 38°C.
[0139] The non-transferred strands 18B, 18C may displaced during extension by a strand displacing polymerase, which allows the transferred strands 16B, 16C to be copied, thus forming fully extended (fully adapted) DNA sample fragments. During the extension reaction, additional sequences (adapters) are added to the 3’ ends of partially adapted DNA fragments. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the partially adapted DNA fragments using the respective transferred strands 16B, 16C as the template. As such, one DNA fragment is extended along the transferred strand 16B to generate complementary sections of the sequencing primer sequence 24B and the first amplification domain 22B, and the other DNA fragment is extended along the transferred strand 16C to generate complementary sections of the sequencing primer sequence 24C and the second amplification domain 26C. The sequences resulting from the extension reaction render the partially adapted fragments fully adapted and ready for further amplification and cluster generation. The fully adapted DNA sample fragments that are generated via the extension reaction respectively include i) the first amplification domain 22B at one end (5’ end) and a complement of the second amplification domain 26C at the other end (3’ end), and ii) the second amplification domain 26C at one end (5’ end) and a complement of the first amplification domain 22B at the other end (3’ end).
[0140] Whether gap fill ligation or the extension reaction is performed, the resulting fully adapted DNA sample fragments are attached to the dendron 34 (via the transferred strands 16A, 16B, or 16C of the transposome 10A, 10B, or 10C attached to the focal point 38).
[0141] The method shown in Fig.3 includes releasing the plurality of fully adapted sample fragments from the plurality of molecular scaffolds 40A or 40B.
[0142] In one example, the fully adapted DNA fragments may be released by introducing a suitable cleaving agent for the cleavage site 32, 32B, 32C. As examples, uracil can be cleaved by Uracil-DNA glycosylase (UDG), inosine can be cleaved by Endo IV, 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol linkages can be cleaved by oxidation, such as treatment with a periodate reagent. It is to be understood that other enzymatic methods may be used to cleave the fully adapted fragments. Following cleavage, the cleaved fully adapted DNA fragments may be denatured to form single stranded, fully adapted DNA sample fragments. In an example, denaturing takes place in NaOH and Tris HCl or heat (e.g., at about 90°C).
[0143] When the molecular scaffold 40B is used, the fully adapted sample fragments may be released by denaturing the attachment tag 44 and the target sequence 46. Denaturing may be performed as described herein, and this process will also denature the fully adapted DNA fragments to form single stranded, fully adapted DNA sample fragments.
[0144] In another example, PCR could be used to release the fully adapted DNA fragments. In still another example where the fully adapted DNA fragments are attached via biotin-streptavidin interaction, free biotin may be used to initiate competition with the biotin-streptavidin attachment.
[0145] The single stranded, fully adapted DNA sample fragments may be introduced to a flow cell 51 including corresponding primers 28, 30 for amplification and sequencing, as will be described in reference to Fig.5, Fig.6A, and Fig.6B.
[0146] The method shown in Fig.4 is a surface based tagmentation method. This example method generally involves introducing the plurality of each of first reactive entities 56 and second reactive entities 56’ to a non-patterned substrate 52, whereby at least some of the first reactive entities 56 respectively attach to the non-patterned substrate 52 and introduce a first binding pair member 58 to the at least the portion of the non-patterned substrate 52, and at least some of the second reactive entities 56’ respectively attach to the non-patterned substrate 52 and introduce a second bindingpair member 59 to the at least the the non-patterned substrate 52; introducing, to the non-patterned substrate 52, a plurality of particles 60 respectively including another first binding pair member (not shown), whereby at least some of the plurality of particles 60 become bound at the at least the portion of the non-patterned substrate 52; introducing, to the non-patterned substrate 52, a plurality of the molecular scaffolds 40A, 40B, whereby at least some of the molecular scaffolds 40A, 40B diffuse through spaces between the at least some of the plurality of particles 60 and respectively attach to the second binding pair member 59; and performing tagmentation of a DNA sample 62 on the non-patterned substrate52 utilizing the transposome dimers 90 (including complexes 10A or 10B and / or 10C) of the at least some of the molecular scaffolds 40A, 40B.
[0147] This method utilizes an example of a non-patterned substrate 52. The non- patterned substrate 52 may be a single layered material with a substantially flat surface. It is to be understood that the non-patterned substrate 52 may alternatively have a lane defined therein. An example of a lane 68 is depicted in Fig.6A. A lane 68 may be desirable in the non-patterned substrate 52 to aid in confinement of particles 60 introduced during the method.
[0148] Examples of suitable materials for the single layered non-patterned substrate 52 include epoxy siloxane, glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceramics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, mica, or the like.
[0149] The first reactive entities 56 and second reactive entities 56’ that are introduced to the non-patterned substrate 52 respectively include the first binding pair member 58 and the second binding pair member 59. These reactive entities 56, 56’ introduce dual functionalization to the non-patterned substrate 52. The first bindingpair member 58 is one member of a pair with another member that is coated on the particles 60. The second binding pair member 59 is one member of a binding pair with another member that is attached at the terminal end of the polymer chain 42 of the molecular scaffold 40A, 40B. Example binding pairs include azide – alkyne, trans-cyclooctyne (TCO) – tetrazine, streptavidin – biotin, aptamer – protein, aptamer – aptamer, antibody – antigen, antibody – antibody, nickel – histidine tag, amine – NHS Ester, metal – ligand, protein – ligand (e.g., streptavidin-biotin), complementary DNA oligomers (similar to the spatial tag and target primers disclosed herein), lectin – carbohydrate, affinity tags (e.g., His-tag, FLAG-tag), or molecularly imprinted polymers (MIPs). It is to be understood that the first and second binding pairs may be selected from any of these examples, as long as the first and second binding pair members 58, 59 are orthogonal, such that the particles 60 cannot attach to the second binding pair member 59 and the molecular scaffolds 40A, 40B cannot attach to the first binding pair member 58.
[0150] Each of the first and second reactive entities 56, 56’ is also capable of attaching to the surface of the non-patterned substrate 52. Thus, at the ends opposite the first and second binding pair members 58, 59, the first and second reactive entities 56, 56’ include substrate reactive groups. These substrate reactive groups are capable of reacting with functional groups at the surface of the non-patterned substrate 52 to introduce the reactive entities 56, 56’ thereto. In an example, the substrate reactive groups are silanes.
[0151] Examples of the first and second reactive entities 56, 56’ include APTMS (amino propyl trimethoxy silane) as the entity 56 and norbornene silane as the entity 56’. In this particular example, the silanes can react with a glass or silica non- patterned substrate 52, while the amino group is the first binding pair member 58 and the norbornene is the second binding pair member 59.
[0152] The plurality of particles 60 is then deposited on the non-patterned substrate 52 (now having dual functionalization). The other member of the first binding pair is coated on the particles 60, and thus the first binding pair member 58 enables the particles 60 to attach to the surface of the non-patterned substrate 52. In oneexample, the particles 60 are coated acid groups, each of which is a binding pair with an amino group (as the first binding pair member 58).
[0153] Example materials that are useful for the particles 60 include, glass, such as modified or functionalized glass; plastic, such as acrylic, polystyrene or a copolymer of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or polytetrafluoroethylene (e.g., TEFLON™ from DuPont); polysaccharides or cross-linked polysaccharides, such as agarose or Sepharose; polyamide; nitrocellulose; resin; silica; silicon and modified silicon; carbon-fiber; or metal. Example beads include controlled pore glass beads, paramagnetic beads, thoria sol, and Sepharose beads. The body of the particle 60 can have a shape characterized, for example, as a sphere, oval, microsphere, or other recognized particle shape whether having regular or irregular dimensions.
[0154] Surface bead self-assembly techniques may be used to generate a single layer of the particles 60, as shown in Fig.4. When the carboxylic acid-functionalized particles 60 are self-assembled on the surface of the non-patterned substrate 52, a peptide coupling step may be performed to covalently anchor the particles 60 onto the surface. The peptide coupling step may involve the introduction of 1-Ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDC), or another coupling reagent, such as hexafluorophosphate benzotriazole tetramethyl uronium (HBTU), 4-(4,6-dimethoxy- 1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), (2-Succinimido-1,1,3,3- Tetramethyluronium Tetrafluoroborate) (TSTU), and (benzotriazol-1- yloxytripyrrolidinophosphonium hexafluorophosphate) (PyBOP).
[0155] Any non-bound particles 60 may then be removed.
[0156] The plurality of molecular scaffolds 40A or 40B are then deposited on the non-patterned substrate 52 having dual functionalization. In an example, the plurality of molecular scaffolds 40A or 40B may be added to a liquid carrier and the liquid carrier may be applied to the non-patterned substrate 52 using any suitable deposition technique. Examples of the liquid carrier include a glycerol buffer or a storage buffer.
[0157] The molecular scaffolds 40A or 40B diffuse through spaces between the particles 60 that are bound to the non-patterned substrate 52. Some examples of the molecular scaffolds 40A or 40B are colloidal in nature, and thus uniformly diffusethrough spaces between the particles may take place at a temperature ranging from about room temperature to about 40°C. If a higher temperature is desirable, it is to be understood that the temperature selected should not deleteriously affect the transposomes 10A, 10B, 10C.
[0158] The molecular scaffolds 40A or 40B that diffuse through the spaces are capable of attaching to the non-patterned substrate 52 through the second binding pair member 59. The other member of the second binding pair is attached at a terminal end of each polymer chain 42 of the scaffold 40A, 40B, and thus the second binding pair member 59 enables the scaffolds 40A, 40B to attach to the surface of the non- patterned substrate 52. In one example, the terminal end of each polymer chain 42 is an azide group, which is a binding pair with a strained alkyne group (as the second binding pair member 59). The click reaction between the azide groups of the scaffolds 40A, 40B and the strained alkyne groups of the reactive entities 56’ may be heat triggered.
[0159] In an example, the molecular scaffold 40A or 40B, and in particular the dendron 34, may be synthesized so that its size corresponds with the space between adjacent particles 60. This enables one molecular scaffold 40A, 40B to diffuse into the space and attach to the non-patterned substrate through the second binding pair.
[0160] Any non-bound molecular scaffolds 40A or 40B may be removed.
[0161] The transposome dimers 90 are accessible through these spaces. The particles 60 help to equally space the bound molecular scaffolds 40A or 40B, which promotes a narrower size distribution of the DNA sample fragments resulting from tagmentation.
[0162] In some examples of the method, the non-patterned substrate 52 is exposed to a wash solution after each of: the introduction of the plurality of first and second reactive entities 56, 56’, the introduction of the plurality of particles 60, and the introduction of the plurality of molecular scaffolds 40A or 40B. An example of the wash solution is an aqueous solution including a buffer agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbates), and / or a chelating agent (e.g., EDTA). In one example, the wash solution includes water, the salt at a concentration ranging from about 25 mM to about 50 mM, the surfactant in anamount ranging from about 0.01 wt% to 0.1 wt%, and optionally the chelating agent. The wash solution may have a relatively high pH, e.g., ranging from about 7 to about 10.
[0163] The method then includes performing tagmentation of the DNA sample 62 on the non-patterned substrate 52 utilizing the transposome dimers 90 of at least some of the bound molecular scaffolds 40A or 40B. In this example method, performing tagmentation involves introducing the DNA sample 62 to the non-patterned substrate 52 with the tagmentation buffer, and adjusting a temperature at the surface of the non-patterned substrate 52 to a tagmentation temperature. When the non- patterned substrate 52 with the substantially flat surface is used, it may be placed into another container so that the transposome dimers 90 remain exposed to the tagmentation buffer and DNA sample 62.
[0164] The DNA sample 62 is added to any example of the tagmentation buffer disclosed herein, and then is deposited on the non-patterned substrate 52 having the particles 60 and the molecular scaffolds 40A or 40B bound thereto. The surface of the non-patterned substrate 52 is then brought to the tagmentation temperature (e.g., at or above 30°C) to initiate fragmentation and ligation of the DNA sample 62 as described herein in reference to Fig.3. As described, the DNA sample 62 is fragmented and the 5’ ends of both strands of the duplex fragment are ligated to respective 3’ ends of the transferred strands 16B, 16C of the transposomes 10B, 10C (or the transferred strands 16A when the transposome 10A is utilized). Thus, in this example method, the partially adapted DNA sample fragments are attached to the non-patterned substrate 52 through the attachment of the molecular scaffolds 40A or 40B. As depicted in Fig. 4, multiple tagmentation events can take place along the DNA sample 62.
[0165] It is to be understood that the plurality of particles 60 may be removed prior to initiating tagmentation, or may remain in place during tagmentation and removed after tagmentation. As such, some examples of the method shown in Fig.4 include removing the plurality of particles 60 prior to performing tagmentation of the DNA sample 62. In other examples of the method shown in Fig.4, the plurality of particles 60 remain bound during tagmentation of the DNA sample 62. When it is desirable to remove the plurality of particles 60, any reagent may be used that can break the firstbinding pair. Because the first and binding pairs are orthogonal, the second binding pair will remain intact. If the particles 60 are removed prior to tagmentation, it is also desirable that the reagent should not disrupt hybridization of the DNA sample 62 or destroy the transposome dimers 90.
[0166] When tagmentation has been allowed to proceed for a desirable amount of time, the method further includes introducing a reaction inhibitor to the non-patterned substrate 52, thereby stopping tagmentation of the DNA sample 62. As mentioned, an example of the reaction inhibitor is sodium dodecyl sulfate (SDS).
[0167] The tagmentation buffer can then be replaced with a reagent that facilitates the generation of fully adapted DNA sample fragments.
[0168] When the transposome 10A is used, the formation of the fully adapted DNA sample fragments is accomplished using gap fill ligation. Gap fill ligation can be performed as described in reference to Fig.3.
[0169] When the transposomes 10B and 10C are used, the formation of the fully adapted DNA sample fragments is accomplished using an extension reaction. The extension reaction can be performed as described in reference to Fig.3.
[0170] Whether gap fill ligation or the extension reaction is performed, the resulting fully adapted DNA sample fragments are attached to the dendron 34 (via the transferred strands 16A, 16B, or 16C of the transposome 10A, 10B, or 10C attached to the focal point 38), and thus are attached to the non-patterned substrate 52.
[0171] The method shown in Fig.4 further includes releasing the plurality of fully adapted DNA sample fragments from the plurality of molecular scaffolds 40A, 40B using any of the techniques set forth herein.
[0172] The fully adapted DNA sample fragments may be introduced to the flow cell 50 including corresponding primers 28, 30 for amplification and sequencing, as will be described in reference to Fig.5, Fig.6A, and Fig.6B.
[0173] The molecular scaffold 40C shown in Fig.2C may also be used in solution- based or surface-based methods similar to those described in Fig.3 and Fig.4. It is to be understood, however, that tagmentation is not performed when the molecular scaffold 40C is used. These methods are ligation-based library preparation methods, where the nucleic acid adapter 48 is ligated to DNA sample fragments. In theseexamples, the molecular scaffold 40C the nucleic acid adapter 48 creates a steric barrier preventing two nucleic acid adapters 48 from ligating to one another and thus forming an adapter dimer. Double stranded DNA sample fragments can readily ligate to respective nucleic acid adapters 48 at both ends. Moreover, the steric effect will impose a size threshold, thus limiting the smallest size of DNA fragment that can successfully ligate the nucleic acid adapters 48 on both ends.
[0174] One of the example methods is similar to the solution-based method described in Fig.3 and includes forming a suspension by introducing a plurality of the molecular scaffolds 40C to a ligation buffer; introducing DNA sample fragments to the ligation buffer; and bringing the suspension to a ligation temperature, thereby respectively ligating the nucleic acid adapters 48 to the DNA sample fragments.
[0175] Another of the example methods is similar to the surface-based method described in Fig.4, and uses a similar non-patterned substrate 52. This method includes introducing a plurality of first and second reactive entities 56, 56’ to the non- patterned substrate 52, whereby at least some of the plurality of first and second reactive entities 56, 56’ respectively attach to the non-patterned substrate 52 and introduce a first binding pair member 58 and a second binding pair member 59 to at least a portion of the non-patterned substrate 52; introducing, to the non-patterned substrate 52, a plurality of the particles 60 (respectively including the other first binding pair member), whereby at least some of the plurality of particles 60 become bound at the at least the portion of the non-patterned substrate 52; introducing, to the non- patterned substrate 52, a plurality of the molecular scaffolds 40C, wherein each of the polymer chains 42’ includes the other second binding pair member, and whereby at least some of the molecular scaffolds 40C diffuse through spaces between the at least some of the plurality of particles 60 and respectively attach to the second binding pair members 59; and ligating the nucleic acid adapters 48 of the at least some of the molecular scaffolds 40C to DNA sample fragments introduced onto the non-patterned substrate 52. In this method, any suitable DNA fragmenting method may be used to prepare the DNA sample fragments that are introduced onto the non-patterned substrate 52 after the molecular scaffolds 40C are attached.
[0176] Amplification and Flow
[0177] The fully adapted DNA sample fragments formed using the methods described in the section entitled “Methods Involving Molecular Scaffolds” may be introduced into another example of the flow cell 50 for amplification and sequencing.
[0178] A top view of an example of the flow cell 50 is shown in Fig.5. As will be discussed in reference to Fig.6A and Fig.6B, some examples of the flow cell 50 include two opposed non-patterned substrates 52, 52’ (shown with a lane 68 defined therein) or two opposed patterned substrates 66, 66’. Other example flow cells 50 include one substrate 52 or 66, which may have a cover slip or other lid bonded to a portion of the substrate 52 or 66. Still other example flow cells 50 include one substrate 52 or 66 that is not bonded to another component, but rather is open to the surrounding environment.
[0179] In the examples shown in Fig.6A and Fig.6B, a flow channel 64 is defined between the two opposed substrates 52 and 52’ or 66 and 66’. In other examples, the flow cell 50 includes one substrate 52 or 66 and the lid (not shown) attached to the substrate 52 or 66. In these examples, the flow channel 64 is defined between the substrate 52 or 66 and the lid. In the open wafer version, the flow channel 64 may be defined by the lane 68 alone (see Fig.6A).
[0180] The non-patterned substrate 52, 52’ shown in Fig.6A is the same as that described in reference to Fig.4, and thus may have a substantially flat surface or have the lane 68 defined therein. Any of the materials set forth herein may be used for the non-patterned substrate 52, 52’ of the flow cell 50. Because the flow cell 50 is used for sequencing, the material selected for the non-patterned substrate 52, 52’ of the flow cell 50 is transparent to visible light.
[0181] In the example shown in Fig.6B, the patterned substrates 66, 66’ are multi- layered. The patterned substrates 66, 66’ include a base support 70, 70’ and a patterned material 72, 72’ on the base support 70, 70’. In any of the examples disclosed herein, the components of the patterned substrates 66, 66’ may be selected to be transparent to visible light.
[0182] The base support 70, 70’ may any of the examples set forth herein for the non-patterned substrate 52. The patterned material 72, 72’ may be any material that is capable of being patterned with depressions 74, 74’.
[0183] In an example, the patterned material 72, 72’ may be an inorganic oxide that is selectively applied to the base support 70, 70’, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), etc. In another example, the patterned material 72, 72’ may be a resin matrix material that is applied to the base support 70, 70’ and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non- polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.
[0184] In an example, the substrates 52, 52’ or 66, 66’ may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular sheet or panel having its largest dimension up to about 10 feet (~ 3 meters). In an example, the substrate 52, 52’ or 66, 66’ is a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form an individual flow cell substrate. In another example, the substrate 52, 52’ or 66, 66’ is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 52, 52’ or 66, 66’ with any suitable dimensions may be used. For another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer. Panels may subsequently be diced to form individual flow cells.
[0185] The flow cell 50 also includes flow channel 64. While several flow channels 64 are shown in Fig.5, it is to be understood that any number of flow channels 64 may be included in the flow cell 50 (e.g., a single channel 64, four channels 64, etc.). Each flow channel 64 may be isolated from each other flow channel 64 in a flow cell 50 so that fluid introduced into any particular flow channel 64 does not flow into any adjacent flow channel 64.
[0186] At least a portion of the flow channel 64 may be defined in the substrate 52, 52’ or 66, 66’ using any suitable technique that depends, in part, upon the material(s) of the substrate 52, 52’ or 66, 66’. With the open wafer flow cell, the entire flow channel 64 may be defined by the lane 68, 68’ that is defined in the substrate 52, 52’. In two examples, at least a portion of the flow channel 64 is etched into a glass substrate or is engraved into a plastic substrate. In another example, at least a portion of the flow channel 64 may be defined in the patterned material 72, 72’ using photolithography, nanoimprint lithography, etc. In enclosed versions of the flow cell 50, a separate material (e.g., interposer 76) may be applied to the substrate 52, 52’ or 66, 66’ so that the interposer 76 defines at least a portion of the walls of the flow channel 64. While the lane 68, 68’ (Fig.6A) or walls of the flow channel 64 (Fig.6B) is / are shown defined in the non-patterned substrate 52, 52’ or the patterned material 72, 72’, it is to be understood that the surface of the non-patterned substrate 52, 52’ or the surface of the patterned material 72, 72’ (at the perimeter where depressions 74, 74’ are not formed) may be substantially flat, and the interposer 76 placed thereon may define the lane 68, 68’ and / or the flow channel 64.
[0187] In an example, the flow channel 64 has a substantially rectangular configuration with rounded ends. The length and width of the flow channel 64 may be smaller, respectively, than the length and width of the substrate 52 or 66 so that a portion of the substrate surface surrounding the flow channel 64 is available for attachment to another substrate 52’ or 66’ or to a lid, or is available to define the perimeter of the open flow channel 64. In some instances, the width of each flow channel 64 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 54 can be at least about 10 mm, at least about 25 mm, at leastabout 50 mm, at least about 100 mm, or The width and / or length of each flow channel 64 can be greater than, less than or between the values specified above. In another example, the flow channel 64 is square (e.g., 10 mm x 10 mm).
[0188] The depth / height of each flow channel 64 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the interposer 76 that partially defines the flow channel walls. In other examples, the depth / height of each flow channel 64 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In an example, the depth / height may range from about 10 μm to about 100 μm. In another example, the depth / height is about 5 μm or less. It is to be understood that the depth / height of each flow channel 64 can also be greater than, less than or between the values specified above. The depth / height of the flow channel 64 may also vary along the length and width of the flow cell 50, e.g., when depressions 74, 74’ are used.
[0189] Each flow channel 64 that is included in the flow cell 50 may be in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 64 may be positioned at opposed ends of the flow cell 50. The inlets and outlets of the respective flow channels 64 may alternatively be positioned anywhere along the length and width of the flow channel 64 that enables desirable fluid flow. The inlets and outlets may be fluidic passages that are defined in the interposer 76 and / or in one of the substrates 52, 52’ or 66, 66’ and / or in the lid.
[0190] The inlet allows fluid(s) to be introduced into the flow channel 64, and the outlet allows fluid(s) to be extracted from the flow channel 64. Each of the inlet(s) and outlet(s) is / are fluidly connected to a fluidic control system (e.g., reservoirs, pumps, valves, waste containers, and the like) that controls fluid introduction and expulsion. Some examples of the fluids that may be introduced into the flow channel(s) 64 include reaction components (e.g., DNA library templates, polymerases, sequencing primers, nucleotides, etc.), washing solutions, etc.
[0191] The example flow cell architecture of Fig.6A includes the lane 68, 68’, without depressions 74, 74’. In this example, the lane 68, 68’ extends just short of the full length and the full width of the substrate 52, 52’ so that interstitial regions 78, 78’ are formed at a perimeter of the lane 68, 68’.
[0192] The example flow cell of Fig.6B includes the depressions 74, 74’ separated by the interstitial regions 78, 78’. Many different layouts of the depressions 74, 74’ may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 74, 74’ are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 74, 74’ and the interstitial regions 78, 78’. In still other examples, the layout or pattern can be a random arrangement of the depressions 74, 74’ and the interstitial regions 78, 78’.
[0193] The layout or pattern may be characterized with respect to the density (number) of the depressions 74, 74’ in a defined area. For example, the depressions 74, 74’ may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high density array may be characterized as having depressions 74, 74’ separated by less than about 100 nm, a medium density array may be characterized as having the depressions 74, 74’ separated by about 400 nm to about 1 µm, and a low density array may be characterized as having the depressions 74, 74’ separated by greater than about 1 µm.
[0194] The layout or pattern of the depressions 74, 74’ may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 74, 74’ to the center of an adjacent depression 74, 74’ (center-to-center spacing) or from the right edge of one depression 74, 74’ to the left edge of an adjacent depression 74, 74’ (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In eithercase, the average pitch can be, for about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 74, 74’ have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.
[0195] The size of each depression 74, 74’ may be characterized by its volume, opening area, depth, and / or diameter. For example, the volume can range from about 1×10−3μm3to about 100 μm3, e.g., about 1×10−2μm3, about 0.1 μm3, about 1 μm3, about 10 μm3, or more, or less. For another example, the opening area can range from about 1×10−3μm2to about 100 μm2, e.g., about 1×10−2μm2, about 0.1 μm2, about 1 μm2, at least about 10 μm2, or more, or less. For still another example, the depth can range from about 0.1 μm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more, or less. For yet another example, the diameter or length and width can range from about 0.1 μm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more, or less.
[0196] The architecture shown in Fig.6B may be desirable for the patterned substrate 66 when it is used to form an open wafer flow cell 50. While not shown, it is to be further understood that the depressions 74, 74’ may be defined across a substantially flat substrate surface, and the interposer 76 may completely define the side walls of the enclosed flow cells 50.
[0197] In any of the examples disclosed herein, the flow cell architecture shown in Fig.6A or in Fig.6B includes a polymeric hydrogel 54, 54’.
[0198] The polymeric hydrogel 54, 54’ may be poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM) or another of the acrylamide copolymers disclosed herein, polyethylene glycol (PEG)-acrylate, PEG- diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG- isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide- polypropylene oxide block copolymers (PEO-PPO), poly(hydroxyethyl methacrylate)(PHEMA), poly(N,N’- poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymers, poly(ethylene glycol)-poly(lactic-co-glycolic acid) block copolymers, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic dihydrazide modified or aldehyde modified poly(L-glutamic acid), bisacrylamide, or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or combinations or mixtures thereof.
[0199] In one example, the polymeric hydrogel 54, 54’ includes an acrylamide copolymer. In this example, the acrylamide copolymer has a structure (I): wherein:RAis any functional group (e.g., an azide, an alkyne, an amino, an alkenyl, an alkyne, a halogen, a hydrazone, a hydrazine, a carboxyl, a hydroxy, a tetrazole, nitrone, sulfate, tetrazine, or thiol) that can attach the primers 28, 30; RBis H or optionally substituted alkyl; RC, RD, and REare each independently selected from the group consisting of H and optionally substituted alkyl; each of the -(CH2)p- can be optionally substituted; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; and m is an integer in the range of 1 to 100,000.
[0200] One specific example of the copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM.
[0201] One of ordinary skill in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0202] The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or may be, in a specific example, about 312 kDa.
[0203] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a cross-linked polymer with various degrees of cross-linking.
[0204] In some examples, the polymeric hydrogel 54, 54’ may be a variation of structure (I). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide ). In another example, the acrylamide unit instructure (I) may be replaced with, where RD, RE, and RFare each GH or a C1-C6 alkyl, and R and alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition tothe acrylamide unit. In this example, structure (I) may inaddition to the recurring “n” and “m” features, where RD, RE, aC1-C6 alkyl, and RGand RHare each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0205] As another example of the polymeric hydrogel 54, 54’, the recurring “n” feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):wherein R1is H or a C1-C6 alkyl; R2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0206] As still another example, the hydrogel 54, 54’ may include a recurring unit of each of structure (III) and (IV): wherein each of R1a, from hydrogen, anoptionally substituted alkyl or optionally substituted phenyl; each of R3aand R3bis independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each L1and L2is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0207] The polymeric hydrogel 54, 54’ can be added to a liquid carrier and applied to the non-patterned substrate 52 or the patterned substrate 66 using any suitable deposition technique. When the lane 68 or patterned substrate 66 is used, the polymeric hydrogel solution / mixture is blanketly deposited and then removed from interstitial regions 78 using polishing. Polishing leaves the polymeric hydrogel 54, 54’intact in the lane 68 or in the depressions 74.
[0208] As shown in Fig.6A and Fig.6B, the flow cell 50 includes the primers 28, 30 attached to the polymeric hydrogel 54, 54’.
[0209] The primers 28, 30 may be any of the examples set forth herein, such as P5 and P7 primers, P15 and P7 primers, or any combination of the PA primers, the PB primers, the PC primers, and the PD primers set forth herein.
[0210] To graft the primers 28, 30 to the polymeric hydrogel 54, 54’, the primers 28, 30 may first be added to a carrier fluid (e.g., water including a neutral buffer and / or salt). The fluid may be introduced to the substrate 52, 52’ or 66, 66’ having thepolymeric hydrogel 54, 54’ already thereon, and allowed to incubate. Grafting may be performed at a temperature ranging from about 55°C to about 65°C for a time ranging from about 20 minutes to about 60 minutes. In one example, grafting is performed at 60°C for about 30 minutes or 60 minutes. It is to be understood that a lower temperature and a longer time or a higher temperature and a shorter time may also be used. During grafting, the 5’ ends of the primers 28, 30 attach to at least some of the surface groups of the polymeric hydrogel 54, 54’ and have no affinity for the interstitial regions 78, 78’ or other edge portions of the substrate 52, 52’ or 66, 66’.
[0211] For amplification and sequencing, the fully adapted DNA sample fragments may be introduced to the flow cell 50. With the amplification domains, the fully adapted DNA sample fragments hybridize, for example, to one of two types of primers 28, 30.
[0212] Amplification of the seeded fully adapted DNA sample fragments may be initiated to form a cluster of the template strands across the polymeric hydrogel 54, 54’. This form of amplification may be referred to as cluster generation. In one example of cluster generation, the fully adapted DNA sample fragments are copied from the hybridized primers by 3’ extension using a high-fidelity DNA polymerase. The original fully adapted DNA sample fragments are denatured, leaving the copies immobilized to the polymeric hydrogel 54, 54’. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. For example, the copied templates loop over to hybridize to an adjacent, complementary primer, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double stranded bridges is denatured. In an example, the reverse strand is removed by specific cleavage at the cleavage site 32, 32B, 32C (e.g., uracil, 8-oxoguanine, allyl-T, etc.) in the amplification domain sequence, leaving forward template strands. Clustering results in the formation of several template strands immobilized on the polymeric hydrogel 54, 54’ through the primers 28, 30.This example of clustering is referred to bridge amplification, and is one example of the amplification that may be performed. It is to be understood that other amplification techniques may be used.
[0213] Some examples of the method then include blocking non-protected (free) 3’ OH ends of the template strands and primers 28, 30 that do not have template strands attached thereto. A blocking group (e.g., a 3’ phosphate) may be added that attaches to the exposed 3’ ends to prevent undesired extension.
[0214] Sequencing primers may then be introduced to the flow cell 50. The sequencing primers hybridize to the sequencing primer sequences 24, 24B, 24C of the template nucleic acid strands. These sequencing primers render the template strands ready for sequencing.
[0215] An incorporation mix including labeled nucleotides may then be introduced into the flow cell 50, e.g., via an inlet. In addition to the labeled nucleotides, the incorporation mix may include water, a buffer, and polymerases. When the incorporation mix is introduced into the flow cell 50, the mix enters the flow channel 64, and contacts the anchored and sequence ready template strands.
[0216] The incorporation mix is allowed to incubate in the flow cell 50, and labeled nucleotides (including optical labels) are incorporated by respective polymerases into the nascent strands along the template strands. During incorporation, one of the labeled nucleotides is incorporated, by a respective polymerase, into one nascent strand that extends one sequencing primer and that is complementary to one of the template strands. Incorporation is performed in a template strand dependent fashion, and thus detection of the order and type of labeled nucleotides added to the nascent strand can be used to determine the sequence of the template strand. Incorporation occurs in at least some of the template strands across the flow cell 50 during a single sequencing cycle.
[0217] The incorporated labeled nucleotides may include a reversible termination property due to the presence of a 3’ OH blocking group, which terminates further sequencing primer extension once the labeled nucleotide has been added. After a desired time for incubation and incorporation, the incorporation mix, including non- incorporated labeled nucleotides, may be removed from the flow cell 50 during a washcycle. The wash cycle may involve a technique, where a washing solution (e.g., buffer) is directed into, through, and then out of flow channel 64, e.g., by a pump or other suitable mechanism.
[0218] Without further incorporation taking place, the most recently incorporated labeled nucleotides can be detected through an imaging event. During the imaging event, an illumination system may provide an excitation light to the flow cell 50. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light. These optical signals may be captured using an imaging device.
[0219] After imaging is performed, a cleavage mix may then be introduced into the flow cell 50. In an example, the cleavage mix is capable of i) removing the 3’ OH blocking group from the incorporated nucleotides, and ii) cleaving the optical label from the incorporated nucleotide. Examples of 3’ OH blocking groups and suitable de- blocking agents / components in the cleavage mix may include: ester moieties that can be removed by base hydrolysis; allyl-moieties that can be removed with Nal, chlorotrimethylsilane and Na2S2O3 or with Hg(II) in acetone / water; azidomethyl which can be cleaved with phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals, such as tert-butoxy-ethoxy, which can be cleaved with acidic conditions; MOM (—CH2OCH3) moieties that can be cleaved with LiBF4and CH3CN / H2O; 2,4-dinitrobenzene sulfenyl which can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ether which can be cleaved with Ag(I) or Hg(II); and 3’ phosphate which can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optical label cleaving agents / components in the cleavage mix may include: sodium periodate, which can cleave a vicinal diol; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP), which can cleave azidomethyl linkages; palladium and THP, which can cleave an allyl; bases, which can cleave ester moieties; or any other suitable cleaving agent of the 3’ OH blocking group.
[0220] Additional sequencing cycles may then be performed until the template strands are sequenced. The nascent strands may be dehybridized, and the blocking group at the 3’ OH ends of the template strands and primers 28 or 30 may be removed. Clustering is performed again, and this time, the forward strands areremoved by specific cleavage at the site (e.g., uracil, 8-oxoguanine, allyl-T, etc. in the primer sequence, leaving the reverse template strands. Sequencing of the reverse template strands may be performed as described herein.
[0221] Surface Based Tagmentation with Beads and Transposomes
[0222] Still another method described herein is similar to the method of Fig.4, but does not utilize the molecular scaffolds 40A or 40B. Rather, the method utilizes the transposomes 10A or 10B and 10C. This surface based tagmentation method is depicted in Fig.7.
[0223] The flow cell 50 used in the method of Fig.7 is similar to the example shown in Fig.6A, and includes the non-patterned substrate 52; the polymeric hydrogel 54 over at least a portion of the non-patterned substrate 52; and a primer set (including primers 28, 30) attached to the polymeric hydrogel 54. For this method, the flow cell 50 is an open wafer flow cell with either the substantially flat surface (see Fig.4) or including the lane 68 (see Fig.6A). When the flow cell 50 with the substantially flat surface is used, it may be placed into another container so that the flow cell surface is exposed to the desired reagents / components during the method.
[0224] The method shown in Fig.7 includes introducing a plurality of first complementary primers 80 to the flow cell 50 at a hybridization temperature, whereby at least some of the plurality of first complementary primers 80 respectively hybridize to first primers 28 of the primer set and introduce a first member 58’ of a binding pair to the portion of the non-patterned substrate 52; introducing, to the flow cell 50, a plurality of particles 60 respectively including a second member of the binding pair, whereby at least some of the plurality of particles 60 become bound at the portion of the non- patterned substrate 52; introducing, to the flow cell 50, a plurality of transposome dimers 90 respectively including a second complementary primer 82, whereby at least some of the plurality of transposome dimers 90 diffuse through spaces between the at least some of the plurality of particles 60 and respectively hybridize to a second primer 30 of the primer set via the second complementary primers 82; and performing tagmentation of a DNA sample 62 on the flow cell 50 utilizing the at least some of the plurality of transposome dimers 90.
[0225] The plurality of first primers 80 has a nucleic acid sequence that is complementary to one of the flow cell surface bound primers 28, 30. Thus, the first complementary primer may have a sequence that is complementary to either the primer 28 or the primer 30. Attached at the 5’ of the sequence of the first complementary primer 80 is the first member 58’ of a binding pair. Similar to the example method described in reference to Fig.4, the second member of the binding pair is coated on the particles 60, and the binding pair enables the particles 60 to attach to the surface of the flow cell 50. Any of the example binding pairs set forth herein may be used. In one example, the first member 58’ of the binding pair is biotin, and the second member of the binding pair is streptavidin.
[0226] The first complementary primers 80 and the first members 58’ attached thereto may be introduced to the flow cell 50 in a carrier liquid and allowed to incubate at a temperature suitable for DNA hybridization (e.g., from about 40°C to about 75°C). At least some of the first complementary primers 80 will respectively hybridize to at least some of the surface bound primers 28 or 30. This introduces the first member 58’ of the binding pair to the flow cell 50.
[0227] The plurality of particles 60 is then deposited on the flow cell 50. Each particle 60 is coated with the second member of the binding pair, and thus will bind to the polymeric hydrogel 54, which has been functionalized with the first member of the binding pair. Any of the particles 60 described in reference to Fig.4A may be used.
[0228] Surface bead self-assembly techniques may be used to generate a single layer of the particles 60, as shown in Fig.7. Any non-bound particles 60 may be removed.
[0229] The plurality of transposomes 10A or 10B and 10C, in the form of dimers 90, are then deposited on the flow cell 50. Any of the transposomes 10A or 10B and 10C may be used and are added to a liquid carrier. In solution, the dimers 90 will form. The transposomes 10A will form homo-dimers. The transposomes 10B and 10C may be introduced into separate solutions to form respective homo-dimers, or may be introduced into the same solution to form a mixture of homo-dimers and hetero-dimers. The dimers 90 may be deposited in solution using any suitable deposition technique. For dimer 90 formation and deposition, any of the liquid carriers set forth herein for themolecular scaffolds 40A, 40B may be In this example, however, the 5’ end functional group 20 or attachment tag 44 is replaced with a primer 82 that is complementary to one of the surface bound primers 30, 28. More particularly, if the first complementary primer 80 is complementary to the surface bound primer 28, then the second complementary primer 82 is complementary to the surface bound primer 30; or if the first complementary primer 80 is complementary to the surface bound primer 30, then the second complementary primer 82 is complementary to the surface bound primer 28.
[0230] When the plurality of transposomes 10A or 10B and 10C (in the form of dimers 90), are deposited, the temperature at the flow cell surface is at or brought to a suitable hybridization temperature. The dimers 90 diffuse through spaces between the particles 60 that are bound to the flow cell 50, and respectively hybridize to the complementary flow cell surface bound primer 30 or 28. The transposome dimers 90 are accessible through these spaces. The particles 60 help to equally space the flow cell surface bound transposome dimers 90, which promotes a narrower size distribution of the DNA sample fragments resulting from tagmentation.
[0231] Any non-bound dimers 90 may be removed.
[0232] In some examples of the method, the flow cell 50 is exposed to a wash solution after each of: the introduction of the plurality of first complementary primers 80, the introduction of the plurality of particles 60, and the introduction of the plurality of plurality of transposome dimers 90. An example of the wash solution disclosed herein may be used.
[0233] The method then includes performing tagmentation of the DNA sample 62 on the flow cell 50 utilizing at least some of the bound transposome dimers 90. In this example method, performing tagmentation involves introducing the DNA sample 62 to the flow cell 50 with the tagmentation buffer, and adjusting a temperature at the surface of the flow cell 50 to a tagmentation temperature.
[0234] The DNA sample 62 is added to any example of the tagmentation buffer disclosed herein, and then is deposited on the flow cell 50 having the particles 60 and the transposomes 10A or 10B and 10C (in the form of dimers 90) bound thereto. The surface of the flow cell 50 is then brought to the tagmentation temperature (e.g., at orabove 30°C) to initiate fragmentation of the DNA sample 62 as described herein in reference to Fig.3. As described, the DNA sample 62 is fragmented and the 5’ ends of both strands of the duplex fragment are ligated to respective 3’ ends of the transferred strands 16B, 16C of the transposomes 10B, 10C (or the transferred strands 16A when the transposome 10A is utilized). Thus, in this example method, the partially adapted DNA sample fragments are attached to the flow cell 50 through the attachment of the transposomes 10A, 10B, 10C. As depicted in Fig.7, multiple tagmentation events can take place along the DNA sample 62.
[0235] It is to be understood that the plurality of particles 60 may be removed prior to initiating tagmentation, or may remain in place during tagmentation and removed after tagmentation. As such, some examples of the method shown in Fig.7 include removing the plurality of particles 60 prior to performing tagmentation of the DNA sample 62. In other examples of the method shown in Fig.7, the plurality of particles 60 remain bound during tagmentation of the DNA sample 62. When it is desirable to remove the plurality of particles 60, any reagent may be used that can break the binding pair. If the particles 60 are removed prior to tagmentation, it is also desirable that the reagent should not disrupt hybridization.
[0236] When tagmentation has been allowed to proceed for a desirable amount of time, the method further includes introducing a reaction inhibitor to the flow cell 50, thereby stopping tagmentation of the DNA sample 62. As mentioned, an example of the reaction inhibitor is sodium dodecyl sulfate (SDS).
[0237] The tagmentation buffer can then be replaced with a reagent that facilitates the generation of fully adapted DNA sample fragments.
[0238] When the transposome 10A is used, the formation of the fully adapted DNA sample fragments is accomplished using gap fill ligation. Gap fill ligation can be performed as described in reference to Fig.3.
[0239] When the transposomes 10B and 10C are used, the formation of the fully adapted DNA sample fragments is accomplished using an extension reaction. The extension reaction can be performed as described in reference to Fig.3.
[0240] Whether gap fill ligation or the extension reaction is performed, the resulting fully adapted DNA sample fragments are attached to the polymeric hydrogel 54 (viathe transferred strands 16A, 16B, or the transposome 10A, 10B, or 10C attached to the primers 30 or 28), and thus are attached to the flow cell 50.
[0241] The method shown in Fig.7 further includes releasing the plurality of fully adapted DNA sample fragments from the polymeric hydrogel 54. In this example, the fully adapted DNA sample fragments can be released during dehybridization.
[0242] Because this example of the flow cell 50 includes primers 28, 30, the released DNA sample fragments may be amplified using the same flow cell 50. In this example, the flow cell 50 may be maintained at a suitable temperature for the released DNA sample fragments to seed to the primers 28, 30. The seeded fully adapted DNA sample fragments can then be amplified as described in reference to Fig.5, Fig.6A, and Fig.6B.
[0243] Alternatively, the released fully adapted DNA sample fragments may be removed from the flow cell 50 used in the method of Fig.7, collected, and introduced to another example of the flow cell 50 including corresponding primers 28, 30 for amplification and sequencing, as described in reference to Fig.5, Fig.6A, and Fig.6B.
[0244] Tagmentation Apparatus including a DNA Origami Structure
[0245] Still other examples disclosed herein are directed to a tagmentation apparatus, which utilizes DNA origami structures to position the transposome dimers 90 at desired distances to achieve a minimum size threshold for tagmented DNA samples. In addition to achieving size exclusion, the DNA origami structures can also be positioned or have a geometry that helps to reduce adapter dimer formation.
[0246] Examples of the tagmentation apparatus 84A, 84B, 84C, 84D, 84E are shown in Fig.8A, Fig.8B, Fig.8D, Fig.8E, and Fig.8F, respectively. Each tagmentation apparatus 84A, 84B, 84C, 84D, 84E includes a substrate 86, 86’, or 86’’, a plurality of deoxyribonucleic acid (DNA) origami structures 88 attached to the substrate 86, 86’, or 86’’; and a transposome dimer 90 attached to each of the plurality of DNA origami structures 88, wherein each transposome dimer 90 is separated from each other transposome dimer 90 by a distance D, D1, D2of at least 70 nm.
[0247] The substrate 86 in the example shown in Fig.8A is similar to the non- patterned substrate 52. Any of the single layered materials set forth herein for thenon-patterned substrate 52 may be the substrate 86’. While the substrate 86 is shown with a substantially flat surface, it is to be understood that the substrate 86 may also have the lane 68 defined therein, and the plurality of DNA origami structures 88 may be attached to the substrate 86 within the lane 68. The apparatus 84A shown in Fig.8A may be incorporated into a flow cell 50.
[0248] The substrate 86’ in the example shown in Fig.8B is a bead, which is similar to the particle 60. Any of the example materials set forth herein for the particle 60 may be used for the substrate 86’.
[0249] The substrates 86’’ shown in Fig.8D, Fig.8E, and Fig.8F are similar to the patterned substrate 66. Any of the materials set forth herein for the multiple layers of the patterned substrate 66 may be used for the substrate 86’’. In the example of Fig. 8D, the substrate 86’’ includes a plurality of depressions 74 separated by interstitial regions 78; and each of the plurality of depressions 74 includes a respective one of the plurality of DNA origami structures 88. The minimum distance D between the dimers 90 in the same depression 74 will depend, in part, upon the size of the depression 74 and the positioning of the dimers 90 on the DNA origami structures 88. The minimum distance DA between the dimers 90 in adjacent depressions 74 will depend, in part, upon the size of the depression 74, the length of the interstitial region 78, and the positioning of the dimers 90 on the DNA origami structures 88. In the example of Fig. 8D, the minimum distances D and DAmay each be greater than 70 nm. In the example of Fig.8E, the substrate 86’’ includes a plurality of depressions 74 separated by interstitial regions 78; and each of the plurality of depressions 74 includes two of the plurality of DNA origami structures (shown as 88A and 88B). The minimum distance D between the dimers 90 in a single depression 74 will depend, in part, upon the size of the depression 74, and the positioning of the dimers 90 on the DNA origami structure(s) 88A, 88B in the depression 74. The example shown in Fig.8F is similar to the example shown in Fig.8D, except that the dimers 90 are positioned differently. In the example of Fig.8F, the substrate 86’’ includes a plurality of depressions 74 separated by interstitial regions 78; and each of the plurality of depressions 74 includes one of the plurality of DNA origami structures 88. In this example, the dimers 90 within the same depression 74 are positioned close to each other and the minimumdistance DA between the dimers 90 in depressions 74 will depend, in part, upon the size of the depression 74, the length of the interstitial region 78, and the positioning of the dimers 90 on the DNA origami structures 88. In the example of Fig. 8F, the minimum distance DA may be greater than 70 nm. Also in this example, the minimum distance D between the dimers 90 on the same DNA origami structure 88 is less than 70 nm. The apparatuses 84C, 84D, 84E shown in Fig.8D, Fig.8E, and Fig. 8F may be incorporated into a flow cell.
[0250] The DNA origami structures 88, 88A, 88B may be constructed from a large DNA scaffold molecule, such as a plasmid or viral vector, with a known sequence that is folded by hybridization with short oligonucleotides, referred to as staples. The staples may be selected to complement distal regions of the backbone of the DNA scaffold molecule and a multitude of staples can fold the scaffold molecule into a number of desired conformations. One or more additional staples can be designed based on the sequence of the scaffold molecule to precisely position the additional staple(s) at determined locations in the final folded structure. In the examples shown in Fig.8A, Fig.8B, and Fig.8C, the large DNA scaffold molecule is folded into a rectangle or square and one additional staple is positioned at the center point of one surface of the rectangle or square. The example shown in Fig.8E is similar to Fig.8A, Fig.8B, and Fig.8C, except that the backbone of the DNA scaffold molecule is folded into a shape that occupies one half of the depression 74 so that two DNA origami structures 88A, 88B can be positioned within the depression 74. When in position, the staples of each of these origami structures 88A, 88B are located closer to the respective edges of the depression 74 than to the center of the depression 74 so the desired distance D, D1, or D2 between the transposome dimers 90A, 90B is achieved. In Fig.8E, the additional staples act as anchor points 92A, 92B for respective transposomes 10A, 10B, or 10C of two different dimers 90A, 90B. In the examples shown in Fig.8D, the large DNA scaffold molecule is folded into a shape that occupies the entire depression 74. In this example, two additional staples are added and act as anchor points 92A, 92B for respective transposomes 10A, 10B, or 10C of two different dimers 90A, 90B.
[0251] While rectangles and squares mentioned as being suitable shapes for the DNA origami structures 88A, 88B, it is to be understood that any suitable 2D or 3D geometry may be used. An example is shown in Fig.10. In this example, the topology of the DNA origami structure 88’ includes a recess 98, in which the transposome dimer 90 is attached. The recessed position may help to reduce adapter dimer formation by tagmentation. The sidewalls that are formed by the DNA origami structure 88’ may also be high enough to prevent DNA sample fragments of less than a minimum length from appending adaptors at both ends. In this example, the transposome dimer 90 can be precisely positioned at the base of the recess 98. When an enzymatic reaction (e.g., tagmentation) happens between the DNA sample 62 and a first transposome dimer 90 at the base of the recess 98 of a first DNA origami structure 88’, an adaptor (through the transferred strand) is appended to the first end of the DNA sample fragment. When this product complex reacts with a second transposome dimer 90 at the base of a second DNA origami structure 88’, it can only do so beyond a desired minimum length that is not sterically excluded by the first product complex.
[0252] One transposome 10A, 10B, or 10C of the dimer 90 may be hybridized to an anchor point 92, 92A, 92B if a complementary nucleic acid sequence is incorporated at the 5’ end of the transposome 10A, 10B, or 10C. Alternatively, one transposome 10A, 10B, or 10C of the dimer 90 may be attached to the anchor point 92, 92A, 92B via ligation or click chemistry through the 5’ end functional group 20. In still another example, the complementary nucleic acid sequence may contain sequences that form part of the mosaic end (ME) binding sequence of the transposome 10A, 10B, or 10C, and these sequences could hybridize to the anchor point 92, 92A, 92B. In this latter example, the transposome 10A, 10B, 10C and associated dimer 90 would be assembled in situ on the staple functioning as the anchor point 92, 92A, 92B.
[0253] In some examples, the DNA origami structure 88, 88’ may be commercially available (e.g., from Tilibit nanosystems). In other examples, the DNA origami structure 88, 88’ may be designed for a specific apparatus using suitable design software, and then constructed using DNA synthesis techniques (oligo formation, annealing, biotechnology methods that utilize bacteria scaffolds, etc.).
[0254] The positioning of the staples will function as the anchor points 92, 92A, 92B will depend upon the size of the DNA origami structure 88, 88A, 88B, 88’, the number of the anchor points 92, 92A, 92B that are to be positioned on a single DNA origami structure 88, 88A, 88B, 88’, and the desired distance D, D1, or D2 between the transposome dimers 90.
[0255] The size of the DNA origami structure 88, 88A, 88B, 88’ will depend upon the substrate 86, 86’, 86’’ that is being used, the desired number of DNA origami structures 88, 88A, 88B, 88’ that are to be attached to the substrate 86, 86’, 86’’, and the desired position of DNA origami structures 88, 88A, 88B, 88’ on the substrate 86, 86’, 86’’. In some instances, the size of the DNA origami structure 88, 88A, 88B, 88’ also depends upon the size of the depression 74 and the number of DNA origami structures 88, 88A, 88B that is / are to be positioned within a single depression 74.
[0256] In the example shown in Fig.8A, the DNA origami structures 88 are rectangles approximately 100 nm by 70 nm, and the anchor points 92 are located at the center of each rectangle. When a plurality of these DNA origami structures 88 are placed adjacent to one another, the minimum distance D1or D2between two directly adjacent transposome dimers 90 may range from 70 nm to 100 nm, depending upon whether the distance D1 or D2 is along the longer or shorter side of the rectangles. In the example shown in Fig.8A, the distance D1reflects the distance between two adjacent dimers 90 along the longer side of the rectangular DNA origami structure 88, 88A, 88B, and the distance D2 reflects the distance between two adjacent dimers 90 along the shorter side of the rectangle rectangular DNA origami structure 88, 88A, 88B. If two directly adjacent dimers 90 were used in tagmentation, the resulting DNA sample fragment would range from 210 bp to 300bp. An array of these transposome dimers 90 will generate a library of fully adapted DNA sample fragments that range in size from 210 bp to greater than 1000 bp, depending on the span of the input DNA sample 62 that is exposed to the array. However, the array will not generate fully adapted DNA sample fragments less than 210 bp to 300 bp in length.
[0257] The DNA origami structures 88, 88A, 88B, 88’ can be constructed with one or more attachment moieties 94 on surface that is to face the substrate 86, 86’, 86’’ (i.e., the surface that is opposed to the anchor point 92, 92A, 92B). Each attachmentmoiety 94 may be any member of the pairs set forth herein, and the surface of the substrate 86, 86’, 86’’ may be coated with the other member of the binding pair. In one example, the moiety 94 is biotin, which can be chemically attached to a staple of the DNA origami structure 88, 88A, 88B, 88’. When a multitude of these DNA origami structures 88, 88A, 88B, 88’ are added to a streptavidin coated substrate 86, 86’, 86’’, they bind via their moieties 94 and cover the substrate 86, 86’, 86’’ with a closely packed monolayer of DNA origami structures 88, 88A, 88B, 88’.
[0258] For any of the tagmentation apparatuses 84A, 84B, 84C, 84D, 84E disclosed herein, any of the transposomes 10A or 10B and 10C may be used to form the transposome dimers 90.
[0259] While each of the DNA origami structures 88, 88A, 88B, 88’ is shown with the transposome dimers 90 attached, it is to be understood that one or more DNA origami structures 88, 88A, 88B, 88’ may not have a transposome dimer 90 attached thereto. These particular DNA origami structures 88, 88A, 88B, 88’ may be used to space out the transposome dimers 90 attached to other DNA origami structures 88, 88A, 88B, 88’.
[0260] Referring now to Fig.9A and Fig.9B, the DNA origami structures 88, 88A, 88B, 88’ may be further modified so that they can link to one another. As shown in Fig.9A, a single linking moiety 96A, 96B may bind two adjacent DNA origami structures 88A, 88B. As shown in Fig.9B, multiple linking moieties 96A, 96B, 96C, 96D may bind two adjacent DNA origami structures 88A, 88B. The linking moieties 96A, 96B, 96C, 96D can be selected so that the DNA origami structures 88A, 88B are linked in a predetermined arrangement. As examples, the linking moieties 96A, 96B, 96C, 96D can be short complementary DNA strands (i.e., overhangs) or chemically conjugated branched DNA structures, such as azide-modified dipentaerythritol conjugated with DBCO oligonucleotides. As another example, the DNA origami structures 88, 88A, 88B, 88’ can be linked by shape selection. As an example of shape selection, a combination of single-stranded overhangs and jigsaw shapes at the respective sides of two DNA origami structures 88, 88A, 88B, 88’ that are to be linked together (e.g., a top side of one structure 88, 88A, 88B, 88’ and a bottom side ofanother structure 88, 88A, 88B, 88’) can provide the linking moieties 96A, 96B, 96C, 96D between the two DNA origami structures 88, 88A, 88B, 88’.
[0261] In some examples, the DNA origami structures 88, 88A, 88B, 88’ may further include additional modifications, such as polythymine terminal chains for enhancing their stability towards enzyme digestion, temperature degradation, or other environmental conditions that may destabilize the structures 88, 88A, 88B, 88’. Depending upon the modification used, the formation of the DNA origami structure 88, 88A, 88B, 88’ may involve additional processing, such as UV irradiation or polymer coating to render the origami structures 88, 88A, 88B, 88’ inert to DNA nucleases or other DNA modifying enzymes.
[0262] Methods Involving Tagmentation Apparatuses
[0263] A DNA size exclusion method that utilizes the tagmentation apparatus described herein includes contacting a DNA sample 62 and a tagmentation buffer with any example of the tagmentation apparatus 84A, 84B, 84C, 84D, 84E disclosed herein; and initiating tagmentation of the DNA sample 62 with at least some of the transposome dimers 90, thereby generating partially adapted DNA sample fragments having a minimum size ranging from amount 210 base pairs to about 300 base pairs. In these methods, any of the tagmentation buffers disclosed herein may be used.
[0264] In one example, the tagmentation apparatus 84A, 84C, 84D, 84E is a flow cell; and initiating tagmentation involves increasing a temperature of the tagmentation buffer in the flow cell to a tagmentation temperature. The DNA sample 62 and tagmentation buffer may be mixed together and introduced into the flow cell, or introduced sequentially into the flow cell. Within the flow cell, the DNA sample 62 and tagmentation buffer are exposed to the DNA origami structures 88, 88A, 88B, 88’ and the dimers 90 attached respectively thereto.
[0265] Tagmentation may be initiated and performed as described herein. In the presence of the tagmentation buffer and with the temperature brought to the tagmentation temperature, the DNA sample 62 is fragmented and the 5’ ends of both strands of the duplex fragment are ligated to respective 3’ ends of the transferred strands 16A or 16B, 16C of transposome dimers 90 that are attached to different DNAorigami structures 88, 88A, 88B, 88’. sample fragments may be generated between directly adjacent dimers 90 and / or between non-adjacent dimers 90. In any instance, the length of the DNA sample fragment is of the minimum size threshold due to the spacing of the dimers 90 across the DNA origami structures 88, 88A, 88B, 88’.
[0266] In another example, the tagmentation apparatus 84B is a bead; and initiating tagmentation involves increasing a temperature of the tagmentation buffer to a tagmentation temperature. The bead (tagmentation apparatus 84B), DNA sample 62, and tagmentation buffer may be mixed together to form a suspension. Within the suspension, the DNA sample 62 and tagmentation buffer are exposed to the DNA origami structures 88, 88A, 88B, 88’ and the dimers 90 attached respectively thereto. The suspension may be brought to the tagmentation temperature.
[0267] Tagmentation may be initiated and performed as described herein. In the presence of the tagmentation buffer and with the temperature brought to the tagmentation temperature, the DNA sample 62 is fragmented and the 5’ ends of both strands of the duplex fragment are ligated to respective 3’ ends of the transferred strands 16A or 16B, 16C of transposome dimers 90 that are attached to different DNA origami structures 88, 88A, 88B, 88’ on the beads. The DNA sample fragments may be generated between directly adjacent dimers 90 and / or between non-adjacent dimers 90. In any instance, the length of the DNA sample fragment is of the minimum size threshold due to the spacing of the dimers 90 across the DNA origami structures 88, 88A, 88B, 88’ on the bead.
[0268] With any of the tagmentation apparatuses 84A, 84B, 84C, 84D, 84E, tagmentation generates partially adapted DNA sample fragments attached to different DNA origami structures 88, 88A, 88B, 88’ by the transferred strands 16A, 16B, or 16C of the dimers 90. When the transposome 10A is used, the formation of the fully adapted DNA sample fragments is accomplished using gap fill ligation. Gap fill ligation can be performed as described in reference to Fig.3. When the transposomes 10B and 10C are used, the formation of the fully adapted DNA sample fragments is accomplished using an extension reaction. The extension reaction can be performed as described in reference to Fig.3.
[0269] Whether gap fill ligation or the reaction is performed, the resulting fully adapted DNA sample fragments are attached to the different DNA origami structures 88, 88A, 88B, 88’ by the transferred strands 16A, 16B, or 16C of the dimers 90, and thus are attached to the tagmentation apparatus 84A, 84B, 84C, 84D, 84E.
[0270] These methods further include releasing the plurality of fully adapted DNA sample fragments from the different DNA origami structures 88, 88A, 88B, 88’ using any of the techniques set forth herein (e.g., cleavage), dehybridization, etc.
[0271] Kits
[0272] Any of the examples set forth herein may be incorporated into kit.
[0273] In one example, the kit is a deoxyribonucleic acid (DNA) library preparation kit that includes a flow cell 50 including a non-patterned substrate 52, a polymeric hydrogel 54 over a portion of the non-patterned substrate 52, and a primer set attached to the polymeric hydrogel 54; a first fluid including a first carrier liquid and a first complementary primer 80 that is complementary to a first primer of the primer set 28 and that includes a first member of a binding pair at its 5’ end; a second fluid including a second carrier liquid and a plurality of particles 60 including a second member of the binding pair; and a third fluid including a third carrier liquid and a plurality of transposome dimers 90, each of the transposome dimers 90 including a second complementary primer 82 that is complementary to a second primer 30 of the primer set. In this example kit, any of the transposomes 10A, or 10B and 10C may be used.
[0274] In another example, the kit is a deoxyribonucleic acid (DNA) library preparation kit including a flow cell 50 including a non-patterned substrate 52 and a polymeric hydrogel 54 over at least a portion of the non-patterned substrate 52; a first fluid including a first carrier liquid and a reactive entity 56 including a first member of a binding pair at one end and a first polymeric hydrogel reactive group at an end opposed to the one end; a second fluid including a second carrier liquid and a plurality of particles 60 including a second member of the binding pair; and a third fluid including a third carrier liquid and a molecular scaffold 40 including a dendron 34 having a single focal point 36 and a plurality of peripheral groups 38 opposed to thesingle focal point 36, a transposome 90 attached to the single focal point 36, and a polymer chain 42 respectively attached to each of the plurality of peripheral groups 38, each polymer chain 42 including a second polymeric hydrogel reactive group at its end. In this example kit, any of the transposomes 10A, or 10B and 10C may be used.
[0275] To further illustrate the present disclosure, examples are given herein. It is to be understood that these examples are provided for illustrative purposes and are not to be construed as limiting the scope of the present disclosure. NON-LIMITING WORKING EXAMPLES
[0276] Example 1
[0277] Example DNA origamis in the shape of 70 nm by 100 nm rectangles were prepared using p7560 scaffold DNA and about 200 staples (short oligonucleotides used for hybridizing the large DNA scaffold molecule to form the origami). Biotin moieties were attached to each piece of example DNA origami. The example DNA origami is also referred to as biotinylated DNA origami.
[0278] Control DNA origamis were prepared in the same manner, but did not include the biotin moieties.
[0279] In one container, the example biotinylated DNA origamis were mixed with streptavidin coated mica beads and allowed to incubate for 30 min at room temperature. After incubation, these example beads were extracted from the example supernatant.
[0280] In another container, the control DNA origamis were mixed with streptavidin coated mica beads and allowed to incubate for 30 min at room temperature. After incubation, these control beads were extracted from the control supernatant.
[0281] The example beads with the biotinylated DNA origamis attached with streptavidin were exposed to Atomic Force Microscopy (AFM). An example of the AFM image (reproduced in black and white) is shown in Fig.11A. The image confirmed that a plurality of the example biotinylated DNA origami rectangles attached to the streptavidin coated mica beads. An enlarged view of one biotinylated DNA origami attached to a streptavidin coated mica bead is shown in Fig.11B. The biotinsthat were spaced in the origami were to streptavidin and are marked “B” in Fig. 11B. These results illustrate that the DNA origami can be attached to a surface, e.g., bead surfaces.
[0282] A comparative sample was then prepared in another container. For the comparative sample, the p7560 scaffold DNA was mixed with streptavidin coated mica beads and allowed to incubate for 30 min at room temperature. After incubation, the beads were extracted from the comparative supernatant.
[0283] The example supernatant, the control supernatant, and the comparative supernatant were exposed to gel electrophoresis. For the example supernatant, it was expected that the biotinylated DNA origamis would attach to the streptavidin coated beads, and so the gel should not show anything. For the control supernatant, it was expected that the control (non-biotinylated) DNA origamis would remain in solution and thus would show up in the gel. For the comparative supernatant, it was expected that the p7560 scaffold DNA would remain in solution and thus would show up in the gel. The gel electrophoresis results are shown in Fig.12. As expected, the example supernatant, shown as “+” under Biotin in Fig.12, exhibited no band (because the DNA origami was removed with the beads); the control supernatant, shown as “-” under Biotin in Fig.12 exhibited a band (because the DNA origamithe supernatant); and the comparative supernatant, shown as “Scaffold” in Fig.12 exhibited several bands (because the p7560 scaffold DNA remained in the supernatant).
[0284] Example 2
[0285] DNA origami in the shape of 70 nm by 100 nm rectangles were used in this example. Some of the DNA origami included no biotin anchor points. Some other of the DNA origami included two biotin anchor points, either at opposed ends of the origami or near the center of the origami. Separate staples were also used.
[0286] Tagged transposomes similar to 10B were used in this example. Each of the tagged transposomes included a biotin 5’ end functional group and an Alexa Fluor 647 fluorophore.
[0287] The following samples were (in a buffer containing MgCl) and exposed to gel electrophoresis i) DNA origami with 2 biotin anchor points at either end of the rectangle which were bound to streptavidin and the tagged transposomes, ii) DNA origami with 2 biotin anchor points in the middle of the rectangle which were bound to streptavidin and the tagged transposomes, iii) DNA origami without biotin anchor points and which had been incubated with the tagged transposomes, iv) DNA origami with 2 biotin anchor points at either end of the rectangle that had not been incubated with streptavidin or the tagged transposomes, v) DNA origami with 2 biotin anchor points in the middle of the rectangle that had not been incubated with streptavidin or the tagged transposomes, and vi) DNA origami without biotin anchor points plus streptavidin plus the transposomes. Fig.13 is an image of the gel electrophoresis results, which depict the Alexa Fluor 647 signal of any attached tagged transposomes. In Fig.13, each sample is identified by its roman numerals i-vi. The bands for samples i-iii (DNA origami with biotin anchor points plus streptavidin and the tagged transposomes) confirmed successful attachment of the tagged transposomes to the biotinylated DNA origami.
[0288] Example 3
[0289] DNA origami in the shape of 70 nm by 100 nm rectangles were used in this example. The DNA was also UV crosslinked. The example crosslinked DNA origami was biotinylated and the control crosslinked DNA origami was not biotinylated. Transposomes similar to those described in Example 2 were used in this example, except they did not include the Alexa Fluor 647 fluorophore.
[0290] The example and control crosslinked DNA origamis were respectively incubated with streptavidin and the transposomes in a buffer containing NaCl. After incubation, the example and control crosslinked DNA origamis were washed and exposed to a Fret assay with a fluorescently labelled double stranded DNA (dsDNA) substrate. During the Fret assay, dsDNA was respectively incubated with the example and control crosslinked DNA origamis. Both the example and control samples were exposed to conditions that should initiate a tagmentation reaction followed by conditions that should stop the tagmentation reaction. Following these reactions (ifthey took place), the short tagmented should melt and the fluorophore should diffuse away from the quencher and fluoresce. The Fret assay can thus be used to quantify tagmentation events. Tagmentation events were expected for the example crosslinked DNA origamis with bound streptavidin transposomes, but were not expected for the control crosslinked DNA origamis (i.e., no biotin to attach the transposomes). The Fret assay results are shown in Fig.14. As expected, the results for the example crosslinked DNA origamis had a higher signal than the control crosslinked DNA origamis. These results confirmed that the transposomes attached to the example crosslinked DNA origamis were active and could bind to dsDNA.
[0291] Additional Notes
[0292] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0293] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0294] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.
Claims
What is claimed is:
1. A molecular scaffold, comprising: a dendron having a single focal point and a plurality of peripheral groups opposed to the single focal point; a transposome dimer attached to the single focal point; and a polymer chain respectively attached to each of the plurality of peripheral groups.
2. The molecular scaffold as defined in claim 1, wherein the transposome dimer includes two transposomes, each of the two transposomes including: a forked adapter including a transferred strand and a non-transferred strand; a transposon end with a portion of the transferred strand hybridized to a portion of the non-transferred strand; the transferred strand including the portion and a first amplification domain; and the non-transferred strand including the portion and a second amplification domain.
3. The molecular scaffold as defined in one of claims 1-2, wherein the polymer chain has a molecular weight ranging from about 100 Daltons to about 110,000 Daltons.
4. The molecular scaffold as defined in one of claims 1-3, wherein a hydrodynamic radius of the dendron with the polymer chains attached ranges from about 100 nm to about 1,000 nm.
5. The molecular scaffold as defined in one of claims 1-4, wherein the transposome dimer is covalently attached to the single focal point.
6. The molecular scaffold as defined in one of claims 1-4, wherein the transposome dimer is hybridized to the single focal point.
7. The molecular scaffold as in one of claims 1 or 3-6, wherein: the transposome dimer includes two transposomes; a first of the two transposomes includes: a first transposon end with a portion of a first transferred strand hybridized to a first non-transferred strand; and the first transferred strand including a first amplification domain; and a second of the two transposomes includes: a second transposon end with a portion of a second transferred strand hybridized to a second non-transferred strand; and the second transferred strand including a second amplification domain.
8. A method, comprising: forming a suspension by: introducing a plurality of molecular scaffolds to a tagmentation buffer, each of the plurality of molecular scaffolds including: a dendron having a single focal point and a plurality of peripheral groups opposed to the single focal point; a transposome dimer attached to the single focal point; and a polymer chain respectively attached to each of the plurality of peripheral groups; introducing a DNA sample to the tagmentation buffer; and bringing the suspension to a tagmentation temperature, thereby tagmenting the DNA sample to form a plurality of partially adapted sample fragments.
9. The method as defined in claim 8, further comprising introducing a reaction inhibitor to the suspension, thereby stopping tagmentation of the DNA sample.
10. The method as defined in claim 9, further comprising initiating a gap fill ligation reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
11. The method as defined in further comprising releasing the plurality of fully adapted sample fragments from the plurality of molecular scaffolds.
12. The method as defined in claim 9, further comprising initiating an extension reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
13. The method as defined in claim 12, further comprising releasing the plurality of fully adapted sample fragments from the plurality of molecular scaffolds.
14. The method as defined in claim 9, wherein the reaction inhibitor is sodium dodecyl sulfate.
15. A deoxyribonucleic acid (DNA) library preparation kit, comprising: a flow cell including: a non-patterned substrate; a polymeric hydrogel over a portion of the non-patterned substrate; and a primer set attached to the polymeric hydrogel; a first fluid including: a first carrier liquid; and a first complementary primer that is complementary to a first primer of the primer set and that includes a first member of a binding pair at its 5’ end; a second fluid including: a second carrier liquid; and a plurality of particles including a second member of the binding pair; and a third fluid including: a third carrier liquid; and a plurality of transposome dimers, each of the transposome dimers including a second complementary primer that is complementary to a second primer of the primer set.
16. The DNA library preparation defined in claim 15, wherein the transposome dimer includes two transposomes, each of the two transposomes including: a forked adapter including a transferred strand and a non-transferred strand; a transposon end with a portion of the transferred strand hybridized to a portion of the non-transferred strand; the transferred strand including the portion and a first amplification domain; and the non-transferred strand including the portion and a second amplification domain.
17. The DNA library preparation kit as defined in claim 15, wherein: the transposome dimer includes two transposomes; a first of the two transposomes includes: a first transposon end with a portion of a first transferred strand hybridized to a first non-transferred strand; and the first transferred strand including a first amplification domain; and a second of the two transposomes includes: a second transposon end with a portion of a second transferred strand hybridized to a second non-transferred strand; and the second transferred strand including a second amplification domain.
18. The DNA library preparation kit as defined in one of claims 15-17, wherein: the first member of the binding pair is biotin; and the second member of the binding pair is streptavidin.
19. A method, comprising: introducing a plurality of first complementary primers to a flow cell at a hybridization temperature, the flow cell including: a non-patterned substrate; a polymeric hydrogel over at least a portion of the non-patterned substrate; anda primer set attached to hydrogel, whereby at least some of the plurality of first complementary primers respectively hybridize to first primers of the primer set and introduce a first member of a binding pair to the at least the portion of the non-patterned substrate; introducing, to the flow cell, a plurality of particles respectively including a second member of the binding pair, whereby at least some of the plurality of particles become bound at the at least the portion of the non-patterned substrate; introducing, to the flow cell, a plurality of transposome dimers respectively including a second complementary primer, whereby at least some of the plurality of transposome dimers diffuse through spaces between the at least some of the plurality of particles and respectively hybridize to a second primer of the primer set via the second complementary primers; and performing tagmentation of a DNA sample on the flow cell utilizing the at least some of the plurality of transposome dimers.
20. The method as defined in claim 19, wherein performing tagmentation of the DNA sample involves: introducing the DNA sample to the flow cell with a tagmentation buffer; and adjusting a temperature at a surface of the flow cell to a tagmentation temperature.
21. The method as defined in one of claims 19-20, further comprising exposing the flow cell to a wash solution after each of: the introduction of the plurality of first complementary primers, the introduction of the plurality of particles, and the introduction of the plurality of transposome dimers.
22. The method as defined in one of claims 19-21, wherein tagmentation generates a plurality of partially adapted sample fragments, and the method further comprises initiating a gap fill ligation reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
23. The method as defined in claims 19-21, wherein tagmentation generates a plurality of partially adapted sample fragments, and the method further comprises initiating an extension reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
24. The method as defined in one of claims 19-23, further comprising removing the plurality of particles prior to performing tagmentation of the DNA sample.
25. The method as defined in one of claims 19-23, wherein the plurality of particles remain bound during tagmentation of the DNA sample.
26. The method as defined in one of claims 19-25, wherein: the first member of the binding pair is biotin; and the second member of the binding pair is streptavidin.
27. A deoxyribonucleic acid (DNA) library preparation kit, comprising: a non-patterned substrate; a first fluid including: a first carrier liquid; and a plurality of each of first reactive entities and second reactive entities, the first reactive entities including a first binding pair member at one end and a first substrate reactive group at an end opposed to the one end and the second reactive entities including a second binding pair member at one end and a second substrate reactive group at an end opposed to the one end; a second fluid including: a second carrier liquid; and a plurality of particles including an other first binding pair member; and a third fluid including: a third carrier liquid; and a molecular scaffold including:a dendron having a focal point and a plurality of peripheral groups opposed to the single focal point; a transposome dimer attached to the single focal point; and a polymer chain respectively attached to each of the plurality of peripheral groups, each polymer chain including an other second binding pair member at its end.
28. The DNA library preparation kit as defined in claim 27, wherein the transposome dimer includes two transposomes, each of the two transposomes including: a forked adapter including a transferred strand and a non-transferred strand; a transposon end with a portion of the transferred strand hybridized to a portion of the non-transferred strand; the transferred strand including the portion and a first amplification domain; and the non-transferred strand including the portion and a second amplification domain.
29. The DNA library preparation kit as defined in claim 27, wherein: the transposome dimer includes two transposomes; a first of the two transposomes includes: a first transposon end with a portion of a first transferred strand hybridized to a first non-transferred strand; and the first transferred strand including a first amplification domain; and a second of the two transposomes includes: a second transposon end with a portion of a second transferred strand hybridized to a second non-transferred strand; and the second transferred strand including a second amplification domain.
30. The DNA library preparation kit as defined in one of claims 27-29, wherein: the first binding pair member and the other first binding pair member are resepctively an amine and a carboxylic acid;the second binding pair member the other first binding pair member are respectively an alkyne and an azide.
31. A method for using the DNA library preparation kit as defined in claim 27, the method comprising: introducing the plurality of each of the first reactive entities and the second reactive entities to the non-patterned substrate, whereby at least some of the first reactive entities respectively attach to the non-patterned substrate and introduce the first binding pair member to the at least the portion of the non-patterned substrate, and at least some of the second reactive entities respectively attach to the non-patterned substrate and introduce the second binding pair member to the at least the portion of the non-patterned substrate; introducing, to the non-patterned substrate, a plurality of particles respectively including the other first binding pair member, whereby at least some of the plurality of particles become bound at the at least the portion of the non-patterned substrate; introducing, to the non-patterned substrate, a plurality of the molecular scaffolds, whereby at least some of the molecular scaffolds diffuse through spaces between the at least some of the plurality of particles and respectively attach to the second binding pair member; and performing tagmentation of a DNA sample on the non-patterned substrate utilizing the transposome dimers of the at least some of the molecular scaffolds.
32. The method as defined in claim 31, wherein performing tagmentation of the DNA sample involves: introducing the DNA sample to the flow cell with a tagmentation buffer; and adjusting a temperature within the flow cell to a tagmentation temperature.
33. The method as defined in one of claims 31-32, further comprising exposing the flow cell to a wash solution after each of: the introduction of the plurality of each of the first reactive entities and the second reactive entities, the introduction of the plurality of particles, and the introduction of the plurality of molecular scaffolds.
34. The method as defined in one of claims 31-33, wherein tagmentation generates a plurality of partially adapted sample fragments, and the method further comprises initiating a gap fill ligation reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
35. The method as defined in one of claims 31-33, wherein tagmentation generates a plurality of partially adapted sample fragments, and the method further comprises initiating an extension reaction to form a plurality of fully adapted sample fragments from the plurality of partially adapted sample fragments.
36. The method as defined in one of claims 31-35, further comprising removing the plurality of particles prior to performing tagmentation of the DNA sample.
37. The method as defined in one of claims 31-35, wherein the plurality of particles remain bound during tagmentation of the DNA sample.
38. The method as defined in one of claims 31-37, wherein: the first binding pair member and the other first binding pair member are respectively an amine and a carboxylic acid; the second binding pair member and the other first binding pair member are respectively an alkyne and an azide.
39. A molecular scaffold, comprising: a dendron having a single focal point and a plurality of peripheral groups opposed to the single focal point; a nucleic acid adapter attached to the single focal point, the nucleic acid adapter including an amplification domain sequence and a sequencing primer sequence; and a polymer chain respectively attached to each of the plurality of peripheral groups.
40. The molecular scaffold as defined in claim 39, wherein the polymer chain has a molecular weight ranging from about 100 Daltons to about 110,000 Daltons.
41. The molecular scaffold as defined in one of claims 39-40, wherein a hydrodynamic radius of the dendron with the polymer chains attached ranges from about 100 nm to about 1,000 nm.
42. The molecular scaffold as defined in one of claims 39-41, wherein the nucleic acid adapter is covalently attached to the single focal point.
43. The molecular scaffold as defined in one of claims 39-41, wherein nucleic acid adapter is hybridized to the single focal point.
44. A method of using the molecular scaffold of claim 39, the method comprising: forming a suspension by introducing a plurality of the molecular scaffolds to a ligation buffer; introducing DNA sample fragments to the ligation buffer; and bringing the suspension to a ligation temperature, thereby respectively ligating the nucleic acid adapters to the DNA sample fragments.
45. A method of using the molecular scaffold of claim 39, the method comprising: introducing a plurality of reactive entities to a flow cell, the flow cell including: a non-patterned substrate; and a polymeric hydrogel over at least a portion of the non-patterned substrate; whereby at least some of the plurality of reactive entities respectively attach to the polymeric hydrogel and introduce a first member of a binding pair to the at least the portion of the non-patterned substrate;introducing, to the flow cell, a of particles respectively including a second member of the binding pair, whereby at least some of the plurality of particles become bound at the at least the portion of the non-patterned substrate; introducing, to the flow cell, a plurality of the molecular scaffolds, wherein each of the polymer chains includes a polymeric hydrogel reactive end group, and whereby at least some of the molecular scaffolds diffuse through spaces between the at least some of the plurality of particles and respectively attach to the polymeric hydrogel through the polymeric hydrogel reactive end group; and ligating the nucleic acid adapters of the at least some of the molecular scaffolds to DNA sample fragments introduced into the flow cell.
46. A tagmentation apparatus, comprising: a substrate; a plurality of deoxyribonucleic acid (DNA) origami structures attached to the substrate; and a transposome dimer attached to each of the plurality of DNA origami structures, wherein each transposome dimer is separated from each other transposome dimer by a distance of at least 70 nm.
47. The tagmentation apparatus as defined in claim 46, wherein: the substrate includes a plurality of depressions defined therein and separated by interstitial regions; and each of the plurality of depressions includes a respective one of the plurality of DNA origami structures.
48. The tagmentation apparatus as defined in claim 47, wherein each of the plurality of DNA origami structures has two transposome dimers attached thereto.
49. The tagmentation apparatus as defined in claim 46, wherein: the substrate includes a plurality of depressions defined therein and separated by interstitial regions; andeach of the plurality of two of the plurality of DNA origami structures.
50. The tagmentation apparatus as defined in one of claims 46-49, wherein each of the plurality of DNA origami structures include a linking moiety, and are linked together in a predetermined arrangement.
51. The tagmentation apparatus as defined in claim 46, wherein the substrate is a bead.
52. The tagmentation apparatus as defined in claim 46, wherein each of the plurality of DNA origami structures has a recess.
53. A DNA size exclusion method, comprising: contacting a DNA sample and a tagmentation buffer with a tagmentation apparatus including: a substrate; a plurality of deoxyribonucleic acid (DNA) origami structures attached to the substrate; and a transposome dimer attached to each of the plurality of DNA origami structures, wherein each transposome dimer is separated from each other transposome dimer by a distance of at least 70 nm; and initiating tagmentation of the DNA sample with at least some of the transposome dimers, thereby generating partially adapted DNA sample fragments having a minimum size ranging from amount 210 base pairs to about 300 base pairs.
54. The method as defined in claim 53, wherein: the tagmentation apparatus is a flow cell; and initiating tagmentation involves increasing a temperature of the tagmentation buffer in the flow cell to a tagmentation temperature.
55. The method as defined in wherein: the tagmentation apparatus is a bead; and initiating tagmentation involves increasing a temperature of the tagmentation buffer to a tagmentation temperature.