Molecular marker associated with cold resistance of corn and use thereof

Abstract

The present invention relates to the technical field of molecular markers, in particular to a molecular marker associated with cold resistance of corn and the use thereof. The molecular marker associated with the cold resistance of corn is ZmTIP4;3, and is obtained by amplification using primers shown as SEQ ID NO. 1 and SEQ ID NO. 2. Since the cold resistance of corn is a quantitative trait, phenotype analysis is time-consuming and labor-consuming. The molecular marker can be applied to cold-resistant corn breeding, and identification can be achieved in the corn seed stage or the early stage of cotyledon emergence, which saves time and is accurate, thus accelerating the process of breeding cold-resistant corn varieties.

Description

Molecular markers linked to cold tolerance in maize and their applications

[0001] Cross-references

[0002] This application claims priority to Chinese Patent Application No. 2024102915738, filed on March 14, 2024, entitled “Molecular markers linked to cold tolerance of corn and their applications,” the disclosure of which is incorporated herein by reference in its entirety. Technical Field

[0003] The present invention relates to the technical field of molecular markers, in particular to molecular markers linked to corn cold tolerance and applications thereof. Background Art

[0004] Corn has a high yield and high demand, but as a thermophilic C4 crop, it is extremely sensitive to temperature. Chilling damage can cause abnormalities in the corn plant's membrane structure, photosynthetic organs, and reproductive organs, impacting its physiological metabolism. Chilling damage also produces harmful substances that affect corn growth and development, leading to yield reductions. Chilling damage is one of the most important abiotic stresses for crops.

[0005] Previous studies have shown significant differences in cold tolerance among different maize inbred lines. Scientists generally believe that this variation reflects a combination of multiple physiological cold tolerance traits, a quantitative trait controlled by multiple genes. Based on this, some studies have attempted to identify relevant genes through GWAS and QTL analysis, but most have only achieved preliminary identification or candidate gene identification. The development of molecular markers for cold tolerance in maize would provide a more convenient means for breeding cold-tolerant maize varieties.

[0006] Therefore, it is necessary to further explore and study the molecular markers of corn cold tolerance.

[0007] Summary of the Invention

[0008] The present invention provides a molecular marker linked to cold tolerance of maize and its application. The specific invention content is as follows.

[0009] In a first aspect, the present invention provides a molecular marker ZmTIP4;3 linked to maize cold tolerance, which is amplified by primers shown as SEQ ID NO.1 and SEQ ID NO.2.

[0010] In a second aspect, the present invention provides primers or primer combinations for amplifying the above-mentioned molecular markers.

[0011] Preferably, the primer or primer combination includes primers shown as SEQ ID NO.1 and SEQ ID NO.2.

[0012] In a third aspect, the present invention provides a reagent or kit containing the above-mentioned primer or primer combination.

[0013] In a fourth aspect, the present invention provides the use of the molecular marker ZmTIP4;3, the primer or primer combination, or the reagent or kit in at least one of the following aspects:

[0014] (1) Identify the cold tolerance phenotype of maize;

[0015] (2) identification, improvement, or molecular marker-assisted breeding of maize germplasm resources;

[0016] (3) Early prediction of corn cold tolerance traits;

[0017] (4) Screening or creating corn with different cold tolerance traits;

[0018] (5) Genotyping of cold tolerance in maize.

[0019] In a fifth aspect, the present invention provides a method for identifying a cold tolerance phenotype of corn, comprising:

[0020] The corn DNA to be identified is used as a template, and PCR amplification is performed using the primers shown in SEQ ID NO.1 and SEQ ID NO.2. The corn cold tolerance phenotype is identified based on the amplified product.

[0021] Preferably, the corn cold tolerance phenotype is identified based on the size of the amplified product band.

[0022] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 94°C to 95°C for 1 to 3 minutes, denaturation at 94°C to 95°C for 20 to 40 seconds, annealing at 54°C to 60°C for 20 to 40 seconds, extension at 70°C to 74°C for 20 to 30 seconds, 30 to 40 cycles from denaturation to extension, and finally extension at 70°C to 74°C for 5 to 10 minutes.

[0023] Preferably, if the amplified product band size is 702 bp, it is determined that the corn to be identified has high cold tolerance.

[0024] Preferably, if the amplified product contains the nucleotide sequence shown in SEQ ID No. 4, it is determined that the corn to be identified has high cold tolerance.

[0025] Preferably, if the amplified product band size is 374 bp, the corn to be identified is judged to be cold-sensitive.

[0026] Preferably, if the amplified product contains the nucleotide sequence shown in SEQ ID No. 5, the corn to be identified is determined to be cold-sensitive.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention identifies a small insertion or deletion in the promoter of the cold-tolerance ZmTIP4;3 gene, linked to maize cold tolerance. The insertion or deletion of this small fragment can serve as a molecular marker for maize cold tolerance. The present invention also provides a primer pair for detecting the maize cold tolerance molecular marker and a method for detecting cold tolerance in maize.

[0029] Since corn cold tolerance is a quantitative trait, phenotypic analysis is time-consuming and labor-intensive. The above-mentioned molecular markers and primer pairs can be applied to corn cold tolerance breeding. They can be identified during the corn seed period or the early stage of cotyledon growth, which is time-saving and accurate, and can accelerate the breeding process of corn cold-tolerant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] A in Figure 1 is an analysis of the association between natural variation of ZmTIP4;3 in 197 maize inbred line materials and relative leaf injury under low temperature stress, wherein ZmTIP4;3 represents the gene number in the maize GDB V4 library; Indel-41 represents the ZmTIP4;3-InDel of the present invention; based on Indel-41 in A (328bp insertion and deletion), the 197 maize inbred lines were divided into two haplotypes, Hap1 and Hap2.

[0031] B in Figure 1 is the leaf injury comparison result of the maize inbred line with ZmTIP4;3-InDel insertion (Hap2 cold-tolerant genotype) and the maize inbred line without ZmTIP4;3-InDel insertion (Hap1 may be cold-sensitive type), where the vertical axis is the percentage of leaf injured area.

[0032] Figure 2 shows the 328bp nucleotide sequences that differ between some anti-allergenic materials (such as 384-2, 4019).

[0033] FIG3 shows the results of PCR amplification using primer pair I in 4019 and 384-2; wherein the marker is a 2000 bp molecular weight standard marker from Polymer Corporation. DETAILED DESCRIPTION

[0034] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0035] Where specific techniques or conditions are not specified in the examples, all methods were performed according to conventional methods, techniques or conditions described in literature in the field, or according to product specifications. Reagents and instruments used, for which the manufacturers are not specified, are conventional products that can be purchased through regular channels.

[0036] Example 1

[0037] In this example, transgenic maize lines overexpressing 700 genes were screened for their cold-resistance phenotypes at the seedling stage. This screening yielded a series of overexpression lines with varying degrees of cold tolerance compared to the wild type. Ultimately, one gene (ZmTIP4;3) was selected for subsequent experiments. Specifically, a loss-of-function mutant of the ZmTIP4;3 gene, whose coding region is 750 bp in length (detailed sequence shown in SEQ ID No. 3), exhibited a higher cold-resistance phenotype than the wild type.

[0038] In order to screen DNA sequence variations suitable for cold-tolerance molecular markers, this example resequencing analysis was performed on the coding region and promoter region (1.3kb) of ZmTIP4;3 in 197 maize inbred lines from different temperature zones (published in: Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels, 2013, Nature Genet 45:1). A total of 127 natural variations (non-synonymous mutations) were identified, including 114 SNP sites and 13 InDels (MAF ≥ 5%). Association analysis (TASSEL5.0) was performed on these natural variations and their correlation with leaf damage in different maize inbred lines under low temperature. The results showed that a 328bp insertion / deletion was most highly correlated with leaf damage (-log 10 (P) = 3.85), see A in Figure 1 (for the specific sequence, see SEQ ID No. 6), and the insertion / deletion fragment was named ZmTIP4;3-InDel.

[0039] The ZmTIP4;3 gene (SEQ ID No. 3) was sequenced using the Illumina sequencing platform (sequencing was performed at Beijing Huada Science & Technology Co., Ltd.) from 197 maize inbred lines from different temperature zones. Comparative analysis of the sequencing data revealed the presence of a 328-bp insertion in the ZmTIP4;3 gene in 20 cold-tolerant inbred lines, represented by 384-2. The identification of the 328-bp nucleotide sequence that differed between some of the allergy-resistant lines is shown in Figure 2.

[0040] The cold tolerance phenotype tests of the above 197 maize inbred lines are as follows:

[0041] 197 maize inbred lines grown at 25°C for 14 days were cold-treated at 4°C for 3 days, followed by another 2-day growth recovery at 25°C. The second leaf of each inbred line was unfolded and affixed to an A4 sheet of paper, with at least three technical replicates for each inbred line. The A4 sheets with leaves were then photographed. The photographs were imported into Image J software, and the total area and injured area were calculated. The leaf injury ratio was calculated as injured area / total area * 100%. The results of the three independent replicates were similar. P < 0.05 was significant. Detailed test results are shown in Table 1 and Figure 1B. All inbred lines lacking this 328 bp fragment were cold-tolerant and suitable for molecular markers. Combined with sequencing results, maize inbred lines lacking this 328 bp fragment were classified as haplotype Hap1, while those with this 328 bp fragment were classified as haplotype Hap2.

[0042] Table 1

[0043] Example 2 Obtaining a fragment inserted into the ZmTIP4;3 promoter of maize ZmTIP4;3 gene (ZmTIP4;3-InDel)

[0044] Based on the sequencing results of Example 1, a primer pair I was designed in this example: ZmTIP4; 3-F1 / ZmTIP4; 3-InDel-R1. The primer sequences are:

[0045] ZmTIP4;3-F1:AGAATAACGTGCGTGCCTCA (SEQ ID No. 1)

[0046] ZmTIP4;3-InDel-R1:TTTTGCTGCCGGTGATTACG (SEQ ID No. 2).

[0047] Using ZmTIP4;3-F1 / ZmTIP4;3-InDel-R1 as primers and genomic DNA of 384-2 as a template, amplification was performed using Taq DNA polymerase from PolyMei Biotechnology Co., Ltd. (PCR system 50 μL: 2× Super Multiplex PCR Mix 25 μL, 10 μM primer ZmTIP4;3-F1 2.5 μL, 10 μM primer ZmTIP4;3-InDel-R1 2.5 μL, DNA 2.0 μL, ddH2O 18 μL; PCR program: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s, 34 cycles of denaturation and extension, and final extension at 72°C for 5 min). The PCR product was sent to Beijing BGI Biotechnology Co., Ltd. for sequencing. The results are shown in FIG2 . The specific sequence of the ZmTIP4;3-InDel insertion is shown in SEQ ID No. 6.

[0048] Example 3 ZmTIP4;3-InDel insertion or deletion in the maize cold tolerance gene ZmTIP4;3 as a molecular marker

[0049] Because the insertion of ZmTIP4;3-InDel only exists in cold-tolerant maize inbred lines (such as 384-2), the deletion of ZmTIP4;3-InDel can be used as a molecular marker to determine whether an individual is cold-tolerant.

[0050] Primer pair I consisted of primers ZmTIP4;3-F1 (forward, SEQ ID No. 1), designed based on the flanking sequences of the ZmTIP4;3-InDel insertion, and ZmTIP4;3-InDel-R1 (reverse, SEQ ID No. 2), designed based on the ZmTIP4;3-InDel sequence. PCR amplification was performed using genomic DNA from the cold-tolerant maize inbred line 384-2 and the relatively cold-sensitive maize inbred line 4019, respectively. The PCR system (20 μL) consisted of 10 μL of 2× Super Multiplex PCR Mix, 1 μL of 10 μM primer ZmTIP4;3-F1, 1 μL of 10 μM primer ZmTIP4;3-InDel-R1, 1 μL of DNA, and 7 μL of ddH2O. PCR program: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 34 cycles from denaturation to extension, and final extension at 72°C for 5 min.

[0051] The results showed that the primer pair amplified a 702-bp band (see SEQ ID No. 4 for the detailed sequence) using total DNA from the cold-tolerant maize inbred line 384-2 as a template for PCR amplification, and a 374-bp band (see SEQ ID No. 5 for the detailed sequence) using total DNA from the maize inbred line 4019 as a template for PCR amplification, as shown in Figure 3. Therefore, primer pair I can be used for molecular-assisted breeding of cold-tolerant maize, and the cold-tolerant molecular marker based on primer pair I was named ZmTIP4;3.

[0052] Example 4 Detecting whether corn is cold-tolerant using cold-tolerant molecular markers

[0053] In this example, nine maize inbred line materials (including some maize backbone inbred lines, which have been published in Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels, 2013, Nature Genet 45:1) were selected for detection. PCR amplification was performed using the maize genomic DNA to be tested as a template using primer pair 1 for detecting the cold-resistant molecular marker of the present invention in Example 2. The results, except for 384-2, only a 374bp band was amplified. The names of the inbred lines used and the identification results are shown in Table 2 below.

[0054] Table 2 “+” indicates that the PCR product size is 702 bp; “-” indicates that the PCR product size is 374 bp.

[0055] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention. Industrial Applicability

[0056] The present invention provides a molecular marker linked to cold tolerance in maize and its application. The molecular marker linked to cold tolerance in maize is ZmTIP4;3, amplified using primers shown in SEQ ID NOs. 1 and 2. Since cold tolerance in maize is a quantitative trait, phenotypic analysis is time-consuming and labor-intensive. The molecular marker of the present invention can be applied to cold tolerance breeding in maize. It can be identified during the seed stage or early cotyledon emergence, saving time and accuracy. This can accelerate the breeding of cold-tolerant maize varieties and has significant economic value and application prospects.

Claims

1. Molecular marker ZmTIP4 linked to maize cold tolerance; 3, characterized in that, It was amplified using primers shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. A primer or primer combination, characterized in that It is used to amplify the molecular marker ZmTIP4;3 described in claim 1.

3. The primer or primer combination according to claim 2, characterized in that The primers include those shown in SEQ ID NO. 1 and SEQ ID NO.

2.

4. A reagent or a kit, characterized in that It contains the primer or primer combination according to claim 2 or 3.

5. The molecular marker ZmTIP4 according to claim 1; 3. Use of the primer or primer combination according to claim 2 or 3, or the reagent or kit according to claim 4 in at least one of the following aspects: (1) Identify the cold tolerance phenotype of maize; (2) identification, improvement, or molecular marker-assisted breeding of maize germplasm resources; (3) Early prediction of corn cold tolerance traits; (4) Screening or creating corn with different cold tolerance traits; (5) Genotyping of cold tolerance in maize.

6. A method for identifying the cold tolerance phenotype of corn, characterized in that: include: The corn DNA to be identified is used as a template, and PCR amplification is performed using the primers shown in SEQ ID NO.1 and SEQ ID NO.

2. The corn cold tolerance phenotype is identified based on the amplified product.

7. The method according to claim 6, characterized in that The cold tolerance phenotype of maize was identified based on the size of the amplified product band.

8. The method according to claim 6 or 7, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 94°C to 95°C for 1 to 3 minutes, denaturation at 94°C to 95°C for 20 to 40 seconds, annealing at 54°C to 60°C for 20 to 40 seconds, extension at 70°C to 74°C for 20 to 30 seconds, 30 to 40 cycles from denaturation to extension, and finally extension at 70°C to 74°C for 5 to 10 minutes.

9. The method according to claim 8, characterized in that If the amplified product has a band size of 702 bp or contains the nucleotide sequence shown in SEQ ID No. 4, it is determined that the corn to be identified has high cold tolerance.

10. The method according to claim 8, characterized in that If the amplified product has a band size of 374 bp or contains the nucleotide sequence shown in SEQ ID No. 5, the corn to be identified is determined to be a cold-sensitive type.

Images