UTR for promoting RNA translation

Abstract

The present invention relates to the field of biomedicine, and particularly relates to the field of RNA medicines. Specifically, the present invention relates to a UTR for promoting RNA translation, which UTR is obtained by means of artificial intelligence technology, and an RNA molecule containing the UTR and the use thereof.

Description

UTRs that promote RNA translation Technical Field

[0001] The present invention relates to the field of biomedicine, in particular to the field of RNA drugs. Specifically, the present invention relates to UTRs that promote RNA translation obtained using artificial intelligence technology, as well as RNA molecules containing the UTRs and their uses.

[0002] Background of the Invention

[0003] RNA (such as mRNA or circular RNA) drug molecules have unique advantages. Compared with traditional DNA gene therapy methods, RNA (such as mRNA or circular RNA) drugs do not produce the safety risk of exogenous genome integration into the host genome. In addition, RNA (such as mRNA or circular RNA) can also provide immediate and controllable protein expression, making it an ideal choice for treating diseases caused by specific gene deletions. At the same time, RNA (such as mRNA or circular RNA) can also act as an antigen to induce an immune response, providing a new approach for vaccine development.

[0004] The untranslated region (UTR) of mRNA plays a crucial regulatory role in mRNA expression. Different UTR sequences can directly influence the expression level of the mRNA-encoded protein by affecting mRNA stability and translation efficiency. Therefore, optimizing and screening 5' UTR sequences to increase the expression level of the mRNA-encoded protein is crucial for enhancing therapeutic efficacy and activating vaccine immune responses.

[0005] The UTR sequences in current mRNA drugs are usually screened from naturally occurring genomes. However, this screening method has some limitations, which restrict further improvements in mRNA expression levels and therapeutic effects. First, naturally occurring UTR sequences usually have relatively conservative characteristics, and their evolution is subject to multiple selective pressures, including transcriptional regulation, translation efficiency, and RNA stability. Therefore, these sequences may have certain limitations in terms of regulatory mechanisms and translation efficiency, and cannot meet the demand for high-level gene expression. Secondly, naturally occurring UTR sequences are usually optimized for the regulation of specific genes and species. When these sequences are applied to other genes or species, problems such as poor expression levels, instability, or excessive immune responses may be encountered. This limits the versatility and scope of application of UTR sequences. In addition, current screening methods mainly rely on practical laboratory operations and traditional biological methods, which require a lot of time and resources, and have certain randomness and limitations, making traditional screening methods cumbersome and difficult to implement efficiently.

[0006] Summary of the Invention

[0007] The present invention systematically screens and designs UTR sequences with optimized translation efficiency by applying artificial intelligence (AI) technology. AI algorithm can analyze currently disclosed human RNA-seq group information and Ribo-seq group information, and establishes a deep learning prediction model to predict the translation efficiency of different UTR sequences. On this basis, artificial intelligence analysis strategies are used, including technologies such as adversarial generation network (Generative Adversarial Network, GAN) and long short-term memory recursive neural network (Long Short-Term Memory, LSTM), using the UTR in the human genome as a training set, constructing a generative learning model, and producing non-natural UTR sequences. Further, experimental verification is carried out in vitro by the technology of in vitro transcription (in vitro transcription), the expression level of the target protein is measured, and the UTR with the actual effect of enhancing the expression of the target protein is screened out.

[0008] Through the screening and optimization process of this invention, a series of 5'UTR and 3'UTR sequences with enhanced expression levels of target proteins can be obtained. This can enhance the therapeutic effect in RNA therapy and enhance immune activation when used as a vaccine. This represents a new breakthrough in the treatment of specific gene-deficient diseases and in vaccine development.

[0009] Therefore, one aspect of the present invention relates to a 5'UTR (5' untranslated region), which comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof. Preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof. More preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 1, 3-5, 7-11, 13, 41-46, 48, 50-53, 55-57, 59-60, or a complementary sequence thereof. More preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 4-5, 7-10, 41, 43-45, 48, 50-51, 53, 55, 57, 59, or a complementary sequence thereof.

[0010] In another aspect, the present invention relates to a 3'UTR (3' untranslated region) which

[0011] i) comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof, preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof, more preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-20, 22-23, 25-26, 28, 61-71, 73-80, or a complementary sequence thereof, more preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-16, 18-19, 22, 25, 28, 61, 63-66, 68, 70-71, 73-80, or a complementary sequence thereof; or

[0012] ii) comprising a nucleotide sequence shown in one of SEQ ID NOs: 15-28 and 61-80 or its complementary sequence with one or more additional sequences inserted therein, preferably the additional sequence is a miRNA binding site, more preferably the additional sequence is selected from the full-length microRNA reverse complementary sequence or the reverse complementary sequence of its seed sequence, more preferably the full-length microRNA reverse complementary sequence is 19-25 nt in length or the reverse complementary sequence of the seed sequence is 7-8 nt in length.

[0013] In another aspect, the present invention relates to an RNA molecule for expressing a polypeptide of interest, comprising a 5'UTR of the present invention and / or a 3'UTR of the present invention.

[0014] In another aspect, the present invention relates to a nucleic acid vector comprising a coding sequence for the RNA molecule of the present invention.

[0015] In another aspect, the invention relates to a cell comprising the RNA molecule of the invention or the nucleic acid vector of the invention.

[0016] In another aspect, the present invention relates to a method for increasing the expression of a polypeptide of interest in a cell, the method comprising introducing into the cell an RNA molecule of the present invention and / or a nucleic acid vector of the present invention.

[0017] In another aspect, the present invention relates to a pharmaceutical composition comprising the RNA molecule of the present invention, and / or the nucleic acid vector of the present invention and / or the host cell of the present invention, and a pharmaceutically acceptable carrier.

[0018] In another aspect, the present invention relates to the use of the 5'UTR of the present invention and / or the 3'UTR of the present invention for improving the translation efficiency of a polypeptide of interest in an RNA molecule comprising the coding sequence of the polypeptide of interest.

[0019] BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1. Exemplary mRNA sequences containing UTRs of the present invention. A: 5'UTR; B: 3'UTR.

[0021] Figure 2. 5200 Fragment Analyzer (Agilent) was used to detect the length and integrity of mRNA molecules (sequence shown in Figure 1).

[0022] Figure 3. Relative light units of firefly luciferase in lysates of cells transfected with mRNA containing candidate 5'UTRs. Statistical differences were calculated using the Student's t-test.

[0023] Figure 4. Flow cytometry was used to measure the relative intensity of red fluorescent protein in lysates of cells transfected with mRNA containing candidate 5'UTRs, and the differences were statistically analyzed using the student t-test.

[0024] Figure 5. Relative light units of firefly luciferase in lysates of cells transfected with mRNA containing candidate 3'UTRs

[0025] Figure 6. Flow cytometry analysis of the relative intensity of red fluorescent protein in cells transfected with mRNA containing candidate 3'UTRs.

[0026] FIG7 . Fluorescence quantitative analysis of the relative intensity of green fluorescent protein after transfection of 293T cells with mRNA containing the 3'UTR of the present invention with three microRNA binding sites, and its changing trend within 24 hours.

[0027] FIG8 . Fluorescence quantitative analysis of the relative intensity of green fluorescent protein after transfection of Hela cells with mRNA containing the 3'UTR of the present invention with three microRNA binding sites, and its changing trend within 24 hours.

[0028] Detailed Description of the Invention

[0029] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terminology and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those widely used in the relevant fields and are standard procedures.

[0030] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0031] "Polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded polymers of RNA or DNA that optionally contain synthetic, non-natural, or altered nucleotide bases. Nucleotides are referred to by their single-letter designations as follows: "A" for adenosine or deoxyadenosine (RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or deoxyguanosine, "U" for uridine, "T" for deoxythymidine, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide. Although nucleotide sequences herein may be presented as DNA sequences (including T), when reference is made to RNA, one skilled in the art can readily determine the corresponding RNA sequence (i.e., replacing T with U).

[0032] "Polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide," "peptide," "amino acid sequence," and "protein" may also include modified forms including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0033] When the term "comprising" is used herein to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention.

[0034] "Sequence identity" between two polypeptide sequences or two polynucleotide sequences refers to the percentage of identical amino acids or nucleotides between the sequences. Methods for assessing the level of sequence identity between polypeptide or polynucleotide sequences are known in the art. Sequence identity can be assessed using various known sequence analysis software. For example, sequence identity can be assessed using the EMBL-EBI online alignment tool (https: / / www.ebi.ac.uk / Tools / psa / ). The sequence identity between two sequences can be assessed using the Needleman-Wunsch algorithm using default parameters. Sequence identity can be sequence identity along the entire length of a given sequence.

[0035] In one aspect, the present invention relates to a 5'UTR (5' untranslated region) comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof. In some embodiments, the 5'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof. In some preferred embodiments, the 5'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 1, 3-5, 7-11, 13, 41-46, 48, 50-53, 55-57, 59-60, or a complementary sequence thereof. In some more preferred embodiments, the 5'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 4-5, 7-10, 41, 43-45, 48, 50-51, 53, 55, 57, 59, or a complementary sequence thereof.

[0036] The "5'UTR" generally refers to the sequence from the 5' end of an mRNA molecule to the translation start codon, which recruits the ribosome complex and initiates mRNA translation. The 5'UTR interacts with transcription factors, ribosomes, and other transcriptional regulatory proteins to regulate post-transcriptional modifications, the formation and stability of the translation initiation complex, and other processes.

[0037] In some embodiments of aspects of the present invention, the 5'UTR is a non-natural 5'UTR. In some embodiments, the 5'UTR is an artificial intelligence designed 5'UTR.

[0038] In another aspect, the present invention relates to a 3'UTR (3' untranslated region) comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof. In some embodiments, the 3'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof. In some preferred embodiments, the 3'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 15-20, 22-23, 25-26, 28, 61-71, 73-80, or a complementary sequence thereof. In some more preferred embodiments, the 3'UTR comprises a nucleotide sequence as set forth in one of SEQ ID NOs: 15-16, 18-19, 22, 25, 28, 61, 63-66, 68, 70-71, 73-80, or a complementary sequence thereof.

[0039] As used herein, "3'UTR" refers to the sequence between the stop codon and the poly(A) sequence of a polypeptide-coding sequence in an mRNA. The 3'UTR can regulate mRNA translation by interacting with mRNA-binding proteins, miRNAs, and other proteins. The sequence and structural characteristics of the 3'UTR can influence mRNA stability, ribosome scanning, and the formation of the translation termination complex, thereby affecting protein expression levels.

[0040] The 3'UTR of the present invention has a certain degree of stability and can tolerate a certain degree of sequence insertion (such as a microRNA binding site) without affecting its ability to promote translation of the coding region in the mRNA molecule or affecting the stability of the mRNA molecule. Therefore, in some embodiments, the 3'UTR of the present invention further has one or more (e.g., 1-5) additional sequences inserted.

[0041] In some embodiments, the one or more additional sequences are inserted into a sequence of one of SEQ ID NOs: 15-28 and 61-80, or a sequence complementary thereto. In some embodiments, the one or more additional sequences are randomly inserted into a sequence of one of SEQ ID NOs: 15-28 and 61-80, or a sequence complementary thereto. In some embodiments, the one or more additional sequences are randomly inserted into a sequence of one of SEQ ID NOs: 15-28 and 61-80, or a sequence complementary thereto, at different positions.

[0042] In some preferred embodiments, the additional sequence is a miRNA binding site. In some preferred embodiments, the additional sequence is selected from the reverse complementary sequence of the full-length microRNA or the reverse complementary sequence of the seed sequence of the microRNA. In some preferred embodiments, the reverse complementary sequence of the full-length microRNA is 19-25 nt in length or more preferably the reverse complementary sequence of the seed sequence of the microRNA is 7-8 nt in length.

[0043] In some embodiments, the microRNA is hsa-microRNA-122-5p. hsa-microRNA-122-5p, for example, has the nucleotide sequence set forth in SEQ ID NO:36, and its reverse complement sequence is set forth in SEQ ID NO:37. In some embodiments, the 3'UTR having one or more inserted additional sequences described herein comprises the nucleotide sequence set forth in SEQ ID NO:38.

[0044] In some embodiments of the various aspects of the present invention, the 3'UTR is a non-natural 3'UTR. In some embodiments, the 3'UTR is an artificial intelligence designed 3'UTR

[0045] In one aspect, the present invention provides an RNA molecule comprising a 5'UTR of the present invention and / or a 3'UTR of the present invention.

[0046] In some embodiments, the RNA molecule comprises a 5'UTR of the present invention. The 5'UTR of the present invention can be combined with a different 3'UTR to enhance the translation of the RNA molecule. The 3'UTR can be a 3'UTR known in the art, such as a 3'UTR from a natural RNA molecule, or a non-natural 3'UTR, such as a 3'UTR designed by artificial intelligence.

[0047] In some embodiments, the RNA molecule comprises a 3'UTR of the present invention. The 3'UTR of the present invention can be combined with a different 5'UTR to enhance the translation of the RNA molecule. The 5'UTR can be a 5'UTR known in the art, such as a 5'UTR from a natural RNA molecule, or a non-natural 5'UTR, such as a 5'UTR designed by artificial intelligence.

[0048] In some embodiments, the RNA molecule comprises a 5'UTR of the present invention and a 3'UTR of the present invention. The 5'UTR of the present invention can be combined with the 3'UTR of the present invention to achieve the effect of enhancing the translation of the RNA molecule.

[0049] In some embodiments, the RNA molecule is a messenger RNA (mRNA). An mRNA molecule is typically a linear RNA molecule.

[0050] In some embodiments, the RNA molecule is a circular RNA molecule.A circular RNA molecule is a covalently closed RNA molecule.

[0051] In some embodiments, the RNA molecule is used to express a polypeptide of interest in a cell. In some embodiments, the RNA molecule comprises a coding sequence for the polypeptide of interest, which is operably linked to the 5' UTR and / or the 3' UTR. Operably linked means that a given element is able to effectively regulate the translation of the polypeptide of interest from the RNA molecule in the cell.

[0052] In some embodiments, the RNA molecule further comprises a poly(A) sequence. In some embodiments, the poly(A) sequence is operably linked to a coding sequence for a polypeptide of interest.

[0053] Poly(A) sequences typically contain multiple adenine nucleotides. The addition of poly(A) sequences contributes to the stability and transport of mRNA, prevents its degradation, and plays an important role in post-transcriptional modification. The poly(A) sequence can be a continuous chain of pure adenine nucleotides, but it can also be a variant containing non-adenine nucleotides, as long as its function is equivalent to that of a conventional poly(A) sequence, that is, it can provide similar biological functions as the natural poly(A) sequence, such as affecting mRNA stability, translation efficiency, or ribosome binding. Known poly(A) sequences include the human growth hormone (hGH) poly(A) sequence and the simian virus 40 (SV40) poly(A) sequence. These variants may differ in nucleotide composition, but are considered functionally equivalent to traditional poly(A) sequences.

[0054] In some embodiments of the present invention, the poly (A) sequence comprises about 20 to about 500 consecutive adenine nucleotides (A), for example, about 25, about 50, about 100, about 150, about 175, about 200, about 300, about 400, about 500 consecutive adenine nucleotides (A).

[0055] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0056] 1) the 5'UTR of the present invention; and

[0057] 2) The coding sequence of the polypeptide of interest.

[0058] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0059] 1) 5'UTR of the present invention;

[0060] 2) the coding sequence of the polypeptide of interest; and

[0061] 3) 3'UTR.

[0062] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0063] 1) 5'UTR of the present invention;

[0064] 2) the coding sequence of the polypeptide of interest; and

[0065] 3) 3'UTR; and

[0066] 4) Poly(A) sequence.

[0067] The 3'UTR in 3) can be a 3'UTR known in the art, such as a 3'UTR from a natural RNA molecule, or can be non-natural, such as a 3'UTR designed by artificial intelligence. In some embodiments, the 3'UTR is a 3'UTR of the present invention.

[0068] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0069] 1] the coding sequence of a polypeptide of interest; and

[0070] 2] The 3'UTR of the present invention.

[0071] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0072] 1]5'UTR;

[0073] 2] the coding sequence of the polypeptide of interest; and

[0074] 3] The 3'UTR of the present invention.

[0075] In some embodiments, the RNA molecule comprises the following sequence from 5' to 3':

[0076] 1]5'UTR;

[0077] 2] The coding sequence of the polypeptide of interest;

[0078] 3] The 3'UTR of the present invention; and

[0079] 4] Poly(A) sequence.

[0080] The 5'UTR in 1] can be a 5'UTR known in the art, such as a 5'UTR from a natural RNA molecule, or can be non-natural, such as a 5'UTR designed by artificial intelligence. In some embodiments, the 5'UTR is a 5'UTR of the present invention.

[0081] The "polypeptide of interest" described herein can be any polypeptide to be expressed in a target cell.

[0082] The polypeptide of interest may be a polypeptide of eukaryotic, prokaryotic, or viral origin. In certain embodiments, the polypeptide of interest may be any polypeptide for therapeutic, prophylactic, or diagnostic purposes. For example, the polypeptide of interest may be an antigen, an antibody, a gene editing enzyme such as a CRISPR nuclease, etc. The polypeptide of interest may also be a chimeric antigen receptor, an immunomodulatory protein, a transcription factor, etc. Examples of such polypeptides include, but are not limited to, luciferase, red / green fluorescent protein, human erythropoietin, and β-galactosidase.

[0083] The coding sequence of the polypeptide of interest may be codon-optimized for the target cell to be expressed.

[0084] Codon optimization refers to a method for modifying a nucleic acid sequence to enhance expression in a host cell of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of a native sequence with a codon that is more frequently or most frequently used in the genes of a host cell. Different species exhibit specific preferences for certain codons of specific amino acids. Codon preference (the difference in codon usage between organisms) is often associated with the translation efficiency of mRNA, and this translation efficiency is considered to depend on the properties of the codons translated and the availability of specific transfer RNA (tRNA) molecules. The advantage of selected tRNA in the cell generally reflects the codons that are most frequently used for peptide synthesis. Therefore, genes can be customized to optimal gene expression based on codon optimization in a given organism. Codon utilization tables can be easily obtained. See, Nakamura Y. et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000. Nucl. Acids Res., 28:292 (2000).

[0085] In some embodiments, the RNA molecule is chemically synthesized. In some embodiments, the RNA molecule is obtained by in vitro transcription.

[0086] In some embodiments, the RNA molecule is an mRNA molecule, which further comprises a 5' cap structure.

[0087] As used herein, "5' cap" for RNA includes 5' cap structures present on natural mRNA and its analogs. The 5' cap structure on natural mRNA refers to that methylated guanylate is connected to the 5' terminal nucleotide of RNA via pyrophosphate to form a 5', 5'-triphosphate connection (5', 5'-triphosphate linkage). There are three types of 5' caps (m7G5'ppp5'Np, m7G5'ppp5'NmpNp, m7G5'ppp5'NmpNmpNp), respectively referred to as Cap0, Cap1 and Cap2. Cap0 refers to that the ribose of the terminal nucleotide is not methylated, Cap1 refers to that the ribose of one terminal nucleotide is methylated, and Cap2 refers to that the ribose of both terminal nucleotides is methylated. In some embodiments of the present invention, the 5' cap structure is a Cap1 cap structure.

[0088] Methods for capping mRNA molecules are known in the art. The 5' cap structure of the mRNA molecule can be added enzymatically after the mRNA molecule is obtained by chemical synthesis or in vitro transcription (for example, using a commercial kit containing vaccinia capping enzyme and mRNA cap structure 2'-O-methyltransferase). However, it is also possible to produce a capped mRNA by directly incorporating a nucleotide analog with a cap structure as the first nucleotide into the transcript during in vitro transcription.

[0089] In some embodiments, the RNA molecules of the present invention may further comprise at least one nucleotide modification. The at least one nucleotide modification includes but is not limited to cytidine modification, uridine modification or adenosine modification. In some embodiments, at least one nucleoside modification includes but is not limited to 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ) and 5-methoxyuridine (5moU). In some embodiments, the RNA molecules of the present invention may comprise at least one modified nucleotide, preferably, the modified nucleotide is selected from pseudouridine, N1-methyl-pseudouridine, 5-methylcytidine or a combination thereof.

[0090] In some embodiments of the invention, an RNA molecule comprising a 5'UTR of the invention results in comparable or increased expression of the polypeptide of interest in a cell (e.g., in HEK293T or HCT116 cells) compared to a corresponding RNA molecule comprising a control 5'UTR (e.g., SEQ ID NO: 14), preferably, expression of the polypeptide of interest is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% or more. Preferred 5'UTRs of the invention result in an increase in expression of the polypeptide of interest of at least 20%. More preferred 5'UTRs of the invention result in an increase in expression of the polypeptide of interest of at least 50%.

[0091] In some embodiments of the invention, an RNA molecule comprising a 3'UTR of the invention results in comparable or increased expression of the polypeptide of interest in a cell (e.g., in HEK293T or HCT116 cells) compared to a corresponding RNA molecule comprising a control 3'UTR (e.g., SEQ ID NO: 29). Preferably, expression of the polypeptide of interest is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% or more. Preferred 3'UTRs of the invention result in an increase in expression of the polypeptide of interest of at least 20%. More preferred 3'UTRs of the invention result in an increase in expression of the polypeptide of interest of at least 50%.

[0092] In some embodiments of the invention, an RNA molecule comprising a 5'UTR of the invention and a 3'UTR of the invention results in comparable expression or increased expression of the polypeptide of interest in a cell (e.g., in HEK293T or HCT116 cells) compared to a corresponding RNA molecule comprising a control 5'UTR (e.g., SEQ ID NO: 14) and a control 3'UTR (e.g., SEQ ID NO: 29). Preferably, expression of the polypeptide of interest is increased by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% or more.

[0093] In one aspect, the present invention provides a nucleic acid vector comprising a coding sequence for an RNA molecule of the present invention. In some embodiments, the nucleic acid vector is used to generate an RNA molecule of the present invention.

[0094] As used herein, "vector" refers to a section of DNA extracted from a virus, plasmid or cell of a higher organism, into which a foreign DNA fragment can be inserted or has been inserted for cloning and / or expression purposes. In certain embodiments, a vector can be stably maintained in an organism. A vector can contain, for example, an origin of replication, a selective marker or a reporter gene, such as antibiotic resistance or GFP, and / or a multiple cloning site (MCS). The term includes linear DNA fragments (e.g., PCR products, linear plasmid fragments), plasmid vectors, viral vectors, cosmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), etc.

[0095] In some embodiments, the nucleic acid vector further comprises an RNA polymerase promoter sequence operably linked to the coding sequence of the RNA molecule. The operably linked promoter allows in vivo and / or in vitro transcription of the RNA molecule. The promoter is, for example, a T7 RNA polymerase promoter, a T6 viral RNA polymerase promoter, an SP6 viral RNA polymerase promoter, a T3 viral RNA polymerase promoter, or a T4 viral RNA polymerase promoter.

[0096] In some embodiments, the nucleic acid vector is a plasmid vector. In some embodiments, the nucleic acid vector comprises a restriction endonuclease site, such as a type IIS restriction endonuclease site, at the 3' flank of the coding sequence of the RNA molecule. Suitable restriction endonucleases include, but are not limited to, BsmBI, BsaI, SapI, etc. The restriction endonuclease site can be used to linearize the nucleic acid vector for in vitro transcription.

[0097] Methods for obtaining RNA molecules by in vitro transcription from nucleic acid vectors are known in the art. For example, commercial kits can be used for in vitro transcription.

[0098] In another aspect, the present invention provides a method for increasing the expression of a polypeptide of interest in a cell, the method comprising introducing the RNA molecule of the present invention and / or the nucleic acid vector of the present invention into the cell.

[0099] The RNA molecules of the present invention and / or the nucleic acid vectors of the present invention can be introduced into cells by methods known in the art, such as microinjection, liposome-mediated transfection, or electroporation.

[0100] In another aspect, the invention provides a cell comprising an RNA molecule of the invention or a nucleic acid vector of the invention.

[0101] In another aspect, the present invention provides a pharmaceutical composition comprising the RNA molecule of the present invention and / or the nucleic acid vector of the present invention and / or the cell of the present invention, and a pharmaceutically acceptable carrier. The specific use of the composition depends on the polypeptide of interest.

[0102] In some embodiments, the pharmaceutical composition is used to treat and / or prevent a disease in a subject. The specific disease to be treated and / or prevented depends on the polypeptide of interest. When the polypeptide of interest is an antigenic polypeptide, the pharmaceutical composition can be a vaccine.

[0103] Pharmaceutically acceptable carriers may include, but are not limited to, buffers, excipients, stabilizers, or preservatives. Examples of pharmaceutically acceptable carriers are physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, such as salts, buffers, sugars, antioxidants, aqueous or non-aqueous carriers, preservatives, wetting agents, surfactants, or emulsifiers, or combinations thereof. The amount of a pharmaceutically acceptable carrier in a pharmaceutical composition can be determined experimentally based on the activity of the carrier and the desired properties of the formulation, such as stability and / or minimal oxidation.

[0104] The "cells" herein may be mammalian cells, including but not limited to rodent cells such as mouse cells and rat cells; primate cells such as monkey cells and human cells. Preferably, the cells are human cells.

[0105] The "subject" herein can be a mammal, including but not limited to a rodent such as a mouse or a rat, a primate such as a monkey or a human. Preferably, the subject is a human. Example

[0106] The present invention can be further understood by reference to the specific embodiments described herein, which are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. Obviously, those skilled in the art will appreciate that various modifications and variations can be made to the present invention without departing from the spirit of the present invention, and such modifications and variations also fall within the scope of the present invention.

[0107] Example 1. Data training and method for generating non-natural UTR sequences

[0108] Using publicly available human cell Ribo-seq and RNA-seq data from public databases, a deep learning prediction model was trained to predict protein translation efficiency based on mRNA 5'UTR sequences. Subsequently, artificial intelligence analysis strategies, including generative adversarial networks (GANs) and long-short-term memory recurrent neural networks (LSTMs), were employed to train a generative learning model using 5'UTR sequences from the human genome. This model was then used to generate novel, non-natural 5'UTR sequences. Combining the generative model with the prediction model, the generated non-natural 5'UTR sequences were evaluated to predict the translation efficiency of RNAs composed of these 5'UTRs and protein-coding ORFs. This model then identified a number of 5'UTR sequences with the potential to achieve high protein translation efficiency. Sequences with low protein translation efficiency in actual expression were then eliminated through wet assays. The resulting candidate 5'UTR sequences are shown in Table 1.

[0109] A similar method was used to screen candidate 3'UTRs, and their sequences are shown in Table 2.

[0110] Table 1. Candidate 5'UTRs

[0111] Table 2. Candidate 3'UTRs

[0112] Example 2: Construction of vectors containing candidate UTR sequence elements

[0113] To test candidate 5'UTRs, a nucleic acid fragment containing a T7 promoter, a candidate 5'UTR or a control 5'UTR, a sequence encoding firefly luciferase or red fluorescent protein (Table 3), a 3'UTR (SEQ ID NO: 29), a poly(A) sequence containing 100 A nucleotide residues, and a type IIS restriction endonuclease cleavage site was synthesized in vitro and cloned into an in vitro transcription vector (pIVTRup, Addgene plasmid #101362). The 5'UTR sequence element (SEQ ID NO: 14) used as a control was derived from the Moderna mRNA1273 expression vector, complete sequence (GenBank: OR134578.1). The 3'UTR sequence element (SEQ ID NO: 29) was derived from the Moderna mRNA1273 expression vector, complete sequence (GenBank: OR134578.1).

[0114] To test candidate 3'UTRs, nucleic acid fragments containing a T7 promoter, a 5'UTR (SEQ ID NO: 14), a sequence encoding firefly luciferase or red fluorescent protein (Table 3), a candidate 3'UTR or a control 3'UTR, a poly(A) sequence comprising 100 A nucleotide residues, and a type IIS restriction endonuclease cleavage site were synthesized in vitro and cloned into an in vitro transcription vector. The 5'UTR sequence element (SEQ ID NO: 14) was derived from the Moderna mRNA1273 expression vector, complete sequence (GenBank: OR134578.1). The control 3'UTR sequence element (SEQ ID NO: 29) was derived from the Moderna mRNA1273 expression vector, complete sequence (GenBank: OR134578.1).

[0115] Table 3. Firefly luciferase and red fluorescent protein sequences

[0116] Example 3. Generation of mRNA molecules containing candidate UTR sequence elements

[0117] The vector obtained in Example 2 was linearized and transcribed in vitro using T7 RNA polymerase to produce mRNA molecules, while simultaneously adding a 5'-cap structure. The 5'-cap structure is incorporated into the transcript as the first nucleotide during in vitro transcription via co-transcriptional capping, directly producing mRNA molecules with the Cap1 structure. Figure 1 shows the sequence of an exemplary mRNA containing a candidate UTR element of the present invention.

[0118] The resulting mRNA molecules were purified and resuspended in water. A 5200 fragment analyzer (Agilent) was used to analyze the mRNA for length and integrity (values ​​derived from the area under the curve of expected length fragments). If these values ​​met the requirements (see Figure 2), they could be used for subsequent testing of different candidate UTR sequence elements.

[0119] Example 4: Identification of the Effect of Candidate 5'UTR Sequence Elements on Translation Efficiency by Luciferase Reporter System

[0120] This example tests whether a candidate 5'UTR sequence element has a positive regulatory effect on translation by the following method:

[0121] 1) Transfecting mammalian 293T cells with RNA molecules containing candidate 5'UTR sequence elements (encoding the protein sequence of firefly luciferase);

[0122] 2) Detect the chemiluminescence absorbance of luciferase at a specific time point (24 hours) after transfection, which represents the protein expression level;

[0123] 3) Subtract the light absorbance value of the background group from the light absorbance value reading of the experimental group containing the candidate 5'UTR sequence element to obtain the relative light unit of the experimental group.

[0124] The relative light units measured for each candidate 5'UTR sequence element can indicate the translational regulatory ability of the candidate 5'UTR sequence element.

[0125] Luciferase chemiluminescence absorbance assay for determining translation efficiency:

[0126] 293T human embryonic kidney cells were cultured at 5×10 4The cells were seeded in 48-well plates at a density of 10 cells / well. The next day, the cells were washed in Opti-MEM and subsequently transfected with 200ng / well of Lipofectamine 2000-complexed mRNA encoding firefly luciferase containing candidate UTR sequence elements in Opti-MEM. Cells without any RNA molecules were used as background groups. After 6 hours of transfection, the mixed culture medium was aspirated and replaced with complete culture medium. After 24 hours of transfection, the culture medium was aspirated and 100μl of lysis buffer (Promega) was added. After lysis for 5 minutes, the absorbance value was detected and read.

[0127] Luciferase activity was measured as relative light units (RLU) in a multiwell plate reader (Agilent). Luciferase activity was measured sequentially from individual samples in the luciferase assay. 20 μl of lysate was pipetted, 50 μl of buffer containing firefly luciferase substrate was added, the plate was shaken to mix, and the absorbance was measured.

[0128] The 5'UTR test results are shown in Table 4 and Figure 3 below.

[0129] Table 4. RLU ratios of candidate 5'UTRs

[0130] Example 5: Identification of the Effect of Candidate 5'UTR Sequence Elements on Translation Efficiency Using a Red Fluorescent Protein Reporter System

[0131] This example uses fluorescent protein experiments to test whether candidate 5'UTR sequence elements have a positive regulatory effect on translation, using the following method:

[0132] 1) Transfect mammalian 293T cells with an RNA molecule containing a candidate 5'UTR sequence element (encoding a red fluorescent protein protein);

[0133] 2) At a specific time point (24 hours) after transfection, the fluorescent protein intensity was detected by flow cytometry to represent its protein expression level;

[0134] 3) Divide the intensity of red fluorescent protein by the internal reference (intensity of green fluorescent protein) to obtain the relative intensity of the experimental group.

[0135] The relative light intensity obtained for each candidate 5'UTR sequence element can indicate the translational regulatory ability of the candidate 5'UTR sequence element.

[0136] Flow cytometry for determining translation efficiency using fluorescence intensity:

[0137] 293T human embryonic kidney cells were cultured at 2×10 5Cells were seeded in 24-well plates at a density of 10 cells / well. The next day, the cells were washed in Opti-MEM and subsequently transfected with 200 ng / well of Lipofectamine 2000-complexed mRNA encoding red fluorescent protein containing the candidate 5'UTR sequence element in Opti-MEM, and an equal amount of green fluorescent protein mRNA was co-transfected as an internal control. Six hours after transfection, the mixed medium was aspirated and replaced with complete medium. 24 hours after transfection, the medium was aspirated, trypsin was added for digestion for 3 minutes, and the cells were neutralized and collected. The cells were suspended in PBS and analyzed in a flow cytometer, and the intensity of red and green fluorescence was read.

[0138] The amino acid sequence of green fluorescent protein used as an internal reference is shown below (SEQ ID NO: 34):

[0139] The sequence of the green fluorescent protein used as an internal reference is as follows (SEQ ID NO: 35):

[0140] The 5'UTR test results are shown in Table 5 and Figure 4 below.

[0141] Table 5. Relative light intensity of candidate 5'UTRs

[0142] N / A: No experiment conducted

[0143] The candidate 5'UTR of the present invention can achieve comparable or better translation efficiency than the control 5'UTR.

[0144] Example 6: Identification of the effect of candidate 3'UTR sequence elements on translation efficiency using a luciferase reporter system

[0145] This example tests whether a candidate 3'UTR sequence element has a positive regulatory effect on translation by the following method:

[0146] 1) Transfect representative human cell lines, human embryonic kidney cell line HKE293T and human colon cancer cell line HCT116, with RNA molecules containing candidate 3'UTR sequence elements (encoding the protein sequence of firefly luciferase);

[0147] 2) Detect the chemiluminescence absorbance of luciferase at a specific time point (24 hours) after transfection, which represents the protein expression level;

[0148] 3) Subtract the absorbance reading of the background group from the absorbance reading of the experimental group containing the candidate 3'UTR sequence element to obtain the relative light unit of the experimental group.

[0149] The relative light units measured for each candidate 3'UTR sequence element can indicate the translational regulatory ability of the candidate 3'UTR sequence element.

[0150] Luciferase chemiluminescence absorbance assay for determining translation efficiency:

[0151] HEK293T human embryonic kidney cells or HCT116 human colon cancer cell lines were cultured at a rate of 5 × 10 4 The cells were seeded in a 48-well plate at a density of 10 cells / well. The next day, the cells were washed in Opti-MEM and subsequently transfected with 200 ng / well of Lipofectamine 2000-complexed mRNA encoding firefly luciferase containing candidate 3'UTR sequence elements in Opti-MEM. Cells without any RNA molecules were used as a background group. After 6 hours of transfection, the mixed culture medium was aspirated and replaced with complete culture medium. After 24 hours of transfection, the culture medium was aspirated and 100 μl of lysis buffer (Promega) was added. After lysis for 5 minutes, the absorbance value was detected and read.

[0152] Luciferase activity was measured as relative light units (RLU) in a multiwell plate reader (Agilent). Luciferase activity was measured sequentially from individual samples in the luciferase assay. 20 μl of lysate was pipetted, 50 μl of buffer containing firefly luciferase substrate was added, the plate was shaken to mix, and the absorbance was measured.

[0153] The results of the 3'UTR assay are shown in Tables 6A and 6B below and in Figures 5A and 5B.

[0154] Table 6A. RLU ratios of candidate 3'UTRs (HEK293T cell line)

[0155] Table 6B, RLU ratios of candidate 3'UTRs (HCT116 cell line)

[0156] Example 7: Identification of the Effect of Candidate 3'UTR Sequence Elements on Translation Efficiency Using a Red Fluorescent Protein Reporter System

[0157] This example uses fluorescent protein experiments to test whether candidate 3'UTR sequence elements have a positive regulatory effect on translation, using the following method:

[0158] 1) Transfect mammalian 293T cells with an RNA molecule containing a candidate 3'UTR sequence element (encoding a red fluorescent protein protein);

[0159] 2) At a specific time point (24 hours) after transfection, the fluorescent protein intensity was detected by flow cytometry to represent its protein expression level;

[0160] 3) Divide the intensity of red fluorescent protein by the internal reference (intensity of green fluorescent protein) to obtain the relative intensity of the experimental group.

[0161] The relative light intensity obtained for each candidate 3'UTR sequence element can indicate the translational regulatory ability of the candidate 3'UTR sequence element.

[0162] Flow cytometry for determining translation efficiency using fluorescence intensity:

[0163] 293T human embryonic kidney cells were cultured at 2×10 5 The cells were seeded in a 24-well plate at a density of 10 cells / well. The next day, the cells were washed in Opti-MEM and subsequently transfected with 200 ng / well of Lipofectamine 2000-complexed mRNA encoding red fluorescent protein containing candidate UTR sequence elements in Opti-MEM, and co-transfected with an equal amount of green fluorescent protein mRNA (SEQ ID NO: 35) as an internal reference. 6 hours after transfection, the mixed culture medium was aspirated and replaced with complete culture medium. 24 hours after transfection, the culture medium was aspirated, trypsin was added for digestion for 3 minutes, neutralized, and the cell samples were collected. Cells were analyzed in a flow cytometer using PBS as a suspension, and the intensity of red and green fluorescence was read.

[0164] The results of the 3'UTR test are shown in Table 7 and Figure 6 below.

[0165] Table 7. Relative light intensity of candidate 3'UTRs

[0166] The candidate 3'UTR of the present invention can achieve comparable or better translation efficiency than the control 3'UTR.

[0167] Example 8: Inserting a microRNA binding site into a candidate 3'UTR does not affect its function

[0168] In nature, the 3'UTR regions of many mRNA molecules contain microRNA binding sites. Through these sites, microRNAs can achieve precise regulation of mRNAs, including translational repression and enhanced mRNA degradation. Given the significant differences in microRNA expression across tissues and disease stages, they are often considered highly specific biomarkers. Therefore, inserting microRNA binding sites into the 3'UTR region is a common strategy for regulating mRNA function. In theory, the interaction between miRNAs and their target mRNAs primarily relies on perfect complementarity between the miRNA seed sequence (typically 2 to 8 nucleotides) and the corresponding site in the mRNA 3'UTR. This complementary pairing is sufficient to direct the RNA-induced silencing complex (RISC) to the target mRNA, thereby inhibiting its translation or promoting its degradation. Numerous studies have demonstrated that in addition to seed sequence matching, additional complementary pairs between miRNA sequences and mRNAs can enhance miRNA-mediated gene regulation. This additional complementary pairing typically occurs in regions outside the miRNA seed sequence. Matching in these regions can increase the affinity of the miRNA for its target, thereby enhancing the efficiency of mRNA repression. For example, Moderna uses a strategy of inserting the full-length reverse complement sequence of a miRNA into the 3'UTR region. This design enables the miRNA to form a more extensive complementary pairing with its target mRNA, not just with the seed sequence, thereby enhancing the regulatory efficacy of the miRNA on the mRNA.

[0169] This example uses a fluorescent protein that rapidly degrades in cells to test whether the function of the candidate 3'UTR sequence element has changed after modification, confirming its positive regulatory function on translation and its regulatory effect on mRNA molecular stability. The method is as follows:

[0170] 1) Insert the full-length hsa-microRNA-122-5p reverse complementary sequence into three random sites in the candidate 3'UTR (SEQ ID NO: 25) to generate a new 3'UTR (SEQ ID NO: 38).

[0171] 2) Transfect mammalian cell lines such as 293T, Hela, and raw264.7 with RNA molecules containing the new 3'UTR and the original 3'UTR sequence elements (both encoding a 1-hour degraded green fluorescent protein, d1EGFP. This protein has a lifespan of approximately 1 hour. After 1 hour when the mRNA is no longer translated into protein, the green fluorescence disappears. Therefore, protein fluorescence can directly indicate the stability of the mRNA).

[0172] 3) Within 24 hours after transfection, cells were photographed every hour to measure the intensity of the fluorescent protein, which represents the protein expression level;

[0173] 4) Divide the GFP intensity by the internal reference (Red intensity) to determine the relative intensity of the experimental or control group. This relative intensity can indicate the translational regulatory capacity of the 3'UTR sequence, and changes in fluorescence intensity over 24 hours can indicate the effect of the 3'UTR sequence on mRNA stability.

[0174] The full-length sequence of hsa-microRNA-122-5p is shown below (SEQ ID NO: 36):

[0175] TGGAGTGTGACAATGGTGTTTG

[0176] The reverse complementary sequence of the full-length hsa-microRNA-122-5p is shown below (SEQ ID NO: 37):

[0177] CAAACACCATTGTCACACTCCA

[0178] The sequence of the new 3'UTR obtained by inserting the reverse complementary sequence of the full-length hsa-microRNA-122-5p into three random sites in 3'UTR-seq24 is as follows (SEQ ID NO: 38):

[0179] The amino acid sequence of 1-hour degraded green fluorescent protein (d1EGFP) is shown below (SEQ ID NO: 39):

[0180] The sequence of the mRNA containing 1-hour degraded green fluorescent protein and a new 3'UTR sequence obtained by inserting the reverse complementary sequence of the full-length hsa-microRNA-122-5p into three random sites in 3'UTR-seq24 is as follows (SEQ ID NO: 40):

[0181] The experimental results showed that inserting a microRNA binding site into the candidate 3'UTR did not affect its function (Figures 7 and 8).

Claims

1. A 5'UTR (5' untranslated region), comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof. Preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 1-13 and 41-60, or a complementary sequence thereof; more preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 1, 3-5, 7-11, 13, 41-46, 48, 50-53, 55-57, 59-60, or a complementary sequence thereof; more preferably, the 5'UTR comprises the nucleotide sequence shown in one of SEQ ID NOs: 4-5, 7-10, 41, 43-45, 48, 50-51, 53, 55, 57, 59, or a complementary sequence thereof.

2. A 3'UTR (3' untranslated region) i) comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof, preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-28 and 61-80, or a complementary sequence thereof; more preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-20, 22-23, 25-26, 28, 61-71, 73-80, or a complementary sequence thereof; more preferably, the 3'UTR comprises the nucleotide sequence as shown in one of SEQ ID NOs: 15-16, 18-19, 22, 25, 28, 61, 63-66, 68, 70-71, 73-80, or a complementary sequence thereof; or ii) comprising a nucleotide sequence shown in one of SEQ ID NOs: 15-28 and 61-80 or its complementary sequence with one or more additional sequences inserted therein, preferably the additional sequence is a miRNA binding site, more preferably the additional sequence is selected from the full-length microRNA reverse complementary sequence or the reverse complementary sequence of its seed sequence, more preferably the full-length microRNA reverse complementary sequence is 19-25 nt in length or the reverse complementary sequence of the seed sequence is 7-8 nt in length.

3. An RNA molecule for expressing a polypeptide of interest, comprising the 5'UTR of claim 1 and / or the 3'UTR of claim 2.

4. The RNA molecule of claim 3, which is a messenger RNA (mRNA) molecule or a circular RNA molecule.

5. The RNA molecule of claim 3 or 4, wherein the RNA molecule comprises in the following order from 5' to 3' direction 1) the 5'UTR of claim 1; and 2) The coding sequence of the polypeptide of interest.

6. The RNA molecule of claim 3 or 4, wherein the RNA molecule comprises the following sequence from 5' to 3': 1) the 5'UTR of claim 1; 2) the coding sequence of the polypeptide of interest; and 3) 3'UTR.

7. The RNA molecule of claim 6, wherein the 3'UTR is the 3'UTR of claim 2.

8. The RNA molecule of claim 3 or 4, wherein the RNA molecule comprises in the following order from 5' to 3' direction 1] the coding sequence of a polypeptide of interest; and 2] The 3'UTR of claim 2.

9. The RNA molecule of claim 3 or 4, wherein the RNA molecule comprises in the following order from 5' to 3' direction 1]5'UTR; 2] the coding sequence of the polypeptide of interest; and 3] The 3'UTR of claim 2.

10. The RNA molecule of claim 9, wherein the 5'UTR is the 5'UTR of claim 1.

11. The RNA molecule of any one of claims 3 to 10, further comprising a poly (A) sequence.

12. The RNA molecule of claim 11, wherein the poly (A) sequence comprises about 20 to about 500 adenine nucleotides (A), for example, about 25, about 50, about 100, about 150, about 175, about 200, about 300, about 400, about 500 adenine nucleotides (A).

13. The RNA molecule of any one of claims 3 to 12, wherein the RNA molecule is an mRNA molecule, which further comprises a 5' cap structure, such as a Cap1 structure.

14. The RNA molecule according to any one of claims 3 to 13, wherein the RNA molecule is chemically synthesized or the RNA molecule is obtained by in vitro transcription.

15. The RNA molecule of any one of claims 3 to 14, wherein the RNA molecule may further comprise at least one nucleotide modification, preferably, the nucleotide modification is selected from one or a combination of 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ) and 5-methoxyuridine (5moU).

16. The RNA molecule of any one of claims 3 to 15, which results in comparable expression or increased expression of the polypeptide of interest in a cell, preferably an increase of about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100% or more in expression of the polypeptide of interest compared to a corresponding RNA molecule comprising a control UTR.

17. A nucleic acid vector comprising the coding sequence of the RNA molecule according to any one of claims 3 to 16.

18. The nucleic acid vector of claim 17, wherein the nucleic acid vector further comprises an RNA polymerase promoter sequence operably linked to the coding sequence of the RNA molecule.

19. The nucleic acid vector of claim 18, wherein the promoter is selected from the group consisting of a T7 RNA polymerase promoter, a T6 viral RNA polymerase promoter, an SP6 viral RNA polymerase promoter, a T3 viral RNA polymerase promoter, and a T4 viral RNA polymerase promoter.

20. A cell comprising the RNA molecule of any one of claims 3 to 16 or the nucleic acid vector of any one of claims 17 to 19.

21. A method for increasing the expression of a polypeptide of interest in a cell, the method comprising introducing into the cell the RNA molecule according to any one of claims 3 to 16 and / or the nucleic acid vector according to any one of claims 17 to 19.

22. A pharmaceutical composition comprising the RNA molecule according to any one of claims 3 to 16, and / or the nucleic acid vector according to any one of claims 17 to 19 and / or the host cell according to claim 20, and a pharmaceutically acceptable carrier.

23. Use of the 5'UTR of claim 1 and / or the 3'UTR of claim 2 for increasing the translation efficiency of a polypeptide of interest in an RNA molecule comprising a coding sequence of the polypeptide of interest.

Images