SLC6a1 gene therapy constructs

Abstract

Provided herein are SLC6A1 gene therapy constructs, as well as SLC6A1 promoters, compositions comprising the constructs and promoters, and methods of using the same.

Description

[0001]Attorney Docket No.37314-0124WO1 / CMCC 4357 SLC6A1 Gene Therapy Constructs CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Patent Application Serial No.63 / 569,989, filed on March 26, 2024. The entire contents of the foregoing are hereby incorporated by reference herein. TECHNICAL FIELD Provided herein are SLC6A1 gene therapy constructs, as well as SLC6A1 promoters, compositions comprising the constructs and promoters, and methods of using the same. BACKGROUND SLC6A1-related disorders are a group of rare genetic conditions (<500 reported cases worldwide1) due to autosomal dominant loss-of-function (LoF) mutations of the solute carrier family 6 member 1 (SLC6A1) gene2. SLC6A1 encodes ^-aminobutyric acid (GABA) transporter type 1 (GAT1), which is responsible for the reuptake of the inhibitory neurotransmitter GABA from the synaptic cleft3,4. SLC6A1 LoF leads to GAT1 functional impairment5,6, resulting in pathologic GABA accumulation in the extracellular space. SLC6A1-related disorders are characterized by developmental delay7,8, autism9, and childhood-onset epilepsy10(mean seizure onset is age 3.7 years). Anti- epileptic medications are ineffective in patients with SLC6A1, and a cure targeting the underlying SLC6A1 LoF such as gene replacement therapy (GRT) is lacking11. Importantly, despite increased ambient GABA, an inhibitory neurotransmitter, patients with SLC6A1 mutations are susceptible to refractory epilepsy12, underscoring the significance of compensatory changes that follow increased ambient GABA that may predispose a patient to epilepsy upon SLC6A1 LoF13. Among such changes that have been described are dampened quantal GABA release14and enhanced GABA- mediated tonic inhibitory currents15. Attorney Docket No.37314-0124WO1 / CMCC 4357 SUMMARY Provided herein are SLC6A1 gene therapy constructs, as well as SLC6A1 promoters, compositions comprising the constructs and promoters, and methods of using the same. Thus, provided herein are nucleic acids comprising a promoter sequence as described herein, e.g., that is at least 90%, 95%, or 99% identical to, or comprises, the full length human SLC6A1 native promoter sequence of SEQ ID NO:1 (hNAP), and optionally non-SLC6A1 sequences. Also provided herein are expression vectors comprising the promoter sequences as described herein, linked to a transgene. In some embodiments, the expression vector comprises a viral vector, e.g., a retrovirus, adenovirus, adeno-associated virus (AAV), or lentivirus, or a recombinant bacterial or eukaryotic plasmid. In some embodiments, the AAV is selected from the group consisting of AAV2 and AAV9. In some embodiments, the transgene is human SLC6A1. In some embodiments, the human SLC6A1 transgene is at least 95% identical to SEQ ID NO:2. In some embodiments, the expression vectors further comprise one, two, or more of: a pair of inverted terminal repeats (ITRs), a woodchuck hepatitis virus posttranscriptional response element (WPRE), and / or polyadenylation sequence. In some embodiments, the expression vector comprises a nucleic acid sequence from 5’ - 3’: ITR – hNaP - hSLC6A1 - WPRE - pA – ITR. In some embodiments, the vector comprises a nucleic acid sequence from 5’ -3’: ITR – hNaP - hSLC6A1 - pA – ITR. In some embodiments, the nucleic acid sequence is at least 90%, 95%, 97%, or 99%, or is 100% identical to SEQ ID NO:3, optionally without the WPRE sequence. Also provided herein are pharmaceutical compositions comprising the expression vectors described herein in a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise a nucleic acid sequence (e.g., a vector) as described herein in a capsid, e.g., an AAV2 or AAV9 capsid. In some embodiments, the expression vector is enclosed in a AAV-BI-hTFR1 capsid, or other capsids with affinity for the human transferrin receptor (TFRC) or is enclosed in AAV-derived capsids or nanoparticles with affinity for components of the human blood-brain barrier, or otherwise have the capacity for crossing the human blood brain barrier. Attorney Docket No.37314-0124WO1 / CMCC 4357 Additionally, provided herein are methods of treating a subject who has a SLC6A1-related disorder. Provided are methods of treating a subject who has a SLC6A1-related disorder, comprising administering to the subject a therapeutically effective amount of an expression vector comprising a transgene comprising human SLC6A1, optionally linked to a promoter sequence that is at least 90%, 95%, or 99% identical to, or comprises, the full length human SLC6A1 native promoter sequence of SEQ ID NO:1 (hNAP). Also provided are the nucleic acids, vectors, or pharmaceutical compositions described herein for use in methods of treating a subject who has a SLC6A1-related disorder. The methods comprise administering to the subject a therapeutically effective amount of a nucleic acid, vector, or pharmaceutical composition as described herein. In some embodiments, the nucleic acid, vector, or pharmaceutical composition is administered to the brain of the subject, e.g., directly to the brain of the subject. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIG 1. Transcriptional regulatory element analysis of the proposed human SLC6A1 native promoter (hNaP). Schematic diagram showing the ~1.6 kb genomic region of promoter sequence upstream of the SLC6A1 transcriptional start site. Regulatory elements sequence motif search was performed using the Nsite database. The respective locations of these regulatory sites (including the 21-bp motif enhancer element reported previously near -700bp) are listed in this graphical presentation. Attorney Docket No.37314-0124WO1 / CMCC 4357 FIGs.2A-C. Cloning strategy for pAAV-hNaP-SLC6A1. (A) An AAV backbone encompassing essential AAV expression and packaging elements available from Addgene. (B) The human SLC6A1 native promoter will be subcloned into the AAV backbone to form the pAAV-hNaP intermediate. (C) Recombinant SLC6A1 gene (coding sequence only) will be further inserted via restriction enzyme digestion and re-ligation. Compatible primer sequences for each cloning step are listed, SEQ ID NOs:4-7. FIGs.3A-C. Exemplary sequence of pAAV-hNaP-hSLC6A1 (7375bp total, 4507bp between ITRs; SEQ ID NO:3). The components include: ITR1: CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACC TTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCC ATCACTAGGGGTTCCT (SEQ ID NO:8) WPRE: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTT GCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCT TCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGAC GCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTC GCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGC TGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCA TCGTCCTTTCCTTGGCTGCTCGCCTATGTTGCCACCTGGATTCTGCGCGGGACGTCC TTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTG CCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCC CTTTGGGCCGCCTCCCCGC (SEQ ID NO:9) PolyA: GGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACT CCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAG GTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTT GGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTG GCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCT CAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTG Attorney Docket No.37314-0124WO1 / CMCC 4357 TTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAA TCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACC ACTGCTCCCTTCCCTGTCCTT (SEQ ID NO:10) ITR2: AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTG AGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGA GCGAGCGAGCGCGCAG (SEQ ID NO:11) The WPRE sequence can be omitted or altered, as can the polyA sequence. DETAILED DESCRIPTION Described herein are compositions and methods for gene replacement therapy (GRT) for the clinical syndrome of SLC6A1 deficiency (i.e., the SLC6A1 syndrome often termed “SLC6A1”), which is characterized by intellectual disability and epilepsy. The SLC6A1 encodes GABA transporter type 1 (GAT1), which is responsible for GABA clearance from the synapse. A viable GRT solution to SLC6A1 should accommodate two limitations to avoid excess GAT1 expression, which may lead to excess GABA clearance and thereby provoke, rather than suppress, seizures. First, SLC6A1 replacement should be limited to those cells that naturally express GAT1. Second, the magnitude of GAT1 expression per cell should not exceed their natural amounts. The present methods meet these requirements, e.g., by incorporating a native promoter for SLC6A1 driving a functional copy of SLC6A1 coding sequence in an AAV expression vector to form a vector AAV-hNaP-SLC6A1. The expression (biodistribution) of this novel AAV should resemble the endogenous expression profile, conferring cell specific SLC6A1 expression with appropriate amount of expression, leading to symptom reversal16. Thus, provided herein are SLC6A1 gene therapy constructs, as well as compositions comprising the constructs and methods of using the same. SLC6A1 Gene Therapy Constructs SLC6A1 nucleic acids can include naked mRNA or DNA, as well as expression constructs comprising sequences encoding SLC6A1, e.g., as provided herein, e.g., sequences that are at least 80%, 90%, 95%, 97%, or 99% identical to Human SLC6A1 Coding sequence (1800bp); SEQ ID NO:2 provides an exemplary Attorney Docket No.37314-0124WO1 / CMCC 4357 sequence. The sequence can optionally be codon optimized. The SLC6A1 expression constructs can be administered to a subject in need thereof. Expression constructs comprising sequences encoding SLC6A1 can include viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids. Suitable expression constructs can include: a coding region; a promoter sequence, e.g., a promoter sequence that restricts expression to a selected cell type as described herein; an optional enhancer sequence; untranslated regulatory sequences, e.g., a 5'untranslated region (UTR), a 3'UTR, or response elements; a polyadenylation site; and / or an insulator sequence. Such sequences are known in the art, and the skilled artisan would be able to select suitable sequences. For example, polyadenylation sequences can include the bovine growth hormone polyadenylation (bgh-PolyA) signal (e.g., comprising 5'- GTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGT C-3', SEQ ID NO:12, see US5122458), mutant BGH polyA, or polyA from herpes simplex virus type 1 thymidine kinase (HSV-TK), SV40, or a synthetic (Synt) poly A (Wang et al., Front Bioeng Biotechnol.2022 Jan 24;10:722722). The woodchuck hepatitis virus posttranscriptional response element (WPRE) and variants thereof can also be used (see, e.g., DE102020106710A1 and Choi et al., (2014). Molecular brain. 7.17.10.1186 / 1756-6606-7-17). See also, e.g., Current Protocols in Molecular Biology, Ausubel, F.M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14; Vancura (ed.), Transcriptional Regulation: Methods and Protocols (Methods in Molecular Biology (Book 809)) Humana Press; 2012 edition (2011) and other standard laboratory manuals. In some embodiments, the expression construct is capable of directing expression of the SLC6A1 nucleic acid preferentially in inhibitory neurons and astrocytes. SLC6A1 expression can be driven by a human native SLC6A1 promoter as described herein (e.g., SEQ ID NO:1, or a sequence that is at least 90%, 95%, 97%, or 99% identical to all or part of the full length of SEQ ID NO:1, e.g., and is at least 1100 nucleotides (nt) long, e.g., at least 1200, at least 1300, at least 1369, at least 1400, at least 1500, or all 1521 nt of SEQ ID NO:1), preferably comprising at least nt 175-1320 of SEQ ID NO:1, and preferably comprising at least 10, 20, 30, 50, 75, 100, 150, or all 200 nt of the 3’ end, e.g., of nt 1300-1521, or 1320-1521 (such that the 3’ Attorney Docket No.37314-0124WO1 / CMCC 4357 end of the promoter is at or comprises nt 1320, 1330, 1340, 1350, 1370, 1395, 1420, 1460, or 1520 or 1521). If truncations of SEQ ID NO:1 are present, the truncations preferably are at either the 3’end or 5’end, but preferably not both. Exemplary sequences can include those that begin at nt 1, 5, 10, 20, 30, 50, 75, 100, 150, or 175 of SEQ ID NO:1, and end at nt 1300, 1320, 1330, 1340, 1350, 1370, 1395, 1420, 1460, or 1520 or 1521, with any combination of the foregoing for start and end points. Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure. The constructs can include, e.g., a viral delivery vector, e.g., preferably an adeno-associated virus (AAV) vector that comprises sequences encoding GAT1 (i.e., SLC6A1 sequences). Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka, N., Curr Top Microbiol Immunol, 1992.158: p.97-129). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nat Rev Genet, 2011.12(5): p.341-55; Deyle and Russell, Curr Opin Mol Ther, 2009.11(4): p.442-7; Asokan et al., Mol Ther, 2012.20(4): p.699-708). AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in WO 2015 / 054653; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of WO 2015 / 054653, and a sequence encoding SLC6A1 as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. Alternatively, AAV.CPP.21 or AAV.CPP.16 can be used, as described in Yao et al., Nat Biomed Eng.2022 Nov;6(11):1257-1271. In some embodiments, the AAV incorporates inverted terminal repeats (ITRs), e.g., derived from the AAV2 or AAV9 serotype. It should be noted, however, that numerous modified versions of the AAV2 or AAV9 ITRs are used in the field. Modifications of these sequences are known in Attorney Docket No.37314-0124WO1 / CMCC 4357 the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure; see, e.g., Pan et al., Gene Ther.2021 Oct 6;29(6):333–345. In some embodiments, the expression vector comprises a nucleic acid sequence from 5’ -3’: ITR – hNaP - hSLC6A1 - WPRE - pA – ITR, optionally wherein the nucleic acid sequence is at least 90%, 95%, 97%, or 99%, or is 100% identical to SEQ ID NO:3 as shown in FIGs.3A-C; in some embodiments, differences can be present in the sequences between the elements recited above, e.g., different restriction enzyme sites, or omission of the WPRE, e.g., a vector that comprises a nucleic acid sequence from 5’ -3’: ITR – hNaP - hSLC6A1 - pA – ITR. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses are known in the art, e.g., can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. The use of AAV vectors to deliver constructs for expression in the brain has been described, e.g., in Iwata et al., Sci Rep.2013;3:1472; Hester et al., Curr Gene Ther.2009;9(5):428-33; Doll et al., Gene Therapy 1996; 3(5):437-447; Foley et al., J Control Release.2014;196:71-8; Liu et al., Metab Brain Dis.2021 Jan;36(1):45-52; Ling et al., Nat Rev Drug Discov.2023 Oct;22(10):789- 806; and Huang et al., Science.2024 May 16; 384(6701):1220-1227 (preprinted at Huang et al., bioRxiv.2023 Dec 22:2023.12.20.572615). Thus, in some embodiments, the SLC6A1 encoding nucleic acid is present in a vector for gene therapy, such as an AAV vector. In some instances, the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAV11, and AAV12. AAV1, 2, 5, 6, 8, 9, rh8, and rh10 have been shown to have strong affinity for the nervous system. In some embodiments, AAV2, AAV9, or AAVrh10 are used. A vector as described herein can be a pseudotyped or engineered vector. Pseudotyping provides a mechanism for modulating a vector’s target cell population. For instance, pseudotyped AAV vectors can be utilized in various methods described herein. Pseudotyped vectors are those that contain the genome of one vector, e.g., the genome of one AAV serotype, in the capsid of a second vector, e.g., a second AAV serotype. Methods of pseudotyping are well known in the art. For instance, a vector Attorney Docket No.37314-0124WO1 / CMCC 4357 may be pseudotyped with envelope glycoproteins derived from Rhabdovirus vesicular stomatitis virus (VSV) serotypes (Indiana and Chandipura strains), rabies virus (e.g., various Evelyn–Rokitnicki–Abelseth ERA strains and challenge virus standard (CVS)), Lyssavirus Mokola virus, a rabies-related virus, vesicular stomatitis virus (VSV), Mokola virus (MV), lymphocytic choriomeningitis virus (LCMV), rabies virus glycoprotein (RV-G), glycoprotein B type (FuG-B), a variant of FuG-B (FuG- B2) or Moloney murine leukemia virus (MuLV). A virus may be pseudotyped for transduction of one or more neurons or groups of cells. In addition, the capsid can be engineered, e.g., altered to include one or more peptides that increase expression in the CNS, see, e.g., Yao et al., Nat Biomed Eng.2022 Oct 10; Chatterjee et al., Gene Ther.2022 Jun;29(6):390-397; Meng et al., Mol Ther Methods Clin Dev.2021 Feb 27;21:28-41; Zhang et al., Biomaterials.2022 Feb;281:121340; Gray, Cell Gene Ther. Insights 5, 1361–1368 (2019); Nonnenmacher et al., Mol. Ther. Methods Clin. Dev. 20, 366–378 (2021). Engineered vectors with capsids that have been altered to change their tropism can also be used. In some embodiments, the vector is enclosed in a AAV-BI-hTFR1 capsid (Huang et al., Science.2024 May 16; 384(6701):1220-1227, preprinted at Huang et al., bioRxiv.2023 Dec 22:2023.12.20.572615), or other capsids with affinity for the human transferrin receptor (TFRC), AAV-derived capsids or nanoparticles with affinity for components of the human blood-brain barrier, or otherwise have the capacity for crossing the human blood brain barrier, e.g., AAV.CPP.16 (Yao et al., Nat Biomed Eng.2022 Nov;6(11):1257-1271) or variants of AAV9 (Wang et al. Mol. Ther.-Methods Clin. Dev.9, 234–246 (2018)); using PB5-3 (Zhang et al., Biomaterials.2022 Feb:281:121340). See also Liu et al., Metab Brain Dis.2021 Jan;36(1):45-52. Without limitation, illustrative examples of pseudotyped or engineered vectors include recombinant AAV2 / 1, AAV2 / 2, AAV2 / 5, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV9, AAVrh10, AAV11, AAV12, and AAV-BI-hTFR1 serotype or engineered vectors. It is known in the art that such vectors may be engineered to include a transgene encoding a human protein or other protein. For example, the present vectors can include a pseudotyped AAV9 or AAVrh10 viral vector including a nucleic acid as disclosed herein. See Viral Vectors for Gene Therapy: Methods and Protocols, ed. Machida, Humana Press, 2003. Attorney Docket No.37314-0124WO1 / CMCC 4357 In some instances, a particular AAV serotype vector may be selected based upon the intended use, e.g., based upon the intended route of administration. Various methods for application of AAV vector constructs in gene therapy are known in the art, including methods of modification, purification, and preparation for administration to human subjects (see, e.g., Viral Vectors for Gene Therapy: Methods and Protocols, ed. Machida, Humana Press, 2003). In addition, AAV based gene therapy targeted to cells of the CNS has been described (see, e.g., U.S. patents 6,180,613 and 6,503,888). High titer AAV preparations can be produced using techniques known in the art, e.g., as described in U.S. Pat. No.5,658,776 A vector construct refers to a polynucleotide molecule including all or a portion of a viral genome and a transgene. In some instances, gene transfer can be mediated by a DNA viral vector, such as an adenovirus (Ad) or adeno-associated virus (AAV). Other vectors useful in methods of gene therapy are known in the art. For example, a construct as disclosed herein can include an alphavirus, herpesvirus, retrovirus, lentivirus, or vaccinia virus. Adenoviruses are a relatively well characterized group of viruses, including over 50 serotypes (see, e.g., WO 95 / 27071, which is herein incorporated by reference). Adenoviruses are tractable through the application of techniques of molecular biology and may not require integration into the host cell genome. Recombinant Ad-derived vectors, including vectors that reduce the potential for recombination and generation of wild-type virus, have been constructed (see, e.g., international patent publications WO 95 / 00655 and WO 95 / 11984, which are herein incorporated by reference). Wild-type AAV has high infectivity and is capable of integrating into a host genome with a high degree of specificity (see, e.g., Hermonat and Muzyczka 1984 Proc. Natl. Acad. Sci., USA 81:6466-6470 and Lebkowski et al. 1988 Mol. Cell. Biol.8:3988-3996). The viral vectors, e.g., AAV, e.g., packaged in AAV capsids, can be included in compositions (such as pharmaceutical compositions) and / or administered to subjects. An exemplary pharmaceutical composition comprising a viral vector, e.g., an AAV, as described herein can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants; exemplary formulations are described in Grossen et al., Eur J Pharm Biopharm.2023 Sep: Attorney Docket No.37314-0124WO1 / CMCC 4357 190:1-23. Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described herein. For example, the vectors can be introduced directly into the brain, e.g., by catheter (see U.S. Patent 5,328,470) or by stereotactic injection, e.g., optionally into the cisterna magna, cerebral ventricles, lumbar intrathecal space, direct injection into hippocampus (e.g., Chen et al., PNAS USA 91: 3054-3057 (1994)) and / or the entorhinal cortex. In some embodiments, delivery methods of SLC6A1-expressing vectors include intrathecal, intracerebroventricular, intracisternal, and stereotactic intraparenchymal administration. The methods can also be administered systemically, e.g., intravenously. The pharmaceutical preparation of the gene therapy constructs can consist essentially of the vectors (e.g., expression constructs packaged in a capsid) in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can comprise one or more cells that produce the vector. Methods of Use Described herein are methods using SLC6A1 nucleic acids, e.g., expression constructs as described herein. The methods can be used to treat SLC6A1-related disorders, e.g., SLC6A1-Related Neurodevelopmental Disorder (Goodspeed et al., Front Neurosci.2022; 16: 1026065). Subjects who have SLC6A1-related disorders and can be treated using the present methods can be identified by a skilled health care provider, e.g., using molecular genetic testing. The subjects typically present with mild-to-severe developmental delay (DD) and / or intellectual disability (ID); generalized hypotonia of infancy; epilepsy, including absence or atypical absence seizures, epilepsy with myoclonic-atonic seizures, and / or generalized tonic-clonic seizures; movement disorders such as tremor, stereotypies, and ataxia; autism spectrum disorder, attention-deficit / hyperactivity disorder, aggression, anxiety, and / or sleep disturbances. See Goodspeed et al. SLC6A1-Related Neurodevelopmental Disorder.2023 Feb 9. In: Adam et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2024. Available from: ncbi.nlm.nih.gov / books / NBK589173 / . Attorney Docket No.37314-0124WO1 / CMCC 4357 Generally, the methods include administering a composition comprising a therapeutically effective amount of a nucleic acid encoding GAT1, e.g., human SLC6A1 linked to a human native SLC6A1 promoter, e.g., as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. In some embodiments, the methods include administering the composition directly to the brain of the subject. For example, the gene therapy construct can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection, e.g., optionally into the cisterna magna, cerebral ventricles, or lumbar intrathecal space (e.g., Chen et al., PNAS USA 91: 3054-3057 (1994)). In some embodiments, delivery methods of SLC6A1 expression constructs as described herein include intravenous, intrathecal, intracerebroventricular, intracisternal, intranerve, intramuscular, subcutaneous, intradermal, epidural, transforaminal, selective nerve root, and stereotactic intraparenchymal administration in the dorsal root or trigeminal ganglia or spinal cord. Preferably intrathecal, intracerebroventricular, or intracisternal administration is used. As used in this context, to “treat” means to ameliorate at least one symptom of the SLC6A1-related disorder. These conditions result in developmental delay7,8, autism9, and epilepsy10; thus, a treatment comprising or consisting of administration of a therapeutically effective amount of a composition described herein can result in a reduction in rate, frequency, severity, or extent of developmental delay, symptoms of autism, and seizures, and a return or approach to normal development or a normal rate of development. In some embodiments, the subject has an early stage of the disease, and the present methods slow or reduce risk of progression. EXEMPLARY SEQUENCES AND CONSTRUCTS In some embodiments, the sequence of a protein or nucleic acid (including an ITR, WPRE, or polyA sequence) used in a composition or method described herein is at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to an exemplary or reference sequence set forth herein. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non- homologous sequences can be disregarded for comparison purposes). In a preferred Attorney Docket No.37314-0124WO1 / CMCC 4357 embodiment, the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For the avoidance of confusion, unless otherwise specified, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. Exemplary Human hNaP sequence (1521bp) CTGGGCTGGAGAGAAGGAATCTTTTCTCTGAGTTCCTGGGGACCCCAGAGGG AAGGGCAGATGTGGCCCCATTCCCAGAAGCCTTTATAAAAGAGGGTGGGGAGGTCAG GCCTTGGCAAGGACAAGGGAAGGAGTCCCTACGTGCTGGATTGGGATTGGCTGGAAA GGGGACTTCTCTGGGAGAATCCCTCAAACCTCAAGAACTGAGAGAAGGGTGTCTGGG GCTCCTGCCACCATCCCTGTTTCCCTTTTAAGTAATCTGTTTCCCCATCTGTCCATC CATACACACAGCCACTTGTGTCTCCATGACCAACCGCTGGCAGTGGAAGGGTGTCCT TCCCACCCCCACTCTTACACACACTCCCAGCTGGTACCCAGAGCCTGGTCACCCCAG GCCAGGCCTGTGTTTCCAGGTGTAACGGGCAGCAGACGCTGCCCTAGGACTAGAGCA GGGAGGGGGCACGGGCCCACCCCAACCCACAGCGACCCACAGAGGGCGAAAAGAGGA CGACCGCAGAGAGAAACGGAAAGGACAGGCCAACGGAAGCAGTACTGCAAGGCTGGA AGGAGAAAAGCCAGGAGGGGAGTGCTTGCTGTGAAAGACAGGGAGACAGAGACCAAG ACGGACAGGCAGACAGGCTGGTGACCCAGGATGAGGCCGGAAAGAGCCATCAAAGGA AGGAGAAGGAAGGAGAGAGATTGGAGCGGGACGGCGGGGCAGGCGAGGGAAGGAGGG GGTGGGGAGAGGGAGGGAGGAAGAGAGGGGAGAAAGAGGGAGGAAGAGAGGGGAGAA GGAGGGAGAAGAGAGCGGGAGAATGCGAGAGGAAAGAAGGGAGAGGGGAGGCGTAGA AGGGGAGAGGAGGTGAAGGGAAAAGGAGAGAGCCTGCTGGCGGCGAAGCTGCAAGAG GCAGCTGCGGAGGGAGCGCGCGGCGGGCCTGGGGGAGCGCTGGGCGGGGGCGGGCGG TGCGGGCAGGGCTATACCCGAGCTGGGCGGGCTCCGGGCGCCGCGGGCCCTGCCCTC CCCCTCCATCCCTCCGGACTCGCTCCCCCCTCCTCTCCCTTCCCCGCGACCCTCCGC CCGCCCTCGGAAGACCGAGACAGCGGAGAGGTTGCGGGTGAGCTGCGCTGAGCCCAG Attorney Docket No.37314-0124WO1 / CMCC 4357 GAGCCGAGGAGTCGGGAGCGCAGTAGCGCTGAGCCCGAGCCCGAGCGGCCCCGCGTC CCGAGCGCATCGGAGCGGCCGAGCCGCCCGGATGCAGCGCCTGTCCCGGGCAGCGCA GCCCCGGCCGCAGGTAGGAAAGGGCGGCCGGCGTCGGGGCGCGGGGCGCAGAGCCTG GGATAACGGCGCAGGAACGGCCAGAGCCCCGAGCCGCTGCCGCGAGCCGGGCCGGGT GGGGGGCGGACACCTCGAGATTCAAGCCCCCGCGCCGCACCTTCCCTGAGCCACATG AAGGAGCAGAGGCGCCGCTCGGACCCCGACGTGCGCCCAGGCCATCCGTCCCCTGGG ACACTCGGGAGGCAGGAGGGCTGGAACAGAGGCGAGAGTTGCAT (SEQ ID NO:1) Exemplary Human SLC6A1 Coding sequence (1800bp) ATGGCGACCAACGGCAGCAAGGTGGCCGACGGGCAGATCTCCACCGAGGTCA GCGAGGCCCCTGTGGCCAATGACAAGCCCAAAACCTTGGTGGTCAAGGTGCAGAAGA AGGCGGCAGACCTCCCCGACCGGGACACGTGGAAGGGCCGCTTCGACTTCCTCATGT CCTGTGTGGGCTATGCCATCGGCCTGGGCAACGTCTGGAGGTTCCCCTATCTCTGCG GGAAAAATGGTGGGGGAGCCTTCCTGATCCCCTATTTCCTGACACTCATCTTTGCGG GGGTCCCACTCTTCCTGCTGGAGTGCTCCCTGGGCCAGTACACCTCCATCGGGGGGC TAGGGGTATGGAAGCTGGCTCCTATGTTCAAGGGCGTGGGCCTTGCGGCTGCTGTGC TATCATTCTGGCTGAACATCTACTACATCGTCATCATCTCCTGGGCCATTTACTACC TGTACAACTCCTTCACCACGACACTGCCGTGGAAACAGTGCGACAACCCCTGGAACA CAGACCGCTGCTTCTCCAACTACAGCATGGTCAACACTACCAACATGACCAGCGCTG TGGTGGAGTTCTGGGAGCGCAACATGCATCAGATGACGGACGGGCTGGATAAGCCAG GTCAGATCCGCTGGCCACTGGCCATCACGCTGGCCATCGCCTGGATCCTTGTGTATT TCTGTATCTGGAAGGGTGTTGGCTGGACTGGAAAGGTGGTCTACTTTTCAGCCACAT ACCCCTACATCATGCTGATCATCCTGTTCTTCCGTGGAGTGACGCTGCCCGGGGCCA AGGAGGGCATCCTCTTCTACATCACACCCAACTTCCGCAAGCTGTCTGACTCCGAGG TGTGGCTGGATGCGGCAACCCAGATCTTCTTCTCATACGGGCTGGGCCTGGGGTCCC TGATCGCTCTCGGGAGCTACAACTCTTTCCACAACAATGTCTACAGGGACTCCATCA TCGTCTGCTGCATCAATTCGTGCACCAGCATGTTCGCAGGATTCGTCATCTTCTCCA TCGTGGGCTTCATGGCCCATGTCACGAAGAGGTCCATTGCTGATGTGGCGGCCTCAG GCCCCGGGCTGGCGTTCCTGGCATACCCAGAGGCGGTGACCCAGCTGCCTATCTCCC CACTCTGGGCCATCCTCTTCTTCTCCATGCTGTTGATGCTGGGCATTGACAGCCAGT TCTGCACTGTGGAGGGCTTCATCACAGCCCTGGTGGATGAGTACCCCAGGCTCCTCC GCAACCGCAGAGAGCTCTTCATTGCTGCTGTCTGCATCATCTCCTACCTGATCGGTC TCTCTAACATCACTCAGGGGGGTATTTATGTCTTCAAACTCTTTGACTACTACTCTG CCAGTGGCATGAGCCTGCTGTTCCTCGTGTTCTTTGAATGTGTCTCTATTTCCTGGT TTTACGGTGTCAACCGATTCTATGACAATATCCAAGAGATGGTTGGATCCAGGCCCT GCATCTGGTGGAAACTCTGCTGGTCTTTCTTCACACCAATCATTGTGGCGGGCGTGT TCATTTTCAGTGCTGTGCAGATGACGCAACTCACCATGGGAAACTATGTTTTCCCCA AGTGGGGCCAGGGTGTGGGCTGGCTGATGGCTCTGTCTTCCATGGTCCTCATCCCCG GGTACATGGCCTACATGTTCCTCACCTTAAAGGGCTCCCTGAAGCAGCGCATCCAAG TCATGGTCCAGCCCAGCGAAGACATCGTTCGCCCAGAGAATGGTCCTGAGCAGCCCC AGGCGGGCAGCTCCACCAGCAAGGAGGCCTACATCTAG (SEQ ID NO:2) EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Attorney Docket No.37314-0124WO1 / CMCC 4357 Example 1. Human SLC6A1 native promoter (hNaP) Promoter regulatory element analysis of proposed human SLC6A1 native promoter (hNaP) previously characterized as genomic sequence found directly upstream of the SLC6A1 transcriptional start site in chromosome 3 (GenBank contig NT_022517)17. Analysis of this genomic DNA sequence using available database (Nsite, Softberry)18revealed the presence of multiple transcriptional regulatory sites including a cluster of transcriptional regulatory sites 0.2 kb proximal to the transcriptional start site (FIG.1), as well as the 21-bp enhancer motif that has been previously characterized to potentiate GAT1 activity19. We further identified another cluster of transcriptional regulatory sites at 1.0 kb region. We defined this ~1.6kb region as the proposed human SLC6A1 native promoter, referred to herein as hNaP. The size of hNaP is compatible within the capacity of an AAV vector20consisting of a recombinant SLC6A1 gene and other essential AAV elements21. Example 2. Construction of AAV with Human SLC6A1 driven by hNaP An AAV vector was developed by molecular cloning of double strand DNA (ssDNA) fragment encompassing the hNaP sequence flanked by MluI and XbaI sites, as well as another ssDNA fragment encompassing the human SLC6A1 coding sequence flanked by XbaI and EcoRI sites. Sequence integrity of the AAV vector was checked using Sanger Sequencing throughout the whole construct between the two inverted terminal repeats (ITR). See, e.g., FIGs.2A-C and 3A-C. References 1 Goodspeed, K. et al. Current knowledge of SLC6A1-related neurodevelopmental disorders. Brain Commun 2, fcaa170, doi:10.1093 / braincomms / fcaa170 (2020). 2 Goodspeed, K. et al. "SLC6A1-Related Neurodevelopmental Disorder." 2023 Feb 9. In: Adam MP, Feldman J, Mirzaa GM, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993- 2025. Available from: ncbi.nlm.nih.gov / books / NBK589173 / . 3 Motiwala, Z. et al. Structural basis of GABA reuptake inhibition. Nature 606, 820-826, doi:10.1038 / s41586-022-04814-x (2022). 4 Zafar, S. & Jabeen, I. Structure, Function, and Modulation of gamma- Aminobutyric Acid Transporter 1 (GAT1) in Neurological Disorders: A Attorney Docket No.37314-0124WO1 / CMCC 4357 Pharmacoinformatic Prospective. Front Chem 6, 397, doi:10.3389 / fchem.2018.00397 (2018). 5 Mattison, K. A. et al. SLC6A1 variants identified in epilepsy patients reduce gamma-aminobutyric acid transport. Epilepsia 59, e135-e141, doi:10.1111 / epi.14531 (2018). 6 Fischer, F. P., Kasture, A. S., Hummel, T. & Sucic, S. Molecular and Clinical Repercussions of GABA Transporter 1 Variants Gone Amiss: Links to Epilepsy and Developmental Spectrum Disorders. Front Mol Biosci 9, 834498, doi:10.3389 / fmolb.2022.834498 (2022). 7 Devries, S., Mulder, M., Charron, J. G., Prokop, J. W. & Mark, P. R. SLC6A1 G443D associated with developmental delay and epilepsy. Cold Spring Harb Mol Case Stud 6, doi:10.1101 / mcs.a005371 (2020). 8 Kalvakuntla, S. et al. Patterns of developmental regression and associated clinical characteristics in SLC6A1-related disorder. Front Neurosci 17, 1024388, doi:10.3389 / fnins.2023.1024388 (2023). 9 Bain, J. M. et al. Consistency of parent-report SLC6A1 data in Simons Searchlight with Provider-Based Publications. J Neurodev Disord 14, 40, doi:10.1186 / s11689-022-09449-7 (2022). 10 Carvill, G. L. et al. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures. Am J Hum Genet 96, 808-815, doi:10.1016 / j.ajhg.2015.02.016 (2015). 11 Goodspeed, K. et al. Gene Therapy: Novel Approaches to Targeting Monogenic Epilepsies. Front Neurol 13, 805007, doi:10.3389 / fneur.2022.805007 (2022). 12 Nwosu, G. et al.4-Phenylbutyrate restored gamma-aminobutyric acid uptake and reduced seizures in SLC6A1 patient variant-bearing cell and mouse models. Brain Commun 4, fcac144, doi:10.1093 / braincomms / fcac144 (2022). 13 Ahring, P. K. et al. Gain-of-function variants in GABRD reveal a novel pathway for neurodevelopmental disorders and epilepsy. Brain 145, 1299-1309, doi:10.1093 / brain / awab391 (2022). 14 Conti, F., Melone, M., Fattorini, G., Bragina, L. & Ciappelloni, S. A Role for GAT-1 in Presynaptic GABA Homeostasis? Front Cell Neurosci 5, 2, doi:10.3389 / fncel.2011.00002 (2011). Attorney Docket No.37314-0124WO1 / CMCC 4357 15 Jensen, K., Chiu, C. S., Sokolova, I., Lester, H. A. & Mody, I. GABA transporter-1 (GAT1)-deficient mice: differential tonic activation of GABAA versus GABAB receptors in the hippocampus. J Neurophysiol 90, 2690-2701, doi:10.1152 / jn.00240.2003 (2003). 16 Davidson, B. L. et al. Gene-based therapeutics for rare genetic neurodevelopmental psychiatric disorders. Mol Ther 30, 2416-2428, doi:10.1016 / j.ymthe.2022.05.014 (2022). 17 Hirunsatit, R. et al. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1) in five populations: implications for pharmacogenetic research. BMC Genet 8, 71, doi:10.1186 / 1471-2156-8-71 (2007). 18 Ghosh, D. Object-oriented transcription factors database (ooTFD). Nucleic Acids Res 28, 308-310, doi:10.1093 / nar / 28.1.308 (2000). 19 Hirunsatit, R. et al. Twenty-one-base-pair insertion polymorphism creates an enhancer element and potentiates SLC6A1 GABA transporter promoter activity. Pharmacogenet Genomics 19, 53-65, doi:10.1097 / FPC.0b013e328318b21a (2009). 20 Gray, S. J. et al. Optimizing promoters for recombinant adeno- associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors. Hum Gene Ther 22, 1143-1153, doi:10.1089 / hum.2010.245 (2011). 21 Domenger, C. & Grimm, D. Next-generation AAV vectors-do not judge a virus (only) by its cover. Hum Mol Genet 28, R3-R14, doi:10.1093 / hmg / ddz148 (2019). 22 Huang et al., An AAV capsid reprogrammed to bind human transferrin receptor mediates brain-wide gene delivery. Science.2024 May 16; 384(6701):1220- 1227, preprinted at Huang et al., An AAV capsid reprogrammed to bind human Transferrin Receptor mediates brain-wide gene delivery. bioRxiv.2023 Dec 22:2023.12.20.572615. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of Attorney Docket No.37314-0124WO1 / CMCC 4357 the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.37314-0124WO1 / CMCC 4357 WHAT IS CLAIMED IS:

1. A nucleic acid comprising a promoter sequence that is at least 90%, 95%, or 99% identical to, or comprises, the full length human SLC6A1 native promoter sequence of SEQ ID NO:1 (hNAP).

2. An expression vector comprising the promoter sequence of claim 1, linked to a transgene.

3. The expression vector of claim 2, comprising a viral vector or a recombinant bacterial or eukaryotic plasmid.

4. The expression vector of claim 3, which is a retrovirus, adenovirus, adeno- associated virus (AAV), or lentivirus.

5. The expression vector of claim 4, which is an AAV selected from the group consisting of AAV2 and AAV9.

6. The expression vector of claims 2-5, wherein the transgene is human SLC6A1.

7. The expression vector of claim 6, wherein the human SLC6A1 transgene is at least 95% identical to SEQ ID NO:

2.

8. The expression vector of claim 7, further comprising one, two, or more of a pair of inverted terminal repeats (ITRs), a woodchuck hepatitis virus posttranscriptional response element (WPRE), and / or polyadenylation sequence, optionally comprising a nucleic acid sequence from 5’ -3’: ITR – hNaP - hSLC6A1 - WPRE - pA – ITR, or ITR – hNaP - hSLC6A1 - pA – ITR.

9. The expression vector of claim 8, wherein the nucleic acid sequence is at least 90%, 95%, 97%, or 99%, or is 100% identical to SEQ ID NO:

3.

10. The expression vector of any of claims 1 to 9, wherein the expression vector is packaged in a capsid.Attorney Docket No.37314-0124WO1 / CMCC 4357 11. The expression vector of claim 10, wherein the expression vector is packaged in an AAV2, AAV9, or AAV-BI-hTFR1 capsid.

12. A pharmaceutical composition comprising the expression vector of any of claims 1-11 in a pharmaceutically acceptable carrier.

13. A method of treating a subject who has a SLC6A1-related disorder, comprising administering to the subject a therapeutically effective amount of an expression vector comprising a transgene comprising human SLC6A1, optionally linked to a promoter sequence that is at least 90%, 95%, or 99% identical to, or comprises, the full length human SLC6A1 native promoter sequence of SEQ ID NO:1 (hNAP).

14. The method of claim 13, wherein the expression vector comprises a viral vector.

15. The method of claim 14, wherein the viral vector is a retrovirus, adenovirus, adeno-associated virus (AAV), or lentivirus.

16. The method of claim 15, wherein the AAV is an AAV selected from the group consisting of AAV2 and AAV9.

17. The method of any of claims 13 to 16, wherein the human SLC6A1 transgene is at least 95% identical to SEQ ID NO:

2.

18. The method of claim 17, wherein the expression vector comprises a nucleic acid sequence from 5’ -3’: ITR – hNaP - hSLC6A1 - WPRE - pA – ITR, or 5’ -3’: ITR – hNaP - hSLC6A1 - pA – ITR.

19. The method of claim 18, wherein the nucleic acid sequence is at least 90%, 95%, 97%, or 99%, or is 100% identical to SEQ ID NO:3, optionally omitting the sequence encoding WPRE.

20. The method of any of claims 13 to 19, wherein the expression vector is an AAV packaged in a capsid.

21. The method of claim 20, wherein the expression vector is packaged in an AAV2, AAV9, or AAV-BI-hTFR1 capsid.Attorney Docket No.37314-0124WO1 / CMCC 4357 22. The method of claim 13, wherein the expression vector or composition is administered to the brain of the subject.

23. The expression vector of claims 2-11, for use in a method of treating a subject who has a SLC6A1-related disorder.

Images