Polypeptide and use thereof in construction of bispecific antibody containing common light chain

Abstract

A polypeptide derived from a light chain variable region or a light chain of a specific anti-c-Met humanized antibody. The polypeptide can be used as a common light chain of a bispecific antibody, together with the heavy chain variable region or heavy chain of an antibody having a binding affinity and / or specificity to other target proteins (such as EGFR), to construct the bispecific antibody. An anti-EGFR and / or c-Met antibody, the antibody containing a common light chain variable region or light chain.

Description

A polypeptide and its use in constructing a bispecific antibody containing a common light chain

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This patent application claims the benefit of priority to Chinese invention patent application number CN202410331237.1 filed on March 22, 2024, the entire contents of which are hereby incorporated by reference for all purposes. Technical Field

[0003] The present invention relates to the field of biomedicine, and in particular, to a peptide and its use as an antibody light chain, as well as an anti-EGFR and / or c-Met antibody comprising the peptide as a common light chain. Background Art

[0004] Somatic mutations in the epidermal growth factor receptor (EGFR) are among the most common oncogenic drivers in cancers such as non-small cell lung cancer (NSCLC), metastatic colorectal cancer, glioblastoma, head and neck cancer, pancreatic cancer, and breast cancer, and are particularly prominent in non-small cell lung cancer. Although molecular targeted drugs targeting the EGFR signaling pathway have demonstrated strong clinical efficacy, patients often develop resistance, and resistance mechanisms are often unavoidable. For example, studies have found that non-small cell lung cancer cells harboring EGFR mutations acquire resistance to EGFR tyrosine kinase inhibitors (EGFR-TKIs) through multiple pathways, including activation of the c-Met receptor pathway.

[0005] Among these mechanisms, the c-MET receptor is closely related to EGFR resistance. c-MET is a hepatocyte growth factor (HGF) receptor with tyrosine kinase activity. The c-MET proto-oncogene bypasses the inhibited EGFR phosphorylation pathway through pathways such as ERBB3-PI3K-AKT and MAPK-ERK1 / 2T, resulting in an amplification effect. This amplified c-MET activates downstream signal transduction through bypass, avoiding the effects of EGFR-TKIs, promoting continued cancer cell proliferation, and ultimately leading to patient resistance to EGFR-TKIs. c-MET is usually lowly expressed or not expressed in most normal tissues, but its high expression can be seen in tumor tissues such as lung cancer, liver cancer, pancreatic cancer, and thyroid cancer.

[0006] For dual-target therapy of EGFR and c-MET, the use of bispecific antibodies can effectively block the signal transduction of these two receptors at the same time, inhibiting tumor growth and survival. At the same time, this type of antibody can also enhance antibody-dependent cell-mediated cytotoxicity (ADCC), thereby increasing the potential to kill tumor cells. Studies have shown that this type of bispecific antibody can bind to EGFR and c-MET simultaneously and trigger the co-degradation of these two target receptors in various tumor cells, while monoclonal antibodies used alone or in combination cannot achieve this effect. Because the mechanism of bispecific antibodies depends on the co-expression of EGFR and c-MET, dual-target bispecific antibodies have lower toxicity and greater therapeutic advantages compared to simple EGFR inhibitors.

[0007] The current conventional method for preparing bispecific antibodies often requires the simultaneous transfection of four plasmids to express two different heavy chains and two light chains, respectively. However, when these four polypeptide chains are assembled into antibodies, there may be a problem of light and heavy chain mispairing. Various strategies have been proposed in this field to solve the mispairing of light and heavy chains during the assembly of bispecific antibodies; among these strategies, it has been proposed that the same polypeptide can be used as a common light chain to pair with the heavy chains of antibodies targeting two different target proteins (such as EGFR and c-MET), thereby constructing a bispecific antibody with binding affinity and specificity for both target proteins. The resulting bispecific antibody is structurally similar to a traditional monoclonal antibody; furthermore, it can be seen that the polypeptide can also be used as a common light chain to pair with heavy chains derived from antibodies to more target proteins, thereby constructing antibodies with binding affinity and specificity for more different target proteins. Summary of the Invention

[0008] The present invention aims to provide a polypeptide that, as an antibody light chain variable region or light chain, can be combined with a heavy chain variable region or heavy chain of an antibody having binding affinity and / or specificity for a target protein (antigen), or with two or even more heavy chain variable regions or heavy chains of antibodies each having binding affinity and / or specificity for different target proteins (antigens), to construct an antibody. Another object of the present invention is to provide an antibody comprising the polypeptide as a light chain variable region or light chain, for example, an antibody in the form of a homodimer or heterodimer.

[0009] The technical solutions of the present invention are as follows.

[0010] In a first aspect, the present invention provides a polypeptide, wherein the amino acid sequence of the polypeptide comprises: the amino acid sequence shown in SEQ ID NO.40; the amino acid sequence shown in SEQ ID NO.41; and the amino acid sequence shown in SEQ ID NO.42.

[0011] Furthermore, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.20.

[0012] Furthermore, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.29.

[0013] The polypeptide provided by the present invention can be used as the light chain variable region or light chain of an antibody, and can be respectively combined with the heavy chain variable region or heavy chain of an antibody having binding affinity and / or specificity for different target proteins (antigens) to construct an antibody, wherein the antibody retains or has stronger binding affinity and / or specificity for the target protein (antigen) and corresponding biological activity, etc.

[0014] The constructed antibody can have any structural form, such as a monoclonal antibody or an antibody form such as scFv, dsFv, (dsFv)2, Fab, Fab', F(ab')2 or Fv. For example, the polypeptide as the light chain variable region or light chain of an antibody can be respectively combined with the heavy chain variable region or heavy chain of an antibody having binding affinity and / or specificity for a target protein (antigen) to construct an antibody that still has binding affinity and / or specificity for the target protein (antigen), and the antibody is an antibody in the form of a homodimer having two identical heavy chains and two identical light chains (a monospecific antibody). Alternatively, for example, the polypeptide as the light chain variable region or light chain of an antibody can be combined with the heavy chain variable region or heavy chain of two antibodies that have binding affinity and / or specificity for two target proteins (antigens) to construct an antibody that still has binding affinity and / or specificity for the two target proteins (antigens), and the antibody is an antibody in the form of a heterodimer having two different heavy chains and two identical light chains (a bispecific antibody). Furthermore, the polypeptide provided by the present invention can also be used to construct multispecific antibodies having binding affinity and / or specificity for more target proteins (antigens).

[0015] In a second aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of the first aspect.

[0016] In a third aspect, the present invention provides use of the polypeptide described in the first aspect or the nucleic acid molecule described in the second aspect in constructing an antibody.

[0017] Experiments have shown that, as an antibody light chain or light chain variable region, the polypeptide provided in the first aspect of the present invention can be combined with the heavy chain or antibody heavy chain variable region of an antibody having binding affinity and / or specificity for a different target protein (antigen) to construct a new antibody, wherein the antibody retains (or even has stronger) binding affinity and / or specificity for the target protein (antigen) as well as biological activity, etc.

[0018] According to a specific embodiment of the present invention, the target protein can be epidermal growth factor receptor (EGFR) or hepatocyte growth factor receptor (c-Met or HGFR). In the context of the present invention, the epidermal growth factor receptor or hepatocyte growth factor receptor can be mammalian, primate or rodent, more preferably human EGFR or c-Met (HGFR).

[0019] Accordingly, as described above in the first aspect, the constructed antibody can be an antibody in the form of a homodimer having two identical heavy chains and two identical light chains, or an antibody in the form of a heterodimer having two different heavy chains and two identical light chains. The polypeptide can be used as the light chain or light chain variable region of the antibody.

[0020] In a fourth aspect, the present invention provides an antibody or an antigen-binding fragment thereof, wherein the antibody or the antigen-binding fragment thereof comprises the polypeptide provided in the first aspect of the present invention; wherein the polypeptide can serve as the light chain variable region or light chain of the antibody or the antigen-binding fragment thereof.

[0021] In the context of the present invention, the antigen-binding fragment is any functional fragment of an antibody that can specifically bind to a target protein. In the context of the present invention, "target protein" and "antigen" can be used interchangeably.

[0022] The antibodies or antigen-binding fragments thereof provided by the present invention may be IgG-like antibodies, or may be antibody forms such as scFv, dsFv, (dsFv)2, Fab, Fab', F(ab')2 or Fv. In the present invention, "IgG-like antibody" refers to an antibody or antigen-binding fragment thereof having two Fab arms and an optional Fc region, which is a traditional monoclonal antibody (mAb) structure or a similar structure. In the present invention, "Fab arm" refers to a Fab fragment (Antigen-binding fragment), which is composed of a complete light chain (variable region and constant region) and a partial heavy chain structure (variable region and a constant region fragment), and the light chain and the heavy chain are connected by a disulfide bond.

[0023] Thus, for example, the antibody or antigen-binding fragment provided herein comprises the amino acid sequence provided in the first aspect of the present invention in its light chain variable region as light chain CDRs; or, the antibody or antigen-binding fragment provided herein comprises the amino acid sequence shown in SEQ ID NO. 20 as a light chain variable region (VL). Alternatively, the antibody or antigen-binding fragment provided herein comprises the amino acid sequence shown in SEQ ID NO. 29 as a light chain.

[0024] Furthermore, the antibody or antigen-binding fragment thereof may further comprise a heavy chain variable region (VH), wherein the heavy chain variable region and the light chain variable region form a binding domain for a target protein. According to a specific embodiment of the present invention, the target protein may be epidermal growth factor receptor (EGFR) or hepatocyte growth factor receptor (c-Met or HGFR).

[0025] According to a specific embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises the following heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and light chain CDRs (LCDR1, LCDR2 and LCDR3), respectively:

[0026] (1) HCDR1 comprising the amino acid sequence of SEQ ID NO. 36, HCDR2 comprising the amino acid sequence of SEQ ID NO. 38, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 39; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 40, LCDR2 comprising the amino acid sequence of SEQ ID NO. 41, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 42;

[0027] (2) HCDR1 comprising the amino acid sequence of SEQ ID NO.30, HCDR2 comprising the amino acid sequence of SEQ ID NO.43, and HCDR3 comprising the amino acid sequence of SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.40, LCDR2 comprising the amino acid sequence of SEQ ID NO.41, and LCDR3 comprising the amino acid sequence of SEQ ID NO.42; or

[0028] (3) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.42.

[0029] Furthermore, the antibody or antigen-binding fragment thereof may comprise a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region respectively comprise:

[0030] (1) the amino acid sequence shown in SEQ ID NO. 13; and the amino acid sequence shown in SEQ ID NO. 14;

[0031] (2) the amino acid sequence shown in SEQ ID NO.19; and the amino acid sequence shown in SEQ ID NO.20;

[0032] (3) the amino acid sequence shown in SEQ ID NO.15; and the amino acid sequence shown in SEQ ID NO.20; or

[0033] (4) The amino acid sequence shown in SEQ ID NO. 17; and the amino acid sequence shown in SEQ ID NO. 20.

[0034] The antibody or antigen-binding fragment thereof may be a murine antibody, a chimeric antibody, or a humanized antibody; and may further comprise a heavy chain constant region and a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be an IgG1 or IgG4 heavy chain constant region; and the light chain constant region may be a kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.21 (hIgG1); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22 (hkappa). Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.23 (hIgG1; Knob) or SEQ ID NO.24 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22.

[0035] The antibody or antigen-binding fragment thereof provided by the present invention may have at least two VH+VL domain combinations (further, two Fab arms), and the domain combinations may be identical to each other, thereby binding to the same target protein (antigen). In this case, the antibody or antigen-binding fragment thereof comprises the same amino acid sequence combination selected from HCDR1 to HCDR3 and LCDR1 to LCDR3 provided above (1) to (3) in at least two VH+VL domain combinations, or comprises the same amino acid sequence combination selected from the heavy chain and light chain variable regions provided above (1) to (4). The antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and a light chain constant region. For example, as described above, the heavy chain constant region comprises the amino acid sequence shown in SEQ ID NO.21; the light chain constant region comprises the amino acid sequence shown in SEQ ID NO.22. Further, the antibody or antigen-binding fragment thereof has a heavy chain and a light chain, for example, is a monoclonal antibody having two identical heavy chains and two identical light chains.

[0036] Alternatively, the at least two VH+VL domain combinations (further, at least two Fab arms) of the antibody or antigen-binding fragment thereof provided by the present invention may be different, thereby binding to different target proteins (antigens). In this case, the antibody comprises different amino acid sequence combinations of HCDR1 to HCDR3 and LCDR1 to LCDR3 selected from the group consisting of (1) to (3) above, or comprises different amino acid sequence combinations of the heavy chain and light chain variable regions selected from the group consisting of (1) to (4) above. In this case, it is preferred that the at least two VH+VL domain combinations (further, at least two Fab arms) of the antibody or antigen-binding fragment thereof comprise the same light chain CDRs sequence combination, or comprise the same light chain VL sequence. For example, the at least two VH+VL domain combinations (further, at least two Fab arms) all have: LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40; LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41; and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.42. Further, for example, the two VH+VL domain combinations (further, two Fab arms) both have: a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.20.

[0037] According to a specific embodiment of the present invention, the antibody or antigen-binding fragment thereof comprises:

[0038] (1) a first VH+VL domain combination (further, a Fab arm) that binds to c-Met, wherein the first VH+VL domain combination comprises: a HCDR1 comprising the amino acid sequence of SEQ ID NO.36, a HCDR2 comprising the amino acid sequence of SEQ ID NO.38, and a HCDR3 comprising the amino acid sequence of SEQ ID NO.39; and a LCDR1 comprising the amino acid sequence of SEQ ID NO.40, a LCDR2 comprising the amino acid sequence of SEQ ID NO.41, and a LCDR3 comprising SEQ ID NO.42; and

[0039] A second VH + VL domain combination (further, a Fab arm) that binds to EGFR, wherein the second VH + VL domain combination has: a HCDR1 comprising the amino acid sequence shown in SEQ ID NO.30, a HCDR2 comprising the amino acid sequence shown in SEQ ID NO.43, and a HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, a LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40, a LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41, and a LCDR3 comprising SEQ ID NO.42; or

[0040] (2) a first VH+VL domain combination (further, a Fab arm) that binds to c-Met, wherein the first VH+VL domain combination comprises: a HCDR1 comprising the amino acid sequence of SEQ ID NO.36; a HCDR2 comprising the amino acid sequence of SEQ ID NO.38; and a HCDR3 comprising the amino acid sequence of SEQ ID NO.39; and, a LCDR1 comprising the amino acid sequence of SEQ ID NO.40; a LCDR2 comprising the amino acid sequence of SEQ ID NO.41; and a LCDR3 comprising the amino acid sequence of SEQ ID NO.42; and

[0041] A second VH+VL domain combination (further, a Fab arm) that binds to EGFR, wherein the second VH+VL domain combination has: a HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, a HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and a HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, a LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40; a LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41; and a LCDR3 comprising the amino acid sequence shown in SEQ ID NO.42.

[0042] According to a specific embodiment of the present invention, further, the antibody or antigen-binding fragment thereof comprises:

[0043] (1) a first VH+VL domain combination (further, a Fab arm) that binds to c-Met, wherein the first VH+VL domain combination comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 19, and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 20; and

[0044] a second VH+VL domain combination (further, a Fab arm) that binds to EGFR, wherein the second VH+VL domain combination comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO.15, and a light chain variable region comprising the amino acid sequence of SEQ ID NO.20; or

[0045] (2) a first VH+VL domain combination (further, a Fab arm) that binds to c-Met, wherein the first VH+VL domain combination comprises: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 19, and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 20; and

[0046] The second VH+VL domain combination (further, Fab arm) that binds to EGFR has: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO.17, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.20.

[0047] In this case, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 21; and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 22. Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 23 (hIgG1; Knob) or SEQ ID NO. 24 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO. 22.

[0048] Furthermore, the antibody is a bispecific antibody having two different heavy chains but comprising two identical light chains. According to a specific embodiment of the present invention, the bispecific antibody may comprise the amino acid sequence shown in SEQ ID NO. 29 as a light chain.

[0049] According to a specific embodiment of the present invention, the bispecific antibodies provided by the present invention are shown in Table 15 in the "Specific Embodiments". The bispecific antibodies in Table 15 include the following domains:

[0050] The bispecific antibody H15H1YCHV2xH22A12-2HV3-hIgG1 comprises two Fab arms targeting c-Met and EGFR, respectively. One Fab arm comprises a heavy chain variable region (SEQ ID NO. 19) and a light chain variable region (SEQ ID NO. 20) targeting c-Met, and the other Fab arm comprises a heavy chain variable region (SEQ ID NO. 15) and a light chain variable region (SEQ ID NO. 20) targeting EGFR. The bispecific antibody comprises two identical light chain variable regions (SEQ ID NO. 20) and corresponding two identical light chains (SEQ ID NO. 29).

[0051] The bispecific antibody H15H1YCHV2xH103G9-3HV2-hIgG1 comprises two Fab arms targeting c-Met and EGFR, respectively, wherein one Fab arm comprises a heavy chain variable region (SEQ ID NO.19) and a light chain variable region (SEQ ID NO.20) targeting c-Met, and the other Fab arm comprises a heavy chain variable region (SEQ ID NO.17) and a light chain variable region (SEQ ID NO.20) targeting EGFR; the bispecific antibody comprises two identical light chain variable regions (SEQ ID NO.20) and corresponding two identical light chains (SEQ ID NO.29).

[0052] Furthermore, each of the bispecific antibodies in Table 15 is an IgG-like antibody, comprising two different heavy chains (heavy chain 1 and heavy chain 2) and the same two light chains:

[0053] The bispecific antibody H15H1YCHV2xH22A12-2HV3-hIgG1 comprises the amino acid sequence of SEQ ID NO. 25 as heavy chain 1, the amino acid sequence of SEQ ID NO. 26 as heavy chain 2, and the amino acid sequence of SEQ ID NO. 29 as the same light chain;

[0054] The bispecific antibody H15H1YCHV2xH103G9-3HV2-hIgG1 comprises the amino acid sequence shown in SEQ ID NO. 27 as heavy chain 1, the amino acid sequence shown in SEQ ID NO. 28 as heavy chain 2, and the amino acid sequence shown in SEQ ID NO. 29 as the same light chain.

[0055] In a fifth aspect, the present invention provides a composition comprising the polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, or the antibody or antigen-binding fragment thereof described in the fourth aspect. The composition may preferably be a pharmaceutical composition, which may further optionally comprise a pharmaceutically acceptable excipient, carrier, or vehicle. The pharmaceutical composition may be prepared in various dosage forms known in the medical or pharmaceutical arts and administered via an appropriate route.

[0056] In a sixth aspect, the present invention provides use of the polypeptide of the first aspect, the nucleic acid molecule of the second aspect, the antibody or antigen-binding fragment thereof of the fourth aspect, or the pharmaceutical composition of the fifth aspect in the preparation of a drug.

[0057] The drug can be an antibody drug used to treat diseases related to the expression of its target protein or antigen, such as EGFR and / or c-Met expression-related diseases. For example, the drug is used to treat tumors or cancers, such as lung cancer (such as non-small cell lung cancer, small cell lung cancer), liver cancer, pancreatic cancer, gastric cancer, colorectal cancer, thyroid cancer, glioblastoma, head and neck cancer, breast cancer, esophageal cancer, bile duct cancer, nasopharyngeal carcinoma, and melanoma.

[0058] In a seventh aspect, the present invention provides a method for treating a disease, comprising administering the polypeptide described in the first aspect, the nucleic acid molecule described in the second aspect, the antibody or antigen-binding fragment thereof described in the fourth aspect, or the pharmaceutical composition described in the fifth aspect to a subject in need thereof.

[0059] The methods provided herein are used to treat tumors or cancers. Preferably, the tumor or cancer is lung cancer (such as non-small cell lung cancer, small cell lung cancer), liver cancer, pancreatic cancer, gastric cancer, colorectal cancer, thyroid cancer, glioblastoma, head and neck cancer, breast cancer, esophageal cancer, bile duct cancer, nasopharyngeal carcinoma, or melanoma. The subject is a mammal, preferably a primate or rodent, and more preferably a human.

[0060] In an eighth aspect, the present invention further provides an antibody or antigen-binding fragment thereof that binds to EGFR, wherein the antibody or antigen-binding fragment thereof comprises the heavy chain CDRs (HCDR1, HCDR2, and HCDR3) and light chain CDRs (LCDR1, LCDR2, and LCDR3) shown below:

[0061] (1) HCDR1 comprising the amino acid sequence of SEQ ID NO. 30, HCDR2 comprising the amino acid sequence of SEQ ID NO. 31, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35;

[0062] (2) HCDR1 comprising the amino acid sequence of SEQ ID NO. 36, HCDR2 comprising the amino acid sequence of SEQ ID NO. 37, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35;

[0063] (3) HCDR1 comprising the amino acid sequence of SEQ ID NO. 30, HCDR2 comprising the amino acid sequence of SEQ ID NO. 43, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35;

[0064] (4) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.33, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.34, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.35.

[0065] Preferably, the antibody or antigen-binding fragment thereof that binds to EGFR comprises a heavy chain variable region and a light chain variable region, and the heavy chain variable region and the light chain variable region respectively comprise:

[0066] (1) the amino acid sequence shown in SEQ ID NO.10; and the amino acid sequence shown in SEQ ID NO.11;

[0067] (2) the amino acid sequence shown in SEQ ID NO.12; and the amino acid sequence shown in SEQ ID NO.11;

[0068] (3) the amino acid sequence shown in SEQ ID NO. 15; and the amino acid sequence shown in SEQ ID NO. 16; or

[0069] (4) the amino acid sequence shown in SEQ ID NO. 17; and the amino acid sequence shown in SEQ ID NO. 18.

[0070] The antibody or antigen-binding fragment thereof may be a murine antibody, a chimeric antibody, or a humanized antibody; and may further comprise a heavy chain constant region and a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be an IgG1 or IgG4 heavy chain constant region; and the light chain constant region may be a kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.21 (hIgG1); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22 (hkappa). Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.23 (hIgG1; Knob) or SEQ ID NO.24 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22.

[0071] In a ninth aspect, the present invention further provides an antibody or antigen-binding fragment thereof that binds to c-Met, wherein the antibody or antigen-binding fragment thereof comprises the heavy chain CDRs (HCDR1, HCDR2, and HCDR3) and light chain CDRs (LCDR1, LCDR2, and LCDR3) shown below:

[0072] HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.38, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.39; and LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.42.

[0073] Preferably, the antibody or antigen-binding fragment thereof that binds to c-Met comprises a heavy chain variable region and a light chain variable region, and the heavy chain variable region and the light chain variable region respectively comprise:

[0074] (1) the amino acid sequence shown in SEQ ID NO. 13; and the amino acid sequence shown in SEQ ID NO. 14; or

[0075] (2) The amino acid sequence shown in SEQ ID NO. 19; and the amino acid sequence shown in SEQ ID NO. 20.

[0076] The antibody or antigen-binding fragment thereof may be a murine antibody, a chimeric antibody, or a humanized antibody; and may further comprise a heavy chain constant region and a light chain constant region. According to a specific embodiment of the present invention, the heavy chain constant region may be an IgG1 or IgG4 heavy chain constant region; and the light chain constant region may be a kappa or lambda light chain constant region. For example, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.21 (hIgG1); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22 (hkappa). Alternatively, the heavy chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.23 (hIgG1; Knob) or SEQ ID NO.24 (hIgG1; Hole); and the light chain constant region of the antibody comprises the amino acid sequence set forth in SEQ ID NO.22.

[0077] In a tenth aspect, the present invention provides use of the antibody or antigen-binding fragment thereof that binds to EGFR according to the eighth aspect or the antibody or antigen-binding fragment thereof that binds to c-Met according to the ninth aspect in the preparation of a medicament.

[0078] The drug can be an antibody drug used to treat diseases related to the expression of its target protein or antigen, such as EGFR and / or c-Met expression-related diseases. For example, the drug is used to treat tumors or cancers, such as lung cancer (such as non-small cell lung cancer, small cell lung cancer), liver cancer, pancreatic cancer, gastric cancer, colorectal cancer, thyroid cancer, glioblastoma, head and neck cancer, breast cancer, esophageal cancer, bile duct cancer, nasopharyngeal carcinoma, and melanoma.

[0079] Compared with the prior art, the present invention provides a polypeptide derived from the light chain variable region or light chain of a specific anti-c-Met humanized antibody. The polypeptide can be used as a common light chain of a bispecific antibody, together with the heavy chain variable region or heavy chain of an antibody having binding affinity and / or specificity for other target proteins (e.g., EGFR), to construct a bispecific antibody. Experiments have shown that the bispecific antibody maintains or even shows stronger binding affinity and / or specificity for two different target proteins. Therefore, the polypeptide provided by the present invention has the potential for use as a common light chain variable region or light chain for constructing bispecific antibodies. In addition, the present invention also provides antibodies comprising the polypeptide as a common light chain variable region or light chain, such as antibodies against EGFR and / or c-Met. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0081] FIG1 shows the binding activity of anti-EGFR mouse antibodies and control antibodies to EGFR-overexpressing cells;

[0082] FIG2 shows the blocking activity of anti-EGFR mouse antibodies and control antibodies on the binding of EGFR to EGF;

[0083] FIG3 shows the blocking activity of anti-EGFR mouse antibodies and control antibodies on EGFR signaling;

[0084] FIG4 shows the binding activity of anti-EGFR humanized antibodies and control antibodies to EGFR-overexpressing cells;

[0085] FIG5 shows the blocking activity of anti-EGFR humanized antibodies and control antibodies on the binding of EGFR to EGF;

[0086] FIG6 shows the blocking activity of anti-EGFR humanized antibodies and control antibodies on EGFR signaling;

[0087] FIG7 shows the binding activity of anti-c-Met mouse antibodies and control antibodies to c-Met-expressing cells;

[0088] FIG8 shows the blocking activity of anti-c-Met mouse antibodies and control antibodies on the binding of c-Met to HGF;

[0089] FIG9 shows the blocking activity of anti-c-Met mouse antibodies and control antibodies on c-Met signaling;

[0090] FIG10 shows the binding activity of anti-c-Met humanized antibodies and control antibodies to c-Met-expressing cells;

[0091] FIG11 shows the blocking activity of anti-c-Met humanized antibodies and control antibodies on the binding of c-Met to HGF;

[0092] FIG12 shows the blocking activity of anti-c-Met humanized antibodies and control antibodies on c-Met signaling;

[0093] FIG13 shows the binding activity of anti-EGFR humanized antibodies, EGFR×c-Met bispecific antibodies, and control antibodies to EGFR-overexpressing cells;

[0094] FIG14 shows the binding activity of anti-c-Met humanized antibodies, EGFR×c-Met bispecific antibodies, and control antibodies to c-Met-overexpressing cells;

[0095] FIG15 shows the blocking activity of EGFR×c-MET bispecific antibody and control antibody on the binding of EGFR to EGF;

[0096] FIG16 shows the blocking activity of EGFR×c-MET bispecific antibody and control antibody on the binding of c-Met to HGF;

[0097] FIG17 shows the blocking activity of EGFR×c-Met bispecific antibody and control antibody on EGFR and c-Met signaling;

[0098] FIG18 shows the inhibitory activity of EGFR×c-Met bispecific antibody and control antibody on tumor growth.

[0099] Best Mode for Carrying Out the Invention

[0100] The present invention is described below with reference to specific examples. Those skilled in the art will appreciate that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0101] Unless otherwise specified, the experimental methods in the following examples are all conventional methods; the materials used in the following examples, unless otherwise specified, are all purchased from conventional biochemical reagent stores.

[0102] In constructing antibodies, the following constant region sequences were used in the examples below:

[0103] >Human heavy chain CH1 and FC sequence (SEQ ID NO.21):

[0104] hIgG1-WT:

[0105] >Human light chain CL sequence (SEQ ID NO.22):

[0106] hkappa:

[0107] >Human heavy chain Knob CH1 and FC sequence (hIgG1; SEQ ID NO.23):

[0108] >Human heavy chain Hole CH1 and FC sequence (hIgG1; SEQ ID NO. 24):

[0109] The following control antibodies were used in the following examples:

[0110] Cetuximab: produced by the applicant, Cat#: KA-1398-01;

[0111] MCLA129-METV2-hIgG1: produced by the applicant, Cat#: KB-1214; constructed using the anti-c-Met variable region sequence of the known EGFR×c-Met-specific antibody MCLA-129, the human light chain CL sequence (SEQ ID NO. 22), and the human heavy chain Knob CH1 and FC sequences (SEQ ID NO. 23);

[0112] JNJ372-EGFR×c-Met: In-house developed by the applicant, Cat#: KB-1123; constructed using the variable region sequence of the known EGFR×c-Met-specific antibody Amivantamab (JNJ-372) via KIH+crossmab dual antibody assembly technology;

[0113] MCLA129V1: produced by the applicant, Cat#: KB-1217; the known EGFR×c-Met specific antibody MCLA-129;

[0114] AZD9592-hIgG1: produced in-house by the applicant, Cat#: KB-1380; it is the antibody portion of AstraZeneca's AZD9592 (EGFR / c-Met ADC).

[0115] Example 1 Screening of common light chains

[0116] Analysis of existing technologies revealed that germline sequences similar to KV4 are more frequently expressed in mice and pair with mouse heavy chains at a higher frequency. Therefore, we selected this type of germline sequence, and among them, we selected the following mouse germline sequence, KV4-59, for its ease of humanization, good solubility, low immunogenicity, and lack of potential modification sites.

[0117] >KV4-59 (SEQ ID NO. 1):

[0118] The above sequences were modified. Since the CDR3 of the light chain (underlined; obtained according to the KABAT definition method) plays an important role in the affinity of antibody-antigen binding, amino acids were added after CDR3 to improve the affinity for potential antigens. The following three sequences were obtained:

[0119] >KV4-59-1 (SEQ ID NO. 2):

[0120] >KV4-59-2 (SEQ ID NO. 3):

[0121] >KV4-59-3 (SEQ ID NO. 4):

[0122] The above three sequences were used as antibody light chain variable region sequences, and chimeric antibodies were constructed with the following mouse anti-hen egg lysozyme antibody heavy chain variable region sequence and human heavy chain and light chain constant regions.

[0123] > Heavy chain variable region sequence of mouse anti-hen egg lysozyme antibody (SEQ ID NO.5):

[0124] By testing the antigen binding affinity, expression level, thermal stability, solubility, freeze-thaw stability and other properties of the three chimeric antibodies, it was confirmed that when KV4-59-1 (SEQ ID NO. 2) was used as the antibody light chain variable region sequence, the constructed antibody had better properties.

[0125] Example 2 Construction of transgenic mice

[0126] Based on the C57 mouse antibody lambda light chain gene sequence, sgRNA was designed and validated in vitro using the Cas9-gRNA Target Efficiency Detection Kit (Weishanglide, Cat#: VK007-30T). The sgRNA sequences TGAATGCCATGTACTTATGG (SEQ ID NO. 6) and AAGTTCAGCTCCTAAAATGG (SEQ ID NO. 7) with high cleavage efficiency were selected. This sgRNA sequence was synthesized and microinjected into fertilized mouse eggs along with the spCas91.1 protein. The sgRNA-mediated Cas9 protein cleavages the target gene fragment at both ends, resulting in double-strand breaks (DSBs). DNA repair occurs at both ends of the genome via non-homologous end joining (NHEJ), deleting the target fragment in the middle and achieving target gene knockout. Two weeks after birth, the mice were genotyped to confirm lambda gene knockout.

[0127] Based on the C57 mouse antibody kappa light chain gene sequence, sgRNAs were designed and validated in vitro using the Cas9-gRNA Target Efficiency Detection Kit (Weishanglide, Cat#: VK007-30T). The sgRNA sequences with high cleavage efficiency, IGK-L1: GTGAATGCCATGTACTTATGG (SEQ ID NO. 8); and IGK-R1: CAAGTTCAGCTCCTAAAATGG (SEQ ID NO. 9), were selected. These sgRNA sequences were synthesized and microinjected into fertilized mouse eggs along with the spCas91.1 protein. The sgRNA-mediated Cas9 protein cleavage of the DNA at the target site created a nick. Using a donor DNA fragment carrying homology arms and the target fragment KV4-59-1 (SEQ ID NO. 2), the DNA fragment was knocked in at the target site via homologous recombination. Two weeks after birth, the mice were genotyped to confirm knock-in of the common light chain gene. Heterozygous mice with lambda gene knockout were selected for mating and breeding with heterozygous mice with common light chain knockin. Genotyping of each offspring was performed 2 weeks after birth to detect common light chain gene knockin and lambda knockout, until mice with common light chain gene knockin of all alleles and knockout of both lambda and kappa were obtained.

[0128] Example 3 Preparation of hybridoma cells secreting anti-EGFR antibodies

[0129] Mice constructed in Example 2 were immunized using EGFR-mFc (Kangyuan Bochuang Biotechnology (Beijing) Co., Ltd. ("Kangyuan Bochuang"), Cat#: KP-1151) as an immunogen. Mice with high titers were selected and serum was obtained. After dissection, the spleens were removed and splenocytes were isolated. These splenocytes were fused with cultured myeloma cells to obtain hybridoma cells. ELISA was used to detect the binding activity of the hybridoma cell supernatant to the antigen protein EGFR-His (Kangyuan Bochuang, Cat#: KP-1150), and multiple positive hybridoma cell lines secreting anti-EGFR antibodies were obtained.

[0130] An anti-EGFR murine antibody was obtained from a positive hybridoma cell line. The variable region sequences are as follows (heavy and light chain CDRs are underlined and were derived according to the KABAT definition method, the same applies hereinafter). The murine antibodies 22A12-2 and 103G9-3 share the same light chain: 22A12-2 (anti-EGFR murine antibody 1; also designated "KD-22-0198")

[0131] >EGFR-22A12-2, VH (SEQ ID NO.10; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.30 / SEQ ID NO.31 / SEQ ID NO.32):

[0132] >EGFR-22A12-2, VL (SEQ ID NO.11; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.33 / SEQ ID NO.34 / SEQ ID NO.35):

[0133] 103G9-3 (anti-EGFR mouse antibody 2; also named "KD-22-0220")

[0134] >EGFR-103G9-3, VH (SEQ ID NO.12; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.36 / SEQ ID NO.37 / SEQ ID NO.32):

[0135] >EGFR-103G9-3, VL (SEQ ID NO.11; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.33 / SEQ ID NO.34 / SEQ ID NO.35):

[0136] Example 4 Binding activity of anti-EGFR mouse antibodies to EGFR-overexpressing cells

[0137] The antibodies to be tested were serially diluted and incubated with EGFR-overexpressing CT26 cells (Kangyuan Broad, Cat#: KC-1451). The cells were then incubated with either the secondary anti-mouse PE anti-mouse IgG Fc antibody (Biolegend, Cat#: 405307) or the secondary anti-human Goat anti-human IgG-PE antibody (SouthernBiotech, Cat#: 2010-09). Antibody binding to cells was detected by flow cytometry. The results are shown in Table 1 and Figure 1.

[0138] Table 1. Binding activity of anti-EGFR mouse antibodies and control antibodies to EGFR-overexpressing cells

[0139] Example 5 Blocking Activity of Anti-EGFR Mouse Antibodies on the Binding of EGFR and EGF

[0140] The antibody to be tested was serially diluted and incubated with 0.4 μg / ml EGFR-mFc (Kangyuan Broad, Cat#: KP-1148) or EGFR-hFc (Kangyuan Broad, Cat#: KP-1149). The plate was then incubated with an ELISA plate coated with EGF-His (2 μg / ml, Acro, Cat#: EGF-H52H3). Finally, the plate was incubated with a secondary anti-mouse antibody (HRP anti-mouse IgG) (SIGMA, Cat#: A9309) or a secondary anti-human antibody (HRP anti-human IgG) (SIGMA, Cat#: A0170). Binding signals were detected using a microplate reader. The results are shown in Table 2 and Figure 2.

[0141] Table 2. Blocking activity of anti-EGFR mouse antibodies and control antibodies on the binding of EGFR to EGF

[0142] Example 6 Blocking Activity of Anti-EGFR Murine Antibodies on EGFR Signaling

[0143] The antibody to be tested was serially diluted and incubated with 293T-NFAT-Luc2-EGFR (Kangyuan Broad, Cat#: KC-2952, expressing luciferase upon EGFR signaling activation) for 30 minutes. EGF-His (20 ng / ml, Acro, Cat#: EGF-H52H3) was then added and incubated overnight. Activated luciferase signal was measured. Incubation without EGF represented background activation. Correlation curves were plotted between the fold increase in activation after EGF addition and antibody concentration. The results are shown in Table 3 and Figure 3.

[0144] Table 3. Blocking activity of anti-EGFR mouse antibodies and control antibodies on EGFR signaling

[0145] Example 7 Affinity of anti-EGFR mouse antibodies for EGFR

[0146] ForteBio Octet was used to test the affinity of the antibody for EGFR. The concentrations of EGFR-His (Kangyuan Broad, Cat#: KP-1150) in the mobile phase were 200, 100, 50, 25, 12.5, 6.25, and 3.12 nM, respectively. The affinity test results are shown in Table 4.

[0147] Table 4. Affinity of anti-EGFR mouse antibodies and control antibodies to EGFR

[0148] Example 8 Construction of humanized and chimeric antibodies against EGFR

[0149] The heavy and light chain variable regions of two murine anti-EGFR antibodies were humanized to generate humanized antibody sequences; two humanized versions of the light chain variable region were obtained. The coding sequences of the humanized antibody sequences were ligated to the coding sequences of the heavy chain constant region of human IgG1 (SEQ ID NO. 21) and the light chain constant region of human kappa (SEQ ID NO. 22), respectively. The resulting coding genes were cloned into eukaryotic expression vectors and expressed to generate two humanized anti-EGFR antibodies, designated H22A12-2V3-1-hIgG1 and H103G9-3V2-2-hIgG1, respectively. The heavy and light chain variable region sequences and full-length heavy and light chains are shown below (heavy and light chain CDRs are underlined).

[0150] In addition, the coding sequences of the heavy and light chain variable regions of two anti-EGFR murine antibodies were respectively connected to the coding sequences of the heavy chain constant region of human IgG1 (SEQ ID NO.21) and the light chain constant region of human kappa (SEQ ID NO.22), and the obtained coding genes were cloned into a eukaryotic expression vector to express and obtain two anti-EGFR chimeric antibodies.

[0151] H22A12-2V3-1-hIgG1 (humanized anti-EGFR antibody 1; also designated "KA-2029")

[0152] >EGFR-H22A12-2V3-1-hIgG1, VH (SEQ ID NO.15; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.30 / SEQ ID NO.43 / SEQ ID NO.32):

[0153] >EGFR-H22A12-2V3-1-hIgG1, VL (SEQ ID NO.16; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.33 / SEQ ID NO.34 / SEQ ID NO.35):

[0154] H103G9-3V2-2-hIgG1 (humanized anti-EGFR antibody 2; also designated "KA-2034")

[0155] >EGFR-H103G9-3V2-2-hIgG1, VH (SEQ ID NO.17; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.36 / SEQ ID NO.37 / SEQ ID NO.32):

[0156] >EGFR-H103G9-3V2-2-hIgG1, VL (SEQ ID NO.18; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.33 / SEQ ID NO.34 / SEQ ID NO.35):

[0157] Example 9 Binding activity of humanized anti-EGFR antibodies to EGFR-overexpressing cells

[0158] The antibodies to be tested were serially diluted and incubated with CT26 cells overexpressing EGFR (Kangyuan Broad, Cat#: KC-2063). The cells were then incubated with a secondary anti-human antibody, Goat anti-human IgG-PE (SouthernBiotech, Cat#: 2010-09). Antibody binding to cells was detected by flow cytometry. The results are shown in Table 5 and Figure 4.

[0159] Table 5. Binding activity of anti-EGFR humanized antibodies and control antibodies to EGFR-overexpressing cells

[0160] Example 10 Blocking activity of humanized anti-EGFR antibodies on the binding of EGFR to EGF

[0161] The antibodies to be tested were serially diluted and incubated with CT26 cells overexpressing EGFR (Kangyuan Broad, Cat#: KC-1451). The cells were then incubated with 0.2 μg / ml EGF-mFc (Acro, Cat#: EGF-H525b), and finally with FITC anti-mouse IgG2a (1:500, Biolegend, Cat#: 407106). Antibody binding to cells was detected by flow cytometry. The results are shown in Table 6 and Figure 5.

[0162] Table 6. Blocking activity of anti-EGFR humanized antibodies and control antibodies on the binding of EGFR to EGF

[0163] Example 11 Blocking Activity of Humanized Anti-EGFR Antibodies on EGFR Signaling

[0164] The antibody to be tested was serially diluted and incubated with 293T-NFAT-Luc2-EGFR (Kangyuan Broad, Cat#: KC-2952, expressing luciferase upon EGFR signaling activation) for 30 minutes. EGF-His (20 ng / ml, Acro, Cat#: EGF-H52H3) was then added and incubated overnight. The activated luciferase signal was measured. Incubation without EGF represented background activation. Correlation curves were plotted between the fold increase in activation after EGF addition and antibody concentration. The results are shown in Table 7 and Figure 6.

[0165] Table 7. Blocking activity of anti-EGFR humanized antibodies and control antibodies on EGFR signaling

[0166] Example 12 Preparation of Hybridoma Cells Secreting Anti-c-Met Antibodies

[0167] Mice constructed in Example 2 were immunized with HGFR SEMA-mFc (Kangyuan Broad, Cat#: KP-1271) as the immunogen. Mice with high titers were selected and serum was collected. After dissection, spleens were removed and splenocytes isolated. These splenocytes were fused with cultured myeloma cells to generate hybridoma cells. The binding activity of the hybridoma supernatant to the antigen protein was assayed using ELISA, resulting in the generation of multiple positive hybridoma cell lines that secreted anti-c-Met antibodies.

[0168] An anti-c-Met murine antibody was obtained from a positive hybridoma cell line. The variable region sequence is as follows (the heavy and light chain CDRs are underlined and were derived according to the KABAT definition method, the same applies hereinafter): 15H1Y1C (anti-c-Met murine antibody, also designated "KD-23-0480")

[0169] >MET-15H1Y1C, VH (SEQ ID NO.13; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.36 / SEQ IDNO.38 / SEQ ID NO.39):

[0170] >MET-15H1Y1C, VL (SEQ ID NO.14; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.40 / SEQ ID NO.41 / SEQ ID NO.42):

[0171] Example 13 Binding activity of anti-c-Met mouse antibodies to c-Met expressing cells

[0172] The antibodies to be tested were serially diluted and incubated with c-Met-expressing human gastric cancer cells MKN45 (Kangyuan Broad, Cat#: KC-0412). The cells were then incubated with either the secondary anti-mouse PE anti-mouse IgG Fc antibody (Biolegend, Cat#: 405307) or the secondary anti-human Goat anti-human IgG-PE antibody (SouthernBiotech, Cat#: 2010-09). Antibody binding to the cells was detected by flow cytometry. The results are shown in Table 8 and Figure 7.

[0173] Table 8. Binding activity of anti-c-Met mouse antibodies and control antibodies to c-Met expressing cells

[0174] Example 14 Blocking Activity of Anti-c-Met Mouse Antibody on the Binding of c-Met to HGF

[0175] The antibodies to be tested were serially diluted and incubated with c-Met-expressing human gastric cancer cells MKN45 (Kangyuan Broad, Cat#: KC-0412). The cells were then incubated with 0.04 μg / ml HGF-His (Acro, Cat#: HGF-H52H3), and finally with the anti-His antibody APC anti-His Tag (1:500, Biolegend, Cat#: 362605). Antibody binding to the cells was detected by flow cytometry. The results are shown in Table 9 and Figure 8.

[0176] Table 9. Blocking activity of anti-c-Met mouse antibodies and control antibodies on the binding of c-Met to HGF

[0177] Example 15 Blocking Activity of Anti-c-Met Murine Antibodies on c-Met Signaling

[0178] The antibody to be tested was serially diluted and incubated with 293T-SRE-Luc2-MET (Kangyuan Broad, Cat#: KC-2056, luciferase expression upon c-Met signaling activation) for 30 minutes. RH-HGF (1 ng / ml, Acro, Cat#: HGF-H5218) was then added and incubated overnight. The activated luciferase signal was measured. Incubation without RH-HGF represented background activation. Correlation curves were plotted between the fold increase in activation intensity after the addition of RH-HGF and the antibody concentration. The results are shown in Table 10 and Figure 9.

[0179] Table 10. Blocking activity of anti-c-Met mouse antibodies and control antibodies on c-Met signaling

[0180] Example 16 Construction of humanized and chimeric antibodies against c-Met

[0181] The heavy and light chain variable regions of a murine anti-c-Met antibody were humanized to generate a humanized antibody sequence. The coding sequence of the humanized antibody sequence was ligated to the coding sequences of the human IgG1 heavy chain constant region (SEQ ID NO. 21) and the human kappa light chain constant region (SEQ ID NO. 22), respectively. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to generate a humanized anti-c-Met antibody named H15H1Y1CV2-hIgG1. The heavy and light chain variable region sequences and full-length heavy and light chains are shown below (heavy and light chain CDRs are underlined).

[0182] In addition, the coding sequences of the heavy and light chain variable regions of the anti-c-Met mouse antibody were linked to the coding sequences of the heavy chain constant region of human IgG1 (SEQ ID NO. 21) and the light chain constant region of human kappa (SEQ ID NO. 22), respectively. The resulting coding genes were cloned into a eukaryotic expression vector and expressed to obtain an anti-c-Met chimeric antibody.

[0183] H15H1Y1CV2-hIgG1 (humanized anti-c-Met antibody; also designated "KA-2427")

[0184] >MET-H15H1Y1CV2-hIgG1, VH (SEQ ID NO.19; HCDR1 / HCDR2 / HCDR3: SEQ ID NO.36 / SEQ ID NO.38 / SEQ ID NO.39)

[0185] >MET-H15H1Y1CV2-hIgG1, VL (SEQ ID NO.20; LCDR1 / LCDR2 / LCDR3: SEQ ID NO.40 / SEQ ID NO.41 / SEQ ID NO.42)

[0186] Example 17 Binding activity of humanized anti-c-Met antibodies to c-Met expressing cells

[0187] The antibodies to be tested were serially diluted and incubated with c-Met-expressing human gastric cancer cells MKN45 (Kangyuan Broad, Cat#: KC-0412). The cells were then incubated with a secondary anti-human antibody, Goat anti-human IgG-PE (SouthernBiotech, Cat#: 2010-09). Antibody binding to the cells was detected by flow cytometry. The results are shown in Table 11 and Figure 10.

[0188] Table 11. Binding activity of anti-c-Met humanized antibodies and control antibodies to c-Met-expressing cells

[0189] Example 18 Blocking Activity of Humanized Anti-c-Met Antibodies on the Binding of c-Met to HGF

[0190] The antibodies to be tested were serially diluted and incubated with c-Met-expressing human gastric cancer cells MKN45 (Kangyuan Broad, Cat#: KC-0412). The cells were then incubated with 0.04 μg / ml HGF-His (Acro, Cat#: HGF-H52H3), and finally with the anti-His antibody APC anti-His Tag (1:500, Biolegend, Cat#: 362605). Antibody binding to the cells was detected by flow cytometry. The results are shown in Table 12 and Figure 11.

[0191] Table 12. Blocking activity of humanized anti-c-Met antibodies and control antibodies on the binding of c-Met to HGF

[0192] Example 19 Blocking Activity of Humanized Antibodies Against c-Met Signaling

[0193] The antibody to be tested was serially diluted and incubated with 293T-SRE-Luc2-MET (Kangyuan Broad, Cat#: KC-2056, luciferase expression upon c-Met signaling activation) for 30 minutes. RH-HGF (1 ng / ml, Acro, Cat#: HGF-H5218) was then added and incubated overnight. The activated luciferase signal was measured. Incubation without RH-HGF represented background activation. Correlation curves were plotted between the fold increase in activation intensity after the addition of RH-HGF and the antibody concentration. The results are shown in Table 13 and Figure 12.

[0194] Table 13. Blocking activity of anti-c-Met humanized antibodies and control antibodies on c-Met signaling

[0195] Example 20 Affinity of anti-c-Met humanized antibodies for c-Met (HGFR)

[0196] ForteBio Octet was used to test the affinity of the antibody for c-Met. The concentrations of human c-Met-His (Kangyuan Broad, Cat#: KP-1153) in the mobile phase were 200, 100, 50, 25, 12.5, 6.25, and 3.12 nM, respectively. The affinity test results are shown in Table 14.

[0197] Table 14. Affinity of anti-c-Met humanized antibodies and control antibodies for c-Met

[0198] Example 21 Construction of EGFR×c-Met bispecific antibody

[0199] The light chain variable region (SEQ ID NO. 20) of the anti-c-Met humanized antibody H15H1Y1CV2-hIgG1 was linked to the coding sequence of the human kappa light chain constant region (SEQ ID NO. 22) to obtain the common light chain of the bispecific antibody.

[0200] The heavy chain variable region (SEQ ID NO. 19) of the anti-c-Met humanized antibody H15H1Y1CV2-hIgG1 was linked to the coding sequence of the human heavy chain Knob CH1 and FC sequence (SEQ ID NO. 23); the heavy chain variable region (SEQ ID NO. 15) of the anti-EGFR humanized antibody 1, i.e., H22A12-2V3-1-hIgG1, was linked to the coding sequence of the human heavy chain Hole CH1 and FC sequence (SEQ ID NO. 24), or the heavy chain variable region (SEQ ID NO. 17) of the anti-EGFR humanized antibody 2, i.e., H103G9-3V2-2-hIgG1, was linked to the coding sequence of the human heavy chain Hole CH1 and FC sequence (SEQ ID NO. 24).

[0201] The obtained coding sequences were cloned into eukaryotic expression vectors to obtain four recombinant expression plasmids (one plasmid encoding a common light chain, one plasmid encoding a heavy chain targeting c-Met, and two plasmids encoding heavy chains targeting EGFR). The three plasmids were transiently co-transfected using the HEK293F expression system (one of the two plasmids encoding the heavy chain targeting EGFR was selected) to produce the EGFR×c-Met bispecific antibody. Briefly, for a 1 L shake flask, HEK293F cells were cultured at a rate of 1×10 6 The cells were inoculated into 250 mL of culture medium at a density of 100 / mL and incubated at 110 rpm and 5% CO2. The next day, the three expression vectors prepared in advance were mixed with the transfection reagent in a certain proportion and the cells were inoculated at a density of 2×10 6The transfection complex was added to the cells at a cell density of 100 μg / mL. Nutrients and DNA inhibitors were added 24 hours later. After 5-7 days of cell culture, the expression supernatant was collected, centrifuged, filtered, and purified using a MabSelectSure affinity chromatography column (GE Healthcare). The purified antibodies were tested for purity by SDS-PAGE electrophoresis and antibody concentration was detected using Nanodrop.

[0202] The domains and sequences of the resulting EGFR×c-Met bispecific antibody are shown in Table 15 and below (the italics in the sequences below indicate the constant regions).

[0203] Table 15. EGFR×c-Met bispecific antibodies containing a common light chain

[0204] H15H1YCHV2xH22A12-2HV3-hIgG1 (EGFR×c-Met bispecific antibody 1; also designated “KA-2597”)

[0205] >MET-H15H1Y1CV2-Knob (heavy chain 1, SEQ ID NO. 25; VH: SEQ ID NO. 19; CH [Knob]: SEQ ID NO. 23)

[0206] >EGFR-H22A12-2V3-Hole (heavy chain 2, SEQ ID NO.26; VH: SEQ ID NO.15; CH[Hole]: SEQ ID NO.24)

[0207] Common light chain (SEQ ID NO. 29; VL: SEQ ID NO. 20; LC: SEQ ID NO. 22)

[0208] H15H1YCHV2×H103G9-3HV2-hIgG1 (EGFR×c-Met bispecific antibody 2; also designated “KA-2599”)

[0209] >MET-H15H1Y1CV2-Knob (heavy chain 1, SEQ ID NO. 27; VH: SEQ ID NO. 19; CH [Knob]: SEQ ID NO. 23)

[0210] >EGFR-H103G9-3HV2-Hole (heavy chain 2, SEQ ID NO.28; VH: SEQ ID NO.17; CH[Hole]: SEQ ID NO.24)

[0211] Common light chain (SEQ ID NO. 29; VL: SEQ ID NO. 20; LC: SEQ ID NO. 22)

[0212] Example 22 Binding Activity of Humanized Anti-EGFR Antibodies, Humanized Anti-c-Met Antibodies, and EGFR×c-Met Bispecific Antibodies to EGFR-Overexpressing and c-Met (HGFR)-Overexpressing Cells

[0213] CT26 cells overexpressing EGFR were constructed and named “CT26-EGFR cells” (Kangyuan Broad, Cat#: KC-2063). CHOK1 cells overexpressing c-Met were constructed and named “CHOK1-cMET cells” (Kangyuan Broad, Cat#: KC-2524).

[0214] The antibodies to be tested were serially diluted and incubated with CT26-EGFR or CHOK1-cMET cells, followed by incubation with the secondary anti-human antibody, Goat anti-human IgG-PE (SouthernBiotech, Cat#: 2010-09). Antibody binding to cells was determined by flow cytometry. The results are shown in Table 16 and Figure 13 (EGFR) and Table 17 and Figure 14 (c-Met).

[0215] Table 16. Binding activity of anti-EGFR humanized antibodies, EGFR×c-Met bispecific antibodies, and control antibodies to EGFR-overexpressing cells

[0216] Table 17. Binding activity of anti-c-Met humanized antibodies, EGFR×c-Met bispecific antibodies, and control antibodies to c-Met overexpressing cells

[0217] Example 23: Affinity of the EGFR×c-Met Bispecific Antibody for Human EGFR and c-Met (HGFR). The affinity of the antibody for EGFR and c-Met was tested using the ForteBio Octet assay. The mobile phases used human EGFR-His (Kangyuan Broad, Cat#: KP-1150) and human c-Met-His (Kangyuan Broad, Cat#: KP-1153), respectively, at concentrations of 200, 100, 50, 25, 12.5, 6.25, and 3.12 nM. The results are shown in Table 18.

[0218] Table 18. Affinity of EGFR×c-Met bispecific antibodies and control antibodies to EGFR and c-Met

[0219] Example 24 Blocking Activity of EGFR×c-MET Bispecific Antibody on Binding of EGFR to EGF

[0220] The antibodies to be tested were serially diluted and incubated with EGFR-overexpressing CT26 cells (Kangyuan Broad, Cat#: KC-1451). The cells were then incubated with 0.2 μg / ml EGF-mFc (Acro, Cat#: EGF-H525b), and finally with FITC anti-mouse IgG2a (1:500, Biolegend, Cat#: 407106). Antibody binding to cells was detected by flow cytometry. The results are shown in Table 19 and Figure 15.

[0221] Table 19. Blocking activity of EGFR×c-MET bispecific antibodies and control antibodies on the binding of EGFR to EGF

[0222] Example 25 Blocking Activity of EGFR×c-MET Bispecific Antibody on the Binding of c-Met to HGF

[0223] The antibodies to be tested were serially diluted and incubated with c-MET-expressing human gastric cancer cells MKN45 (Kangyuan Broad, Cat#: KC-0412). The cells were then incubated with 0.04 μg / ml HGF-His (Acro, Cat#: HGF-H52H3), and finally with the anti-His antibody APC anti-His Tag (1:500, Biolegend Cat#: 362605). Antibody binding to the cells was detected by flow cytometry. The results are shown in Table 20 and Figure 16.

[0224] Table 20. Blocking activity of EGFR×c-MET bispecific antibodies and control antibodies on the binding of c-Met to HGF

[0225] Example 26 Blocking Activity of EGFR×c-Met Bispecific Antibody on EGFR and c-Met Signaling

[0226] The antibodies to be tested were co-incubated with H1975 cells (Kangyuan Bochuang, Cat#: KC-1566) at a final concentration of 10 μg / ml, and EGF-mFc (Acro, Cat#: EGF-H525b) at a final concentration of 50 ng / ml and HGF-His (Acro, Cat#: HGF-H52H3) at a final concentration of 100 ng / ml were added. After incubation at 37°C for 15 minutes, lysis buffer was added to each well to lyse the cells, and then the phosphorylation levels of EGFR, c-Met, Akt and Erk in the cells were measured by western blotting to analyze the activation of the EGFR and c-Met signaling pathways, thereby evaluating the efficiency of the antibodies in inhibiting the EGFR and c-Met signaling pathways. The results are shown in Figure 17.

[0227] The results showed that the two EGFR×c-Met bispecific antibodies had significantly stronger inhibitory efficiency on the EGFR and c-Met signaling pathways than the control antibody.

[0228] Example 27 Inhibitory Activity of EGFR×c-Met Bispecific Antibody on Tumor Growth

[0229] Immunodeficient B-NDG mice (Biocytogen, Cat#: 110586) were subcutaneously inoculated with one million HGF-overexpressing H1975 tumor cells (Kangyuan Broad, Cat#: KC-1566). Tumor size was measured three times a week, and tumor volume was calculated as = 0.5 × length × width × height. When the tumor grew to ∼100 mm 3 At the same time, mice with tumor-transplanted tumors were randomly divided into groups and intravenously injected with the antibody to be tested. The antibody was injected twice a week, and after three consecutive injections, it was reduced to once a week. The results are shown in Figure 18.

[0230] The results showed that the EGFR×c-MET bispecific antibody KA-2597 significantly inhibited tumor growth, and its tumor inhibition effect was better than that of the control antibody.

[0231] The above description of the specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention. As long as they do not depart from the spirit of the present invention, they should fall within the scope of the claims attached to the present invention.

Claims

1. A polypeptide, wherein the amino acid sequence of the polypeptide comprises: the amino acid sequence shown in SEQ ID NO. 40; the amino acid sequence shown in SEQ ID NO. 41; and the amino acid sequence shown in SEQ ID NO.

42.

2. The polypeptide according to claim 1, characterized in that The polypeptide comprises the amino acid sequence shown in SEQ ID NO.20; Preferably, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.

29.

3. A nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of claim 1 or 2.

4. Use of the polypeptide according to claim 1 or 2 or the nucleic acid according to claim 3 in constructing an antibody.

5. An antibody or an antigen-binding fragment thereof, comprising the polypeptide of claim 1 or 2; Preferably, the antibody or antigen-binding fragment thereof comprises the polypeptide of claim 1 or 2 as a light chain variable region or light chain; Preferably, the antibody or antigen-binding fragment thereof is an IgG-like antibody or an antibody in the form of scFv, dsFv, (dsFv)2, Fab, Fab', F(ab')2 or Fv.

6. The antibody or antigen-binding fragment thereof according to claim 5, characterized in that The antibody or antigen-binding fragment thereof comprises the heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and light chain CDRs (LCDR1, LCDR2 and LCDR3) shown below, respectively: (1) HCDR1 comprising the amino acid sequence of SEQ ID NO. 36, HCDR2 comprising the amino acid sequence of SEQ ID NO. 38, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 39; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 40, LCDR2 comprising the amino acid sequence of SEQ ID NO. 41, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 42; (2) HCDR1 comprising the amino acid sequence of SEQ ID NO.30, HCDR2 comprising the amino acid sequence of SEQ ID NO.43, and HCDR3 comprising the amino acid sequence of SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO.40, LCDR2 comprising the amino acid sequence of SEQ ID NO.41, and LCDR3 comprising the amino acid sequence of SEQ ID NO.42; or (3) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.

42.

7. The antibody or antigen-binding fragment thereof according to claim 5 or 6, characterized in that The antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region respectively comprise: (1) the amino acid sequence shown in SEQ ID NO. 13; and the amino acid sequence shown in SEQ ID NO. 14; (2) the amino acid sequence shown in SEQ ID NO.19; and the amino acid sequence shown in SEQ ID NO.20; (3) the amino acid sequence shown in SEQ ID NO.15; and the amino acid sequence shown in SEQ ID NO.20; or (4) The amino acid sequence shown in SEQ ID NO. 17; and the amino acid sequence shown in SEQ ID NO.

20.

8. The antibody or antigen-binding fragment thereof according to any one of claims 5 to 7, characterized in that The antibody or antigen-binding fragment thereof has at least two VH+VL domain combinations, which are identical, thereby binding to the same target protein; or different, thereby binding to different target proteins; Preferably, the two VH+VL domain combinations have: a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.

20.

9. The antibody or antigen-binding fragment thereof according to any one of claims 5 to 8, characterized in that The antibody or antigen-binding fragment thereof comprises: (1) a first VH+VL domain combination that binds to c-Met, comprising: a HCDR1 comprising the amino acid sequence of SEQ ID NO.36, a HCDR2 comprising the amino acid sequence of SEQ ID NO.38, and a HCDR3 comprising the amino acid sequence of SEQ ID NO.39; and a LCDR1 comprising the amino acid sequence of SEQ ID NO.40, a LCDR2 comprising the amino acid sequence of SEQ ID NO.41, and a LCDR3 comprising SEQ ID NO.42; and A second VH+VL domain combination that binds to EGFR, comprising: a HCDR1 comprising the amino acid sequence of SEQ ID NO.30, a HCDR2 comprising the amino acid sequence of SEQ ID NO.43, and a HCDR3 comprising the amino acid sequence of SEQ ID NO.32; and, a LCDR1 comprising the amino acid sequence of SEQ ID NO.40, a LCDR2 comprising the amino acid sequence of SEQ ID NO.41, and a LCDR3 comprising SEQ ID NO.42; or (2) a first VH+VL domain combination that binds to c-Met, comprising: a HCDR1 comprising the amino acid sequence of SEQ ID NO.36; a HCDR2 comprising the amino acid sequence of SEQ ID NO.38; and a HCDR3 comprising the amino acid sequence of SEQ ID NO.39; and, a LCDR1 comprising the amino acid sequence of SEQ ID NO.40; a LCDR2 comprising the amino acid sequence of SEQ ID NO.41; and a LCDR3 comprising the amino acid sequence of SEQ ID NO.42; A second VH+VL domain combination that binds to EGFR, comprising: a HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, a HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and a HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, a LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40; a LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41; and a LCDR3 comprising the amino acid sequence shown in SEQ ID NO.

42.

10. The antibody or antigen-binding fragment thereof according to any one of claims 5 to 9, characterized in that The antibody or antigen-binding fragment thereof comprises: (1) a first VH+VL domain combination that binds to c-Met, comprising: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 19, and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 20; A second VH+VL domain combination that binds to EGFR, comprising: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO.15, and a light chain variable region comprising the amino acid sequence of SEQ ID NO.20; or (2) a first VH+VL domain combination that binds to c-Met, comprising: a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 19, and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 20; The second VH+VL domain combination that binds to EGFR comprises: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO.17, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO.

20.

11. The antibody or antigen-binding fragment thereof according to any one of claims 5 to 10, characterized in that The antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region; Preferably, the antibody is a bispecific antibody. 12 . A composition comprising the polypeptide of claim 1 or 2 , the nucleic acid molecule of claim 3 , or the antibody or antigen-binding fragment thereof of any one of claims 5 to 11 .

13. Use of the polypeptide according to claim 1 or 2, the nucleic acid molecule according to claim 3, the antibody or antigen-binding fragment thereof according to any one of claims 5 to 11, or the composition according to claim 12 in the preparation of a medicament.

14. An anti-EGFR antibody or antigen-binding fragment thereof, comprising the heavy chain CDRs (HCDR1, HCDR2, and HCDR3) and light chain CDRs (LCDR1, LCDR2, and LCDR3) shown below: (1) HCDR1 comprising the amino acid sequence of SEQ ID NO. 30, HCDR2 comprising the amino acid sequence of SEQ ID NO. 31, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35; (2) HCDR1 comprising the amino acid sequence of SEQ ID NO. 36, HCDR2 comprising the amino acid sequence of SEQ ID NO. 37, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35; (3) HCDR1 comprising the amino acid sequence of SEQ ID NO. 30, HCDR2 comprising the amino acid sequence of SEQ ID NO. 43, and HCDR3 comprising the amino acid sequence of SEQ ID NO. 32; and, LCDR1 comprising the amino acid sequence of SEQ ID NO. 33, LCDR2 comprising the amino acid sequence of SEQ ID NO. 34, and LCDR3 comprising the amino acid sequence of SEQ ID NO. 35; (4) HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.37, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.32; and, LCDR1 comprising the amino acid sequence shown in SEQ ID NO.33, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.34, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.

35.

15. An anti-c-Met antibody or antigen-binding fragment thereof, comprising the heavy chain CDRs (HCDR1, HCDR2 and HCDR3) and light chain CDRs (LCDR1, LCDR2 and LCDR3) shown below: HCDR1 comprising the amino acid sequence shown in SEQ ID NO.36, HCDR2 comprising the amino acid sequence shown in SEQ ID NO.38, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO.39; and LCDR1 comprising the amino acid sequence shown in SEQ ID NO.40, LCDR2 comprising the amino acid sequence shown in SEQ ID NO.41, and LCDR3 comprising the amino acid sequence shown in SEQ ID NO.42.

Images