System and method for detecting the interaction between reactive probes and proteins
The ELISA and qPCR system allows for precise detection of protein-small molecule interactions in live cells, overcoming the need for protein purification or modification, facilitating high-throughput ligand screening and drug discovery.
Patent Information
- Application Number
- PCT/CN2025/086976
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-02
- Filing Date
- 2025-04-02
- Publication Date
- 2025-10-09
AI Technical Summary
Existing methods for detecting ligand-protein interactions in drug development and biological research require protein purification or modification, are cumbersome, and are not suitable for high-throughput screening.
A method using an ELISA and qPCR quantitative detection system for detecting protein-small molecule interactions in live cells without prior protein modification or purification, suitable for diverse complex environments and enabling high-throughput ligand screening.
Enables precise detection of protein targets across various abundance levels and supports high-throughput ligand screening, providing an efficient tool for drug discovery and diagnostic technologies.
Smart Images

Figure PCTCN2025086976-FTAPPB-I100001 
Figure PCTCN2025086976-FTAPPB-I100002 
Figure PCTCN2025086976-FTAPPB-I100003
Abstract
Description
SYSTEM AND METHOD FOR DETECTING THE INTERACTION BETWEEN REACTIVE PROBES AND PROTEINS
[0001] CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims the benefit of PCT Application PCT / CN2024 / 085651, filed April 2, 2024. The entire content of each of the foregoing applications is incorporated herein by reference.FIELD
[0003] The present invention relates to the field of drug discovery, biological research and chemical pharmaceutical technology, specifically to ligand discovery for protein targets in situ and in vivo system.BACKGROUND
[0004] In drug development and biological research, the rapid and precise detection of interactions between small molecules and target proteins is essential for both drug screening and mechanistic studies. Photoaffinity labeling (PAL) and activity-based protein profiling (ABPP) are powerful chemical proteomics approaches that facilitate the detection of ligand–protein interactions in complex cellular environments. Non-labeling techniques-such as the cellular thermal shift assay (CETSA) , thermal proteome profiling (TPP) , and drug affinity responsive target stability (DARTS) -can also be used for this purpose. However, these methods typically require mass spectrometry and involve cumbersome experimental workflows, which limits their feasibility for high-throughput screening (HTS) .
[0005] Surface plasmon resonance (SPR) can measure binding affinity and kinetic parameters with high precision but necessitates protein purification and immobilization. These requirements make SPR unsuitable for proteins that are difficult to purify or for large-scale screening applications. More recently, advanced technologies such as NanoBRET, the luciferase thermal shift assay (LTSA) , and Reactive Affinity Probe-Interaction Discovery (RAPID) have been developed to enable ligand-binding assessment in live cells. However, these methods often require genetic modifications to introduce a protein fragment into the target protein, leading to lengthy initial construction processes and potentially disturbing the native protein state. Table 1 provides a detailed comparison of the relevant technical parameters.
[0006] To address these challenges, the industry urgently needs a technical approach that eliminates the requirements for target protein modification or purification, allowing for the direct and quantitative identification of ligand–protein interactions in cellular or physiologically relevant environments. Such a technology must be compatible with a wide range of proteins, offer high-throughput potential, and minimize limitations arising from protein conformational changes or reliance on specialized equipment inherent in conventional methods. SUMMARY
[0007] The inventors have developed a method based on an ELISA and qPCR quantitative detection system, IN-VIVO TARGET RESPONSE ANALYSIS PLATFORM to surprisingly overcome the above technical bottlenecks, and achieve high-sensitivity detection of specific protein-small molecule interactions in live cells using active probes, without requiring prior protein modification or purification. The method of the present disclosure is applicable to diverse complex physiological environments, achieves precise detection of protein targets across high, medium, and low abundance levels, and holds potential for high-throughput ligand screening. It not only provides an efficient and reliable new tool for drug lead compound discovery and fundamental biological research but also has broad applications in the development of in vitro diagnostic (IVD) reagents. The method and system of the present disclosure effectively address the shortcomings of existing technologies, offering a novel, efficient, and precise tool for drug screening, biological research, and diagnostic technologies, with significant application prospects and technical advantages.
[0008] Disclosed herein are a system and method for detecting the interaction between active probes and proteins, suitable for screening candidate ligands of target proteins (biomolecules) in the context of living cells. It overcomes the disadvantages of traditional ligand screening methods that require modification or purification of target proteins, representing an in situ quantitative screening technology. The inventors have developed two readout methods for this system, as shown in FIGs. 1 and 2. The first method (FIG. 1) uses the ELISA detection technology, suitable for medium and high abundance target protein systems, while the second method (FIG. 2) uses the qPCR detection technology, suitable for high, medium, and low abundance target protein systems.
[0009] In some embodiments of the method of the present disclosure, the biomacromolecule is from receptor tyrosine kinase family, which is preferably selected from but not limited to EGFR, HER2, HER3, and HER4. The method enables parallel detection of protein mutants and wild-type proteins (e.g., T790M / L858R-EGFR and wild-type EGFR) , allowing comparison of the interference levels of candidate ligands in both systems to screen for mutant-specific ligands, including inhibitors and activators. Additionally, the method of the present disclosure can be applied to the screening of protein degraders (e.g., PROTAC molecules) . By first introducing degraders into the cellular system to induce degradation of the target protein, followed by probe detection, a significant increase in probe-bound protein signals would indicate that the candidate ligand successfully reduced the target protein level.
[0010] The methods of the present disclosure can also be used to detect antigens by a combination of a specific probe and antibody in in vitro diagnostics (IVD) . The methods of the present disclosure can further be used to screen specific probes as reagents for use in IVD. The ligand or probe screened by the methods of the present disclosure has good affinity for a biomolecule, such as a target protein or antigen protein, and thus the ligand and probe can be used as a binding reagent in in vitro diagnostic methods based on readouts such as ELISA, chemiluminescent immunoassays, qPCR, LAMP, RPA, NGS, ddElisa, and ddPCR.
[0011] In one aspect, the present disclosure provides a method of screening a ligand for a target biomolecule, which comprises the following steps:
[0012] a1) adding a probe alone to a system comprising the target biomolecule, the probe binding to the target biomolecule thereby forming a target biomolecule-probe conjugate,
[0013] a2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe,
[0014] a3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule and / or the target biomolecule-probe conjugate to the solid support,
[0015] a4) performing quantitative assay on the solid support to obtain a reference value T0;
[0016] b1) adding a probe and a candidate ligand (s) to a system comprising the target biomolecule, the probe and the candidate ligand competing for binding to the target biomolecule thereby forming a target biomolecule-probe conjugate and / or a target biomolecule-candidate ligand conjugate and / or a target biomolecule-probe-candidate ligand conjugate,
[0017] b2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe and / or a detectable target biomolecule-probe-candidate ligand conjugate,
[0018] b3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule, the target biomolecule-probe conjugate and / or the target biomolecule-candidate ligand conjugate and / or the target biomolecule-probe-candidate ligand conjugate to the solid support,
[0019] b4) performing quantitative assay on the solid support to obtain a measured value T1;
[0020] if T1 < T0, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, and
[0021] if T1 > T0, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule.
[0022] In some embodiments, if T1 ≤ T0 × (100-E) %, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, or
[0023] if T1 ≥ T0 × (100+E’ ) %, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule,
[0024] where E ≥ 5, for example, E ≥ 10, E ≥ 15, E ≥ 20, or E ≥ 25,
[0025] E’≥ 5, for example, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, or E’ ≥ 25,
[0026] E and E’ may be the same or different.
[0027] In some embodiments, the biomolecule comprises a nucleic acid, a carbohydrate, a lipid, a protein, or any combination thereof, preferably, the biomolecule comprises a protein or a variant thereof.
[0028] In some embodiments, the biomolecule comprises a protein of a wild-type form, a mutated form with at least one amino acid mutation compared to the corresponding wild-type protein, or a post-translational modified form, optionally, the protein is a protein without an epitope tag.
[0029] In some embodiments, the biomolecule comprises a protein selected from G protein-coupled receptors (GPCRs) , receptor tyrosine kinases (RTKs) , nuclear receptors, or a variant thereof, preferably selected from receptor tyrosine kinase (RTK) family comprising EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, a variant thereof, where the variant is a mutate with at least one amino acid mutation compared to the corresponding wild-type RTK.
[0030] In some embodiments, the probe comprises a binding moiety, a reporter moiety, and optionally a reactive moiety.
[0031] In some embodiments, the binding moiety is selected from a small molecule fragment, and a peptide.
[0032] In some embodiments, the report moiety is selected from azadibenzocyclooctyne, benzocyclobutene, thiol, alkene, alkyne, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, or active ester including hydroxybenzotriazole ester.
[0033] In some embodiments, the reactive moiety is selected from the group consisting of a photo-crosslinking group, sulfonyl fluoride, fluorosulfate, a Michael acceptor group, a leaving group, nickel NTA (nitrilotriacetic acid) .
[0034] In some embodiments, the probe comprises a binding moiety, a reporter moiety, and optionally a reactive moiety,
[0035] the binding moiety is a small molecule fragment derived from an inhibitor of the ErbB / HER protein family selected from the group consisting of Gefitinib, Afatinib, Mavelertinib, Erlotinib, Lapatinib, Afatinib, Dacomitinib, Neratinib, and Osimertinib, preferably Gefitinib, Afatinib, and Mavelertinib;
[0036] the reporter portion is selected from the group of azadibenzocyclooctyne, benzocyclobutene, thiol, alkenyl, alkynyl, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, preferably alkynyl; and
[0037] the optional reactive moiety is a photo-crosslinking group selected from the group consisting of diazirine, benzophenone, aryl azides, psoralen derivatives, cyclopropene-diazirine hybrids, anthraquinones, and derivative and analogue thereof, preferably, diazirine.
[0038] In some embodiments, the probe is selected from the group consisting of
[0039] In some embodiments, the detectable molecule is selected from the group consisting of fluorophores and related groups comprising non-fluorescent dye chromophores, fluorophores, fluorescent enzyme substrates, organic dyes, inorganic dyes, metal chelates, and quenchers;
[0040] enzyme-linked systems comprising biotin-streptavidin conjugates;
[0041] chemical tags comprising digoxigenin, sulfonate labels, and nickel nitrilotriacetic acid (Ni-NTA) ;
[0042] nucleic acid-based markers: DNA or RNA probes and nucleic acid aptamers; and
[0043] physical detection entities: surface-enhanced Raman scattering (SERS) -active nanoparticles and radioisotopes.
[0044] In some embodiments, the detectable molecule is selected from the group consisting of biotin, streptavidin conjugates including HRP, sulfonate label, fluorescent group, metal chelate, and a nucleic acid.
[0045] In some embodiments, the solid support comprises a solid and a recognition moiety.
[0046] In some embodiments, the solid is selected from the group consisting of a membrane, glass, plastic, synthetic polymer, eppendorf tube, a well of a multi-well plate, or a surface plasmon resonance chip.
[0047] In some embodiments, the recognition moiety comprises an antibody, a DNA-conjugated probes, or a bioorthogonal handles.
[0048] In some embodiments, the antibody includes a protein antibody, DNA-conjugated protein antibody, or DNA-conjugated nucleic acid aptamer.
[0049] In some embodiments, the antibody is an antibody against a member of the receptor tyrosine kinase (RTK) family comprising EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, or a variant thereof comprising at least one amino acid mutation compared to the corresponding wild-type RTK.
[0050] In some embodiments, the quantitative assay is selected from the group consisting of enzyme-linked immunosorbent assay (ELISA) , quantitative polymerase chain reaction (qPCR) , loop-mediated isothermal amplification (LAMP) , recombinase polymerase amplification (RPA) , next-generation sequencing (NGS) , digital droplet ELISA (ddElisa) , digital droplet PCR (ddPCR) , immunoblotting, fluorescence microvolume analysis technique (FMAT) , chemiluminescence, surface-enhanced Raman spectroscopy (SERS) , and subcellular staining, preferably ELISA, qPCR, and chemiluminescence.
[0051] In some embodiments, the method is performed in situ in cells, in organelles, or on crude cell extracts.
[0052] In some embodiments, the system is a cell line comprising the target biomolecule.
[0053] In some embodiments, the cell is optionally lysed prior step (a2) and (b2) .
[0054] In another aspect, the present disclosure provides a compound selected from the group consisting of
[0055] In some embodiments, the compound of the present disclosure for use as a probe for the method of the present disclosure.DESCRIPTION OF DRAWINGS
[0056] FIG. 1 shows Schematic Diagram of the Drug Screening Method Based on Elisa.
[0057] FIG. 2 shows Schematic Diagram of the Drug Screening Method Based on qPCR.
[0058] FIG. 3 shows Schematic Diagram of EGFR Agonist Screening.
[0059] FIG. 4 shows Probe Design and Screening for EGFR Target Platform Based on Probe-Labeled Target Protein EC50 Curves, Antibody Capture Preference, and Core Drug IC50. (a-b) Probe design; (c) Comparison of EC50 curves of different probes to determine optimal probe and dosage.
[0060] FIG. 5 shows Platform Feasibility Analysis Test. (a) Effect of different probe labeling on antigen-antibody binding; (b) IC50 curves of core drugs from different probes on signal inhibition.
[0061] FIG. 6 shows Effects of Incubation Time and UV Irradiation on Labeling Efficiency of Three Probes. (a) Optimal incubation time for LA1562-P01 probe; (b) Optimal incubation time for LA1560-P01 probe; (c) Optimal incubation time for LA1560-MP01 probe; (d) Characterization of UV-Dependent Target Labeling by LA1562-P01 and Structure-Function Analysis via LA1562-C01.
[0062] FIG. 7 shows Validation of Positive / Negative Molecule Screening for EGFR Ligand Screening Platform Based on wt-EGFR-Overexpressing Cell Line (A431 Cells) and LA1562-P01 Probe. (a) High-throughput screening of known EGFR inhibitors and unreported EGFR-inhibiting compounds in the wt-EGFR-overexpressing cell line; (b) Graphical representation of 67 compounds, including covalent, non-covalent, and unreported EGFR inhibitors.
[0063] FIG. 8 shows Validation of Positive / Negative Molecule Screening for EGFR Ligand Screening Platform Based on wt-EGFR-Low expressing Cell Line (Hela Cells) and LA1562-P01 Probe. (a) High-throughput screening of known EGFR inhibitors and unreported EGFR-inhibiting compounds in the wt-EGFR-Low expressing cell line; (b) Graphical representation of 67 compounds, including covalent, non-covalent, and unreported EGFR inhibitors.
[0064] FIG. 9 shows Validation of Positive / Negative Molecule Screening for EGFR Ligand Screening Platform Based on wt-EGFR-Overexpressing Cell Line (A431 Cells) and LA1560-P01 Probe. (a) High-throughput screening of known EGFR inhibitors and unreported EGFR-inhibiting compounds using the photoaffinity probe in the wt-EGFR-overexpressing cell line; (b) Graphical representation of 67 compounds, including covalent, non-covalent, and unreported EGFR inhibitors.
[0065] FIG. 10 shows Validation of Positive / Negative Molecule Screening for EGFR Ligand Screening Platform Based on wt-EGFR-Overexpressing Cell Line (A431 Cells) and LA1560-MP01 Probe. (a) High-throughput screening of known EGFR inhibitors and unreported EGFR-inhibiting compounds using the LA1560-MP01 probe in the wt-EGFR-overexpressing cell line; (b) Graphical representation of 67 compounds, including covalent, non-covalent, and unreported EGFR inhibitors.
[0066] FIG. 11 shows IC50 Curves of Known Inhibitors Not Selected by the EGFR Platform in Initial Screening (Inhibition Rate < 25%) .
[0067] FIG. 12 shows Western Blot (WB) Validation of Abnormal Drug Inhibition on EGFR Phosphorylation. (a) Known inhibitors screened by the platform; (b) Known inhibitors not screened by the platform.
[0068] FIG. 13 shows EGF Agonist Screening and Application Testing. (a) EGF-enhanced probe signal curve; (b) Structure of Methylene Blue; (c) Enhancement of probe signal by Methylene Blue; (d) Protein expression levels of pEGFR (Tyr1068) and GAPDH under treatment with different concentrations of Methylene Blue, measured by Western blot.
[0069] FIG. 14 shows Parameter Determination for Mutation-Selective EGFR Ligand Screening Platform. (a) Design and synthesis of mutant-selective Probe4; (b) EC50 curve of LA1607-Y8 probe to determine optimal probe and dosage; (c) Optimal incubation time for LA1607-Y8 probe; (d) Effect of LA1607-Y8 probe labeling on antigen-antibody binding; (e) Exploration of optimal antibody ratio when GFP antibody and EGFR antibody are mixed (signal = 1) ; (f) Protein saturation coating test under the optimal antibody ratio (signal = 1) ; (g) IC50 curve of LA1607-Y8 probe’s core drug on signal inhibition.
[0070] FIG. 15 shows Feasibility Validation of T790M / L858R-EGFR Drug Screening Platform. (a) - (e) Concentration-signal inhibition rate curves of reported T790M / L858R-EGFR mutation-selective inhibitors tested on this platform; (f) Concentration-signal inhibition rate curve of reported non-selective inhibitors tested on this platform; (g) Concentration-signal inhibition rate curve of reported wt-EGFR-preferential inhibitors tested on this platform.
[0071] FIG. 16 shows Schematic Diagram of Degrader Screening Principle Based on INTRAP Technology.
[0072] FIG. 17 shows Validation of EGFR Degrader Screening Using LA1562-P01. (a) Chemical structure of Gefitinib-based PROTAC 3 (CAS No. 2230821-27-7) ; (b) Dose-response ELISA curves (x-axis: drug concentration, y-axis: probe signal OD450) after co-treatment with Gefitinib or its PROTAC derivative at varying concentrations and LA1562-P01 probe.
[0073] FIG. 18 shows Extension of INTRAP Detection Method. (a) Comparison of ELISA and q-PCR detection for the same sample; (b) Single-point screening using q-PCR: 10 wt-EGFR-active drugs and 70 unreported EGFR-related drugs were tested. The probe-only group (control) served as the reference. Ct values >1.1×T0 indicate potential competitive ligands for probe-target binding, while inhibition rates <0.9×T0 indicate potential synergistic ligands.
[0074] FIG. 19 shows Determination of LA1562-P01 Probe and Cell Line for HER2 Ligand Screening Platform. (a) Design of LA1562-P01 Probe; (b) HER2 protein abundance in different cell lines detected using Beyotime antibody; (c) HER2 protein abundance in different cell lines detected using Abbkine antibody.
[0075] FIG. 20 shows Incubation Time-and Concentration-Dependent Gel Images of LA1562-P01 Probe Labeling in SKBR3 Cell Proteins. FL: Fluorescence gel image; CBB: Coomassie Brilliant Blue. (a) Time-Dependent Gel Image; (b) Concentration-Dependent Gel Image.
[0076] FIG. 21 shows Parameter Determination for HER2 Ligand Screening Platform. (a) Mass spectrometry confirmation of LA1562-P01-labeled target protein; (b) EC50 curve of LA1562-P01 probe labeling HER2 to determine probe dosage; (c) Optimal incubation time for LA1562-P01 probe; (d) Effect of LA1562-P01 probe labeling on antigen-antibody binding; (e) Antibody coating amount optimization; (f) Protein loading amount optimization; (g) IC50 curve of LA1562-P01 probe’s core drug on probe signal inhibition; (h) Effect of EGF concentration on probe labeling efficiency.
[0077] FIG. 22 shows Positive / Negative Molecule Screening and Validation for HER2 Ligand Screening Platform Based on HER2-Overexpressing Cell Line (SKBR3 Cells) and LA1562-P01 Probe. (a) Screening of 53 candidate compounds; (b) IC50 curves of known inhibitors not selected by the HER2 platform in initial screening.
[0078] FIG. 23 shows WB validation of screened drugs blocking the PI3K / AKT / mTOR pathway.
[0079] FIG. 24 shows Analysis of LA1562-P01 Probe Labeling on Protein Phosphorylation Status. (a) Labeling efficiency of LA1562-P01 probe for HER2 and p-HER2 in live cells; (b) Effect of LA1562-P01 probe on HER2 phosphorylation; (c) Pull Down &WB validation of LA1562-P01 probe’s ability to label HER2 protein in live cells (+’ : Post-pulldown lysate) .DETAILED DESCRIPTION
[0080] Reference will now be made in detail to certain embodiments, examples of which are illustrated in the accompanying detailed description. While enumerated embodiments will be described, it shall be understood that they are not intended to limit the present disclosure to those embodiments. On the contrary, the present disclosure is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present disclosure as defined by the claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present disclosure. The present disclosure is in no way limited to the methods and materials as described. In the event that one or more of the incorporated literatures and similar materials differs from or contradicts this disclosure, including but not limited to defined terms, term usage, described techniques, or the like, this disclosure controls.
[0081] It is appreciated that certain features of the present disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the present disclosure, which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable sub-combination.
[0082] DEFINITIONS
[0083] The terms used but not defined herein have their ordinary meaning and the meaning of such terms is independent at each occurrence thereof. Nevertheless, unless otherwise stated, the following definitions apply throughout the specification and claims.
[0084] As used herein, the singular forms “a” , “an” , and “the” include plural referents unless expressly stated to the contrary.
[0085] As used herein, the terms “comprise” and “include” are intended to specify the presence of stated features, integers, components, or steps, but they do not preclude the presence or addition of one or more other features, integers, components, steps, or groups thereof.
[0086] Definitions of specific functional groups and chemical terms are described in more detail below. For purpose of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Edition, inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito, 1999; Smith and March, March’s Advanced Organic Chemistry, 5th Edition, John Wiley &Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; Carruthers, Some Modem Methods of Organic Synthesis, 3rd Edition, Cambridge University Press, Cambridge, 1987.
[0087] All ranges cited herein are inclusive, unless expressly stated to the contrary.
[0088] As used herein, the term “biomolecule” refers to a component or reagent that is derived from a living organism by purification or synthesis and may be biologically active. The term “biomolecule” includes any variants thereof (e.g., mutated or otherwise modified forms) and more broadly encompasses any biomacromolecule capable of being specifically recognized and bound by a probe in living cells. By way of example, biomolecules comprise nucleic acids, carbohydrates, amino acids, polypeptides, protein, glycoproteins, hormones, aptamers, and mixtures thereof. More specifically, the term “biomolecule” is intended to include, but is not limited to, RNA, DNA, oligonucleotides, modified or derived nucleotides, enzymes, receptors, prions, receptor ligands (including hormones) , antibodies, antigens, and toxins, as well as bacteria, viruses, blood cells, and tissue cells. As disclosed herein, A detectable biomolecule is prepared by contacting a biomolecule with a probe compound having a reactive moiety, and the reactive moiety is capable of attaching the biomolecule to the probe compound via any available atom or functional group on the biomolecule (e.g., an amino group, hydroxyl group, carboxyl group, or sulfhydryl group) .
[0089] As used herein, the terms "protein" , "polypeptide" , and "peptide" refer to a polymeric form of amino acids. Proteins are understood to comprise more amino acids than polypeptides and peptides and a protein typically comprises at least about 50 amino acids, while a peptide typically comprises from 2 to about 50 amino acids, and a polypeptide is between the peptide and protein in length, usually containing 10 to 100 amino acids. However, it should be understood that, when used by those skilled in the art, the amino acid chain lengths represented by the terms "protein" , "polypeptide" and "peptide" are not strictly distinguished as defined above, and these terms can be used interchangeably to a certain extent. The amino acids in a protein or peptide may exist in either the D or L configuration or a combination of the two configurations and may be chemically or biochemically modified. Modification of the amino acids may take place at the side chains or at the peptide bond linking the amino acids. The peptide bonds (-CONH-) may be modified to change the properties of the peptide bond. The peptide may also be chemically modified by the addition of covalently bound chemical groups such as biotin, thiol, cysteine, amide, carboxyl, linear or branched alkyl, primary or secondary amines, lipids, phospholipids, fatty acids cholesterol etc. These chemical groups may be added to the peptide at the N-terminal and / or C-terminal end or within the peptide. A peptide may also be modified by the addition of one or more additional bonds within the peptide between the N-and C-terminals, such as a disulphide bond. The amine group at the N-terminal may also be chemically modified, for example by the additional of a cap by acetylation.
[0090] As used herein, the term "modified" , "protected / modified form" , "modification" or grammatical variants thereof in the context of a modified amino acid refers to an amino acid wherein one or more groups on the side chain is substituted. The one or more groups may be substituted with alkyl, alkenyl, alkynyl, thioalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, halo, carboxyl, haloalkyl, haloalkynyl, hydroxyl, alkoxy, thioalkoxy, alkenyloxy, haloalkoxy, haloalkenyloxy, nitro, amino, nitroalkyl, nitroalkenyl, nitroalkynyl, nitroheterocyclyl, alkylamino, dialkylamino, alkenylamine, alkynylamino, acyl, alkenoyl, alkynoyl, acylamino, diacylamino, acyloxy, alkylsulfonyloxy, heterocycloxy, heterocycloamino, haloheterocycloalkyl, alkylsulfenyl, alkylcarbonyloxy, alkylthio, acylthio, phosphorus-containing groups such as phosphono and phosphinyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, cyano, cyanate, isocyanate, -C (O) NH (alkyl) , and -C (O) N (alkyl) 2.
[0091] As used herein, the terms "amino acid" refers to a molecule that comprises amine (-NH) and carboxyl (-COOH) functional groups and a side chain. Amino acids may be encoded by triplet codons of nucleic acids (canonical amino acids) or by variant codons (non-canonical amino acids) . Amino acids may be characterized as α-amino acids or β-amino acids. In α-amino acids, the amine and carboxylic groups are attached to the first carbon. In β-amino acids, the amine and carboxyl groups are attached to adjacent carbons. Amino acids may also be characterized as D-amino acids (where the stereogenic carbon alpha to the amino group has the D-configuration) or L-amino acids (where the stereogenic carbon alpha to the amino group has the L-configuration) . Amino acids may also be classified based on their properties of their side chains. For example, amino acids may be classified as acidic, basic, polar, hydrophobic or aromatic and an amino acid may fall into one or more categories. Aromatic amino acids include phenylalanine (Phe) , tryptophan (Trp) , tyrosine (Tyr) , and histidine (His) . Hydrophobic amino acids include glycine (Gly) , alanine (Ala) , valine (Val) , leucine (Leu) , isoleucine (lie) , proline (Pro) , phenylalanine (Phe) , methionine (Met) , and tryptophan (Trp) . Polar amino acids include serine (Ser) , threonine (Thr) , cysteine (Cys) , asparagine (Asn) , glutamine (Gin) , and tyrosine (Tyr) . Basic amino acids include arginine (Arg) , lysine (Lys) , and histidine (His) and acidic amino acids include aspartic acid or aspartate (Asp) and glutamic acid or glutamate (Glu) .
[0092] As used herein, the term "antibody" refers to any form of immunoglobulin molecule that exhibits the desired biological or binding activity. Accordingly, it is used in the broadest sense and specifically covers, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies) , polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) , humanized, fully human antibodies, chimeric antibodies and camelidized single domain antibodies. As used herein, the term "antibody" includes not only an intact polyclonal or monoclonal antibody, but also, unless otherwise specified, any antigen-binding portion thereof that competes with the intact antibody for specific binding, a fusion protein comprising an antigen-binding portion, and any other modified conformation of an immunoglobulin molecule comprising an antigen recognition site. Antigen-binding portions include, for example, Fab, Fab', F(ab') 2, Fd, Fv, structural domain antibodies (dAb, e.g. shark and camel antibodies) , fragments containing complementary determining regions (CDR) , single-chain variable fragment antibodies (scFv) , maximal antibodies, microbodies, intracellular antibodies, double antibodies, triple antibodies, quadruple antibodies, v-NAR and double scFv, and immune peptides containing at least a portion of an immunoglobulin (sufficient to confer peptide-specific antigen binding) . Antibodies include any class of antibody, such as IgG, IgA or IgM (or subclasses thereof) , and the antibody need not be of any particular class.
[0093] SCREENING METHOD
[0094] The present disclosure provides a screening method capable of screening potential ligands for biomolecules, such as target proteins, at the living cell level, which overcome the drawbacks of traditional target protein ligand screening methods that require modification or purification of the target proteins, with fewer steps and easier operation. The screening method of the present disclosure is quantitative screening techniques capable of performing the operations in situ.
[0095] In one aspect, the present disclosure provides a method of screening a ligand for a target biomolecule, which comprises the following steps:
[0096] a1) adding a probe alone to a system comprising the target biomolecule, the probe binding to the target biomolecule thereby forming a target biomolecule-probe conjugate,
[0097] a2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe,
[0098] a3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule and / or the target biomolecule-probe conjugate to the solid support,
[0099] a4) performing quantitative assay on the solid support to obtain a reference value T0;
[0100] b1) adding a probe and a candidate ligand (s) to a system comprising the target biomolecule, the probe and the candidate ligand (s) competing for binding to the target biomolecule thereby forming a target biomolecule-probe conjugate and / or a target biomolecule-candidate ligand conjugate and / or a target biomolecule-probe-candidate ligand conjugate,
[0101] b2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe and / or a detectable target biomolecule-probe-candidate ligand conjugate,
[0102] b3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule, the target biomolecule-probe conjugate and / or the target biomolecule-candidate ligand conjugate and / or the target biomolecule-probe-candidate ligand conjugate to the solid support,
[0103] b4) performing quantitative assay on the solid support to obtain a measured value T1;
[0104] if T1 < T0, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, and
[0105] if T1 > T0, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule.
[0106] A person skilled in the art will understand that, in some embodiments, steps a1-a4 and steps b1-b4 are performed independently and separately. These steps can be carried out in any order, either sequentially or simultaneously. In some embodiments, steps a1-a4 are performed first to measure the reference value T0, followed by steps b1-b4 to measure the measured value T1. In some embodiments, steps a1-a4 and steps b1-b4 are performed concurrently to obtain T0 and T1, respectively. In some embodiments, steps b1-b4 may be performed first to measure T1, followed by steps a1-a4 to measure T0.
[0107] The system for performing steps a1-a4 and b1-b4 may involve separate biological samples, distinct reaction containers, or spatially partitioned regions within the same experimental platform (e.g., different wells of a multi-well plate or separate cell cultures) . Additionally, the time intervals between these steps may vary, including but not limited to sequential execution within a single experimental session, staggered execution across multiple sessions, or concurrent execution using synchronized protocols.
[0108] The independence and flexibility in the order of these steps allow for various experimental designs and controls. For example, performing steps a1-a4 first establishes a baseline measurement (T0) of the target biomolecule-probe interaction in the absence of a candidate ligand. This baseline is crucial for accurately comparing the measured value T1 obtained in steps b1-b4, where the candidate ligand is present. Conversely, performing steps b1-b4 first may be advantageous when assessing the immediate impact of the candidate ligand on probe binding. Furthermore, simultaneous execution of steps a1-a4 and b1-b4 can streamline the screening process, particularly in high-throughput applications. This approach allows for direct comparison of T0 and T1 under identical experimental conditions, minimizing variability.
[0109] To enhance experimental efficiency, adaptability, and data robustness, the method disclosed herein allows for multiple iterations of steps a1-a4 and / or b1-b4 under consistent or varied conditions, such as adjustments to probe concentrations, candidate ligand dosages, incubation times, or other experimental parameters. These iterative executions enable the validation of reproducibility, assessment of dose-dependent effects, and generation of comprehensive binding profiles and kinetic data. Furthermore, the method incorporates internal controls, including parallel measurements of T0 and T1 within the same biological system or normalization against baseline signals from unmodified biomolecules. This iterative and flexible approach strengthens the reliability of ligand identification, facilitating the discovery of compounds with diverse binding affinities, mechanisms of action, or cooperative / competitive behaviors under systematically modulated conditions.
[0110] In summary, the flexibility in the order and execution of steps a1-a4 and b1-b4, combined with the option for repeated measurements and additional controls, ensures comprehensive screening across diverse experimental configurations while maintaining the method’s core advantages of simplicity, in situ operability, and quantitative accuracy. Therefore, the present disclosure provides a versatile and robust screening method for identifying potential ligands for target biomolecules.
[0111] In the present disclosure, the system encompasses biological environments comprising target biomolecules, which may include live cell lines, organelle fractions, or crude cellular extracts. In preferred embodiments, the system comprises cell lines expressing the target biomolecule, particularly proteins of therapeutic or diagnostic relevance. These cell lines may be naturally occurring (e.g., cancer-derived cell lines with endogenous overexpression of a target protein) or engineered to express recombinant or mutant forms of the biomolecule. For example, cell lines expressing receptor tyrosine kinase (RTK) family proteins, such as EGFR-overexpressing A431 cells, HER2-amplified SKBR3 cells, or H1975 cells harboring EGFR T790M / L858R mutations, are utilized to model disease-associated targets and evaluate ligand interactions under physiologically relevant conditions. The system further accommodates primary cells (e.g., patient-derived tumor cells) , stem cells, or immortalized cell lines (e.g., HEK293, CHO) modified via CRISPR / Cas9, siRNA, or viral transduction to modulate target expression levels or introduce specific mutations. The system is not limited to human-derived cells but may also incorporate prokaryotic (e.g., E. coli) , yeast (e.g., S. cerevisiae) , or insect (e.g., Sf9) expression systems for target production and screening. Additionally, the system extends to complex physiological models, such as 3D cell cultures, co-culture systems (e.g., tumor-stromal interactions) , organoids, or in vivo models (e.g., zebrafish, murine xenografts) , to recapitulate tissue-specific microenvironments and multicellular interactions. The target biomolecule may include, but is not limited to, wild-type or mutant proteins (e.g., kinases, GPCRs, ion channels) , nucleic acids (e.g., DNA G-quadruplexes, RNA aptamers) , glycoproteins, or lipid-associated molecules. For non-protein targets, the system may employ cell lines engineered to present specific carbohydrate epitopes or lipid membranes enriched with target molecules.
[0112] In the present disclosure, the biomolecule refers to a target during the drug screening process, for example, a nucleic acid, a carbohydrate, a lipid, a protein, or any combination thereof, typically a protein, especially a protein with specific physiological functions, such as an enzyme and a receptor. As used herein, the terms "biomolecule" and "biomacromolecule" can be used interchangeable.
[0113] The candidate ligand is a compound to be screened which is validated by the screening method of the present disclosure to determine whether it is potential ligand that may be able to bind to the target biomolecule. The candidate ligands may include small-molecule compounds, peptides, protein fragments, nucleic acid aptamers, or other molecules capable of binding to the target biomolecule, for example a protein, a protein with specific physiological functions, such as an enzyme and a receptor. Their functional roles encompass, but are not limited to, direct interaction with the target biomolecule (e.g., acting as inhibitors or agonists) or indirectly modulating the target biomolecule's status by engaging other mechanisms (e.g., PROTAC-induced degradation) .
[0114] The probe is a compound that has an affinity for the target biomolecule to which it can bind specifically.
[0115] In the screening method of the present disclosure, binding of the probe to the target biomolecule can be measured by a detection assay commonly known to those skilled in the art. For example, the detection assay is ELISA, qPCR, LAMP, ddPCR, ddElisa, NGS or any others.
[0116] Given that different assays have different detection principles and sensitivities, the determination thresholds for determining whether a candidate ligand is a ligand for a target biomolecule are different. It should be noted that a person skilled in the art has the ability to determine appropriate detection thresholds for assessing whether a candidate ligand interacts with a target biomolecule. This determination is crucial, as different assays inherently possess varying detection principles and sensitivities. Consequently, the thresholds required to confidently identify a ligand for a given target will differ across assays. For instance, highly sensitive techniques may necessitate lower thresholds to discern subtle interactions, whereas less sensitive methods might demand higher thresholds to minimize false positives. Furthermore, a skilled practitioner will also consider factors such as experimental conditions, the specific properties of the biomolecule, and the concentration of the candidate ligand when setting these thresholds. By carefully evaluating these variables, a person skilled in the art can effectively utilize a range of detection methods to accurately characterize ligand-target biomolecule interactions.
[0117] In some embodiments, in step (b1) , the probe and a candidate ligand (s) can be added in any order to the target biomolecule, or simultaneously. The flexibility in the order of addition allows for various experimental designs to assess ligand binding and displacement. For instance, the probe can be pre-incubated with the target biomolecule to establish a baseline signal, followed by the addition of the candidate ligand to observe displacement or competition. Alternatively, the candidate ligand (s) can be added first, allowing for pre-equilibration, followed by the addition of the probe to assess its ability to bind in the presence of the ligand. In a simultaneous addition scenario, the probe and candidate ligand (s) are added together, enabling the observation of competitive binding dynamics in real-time.
[0118] Furthermore, the addition can be sequential, with varying incubation times between additions, allowing for kinetic studies of binding and displacement. This approach can be particularly useful in determining the rate constants of ligand binding and the stability of the resulting complexes. In certain embodiments, the probe and candidate ligand (s) may be added in a stepwise manner, where multiple additions of the candidate ligand (s) are performed over time, allowing for the observation of dose-dependent displacement or competitive binding. The addition can also be performed in a continuous manner, where the probe and candidate ligand (s) are added continuously over time, allowing for the observation of dynamic binding and displacement.
[0119] The choice of addition order and timing will depend on the specific experimental objectives. A skilled artisan will appreciate the versatility of this approach, adapting the addition strategy to optimize data acquisition and interpretation for a wide range of ligand screening and biomolecular interaction studies.
[0120] In some embodiments, in step (b1) , the candidate ligand (s) is / are added to the target biomolecule prior to, subsequent to, or concurrently with the probe.
[0121] In some embodiments, if T1 ≤ T0 × (100-E) %, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, and
[0122] if T1 ≥ T0 × (100+E’ ) %, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule,
[0123] where E ≥ 5, for example, E ≥ 10, E ≥ 15, E ≥ 20, E ≥ 25, E ≥ 30, E ≥ 35, E ≥ 40, E ≥ 45, E ≥ 50,
[0124] E’≥ 5, for example, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, E’ ≥ 25, E’ ≥ 30, E’ ≥ 35, E’ ≥ 40, E’ ≥ 45, E’ ≥ 50,
[0125] E and E’ may be the same or different.
[0126] In some embodiments, the detection assay is ELISA, and E ≥ 5, for example, E ≥ 10, E ≥15, E ≥ 20, E ≥ 25, E ≥ 30, E ≥ 35, E ≥ 40, E ≥ 45, E ≥ 50,
[0127] E’≥ 5, for example, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, E’ ≥ 25, E’ ≥ 30, E’ ≥ 35, E’ ≥ 40, E’ ≥ 45, E’ ≥ 50,
[0128] E and E’ may be the same or different.
[0129] In some embodiments, the detection assay is ELISA, and E ≥ 25 and E’ ≥ 25, for example, E is 25 and E’ is 25, i.e.,
[0130] if T1 < T0 × 75%, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, or
[0131] if T1 ≥ T0 × 125%, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule.
[0132] In some embodiments, the detection assay is qPCR, and E ≥ 5, for example, E ≥ 10, E ≥ 15, E ≥ 20, E ≥ 25, E ≥ 30, E ≥ 35, E ≥ 40, E ≥ 45, E ≥ 50,
[0133] E’≥ 5, for example, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, E’ ≥ 25, E’ ≥ 30, E’ ≥ 35, E’ ≥ 40, E’ ≥ 45, E’ ≥ 50,
[0134] E and E’ may be the same or different.
[0135] In some embodiments, the detection assay is qPCR, and E ≥ 10 and E’ ≥ 10, for example, E is 10 and E’ is 10, i.e.,
[0136] if T1 < T0 × 90%, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, or
[0137] if T1 ≥ T0 × 110%, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule.
[0138] Alternatively, in the method of the present disclosure, instead of forming a conjugate, the components added to the system bind to each other to form a complex. Specifically, in step a1) , the probe binds to the target biomolecule to form a target biomolecule-probe complex. In step a2) , a detectable target biomolecule-probe complex is formed.
[0139] In step b1) , the probe and the candidate ligand (s) competing for binding to the target biomolecule to form a target biomolecule-probe complex and / or a target biomolecule-candidate ligand complex and / or a target biomolecule-probe-candidate ligand complex. In step b2) , a detectable target biomolecule-probe complex, and / or a detectable target biomolecule-probe-candidate ligand complex conjugate is formed.
[0140] As used herein, the term "conjugate" refers to a stable molecular entity formed by the covalent linkage of two or more distinct molecules. This covalent linkage typically involves a chemical reaction resulting in the formation of a strong chemical bond, rendering the resulting conjugate a stable and well-defined structure. Examples of conjugates include, but are not limited to, antibody-drug conjugates (ADCs) and protein-polymer conjugates. The formation of a conjugate often involves chemical modification of the constituent molecules, and the resulting conjugate exhibits properties distinct from its individual components.
[0141] As used herein, the term "complex" refers to a molecular assembly formed by the non-covalent association of two or more distinct molecules. These non-covalent interactions may include, but are not limited to, hydrogen bonds, ionic interactions, van der Waals forces, and hydrophobic interactions. Complexes are typically characterized by their dynamic nature, with the association and dissociation of the constituent molecules occurring reversibly. Examples of complexes include, but are not limited to, protein-ligand complexes, DNA-protein complexes, and antigen-antibody complexes. The formation of a complex does not involve chemical modification of the constituent molecules, and the resulting complex retains the individual properties of its components while exhibiting a cooperative function.
[0142] BIOMOLECULE
[0143] In the present disclosure, the term "biomolecule" as used herein, is intended to include naturally occurring biomolecules, as well as synthetic or modified versions thereof, that retain a relevant biological activity or function. This definition is not intended to be limiting, and other molecules that are understood by those skilled in the art to be involved in biological systems are also included within the scope of this term.
[0144] In some embodiments, the biomolecule comprises a nucleic acid, a carbohydrate, a lipid, a protein, or any combination thereof.
[0145] In some embodiments, the nucleic acid is selected from DNA, RNA, oligonucleotide, aptamer, or any combination thereof.
[0146] In some embodiments, the carbohydrate is selected from monosaccharide, polysaccharide, glycoprotein, or any combination thereof.
[0147] In some embodiments, the lipid is selected from phospholipid, fatty acid, cholesterol, or any combination thereof.
[0148] In some embodiments, the biomolecule comprises a hormone.
[0149] In some embodiments, the biomolecule comprises a protein or a variant thereof.
[0150] In some embodiments, the biomolecule comprises a protein of a wild-type form, a mutated form with at least one amino acid mutation compared to the corresponding wild-type protein, or a post-translational modified form.
[0151] In some embodiments, the protein or its variant is involved in cell signaling, metabolism, or disease pathology.
[0152] In some embodiments, the protein is a protein without an epitope tag.
[0153] In some embodiments, the protein is selected from an enzyme, a receptor, a cell surface protein, an antibody, an antigen, or any combination thereof.
[0154] In some embodiments, the protein is a cell surface receptor selected from G protein-coupled receptors (GPCRs) , receptor tyrosine kinases (RTKs) , nuclear receptors, or a variant thereof. In some preferable embodiments, the protein is selected from receptor tyrosine kinase (RTK) family including but not limited to EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, a variant thereof, where the variant is a mutate with at least one amino acid mutation compared to the corresponding wild-type RTK.
[0155] In some embodiments, the target biomolecule includes, but is not limited to, a mutant protein containing at least one amino acid mutation compared to its corresponding wild-type protein. In some embodiments, the mutant protein is EGFR with T790M and / or L858R mutation.
[0156] In some embodiment, the method of the present disclosure involves performing steps in parallel in two systems: one containing the mutant protein and the other containing the corresponding wild-type protein. The interference of candidate ligands with probe-protein binding is then compared between the two systems. Candidate ligands that selectively and significantly disrupt probe binding only in the mutant protein system are identified as specific ligands targeting the mutant.
[0157] LIGAND / CANDIDATE LIGAND
[0158] The present disclosure provides a high-efficiency method for directly and quantitatively screening ligands of target biomolecules (e.g., proteins) in live cells or physiologically relevant environments. The ligands may include but are not limited to inhibitors (competitive / non-competitive) , agonists (activators) , degraders (e.g., PROTACs) , allosteric modulators, neutralizing antibodies, and synergistic ligands. These ligands modulate target functions through inhibition, activation, stabilization, or clearance, offering comprehensive support for drug development and biological research.
[0159] As used herein, the term "ligand" refers to a molecular entity capable of specifically binding to a target biomolecule (e.g., protein) and regulating its function or causing its degradation, including small molecules, peptides, nucleic acid aptamers, antibodies, or fragments thereof.
[0160] Based on mechanisms of action, ligands are categorized as follows:
[0161] I. Inhibitors
[0162] Competitive Inhibitors: Directly compete with the probe for binding to the active site of the target molecule, reducing detection signals (T1 < T0) by blocking probe-target complex formation.
[0163] Non-competitive Inhibitors: Bind to allosteric sites or induce conformational changes, indirectly inhibiting probe binding (signal reduction) .
[0164] Covalent Inhibitors: Form irreversible bonds with the target via reactive groups (e.g., Michael acceptors, sulfonyl fluorides) , suitable for high-affinity screening.
[0165] II. Agonists / Activators
[0166] Enhance probe-target binding by stabilizing the active conformation or promoting dimerization, leading to signal elevation (T1 > T0) .
[0167] III. Degraders
[0168] Induce target protein degradation via ubiquitin-proteasome (e.g., PROTACs) or lysosomal pathways (e.g., LYTACs) . Increased probe signals (T1 > T0) indicate successful degradation (as probes bind remaining non-degraded targets) .
[0169] IV. Allosteric Modulators
[0170] Bind to non-active sites, modulating probe binding through conformational changes. May cause bidirectional signal changes (T1 increase or decrease) .
[0171] V. Neutralizing Antibodies
[0172] Block probe-target binding via steric hindrance or epitope masking, suitable for macromolecular ligand screening.
[0173] VI. Synergistic Ligands
[0174] Bind to regions adjacent to the probe-binding site, enhancing probe stability through synergistic effects (T1 >> T0) .
[0175] In the present disclosure, a ligand that cause a decrease in the detection signal (T1 < T0) can also be classified as a competitive ligand, such as but not limited to the inhibitors, allosteric modulators, and neutralizing antibodies mentioned above.
[0176] In the present disclosure, ligands that cause an increase in the detection signal (T1 > T0) can also be classified as cooperative ligands, such as but not limited to the agonists / activators, synergistic ligands and degraders mentioned above.
[0177] In the methods of the present disclosure, although a degrader significantly reduces the overall level of a target biomolecule (such as a protein) by inducing its degradation, its mechanism of action results in a statistically significant increase in the detection signal (T1) compared to the reference value (T0) , thereby categorizing it as a cooperative ligand. This classification can be explained by the following mechanism: when a candidate degrader (e.g., a PROTAC molecule) is introduced into a living cell system, it specifically binds to and mediates the degradation of the target biomolecule. The degrader preferentially degrades free target biomolecules that are not bound by the probe. Among the total target biomolecules, the proportion of probe-bound target biomolecules is significantly increased due to the degradation of free target biomolecules, resulting in an increase in signal. As shown in Example 5, when the degrader is pre-incubated in the cellular system and the target clearance is complete, the signal (T1) of the probe-labeled target-probe complex significantly increases compared to the untreated group (T0) (T1 > T0) . Therefore, based on the quantitative comparison of the detection signal (T1 ≥ T0 × (100+E') %) , the degrader is defined as a cooperative ligand, whose mode of action is different from traditional competitive inhibitors, and can be efficiently screened and validated by the methods of the present disclosure.
[0178] Screening Criteria for Candidate Ligands
[0179] Competitive Ligands: Identified when T1 ≤ T0 × (100-E) %, for example, E ≥ 5, E ≥ 10, E ≥15, E ≥ 20, E ≥ 25, E ≥ 30, E ≥ 35, E ≥ 40, E ≥ 45, E ≥ 50;
[0180] Cooperative Ligands: Identified when T1 ≥ T0 × (100+E’ ) %, for example, E’ ≥ 5, E’ ≥ 10, E’≥ 15, E’ ≥ 20, E’ ≥ 25, E’ ≥ 30, E’ ≥ 35, E’ ≥ 40, E’ ≥ 45, E’ ≥ 50;
[0181] In case of degraders: Significant signal elevation (T1 > T0) after pre-incubation indicates effective target clearance, for example, identified when T1 ≥ T0 × (100+E’ ) %, for example, E’ ≥5, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, E’ ≥ 25, E’ ≥ 30, E’ ≥ 35, E’ ≥ 40, E’ ≥ 45, E’ ≥ 50.
[0182] In some embodiments, the candidate ligand comprises a degrader capable of reducing or eliminating the level of the target biomolecule. The method includes adding the candidate ligands to a live cellular system containing the target biomolecule and incubating for a sufficient duration to allow ligand-induced degradation of the target biomolecule in step (b1) . Subsequent steps are performed, where an increase in the detection signal of the probe-protein complex indicates that the candidate ligand has induced degradation of the target biomolecule.
[0183] In some embodiments, the candidate ligand is a PROTAC.
[0184] In some embodiments, the candidate ligand is a candidate degrader, preferably a candidate PROTAC.
[0185] In some embodiments, and in step (b1) , the candidate ligand (s) is / are added to the target biomolecule subsequent to the probe, and optionally incubated for a period of 1 to 48 h, or 1 to 24 h, or 1 to 12h, or any time within the range.
[0186] The method of the present disclosure is particularly advantageous for screening degraders, including proteolysis-targeting chimeras (PROTACs) , which induce targeted protein degradation via ubiquitin-proteasome or lysosomal pathways. PROTACs are heterobifunctional molecules comprising a target-binding moiety, an E3 ubiquitin ligase-recruiting moiety, and a linker. When a PROTAC binds to both the target biomolecule and an E3 ligase, it facilitates ubiquitination and subsequent proteasomal degradation of the target. In the context of the present method, candidate PROTACs are introduced into a live cellular system containing the target biomolecule and incubated for a duration sufficient to induce degradation (e.g., 2 to 24 hours) prior to probe addition. Following target clearance, the remaining non-degraded target molecules (if any) are labeled with the probe. A significant increase in the detection signal (T1 > T0) indicates successful degradation, as the probe binds to residual non-degraded targets with reduced competition from the PROTAC. This approach enables quantitative assessment of degradation efficiency and identification of PROTACs with optimal degradation potency.
[0187] The method further accommodates degraders beyond PROTACs, such as molecular glues (e.g., immunomodulatory imide drugs) or lysosome-targeting chimeras (LYTACs) , which operate through distinct mechanisms.
[0188] Notably, the method distinguishes degraders from competitive inhibitors by their temporal effects: degraders require pre-incubation to exert their function, whereas competitive inhibitors act immediately upon co-administration with the probe. Additionally, degraders may exhibit concentration-dependent signal amplification, as higher concentrations enhance target clearance, thereby increasing probe binding to residual targets. This contrasts with agonists or synergistic ligands, which enhance probe binding without reducing target abundance. The method’s compatibility with diverse physiological environments (e.g., intact cells, organelle fractions) ensures accurate evaluation of degrader efficacy in native contexts, including target ubiquitination dynamics, proteasome activity, and compensatory protein synthesis.
[0189] PROBE
[0190] In the present disclosure, the term "probe" refers to a compound engineered for specific interaction with a target biomolecule. This probe serves as a pivotal intermediate in screening methods, enabling the detection and quantification of ligand binding. Functionally, it exhibits high affinity for the target, facilitating stable conjugate or complex formation. Notably, the probe integrates a reporter moiety for detectable molecule coupling and an optional reactive moiety for covalent attachment to the target, ensuring stable conjugate formation. This multifunctional design enables precise assessment of candidate ligand interactions with the target biomolecule. "
[0191] The probe comprises a binding moiety, a reporter moiety, and optionally a reactive moiety.
[0192] The binding moiety is a portion of the probe molecule that recognizes and binds to the target biomolecule. The binding moiety is selected from a small molecule (typically with molecular weight < 1000Da) , binding to specific pockets of the target biomolecule covalently or noncovalently, or a peptide (typically with less than 40 amino acid residues) , binding to specific pockets or surface of the target biomolecule noncovalently.
[0193] In some specific embodiments, the small molecule fragment may be derived from kinase inhibitors e.g. marketed EGFR inhibitor drugs or GPCR ligands e.g. GLP-1R agonist peptides.
[0194] It should be appreciated by those of skill in the art that the small molecule that serves as the binding moiety of the probe molecule may be a known small molecule drug directed against the target biomolecule or a small molecule compound synthesized by the researcher on his or her own, as long as the small molecule compound has an affinity for the target biomolecule and is capable of binding specifically to it.
[0195] In some embodiments, the binding moiety is a small molecule fragment derived from ligands of Receptor Tyrosine Kinases (RTKs) , such as inhibitors, and more preferably inhibitors of the ErbB / HER protein family. Examples of such inhibitors include, but are not limited to Gefitinib, Erlotinib, Afatinib, Dacomitinib, Osimertinib, Lapatinib, Neratinib, Mavelertinib, Icotinib, Pelitinib, Poziotinib, Vandetanib, and Canertinib.
[0196] In some embodiments, the binding moiety is a peptide for binding to Receptor Tyrosine Kinases (RTKs) , and more preferably the ErbB / HER protein family, such as inhibitors. Examples of such antibody inhibitors include, but are not limited to Trastuzumab, Pertuzumab, Cetuximab, Panitumumab, Necitumumab, and Margetuximab (or their antibody–drug conjugates, such as T-DM1) .
[0197] It should be appreciated by those skilled in the art that other RTK inhibitors, including those targeting other members of the ErbB / HER family (e.g., HER3, HER4) or other RTK families, may also be used as the binding moiety. The selection of the specific binding moiety will depend on the target biomolecule and the desired binding affinity and specificity.
[0198] The reporter moiety is a portion of the probe molecule that is capable of being linked to a detectable molecule via a coupling reaction, such as click chemistry. The reporter moiety of the probe molecule is engineered to enable covalent or non-covalent coupling with a detectable molecule via bioorthogonal reactions, ensuring precise quantification of the target biomolecule-probe conjugate. Suitable reporter moieties include azadibenzocyclooctyne (ADIBO) , benzocyclobutene (BCB) , thiol (-SH) , alkene (C=C) , alkyne (C≡C) , azide (-N3) , tetrazine (C2N4) , trans-cyclooctene (TCO) , (diphenylphosphine) aryl, (diphenylphosphine) alkyl, or active esters such as hydroxybenzotriazole (HOBt) esters. These moieties are selected based on their compatibility with specific coupling chemistries, such as:
[0199] Strain-promoted azide-alkyne cycloaddition (SPAAC) between cyclooctynes (e.g., ADIBO) and azides;
[0200] Inverse electron-demand Diels-Alder (IEDDA) reactions between tetrazines and TCO, favored for rapid kinetics in live-cell imaging;
[0201] Copper-catalyzed azide-alkyne cycloaddition (CuAAC) for azide-alkyne pairs, optimized for in vitro assays;
[0202] Thiol-ene / yne or phosphine-based conjugation for selective reduction and coupling.
[0203] A skilled artisan will select the reporter moiety and detectable molecule (e.g., fluorophores, chemiluminescent tags, or biotin for streptavidin amplification) based on detection modality, experimental conditions (in vitro vs. in vivo) , and target biomolecule environment. For instance, tetrazine-TCO pairs minimize background interference in live-cell systems, while azide-alkyne systems suit high-throughput assays. Coupling efficiency and specificity are further influenced by reaction parameters (pH, temperature, catalyst presence) , which are routinely optimized using techniques like mass spectrometry or fluorescence polarization, and within the purview of a skilled practitioner. Click chemistry methodologies, known for their selectivity and stability, are particularly advantageous for constructing robust probe-detectable molecule complexes. This design flexibility ensures adaptability across diverse biological systems while maintaining sensitivity and reproducibility.
[0204] In some embodiments, the reporter portion is selected from the group of azadibenzocyclooctyne, benzocyclobutene, thiol, alkene, alkyne, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, active ester including hydroxybenzotriazole ester, and a radical thereof. In some embodiments, the reporter portion is alkynyl.
[0205] It is understood by those skilled in the art that while the reporter moieties may be referred to by their molecular names, when incorporated into the probe, they exist as monovalent or multivalent functional groups. These groups are covalently bonded to other components of the probe molecule. Specifically, the entities listed as potential reporter moieties are not present as free molecules, but rather as chemical moieties integrated into the probe's structure through one or more covalent linkages.
[0206] The reactive moiety is a portion of the probe molecule that is capable of covalently linking to a target biomolecule through a chemistry reaction, thereby attaching the probe molecule to the target biomolecule to form a target biomolecule-probe conjugate.
[0207] The probe of the present disclosure optionally comprises a reactive moiety. This design consideration acknowledges that, in certain instances, the binding moiety itself may form a covalent linkage with the target biomolecule, resulting in a sufficiently stable conjugate that obviates the need for an additional reactive moiety. For example, when the binding moiety is a small molecule inhibitor that forms a covalent bond with a specific residue within the target protein's active site, the resulting conjugate can be inherently robust and resistant to dissociation.
[0208] Conversely, when the binding moiety forms a non-covalent interaction with the target biomolecule, the inclusion of a reactive moiety becomes advantageous. This reactive moiety can then facilitate a covalent linkage, significantly enhancing the stability of the probe-target biomolecule conjugate. Suitable reactive moieties include photo-crosslinking groups, Michael acceptors, and leaving groups, among others, which can be selected based on their compatibility with the target biomolecule's reactive residues and experimental conditions.
[0209] Furthermore, even when the binding moiety forms a covalent bond, incorporating an additional reactive moiety can provide supplementary stability or introduce functionalities for specific applications. For instance, a dual-covalent linkage strategy may be employed to minimize off-target interactions or to enable controlled release of the probe under specific conditions. Additionally, the reactive moiety can be engineered to introduce specific chemical handles for subsequent modifications or to facilitate immobilization onto a solid support, even when the binding moiety alone is capable of forming a stable interaction.
[0210] In certain embodiments, the absence of a reactive moiety simplifies the probe design and synthesis, particularly when the binding moiety's intrinsic reactivity is sufficient for stable conjugate formation. This approach can be particularly beneficial in high-throughput screening assays where minimizing synthetic complexity and maximizing assay throughput are critical.
[0211] In summary, the inclusion of a reactive moiety in the probe design is a context-dependent choice, guided by the nature of the binding moiety, the stability requirements of the conjugate, and the specific objectives of the assay. A skilled artisan will appreciate the flexibility afforded by this optional component, tailoring the probe design to optimize performance across a wide range of applications.
[0212] The reactive moiety of the probe molecule is designed to enable covalent linkage to the target biomolecule through selective chemical reactions, ensuring stable and irreversible conjugate formation. Suitable reactive moieties include, but are not limited to, photo-crosslinking groups (e.g., diazirine, benzophenone) , sulfonyl fluoride, fluorosulfate, Michael acceptor groups (e.g., acrylamide, maleimide) , leaving groups (e.g., NHS esters, imidoesters) , nickel-nitrilotriacetic acid (Ni-NTA) for histidine-tagged proteins, and residues targeting nucleophilic amino acids such as cysteine, glutamic acid, aspartic acid, methionine, serine, or tyrosine. These moieties are selected based on their compatibility with the target biomolecule’s reactive residues, reaction kinetics, and environmental conditions (e.g., pH, temperature, redox state) . For instance, maleimide derivatives exhibit high specificity for thiol (-SH) groups in cysteine under physiological conditions, while NHS esters react selectively with primary amines (e.g., lysine ε-amino groups or N-termini) to form stable amide bonds. Photo-crosslinking groups, such as diazirine, enable spatiotemporal control over conjugation upon UV irradiation, facilitating dynamic studies of biomolecular interactions in live-cell systems.
[0213] A skilled artisan will choose the reactive moiety based on the target biomolecule’s structural features (e.g., solvent-exposed residues, post-translational modifications) and the desired conjugation stability. For example, sulfonyl fluoride derivatives offer broad reactivity toward tyrosine, lysine, and histidine residues, making them versatile for diverse protein targets. Reversible covalent bonds (e.g., disulfide linkages or boronic acid-diol interactions) may also be employed for transient conjugation, enabling probe detachment under reducing conditions or competitive ligand displacement. Reaction parameters such as pH, buffer composition, and catalyst presence (e.g., tris (2-carboxyethyl) phosphine (TCEP) for disulfide reduction) are routinely optimized to maximize conjugation efficiency while preserving the target biomolecule’s native conformation and activity. Validation methods, including mass spectrometry, SDS-PAGE, or fluorescence resonance energy transfer (FRET) , confirm successful conjugate formation and assess cross-linking specificity. This modular design ensures adaptability across biomolecule classes (e.g., wild-type or mutant proteins, nucleic acids, glycans) and experimental contexts (e.g., in vitro assays, live-cell imaging) , thereby advancing precision in ligand screening and functional studies.
[0214] In some embodiments, the reactive moiety include, but are not limited to, photo-crosslinking groups (e.g., diazirine, benzophenone) , sulfonyl fluoride, fluorosulfate, Michael acceptor groups (e.g., acrylamide, maleimide) , leaving groups (e.g., NHS esters, imidoesters) , nickel-nitrilotriacetic acid (Ni-NTA) for histidine-tagged proteins, and residues targeting nucleophilic amino acids such as cysteine, glutamic acid, aspartic acid, methionine, serine, or tyrosine. In some embodiment, the reactive moiety is a photo-crosslinking group comprising diazirine, benzophenone, aryl azides, psoralen derivatives, cyclopropene-diazirine hybrids, anthraquinones, and derivative and analogue thereof.
[0215] In some preferably embodiments, the binding moiety is a small molecule fragment derived from an inhibitor of the ErbB / HER protein family selected from the group consisting of Gefitinib, Afatinib, Mavelertinib, Erlotinib, Lapatinib, Afatinib, Dacomitinib, Neratinib, and Osimertinib, preferably Gefitinib, Afatinib, and Mavelertinib.
[0216] In some preferably embodiments, the reporter portion is selected from the group of azadibenzocyclooctyne, benzocyclobutene, thiol, alkenyl, alkynyl, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, preferably alkynyl.
[0217] In some preferably embodiments, the reactive moiety is a photo-crosslinking group selected from the group consisting of diazirine, benzophenone, aryl azides, psoralen derivatives, cyclopropene-diazirine hybrids, anthraquinones, and derivative and analogue thereof, preferably, diazirine.
[0218] In some preferably embodiments, the binding moiety is a small molecule fragment derived from an inhibitor of the ErbB / HER protein family selected from the group consisting of Gefitinib, Afatinib, and Mavelertinib; the reporter portion is alkynyl; and the reactive moiety is diazirine.
[0219] In some preferably embodiments, the probe is selected from the group consisting of
[0220] A person skilled in the art will recognize that the design and preparation of probes, as described herein, can be meticulously tailored to specific target biomolecules by judiciously adapting the structural components of the binding moiety, reporter moiety, and optional reactive moiety. The selection and arrangement of these components are customizable to optimize probe performance for a given application. The binding moiety, whether derived from known ligands (e.g., small-molecule inhibitors, peptide fragments, or antibody mimetics) or novel compounds identified through computational modeling or empirical screening, must exhibit sufficient affinity and specificity for the target. The reporter moiety, chosen from a range of bioorthogonal handles (e.g., alkynes, azides, tetrazines) , enables versatile coupling to detectable molecules via click chemistry or other conjugation methods, with the choice influenced by assay conditions (e.g., live-cell vs. in vitro systems) and compatibility with the detectable molecule (e.g., fluorophores, chemiluminescent tags, or nucleic acid-based amplification) .
[0221] The optional reactive moiety, when included, varies based on the target’s chemical environment (e.g., solvent-exposed nucleophilic residues, proximity to hydrophobic pockets) and the desired conjugation mechanism (e.g., UV-triggered crosslinking, spontaneous covalent bonding) . Connection points between these moieties (e.g., via alkyl linkers, polyethylene glycol [PEG] spacers, or aromatic bridges) are optimized to minimize steric hindrance, enhance solubility, or adjust pharmacokinetic properties. For instance, in membrane-bound targets like receptor tyrosine kinases, the binding moiety may be attached to a hydrophobic linker to improve membrane penetration, while the reporter moiety could be positioned distally to avoid interference with ligand-receptor interactions. Additionally, the probe may incorporate multiple reactive or reporter groups for multiplexed detection or dual-labeling strategies.
[0222] Furthermore, leveraging the detailed descriptions of the probe's structural components provided herein, a skilled artisan is capable of designing and synthesizing probes tailored to specific target biomolecules. The linkages connecting these moieties within the probe can be varied, employing flexible or rigid spacers to optimize spatial presentation and minimize steric hindrance. The position of each moiety within the probe structure can be strategically chosen to maximize accessibility and reactivity, considering factors such as the target biomolecule's structure and the assay conditions. For instance, in cases where the binding moiety forms a non-covalent interaction, the reactive moiety may be positioned to facilitate efficient crosslinking with a proximal residue on the target biomolecule. Conversely, when the binding moiety forms a covalent bond, the reactive moiety may be omitted, and the reporter moiety positioned to ensure optimal signal generation.
[0223] Moreover, the design can incorporate additional functionalities, such as cleavable linkers, to enable controlled release of the probe or detectable molecule under specific conditions. It is also understood that the absence of a reactive moiety, as in non-covalent probes, remains viable when the binding moiety’s intrinsic affinity ensures sufficient complex stability under assay conditions. This modular approach allows for fine-tuning of the probe's properties, ensuring compatibility with diverse biological systems and experimental setups. Such design flexibility ensures adaptability across diverse biological targets, including wild-type proteins, mutants, post-translationally modified variants, and non-protein biomolecules (e.g., nucleic acids, glycans) , thereby enabling precise ligand screening in complex physiological environments. A skilled artisan will appreciate the flexibility afforded by this design framework, readily adapting the probe structure to meet the specific requirements of ligand screening and biomolecular interaction studies.
[0224] CELL LYSIS
[0225] In some embodiments, the cell is optionally lysed prior step (a2) and (b2) .
[0226] In the methods of the present disclosure, cell lysis is optionally performed prior to steps (a2) or (b2) to release intracellular contents, including target biomolecule-probe conjugates or complexes, for subsequent detection. The lysis step disrupts cellular membranes while preserving the integrity and biochemical activity of the target biomolecule, enabling quantitative analysis of probe-bound species in a controlled in vitro environment.
[0227] Cell lysis may be achieved through mechanical, chemical, or enzymatic methods, or combinations thereof, tailored to the target biomolecule’s subcellular localization and stability. For membrane-bound targets (e.g., receptor tyrosine kinases) , lysis buffers comprising non-ionic detergents (e.g., Triton X-100, NP-40) or zwitterionic surfactants (e.g., CHAPS) are employed to solubilize membrane proteins while maintaining native conformations. For cytoplasmic or nuclear targets, harsher detergents (e.g., sodium deoxycholate, SDS) or sonication may be utilized. Protease and phosphatase inhibitor cocktails are routinely included to prevent post-lysis degradation or dephosphorylation of the target biomolecule.
[0228] In some embodiments, lysis is performed under non-denaturing conditions (e.g., 0.5-1%Triton X-100 in isotonic PBS, pH 7.4) to retain non-covalent interactions between the probe and target. In other embodiments, denaturing buffers (e.g., RIPA buffer with 1%SDS) are used to dissociate non-specific interactions and isolate covalently linked probe-target conjugates. The choice of lysis method is guided by the probe’s binding mechanism (covalent vs. non-covalent) and the downstream detection assay requirements. For instance, mild lysis preserves antigen-antibody binding epitopes for ELISA, while harsher conditions maximize protein solubility for immunoblotting.
[0229] Post-lysis, cellular debris is removed via centrifugation (e.g., 10,000–20,000 ×g for 10–30 min at 4℃) , and the supernatant containing solubilized probe-target complexes is subjected to click chemistry coupling with detectable molecules. Alternatively, for organelle-specific targets (e.g., mitochondrial proteins) , differential centrifugation or density gradient separation may precede lysis to enrich subcellular fractions. In live-cell imaging or flow cytometry applications, lysis may be omitted, and probe-target interactions analyzed directly in intact cells.
[0230] The timing of lysis is critical: premature lysis may disrupt probe-target binding equilibria, while delayed lysis risks probe dissociation or target degradation. Optimization parameters include lysis buffer composition, incubation time (e.g., 10–60 min at 4℃) , and mechanical disruption intensity (e.g., vortexing, pipette shearing) . A skilled artisan will adapt lysis protocols to balance target recovery, complex stability, and compatibility with subsequent detection steps.
[0231] DETECABLE MOLECULE
[0232] In the present disclosure, a detectable molecule refers to a chemical or biological entity capable of generating a measurable signal through qualitative and / or quantitative detection techniques. Suitable detectable molecules include, but are not limited to:
[0233] Chromophores and luminophores (e.g., Cy3, Cy5, TAMRA, FITC, quantum dots) for fluorescence-based detection;
[0234] Enzymatic substrates (e.g., horseradish peroxidase (HRP) , alkaline phosphatase (AP) ) for chemiluminescence or colorimetric assays;
[0235] Biotin-streptavidin systems for signal amplification via streptavidin-conjugated enzymes (HRP, AP) or fluorophores;
[0236] Metal chelates (e.g., europium (III) complexes) for time-resolved fluorescence;
[0237] Nucleic acid probes (e.g., TaqMan probes, molecular beacons) for qPCR, LAMP, or NGS-based detection;
[0238] SERS-active nanoparticles (e.g., gold or silver nanostructures) for surface-enhanced Raman spectroscopy (SERS) ;
[0239] Radioisotopes (e.g., 32P, 125I) for autoradiography or scintillation counting;
[0240] Chemical tags (e.g., digoxigenin, sulfonate labels) for immunoblotting or ELISA.
[0241] A skilled artisan will select the detectable molecule based on the target biomolecule’s properties, experimental conditions (in vitro vs. in vivo) , and the required sensitivity. For instance, fluorophores like Cy5 or quantum dots are preferred for live-cell imaging due to their photostability and biocompatibility, while HRP-conjugated streptavidin enables high-sensitivity chemiluminescent detection in high-throughput in vitro assays. For ultra-low concentration detection, SERS-active nanoparticles coupled with bioorthogonal click chemistry (e.g., tetrazine-TCO pairs) achieve single-molecule resolution, as demonstrated in digital colloid-enhanced Raman spectroscopy (dCERS) . Similarly, metal-chelating tags (e.g., nickel-NTA) facilitate immobilization of histidine-tagged proteins on solid supports for fluorescence polarization or mass spectrometric analysis.
[0242] Detection modalities are tailored to the detectable molecule’s characteristics:
[0243] Fluorescence: Flow cytometry, fluorescence microscopy, or fluorescence resonance energy transfer (FRET) for dynamic interaction studies, for example, Streptavidin labeled with fluorophores (e.g., FITC, PE, Cy5) enables fluorescence microscopy, flow cytometry, or fluorescence polarization assays;
[0244] Chemiluminescence: Microplate readers for high-throughput ligand screening, for example, Streptavidin conjugated to horseradish peroxidase (HRP) or alkaline phosphatase (AP) catalyzes luminol or CDP-Star substrates, generating measurable light signals in ELISA, Western blotting, or bead-based assays;
[0245] SERS: Portable Raman spectrometers for on-site analysis of trace biomolecules;
[0246] Mass spectrometry (MS) : MALDI-TOF or portable GC-MS for precise quantification of small molecules (e.g., volatile organic compounds) ;
[0247] Molecular techniques: qPCR, ddPCR or NGS for nucleic acid-ligand interaction profiling.
[0248] The coupling efficiency between the probe’s reporter moiety (e.g., azide, tetrazine) and the detectable molecule is optimized by adjusting reaction parameters (pH, temperature, catalyst concentration) and validated via techniques such as SDS-PAGE, fluorescence polarization, or LC-MS. This modular design ensures compatibility with diverse biological systems, enabling robust and reproducible detection across applications ranging from drug discovery to environmental monitoring.
[0249] In some embodiments, the detectable molecule is selected from the group consisting of:
[0250] fluorophores and related groups comprising non-fluorescent dye chromophores, fluorophores (e.g., cyanine dyes, xanthene derivatives) , fluorescent enzyme substrates, organic dyes (e.g., FITC, Tamra) , inorganic dyes, metal chelates (e.g., europium (III) complexes) , and quenchers;
[0251] enzyme-linked systems comprising biotin-streptavidin conjugates (e.g., horseradish peroxidase (HRP) , alkaline phosphatase (AP) ) , sulfonate labels, and enzyme substrates (e.g., luminol for chemiluminescence) ;
[0252] chemical tags comprising digoxigenin, sulfonate labels, and nickel nitrilotriacetic acid (Ni-NTA) ;
[0253] nucleic acid-based markers: DNA or RNA probes (e.g., biotinylated oligonucleotides) and nucleic acid aptamers; and
[0254] physical detection entities: surface-enhanced Raman scattering (SERS) -active nanoparticles (e.g., gold or silver nanostructures) and radioisotopes (e.g., 32P, 125I) .
[0255] In some embodiments, the detectable molecule is selected from the group consisting of digoxin, nickel NTA (nitrilotriacetic acid) , a chromophore or a luminophore including non-fluorescent dye chromophore, quencher, absorbent chromophore, fluorescent group, organic dye, inorganic dye, metal chelate, or fluorescent enzyme substrate, biotin, streptavidin conjugates including HRP, sulfonate label, fluorescent group, or metal chelate, a nucleic acid.
[0256] The detectable molecules of the present disclosure can be qualitatively and / or quantitatively detected by detection techniques known to those skilled in the art, including but not limited to ELISA, immunoblotting, immunofluorescence analysis, fluorescence analysis, fluorescence microvolume analysis technique (FMAT) , and subcellular staining, qPCR, LAMP, RPA, NGS, ddElisa, and ddPCR, chemiluminescence.
[0257] In some embodiments, the detectable molecule is selected from the group consisting of non-fluorochrome chromophores, quenchers, absorption chromophores, fluorophores, organic dyes, inorganic dyes, metal chelates, fluorescent enzyme substrates, biotin-streptavidin conjugates, nucleic acids, SERS-active nanoparticles, radioisotopes, and chemical tags (e.g., digoxigenin, sulfonate labels) .
[0258] In some embodiments, the detectable molecule is a fluorophore selected from cyanine dyes (Cy3, Cy5) , xanthene derivatives (FITC, Tamra) , coumarins, BODIPY, quantum dots, or europium (III) complexes for time-resolved fluorescence.
[0259] In some embodiments, the detectable molecule is biotin, which is coupled to streptavidin conjugates such as horseradish peroxidase (HRP) , alkaline phosphatase (AP) , fluorophores (e.g., FITC, PE) , or metal chelates (e.g., gold nanoparticles) .
[0260] In some embodiments, the detectable molecule is selected from biotin, Cy3 dye, Tamra dye, or digoxigenin.
[0261] SOLID SUPPORT
[0262] In the present disclosure, the target biomolecule probe conjugate is able to be attached and thus immobilized on the surface of the solid support for subsequent qualitative and / or quantitative detection. Therefore, the solid support of the present disclosure provides a substrate for immobilizing the target biomolecule-probe conjugate to enable precise qualitative and / or quantitative detection.
[0263] In some embodiments, the solid support comprises a solid matrix and a recognition moiety. The recognition moiety is designed to specifically interact with the target biomolecule, enabling its capture and immobilization. These interactions can be mediated by covalent or non-covalent linkages, ensuring stable binding under experimental conditions.
[0264] In some embodiments, suitable solid supports include, but are not limited to, membranes (e.g., nitrocellulose, PVDF) , glass slides, plastics (e.g., polystyrene, polypropylene) , synthetic polymers (e.g., PEG hydrogels) , Eppendorf tubes, multi-well plate surfaces, or surface plasmon resonance (SPR) chips. The choice of solid matrix depends on factors such as surface area, chemical compatibility, optical properties, and the requirements of the detection method. For instance, multi-well plates are suitable for high-throughput assays, while SPR chips are preferred for real-time monitoring of biomolecular interactions.
[0265] The support is functionalized with a recognition moiety that interacts with the target biomolecule via covalent or non-covalent linkages.
[0266] In some embodiments, the recognition moiety may comprise:
[0267] Antibodies: Protein A / G-bound antibodies targeting epitopes on the biomolecule, or chemically modified antibodies (e.g., maleimide-activated for thiol coupling, NHS ester-functionalized for amine coupling) covalently linked to the solid support;
[0268] DNA-Conjugated Probes: DNA-tagged antibodies or nucleic acid aptamers hybridized to complementary DNA strands immobilized on the support, enabling programmable and reversible binding;
[0269] Bioorthogonal Handles: Antibodies or aptamers functionalized with click chemistry-compatible groups (e.g., azide, alkyne, tetrazine) for site-specific conjugation to complementary groups (e.g., cyclooctyne, TCO) on the solid support.
[0270] In some embodiments, the recognition moiety is an antibody specific to the target biomolecule, or protein A bound to an antibody, leveraging the high specificity and affinity of antibody-antigen interactions. Alternatively, the recognition moiety can be an antibody modified with activating functional groups such as EDC / NHS, maleimide, azadibenzocyclooctyne benzocyclobutene, thiol, alkene, alkyne, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, or active esters including hydroxybenzotriazole ester. These modified antibodies can directly bind to the surface of the solid support, which is also modified with compatible activating functional groups, through covalent linkages.
[0271] In some embodiments, the antibody may be a protein antibody, a DNA-conjugated protein antibody, or a DNA-conjugated nucleic acid aptamer, providing versatility in target recognition and signal transduction.
[0272] In some embodiments, the antibody is an antibody against a member of the receptor tyrosine kinase (RTK) family, including but not limited to EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, or a variant thereof comprising at least one amino acid mutation compared to the corresponding wild-type RTK. This encompasses antibodies capable of specifically binding to these RTK proteins, allowing for the detection, quantification, or modulation of their activity. The antibodies can be monoclonal or polyclonal, and may be further engineered to optimize their binding affinity, specificity, or stability. For instance, single-chain variable fragments (scFvs) , Fab fragments, or bispecific antibodies can be employed. These antibodies may target specific domains of the RTK proteins, such as the extracellular domain, the transmembrane domain, or the intracellular kinase domain. Furthermore, these antibodies may exhibit specificity towards particular mutations within the RTK proteins, enabling the selective targeting of mutant forms over wild-type forms. This is particularly relevant in cancer research, where RTK mutations often drive tumor growth and progression.
[0273] Specifically, such antibodies may be monoclonal, polyclonal, humanized, chimeric, or bispecific, and are engineered to specifically recognize:
[0274] Extracellular domains: Epitopes within the ligand-binding region (e.g., HER2 subdomains III / IV targeted by trastuzumab) , dimerization interfaces, or glycosylation sites critical for receptor activation;
[0275] Intracellular domains: Phosphorylation sites (e.g., tyrosine residues in the kinase domain of EGFR) , autophosphorylation motifs, or regulatory regions (e.g., juxtamembrane domains) ; and
[0276] Mutant-specific epitopes: Conformational or linear epitopes unique to RTK variants, such as EGFR L858R, EGFR T790M, HER2 S310F, or HER3 E928G mutations.
[0277] Exemplary antibodies include but are not limited to
[0278] Cetuximab (anti-EGFR) , panitumumab (anti-EGFR) , or mutant-selective antibodies targeting exon 19 deletions
[0279] Trastuzumab (anti-HER2) , pertuzumab (anti-HER2 dimerization domain) , or antibodies targeting HER2 / EGFR heterodimers, and
[0280] Patritumab (anti-HER3) or antibodies blocking heregulin binding.
[0281] A skilled artisan will appreciate that the selection of the appropriate antibody depends on the specific application, considering factors such as binding affinity, specificity, and cross-reactivity. Optimization of antibody labeling, conjugation, and assay conditions is routinely performed to ensure robust and reliable results.
[0282] In summary, it should be understood that a skilled artisan will select the appropriate solid support and recognition moiety based on the specific application, considering factors such as the nature of the target biomolecule, the desired sensitivity and specificity, and the detection methodology. Optimization of surface modification, linker chemistry, and immobilization conditions is routinely performed to maximize target capture efficiency and minimize non-specific binding, ensuring robust and reliable assay performance.
[0283] QUANTITATIVE ASSAY
[0284] In the present disclosure, the quantitative assay refers to analytical techniques capable of measuring the abundance or activity of the target biomolecule-probe conjugate or complex in a system, enabling precise determination of ligand binding efficacy. These assays are performed after immobilization of the conjugate / complex on a solid support, utilizing detection modalities tailored to the specific reporter-detectable molecule pairing. The quantitative assay provides numerical values (e.g., T0 and T1) that reflect the competitive or cooperative effects of candidate ligands on probe-target interactions.
[0285] In some embodiments, the quantitative assay is selected from the group consisting of enzyme-linked immunosorbent assay (ELISA) , quantitative polymerase chain reaction (qPCR) , loop-mediated isothermal amplification (LAMP) , recombinase polymerase amplification (RPA) , next-generation sequencing (NGS) , digital droplet ELISA (ddElisa) , digital droplet PCR (ddPCR) , immunoblotting, fluorescence microvolume analysis technique (FMAT) , chemiluminescence, surface-enhanced Raman spectroscopy (SERS) , and subcellular staining. Among these, ELISA and qPCR are particularly advantageous for high-throughput screening and sensitivity across diverse target abundance levels.
[0286] ELISA-Based Quantification
[0287] ELISA is employed for medium-to-high abundance target biomolecules. The assay involves capturing the probe-labeled target via an immobilized antibody on a multi-well plate, followed by detection using enzyme-conjugated streptavidin (e.g., horseradish peroxidase (HRP) or alkaline phosphatase (AP) ) that catalyzes a chromogenic, fluorogenic, or chemiluminescent substrate. Signal intensity, measured as optical density (OD) at specific wavelengths (e.g., OD450 for HRP / TMB substrates) , correlates with the amount of probe-target conjugate. Thresholds for ligand classification are empirically determined; for example, a reduction in OD450 to ≤75%of T0 (E ≥ 25) identifies competitive ligands, while an increase to ≥ 125%of T0 (E’ ≥ 25) indicates cooperative ligands.
[0288] qPCR-Based Quantification
[0289] qPCR is utilized for targets spanning high, medium, and low abundance levels, particularly in complex biological matrices. The detectable molecule may comprise a nucleic acid tag (e.g., biotinylated DNA) coupled to the probe via click chemistry. Following immobilization, the DNA tag is amplified using sequence-specific primers, and quantification is achieved through real-time fluorescence monitoring of amplification curves (Ct values) . A Ct value increase ≥1.1×T0 suggests competitive ligand binding, while a decrease ≤0.9×T0 indicates synergistic effects. qPCR offers superior sensitivity, detecting femtogram-level targets, and is compatible with multiplexed detection using probes labeled with distinct DNA barcodes.
[0290] Additional Detection Modalities
[0291] Chemiluminescence: Enhances sensitivity in low-abundance systems by utilizing luminol or acridinium ester substrates, with signal-to-noise ratios optimized for automated plate readers.
[0292] Digital Assays (ddElisa / ddPCR) : Partition samples into nanoliter droplets to achieve absolute quantification, minimizing background interference and enabling single-molecule resolution.
[0293] Fluorescence Techniques: Include fluorescence polarization (FP) for kinetic binding studies and fluorescence resonance energy transfer (FRET) for proximity-based detection in live-cell imaging.
[0294] NGS Integration: Enables genome-wide ligand profiling by sequencing DNA tags associated with probe-target complexes, particularly useful for identifying off-target interactions.
[0295] Parameter Optimization
[0296] Critical parameters such as incubation time, temperature, and reagent concentrations (e.g., antibody coating density, probe concentration) are empirically optimized to maximize signal specificity and reproducibility. For instance, ELISA antibody coatings are titrated to achieve saturation binding, while qPCR primer concentrations are adjusted to minimize nonspecific amplification. Thresholds (E and E’ ) are validated using positive / negative controls (e.g., known inhibitors / agonists) to ensure assay robustness across biological replicates.
[0297] The quantitative assay is performed in situ within live cells, organelles, or crude lysates, preserving native biomolecule conformations and post-translational modifications. It is adaptable to high-throughput formats for large-scale ligand libraries or precision diagnostics.
[0298] The method of the present disclosure can be performed in situ in cells, in organelles, or on crude cell extracts. The screening methods of the present disclosure have the advantage of being able to operate in situ in living cells. When operated in situ in living cells, the target biomolecule maintains its structure in a physiologically active state, which can accurately reflect the true in vivo effect of the candidate ligand drug molecule.
[0299] EXAMPLES
[0300] In order that the disclosure may be more fully understood, the following examples are set forth. The examples described herein are offered to illustrate the method provided herein and are not to be construed in any way as limiting the scope of the disclosure.
[0301] The method of the present disclosure was demonstrated using the EGFR (Epidermal Growth Factor Receptor) protein as an example. EGFR is a receptor tyrosine kinase located on the cell membrane and is an important cell surface receptor involved in regulating biological processes such as cell growth, proliferation, and differentiation. EGFR overexpression or mutation has been found in various cancers, such as non-small cell lung cancer, colorectal cancer, breast cancer, etc. These abnormally expressed or mutated EGFRs can lead to abnormal signal transduction, promoting the proliferation and survival of tumor cells. Therefore, EGFR has become one of the most important and attractive clinical and scientific targets in most cancer treatments. The discovery of EGFR active ligands and the development of their small molecule drugs are the mainstream routes to current EGFR-targeted therapy.
[0302] Example 1. Synthesis, Evaluation, and Experimental Condition Screening of Probes LA1560-P01, LA1560-MP01, and LA1562-P01
[0303] During the early development of the screening platform of the present invention, we designed and synthesized three potential probe molecules targeting the EGFR protein: LA1560-P01, LA1560-MP01, and LA1562-P01. By measuring the EC50 values of each labeled probe, their impact on antigen-probe binding, and competition between the parent scaffold and the probes, optimal labeling strategies and working conditions were identified.
[0304] Synthesis of LA1560-P01, LA1560-MP01, LA1562-P01 Probe Molecule and Preparation of Working Solution
[0305] To achieve specific labeling of EGFR protein in live-cell systems and enable subsequent high-throughput screening, we designed and synthesized four candidate probes (FIG. 4a-b) based on existing small-molecule inhibitor scaffolds and photoactivation / covalent binding strategies:
[0306] LA1560-P01: Derived from the reversible EGFR inhibitor drug Gefitinib, this probe incorporates a photosensitive group (activated under UV irradiation) and an alkynyl handle for downstream click chemistry labeling.
[0307] LA1560-M0 (50.00 mg, 0.16 mmol, 1.00 eq. ) was added into an 8 mL vial and dissolved in N, N-methylformamide (0.50 ml) , potassium carbonate (33.00 mg, 0.23 mmol, 1.50 eq. ) was added at room temperature and the reaction was carried out at a constant temperature for 0.5 h, and then 3- (3-alkyn-1-butyl) -3- (2-ethanesulfonyloxyethyl) -3H-diaziridine (40.00 mg, 0.17 mmol, 1.10 eq. ) was added and the reaction was carried out at a constant temperature overnight. One drop of the reaction solution was extracted with water and EA and then spotted on a plate. The developing agent was PE: EA = 1: 1, sm Rf = 0.4, RRf = 0.6. When the raw material was basically reacted, the reaction was stopped. The reaction solution was extracted with EA 3 times and then washed with saturated brine twice. The EA phase was dried over anhydrous sodium sulfate, filtered, and spin-dried. The crude product was separated with a silica gel plate and then 1 After dissolving in 100 mL DMF, the product was passed through a reverse column (0.05%FA water / ACN, 40 mL / min, 20-80 gradient, 20 min) , and LA1560-P01 (25.70 mg, 37%yield) was obtained after rotary evaporation and freeze-drying.
[0308] 1H NMR (500 MHz, DMSO-d6) δ 9.55 (s, 1H) , 8.44 (s, 1H) , 8.08 –8.03 (m, 1H) , 7.75 –7.69 (m, 2H) , 7.38 (t, J = 9.1 Hz, 1H) , 7.15 (s, 1H) , 3.94 (t, J = 6.1 Hz, 2H) , 3.89 (s, 3H) , 2.77 (t, J = 2.7 Hz, 1H) , 2.07 –1.99 (m, 2H) , 1.93 (t, J = 6.1 Hz, 2H) , 1.67 (t, J = 7.5 Hz, 2H) .
[0309] MS (m / z) : MW calc’ d for ( [M+H] +) : C22H19ClFN5O2: 439.87, found: 439.1211.
[0310] LA1560-MP01:
[0311] LA1560-M0 (15.00 mg, 0.05 mmol, 1.00 eq. ) was placed in an 8 mL vial and dissolved in DMF (0.50 mL) . At room temperature, K2CO3 (13.20 mg, 0.09 mmol, 2.00 eq., 99%purity) and (3- (but-3-yn-1-yl) -3H-diazirin-3-yl) methyl ethanesulfonate (15.50 mg, 0.07 mmol, 1.50 eq. ) were added. The mixture was heated to 50℃ and stirred overnight, with the reaction progress monitored by LC–MS. After completion, the crude product was dissolved in 1.00 mL of DMF and purified by preparative HPLC, yielding LA1560-MP01 (3.66 mg, 18%yield) .
[0312] 1H NMR (500 MHz, DMSO-d6 ) δ 9.50 (s, 1H) , 8.52 (s, 1H) , 8.21 (s, 1H) , 8.14 –8.09 (m, 1H) , 7.80 –7.75 (m, 2H) , 7.45 (t, J = 9.1 Hz, 1H) , 7.23 (s, 1H) , 4.13 (s, 2H) , 3.96 (s, 3H) , 2.88 (t, J = 2.7 Hz, 1H) , 2.19 –2.14 (m, 2H) , 1.82 (t, J = 7.3 Hz, 2H) .
[0313] MS (m / z) : MW calc’ d for ( [M+H] +) : C21H17ClFN5O2: 425.84, found: 425.1055.
[0314] LA1562-P01: Based on the irreversible inhibitor Afatinib, this probe introduces an alkynyl group and a crosslinkable moiety to enhance covalent binding capability.
[0315] Trans-4-dimethylaminocroton hydrochloride (35.50 mg, 0.21 mmol, 1.50 eq., 98 %) was added into an 8 mL vial and dissolved in tetrahydrofuran (1.00 ml) . Oxalyl chloride (28.80 mg, 0.22 mmol, 1.60 eq., 98 %) and an appropriate amount of DMF were added at 0℃ and the reaction was carried out at a constant temperature for 1 h. LA1562-1-M0-P01 (60.00 mg, 0.14 mmol, 1.00 eq. ) was dissolved in N-methylpyrrolidone (1.00 ml) and then added to the above reaction solution. The reaction was carried out at constant temperature for 3 h. The reaction was monitored by LCMS and the product was generated. The product was extracted with EA for 3 times, and then washed with saturated brine for 2 times. The EA phase was dried over anhydrous sodium sulfate, filtered, and dried by rotary evaporation. After being dissolved with 1 mL DMF, the product was passed through a reverse column (0.05%FA water / ACN, 40 mL / min, 5-95 gradient, 20 min) to obtain LA1562-P01 (33.50 mg, 44%yield) .
[0316] 1H NMR (500 MHz, DMSO-d6 ) δ 9.83 (s, 1H) , 9.44 (s, 1H) , 8.91 (s, 1H) , 8.54 (s, 1H) , 8.16 –8.11 (m, 1H) , 7.84 –7.77 (m, 1H) , 7.43 (t, J = 9.1 Hz, 1H) , 7.28 (s, 1H) , 6.86 –6.77 (m, 1H) , 6.52 (d, J = 15.4 Hz, 1H) , 4.13 (t, J = 6.1 Hz, 2H) , 3.12 –3.07 (m, 2H) , 2.83 (t, J = 2.6 Hz, 1H) , 2.19 (s, 6H) , 2.08 –2.01 (m, 2H) , 1.97 (t, J = 6.1 Hz, 2H) , 1.71 (t, J = 7.4 Hz, 2H) .
[0317] MS (m / z) : MW calc’ d for ( [M+H] +) : C27H27ClFN7O2: 536.00, found: 535.1899
[0318] LA1562-C01: Shares the same parent scaffold as LA1562-P01 but features reduced photosensitive group reactivity.
[0319] Trans-4-dimethylaminocroton hydrochloride (41.60 mg, 0.25 mmol, 2.00 eq. 98 %) was into an 8 ml vial and dissolved in tetrahydrofuran (1.00 ml) . Oxalyl chloride (31.10 mg, 0.25mmol, 2.00 eq. 98%) and an appropriate amount of DMF were added at 0℃ and the reaction was carried out at for 1 h, LA1562-1-M0-C01 (N4- (3-chloro-4-fluorophenyl) -7- (hept-6-yn-1-yloxy) quinazoline-4, 6-diamine) (50.00 mg, 0.12 mmol, 1.00 eq. ) was dissolved in N-methylpyrrolidone (1.00 ml) and added to the above reaction solution. The reaction was carried out at constant temperature for 3 h. The reaction was monitored by LCMS and a product was generated. The product was extracted with EA for 3 times, and then washed with saturated brine for 2 times. The EA phase was dried over anhydrous sodium sulfate, filtered. and dried by rotary evaporation. The crude product was separated with a silica gel plate, and then dissolved with 1 mL DMF and passed through a reverse column (0.05%FA water / ACN, 40 mL / min, 5-95 gradient, 20 min) to obtain LA1562-C01 (E) -N- (4- ( (3-chloro-4-fluorophenyl) amino) -7- (hept-6-yn-1-yloxy) quinazolin-6-yl) -4- (dimethylamino) but-2-enamide (1.13 mg, 2%yield) .
[0320] 1H NMR (500 MHz, DMSO-d6 ) δ 9.80 (s, 1H) , 9.50 (s, 1H) , 8.87 (s, 1H) , 8.52 (s, 1H) , 8.15 –8.09 (m, 1H) , 7.82 –7.76 (m, 1H) , 7.42 (t, J = 9.1 Hz, 1H) , 7.27 (s, 1H) , 6.82 –6.75 (m, 1H) , 6.54 (d, J = 15.5 Hz, 1H) , 4.21 (t, J = 6.5 Hz, 2H) , 3.08 (d, J = 6.1 Hz, 2H) , 2.75 –2.72 (m, 1H) , 2.20 –2.16 (m, 8H) , 1.88 –1.82 (m, 2H) , 1.56 –1.52 (m, 4H) .
[0321] MS (m / z) : MW calc’ d for ( [M+H] +) : C27H29ClFN5O2: 510.00, found: 509.1994.
[0322] LA1562-1-M0-C01:
[0323] LA1562-1-M0 (6-amino-4- ( (3-chloro-4-fluorophenyl) amino) quinazolin-7-ol) (50.00mg, 0.16mmol, 1.00eq. ) was into an 8 mL vial and dissolved in DMF (1.00 mL) . Potassium carbonate (45.50mg, 0.33mmol, 2.00eq., 99%) and 7-ethanesulfonyloxyheptylene (40.20mg, 0.20mmol, 1.20eq. ) were added at room temperature. The reaction was heated to 50℃ and carried out at constant temperature overnight. The reaction was monitored by LCMS and a product was generated. The product was extracted with EA for 3 times, and then washed with saturated brine for 2 times. The EA phase was dried over anhydrous sodium sulfate, filtered. and dried by rotary evaporation. The crude product was separated with a silica gel plate (PE: EA=1: 1) to obtain
[0324] LA1562-1-M0-C01 (N4- (3-chloro-4-fluorophenyl) -7- (hept-6-yn-1-yloxy) quinazoline-4, 6-diamine) (50.00mg, 76%yield)
[0325] LA1562-1-M0:
[0326] N4- (3-chloro-4-fluorophenyl) -7-methoxyquinazoline-4, 6-diamine (400.10mg, 1.25mmol, 1.00eq. ) was into 40 mL vial and dissolved in DCM (5.00 mL) . BBr3 (8.80ml, 8.78mmol, 7.00eq. ) was added dropwise at 0℃, after stirring evenly, the reaction was heated to 50℃ and carried out at this constant temperature overnight. The reaction was monitored by TLC (DCM / Me=10: 1) and a new point with increased polarity was generated at Rf=0.6. Saturated sodium bicarbonate aqueous solution added to adjust pH to weaken alkalinity, then the product was extracted with EA for 3 times, and then washed with saturated brine for 2 times. The EA phase was dried over anhydrous sodium sulfate, filtered. and dried by rotary evaporation. The crude product was separated with a silica gel plate (EA=100%) to obtain
[0327] LA1562-1-M0 (6-amino-4- ( (3-chloro-4-fluorophenyl) amino) quinazolin-7-ol) (250.00mg, 65 %yield)
[0328] Probes were dissolved in DMSO (Solarbio Cat. No. D8371) and diluted into DMEM medium (Corning Cat. No. 10-013-CV) to prepare working solutions. All probes were synthesized using methods detailed in the chemical synthesis section of the specification. Purity (>95%) and molecular weight consistency with theoretical values were confirmed by HPLC, MS, and NMR.
[0329] Preparation of Solid Support (ELISA Plate) for Conjugate Detection
[0330] Protein A (Sangon Biotech, Cat. No. C610039) was dissolved in ddH2O to 5 mg / mL, then diluted to 30 ng / μL with 1× coating buffer (Sangon Biotech, Cat. No. E661004; diluted with H2O to 1×) . 50 μL of the diluted Protein A was added to each well of the ELISA plate (Sangon Biotech, Cat. No. F605031) , incubated at room temperature for 2 hrs, then the liquid in the wells was discarded, and washed twice with 1× coating buffer. 200 μL of blocking buffer (Thermo Cat. No. 37580) was then added to each well, incubated at room temperature for 1 hr, and washed three times with PBST (1×PBS+0.5%Tween 20) . The recognition component of the ELISA plate was EGFR rabbit monoclonal antibody (Beyotime Cat. No. AG1810) , diluted to 5 ng / μL with blocking buffer, 100 μL of the diluted antibody was added to each well, and incubated at room temperature for 1 h. After incubation, the liquid in the wells was discarded, and washed three times with PBST. 300 μL of PBST was added to each well of the washed ELISA plate, covered with a sealing film (Shengong, Cat. No. F600418) , and stored at 4℃ for later use.
[0331] Preparation of Cell Samples
[0332] A-431 cell line was cultured until 90%confluence, the culture medium was aspirated, and washed twice with 1×PBS (Corning Cat. No. 21-040-CV) . After discarding the washing solution, 90 μL of 1μM drug working solution was added to the cell culture plate, incubated in a cell culture incubator at 37℃ for 1 h, then 10 μL of probe working solution was added to each well (to make the final concentration of the probe 1 μM, the negative control group added only the probe and no drug working solution added) , shaken to mix, and incubated in the cell culture incubator for another 1 h, allowing the probe-protein conjugate to fully form within the living cells, under UV irradiation (optional) .
[0333] Cell Lysis
[0334] After incubation, the culture medium in the cell culture plate was aspirated, washed twice with pre-cooled 1×PBS washing solution, and 50 μL of pre-cooled cell lysis buffer (0.25 g SDS, Diamond Cat. No. A100227; 500 μL TritonX-100, Solarbio Cat. No. IT9100; 500 μL protease inhibitor, MeilunBio Cat. No. MB2678; diluted to 50 mL with 1×PBS) was added to each well. The cells were left at 4℃ for 30 min to fully lyse, releasing the probe-protein conjugates.
[0335] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0336] 1.35 μL of click reagent (3.4 mM TBTA, Sigma, Cat. No. 678937, dissolved in DMSO; 200 mM CuSO4, Sigma Cat. No. 908940, dissolved in H2O; 200 mM TCEP, Sigma Cat. No. C4706, dissolved in H2O; 50 mM Biotin-PEG3-Azide, Clickchemistrytools Cat. No. AZ104, dissolved in DMSO; components mixed in a volume ratio of 3: 1: 1: 0.4) was added to each well of the lysed cells, and incubated with shaking for 2 h (25℃, 1350 rpm) using a constant temperature shaker (Shuoguang, CF2970M model) . This allowed the functional molecule (alkyne handle) of the probe-protein conjugate to couple with the detectable molecule (biotin) azide group, forming a detectable conjugate.
[0337] Detection of Probe-Protein Conjugates
[0338] The ELISA plate stored at 4℃ was placed at room temperature for 15 min to return to room temperature, then the liquid in the wells was discarded. 50 μL of cell lysate after click coupling was added to each well and incubated at room temperature for 1 h. After incubation, the liquid in the wells was discarded, and the wells were washed 5 times with PBST. 100 μL of HRP-labeled streptavidin (Sangon Biotech, Cat. No. D111054) diluted 1000 times with PBST was added to each well, incubated at room temperature for 30 min, then washed 5 times with PBST and the washing liquid was discarded. The wells were developed using ELISA developing solution (Sangon Biotech, Cat. No. E661007) following the instructions provided, mixing developing solutions A and B in a 1: 1 ratio, adding 100 μL of the mixed developing solution to each well, incubating at room temperature in the dark for 15 min, then immediately adding 100 μL of stop solution (Sangon Biotech, Cat. No. E661006) to each well. The absorbance was measured immediately at 450 nm wavelength using an ELISA reader (Thermo Muliiskan FC model) .
[0339] EC50 Determination of LA1560-P01, LA1560-MP01, and LA1562-P01 Probes for EGFR Labeling
[0340] A431 cells were seeded in 96-well plates at 2×104 cells / well (100 μL / well of DMEM + 10%FBS) and cultured overnight (37℃, 5%CO2) . The next day, the medium was replaced with probe-containing medium. Probe concentrations were set in a gradient: 10,000, 5,000, 2,000, 1,000, 500, 250, 125, 62.5 nM (with a blank control group containing no probe) , with 3–5 replicates per concentration. Cells were incubated for 1 h (37℃, 5%CO2) . For probes with photosensitive groups (LA1562-P01, LA1560-P01, LA1560-MP01) , UV irradiation (254 nm, 10 min) was applied at 4℃ post-incubation. (FIG. 4c)
[0341] Impact of Probe Labeling on Antigen-Antibody Binding
[0342] Two protein samples were prepared: Unlabeled protein (Fully unmodified) , Probe-bound protein (Fully labeled with probes) . Both samples were matched for concentration and purity to eliminate non-labeling variables. A series of mixed protein solutions (0%, 20%, 40%, 60%, 80%, 100%labeled protein) were prepared by combining aliquots from labeled and unlabeled stocks. Each mixture was diluted to a working concentration compatible with ELISA well capacity and expected OD ranges, followed by ELISA detection.
[0343] IC50 Curves of Parent Scaffold Drugs (Afatinib, Gefitinib) for Signal Inhibition
[0344] Parent drugs (Afatinib, Gefitinib) were prepared at final concentrations of 100,000, 30,000, 10,000, 1,000, 100, 10, 1 nM in cell culture medium. Cells were co-incubated with drugs for 1 h, followed by addition of fixed probe concentrations (1 μM LA1560-P01, 5 μM LA1560-MP01, 5 μM LA1562-P01) and another 1 h incubation. For probes requiring UV / laser activation, irradiation was applied post-treatment. Cells were lysed to release intracellular contents. Click chemistry was used to introduce labels, and ELISA measured probe signal changes.
[0345] Incubation Time Optimization for LA1560-P01, LA1560-MP01, LA1562-P01 Probes
[0346] A431 cells (high EGFR expression) were cultured overnight in 96-well plates and treated with fixed probe concentrations (1 μM LA1560-P01, 5 μM LA1560-MP01, 5 μM LA1562-P01) . Incubation was terminated at 0, 20, 40, 60, 90, 120 min. Samples were lysed, subjected to click chemistry, and analyzed via EGFR antibody-coated ELISA plates (OD450 measurement) . The time point with maximal OD450 indicated equilibrium or optimal labeling efficiency.
[0347] Effect of UV Irradiation on LA1562-P01 Probe Labeling Efficiency
[0348] A431 cells were prepared as in Experiment 1. LA1562-P01 probe was tested at concentrations of 64,000, 32,000, 16,000, 8,000, 4,000, 2,000, 1,000, 500, 250, 125, 65.5, 0.1 nM.LA1562-P01 samples were divided into two groups. Post-1 h incubation, one group underwent UV irradiation (10 min) . Cells were lysed, labeled via click chemistry, and analyzed by ELISA. OD450 values from UV-treated and control groups were compared to assess UV-induced labeling enhancement.
[0349] The results are shown in FIG. 4 to FIG. 6.
[0350] By comparing the EC50 curves of different probes, the optimal effective concentrations for each probe were determined, with specific concentrations varying depending on the probe. The accuracy of probe-target labeling was validated through competition with the original positive drug, which suppressed the probe signal, confirming the specificity of the labeling. The incubation time was optimized to ensure sufficient antibody binding while avoiding non-specific interactions. To ensure experimental consistency and reproducibility, the antibody coating amount was meticulously standardized. Additionally, incubation conditions such as temperature and duration were precisely adjusted to enhance reaction efficiency and reduce background noise. The impact of UV irradiation on probe labeling efficiency was evaluated to identify and avoid potential interference factors during experimental operations. Finally, AlphaFold3 was utilized to predict structural similarities between the probes and their parent drugs, providing support for the rational design of the probes.
[0351] The optimal concentrations were determined as 1 μM for LA1560-P01, 5 μM for LA1560-MP01, and 5 μM for LA1562-P01 (FIG. 4c) . The proportion of antibody-labeled proteins exhibited a linear positive correlation with detection signals, indicating that the antibody showed no significant preference for capturing labeled versus unlabeled proteins and that probe labeling did not interfere with antibody-mediated protein capture (FIG. 5a) . Furthermore, the parent drug effectively suppressed the probe signal, confirming the accuracy of probe-target labeling (FIG. 5b) .
[0352] FIG. 6 demonstrates that a probe incubation time of 1 hour is optimal (FIGs. 6a to 6c) . For LA1562-P01, a covalent probe, UV crosslinking had minimal impact on its labeling efficiency. Furthermore, LA1562-C01 demonstrated lower labeling efficiency compared to LA1562-P01 (FIG. 6d) .
[0353] Therefore, the present invention adopts LA1562-P01 as the core probe in subsequent embodiments for the screening platform targeting EGFR and its homologous proteins. The remaining probes underperformed in various metrics of this screening (specificity, sensitivity, and operational convenience) and may server as alternatives / comparative references.
[0354] Example 2. EGFR Ligand Screening Based on ELISA Method
[0355] The following example used the EGFR protein as the target biomolecule, using the platform technology of the present disclosure, to screen out binding ligands for the EGFR protein from 67 test candidate ligands:
[0356] Specifically, A431 cells (human epidermal cancer cell line, highly expressing EGFR protein) and Hela cells (human epidermal cancer cell line, low expressing EGFR protein) were used as the site for preparing the protein-probe conjugate. LA1560-P01, LA1560-MP01, LA1562-P01 probes (EGFR specific) were used to form a protein-probe conjugate with the EGFR protein. In the presence of candidate ligand molecules interfering with the formation of the P01 probe and EGFR conjugate, ELISA method was used for quantitative detection of the conjugate. By comparing the signal strength, the candidate ligand molecules were screened for their affinity to EGFR protein, ultimately screening out ligands for EGFR protein.
[0357] Synthesis of P01 Probe Molecule and Preparation of Working Solution
[0358] Same as in Example 1.
[0359] Preparation of Candidate Drug Solutions
[0360] Candidate drugs LA-1~LA-67 (Table 2) were dissolved in DMSO, and diluted to 100 μM stock solution, then diluted to 1 μM working solution in DMEM medium when used.
[0361] Table 2. Candidate drugs LA-1~LA-67
[0362] Preparation of Solid Support (ELISA Plate) for Conjugate Detection
[0363] Same as in Example 1.
[0364] Preparation of Cell Samples
[0365] Same as in Example 1.
[0366] Cell Lysis
[0367] Same as in Example 1.
[0368] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0369] Same as in Example 1.
[0370] Detection of Probe-Protein Conjugates
[0371] Same as in Example 1.
[0372] IC50 Curves of Known Inhibitors Not Initially Selected by the EGFR Platform (Inhibition Rate <25%)
[0373] Known inhibitors (LA-8, LA-14, LLA-23, LA-25, LA-36, LA-42, LA-50, LA-60, LA-65) that were not initially selected by the EGFR platform were prepared at concentrations of 10, 100, 300, 1000, 3000, 10000, and 100000 nM, respectively. Following the aforementioned protocol, cells were incubated with these compounds for 1 h, followed by a 1 h incubation with the LA1562-P01 probe. IC50 assays were performed to evaluate whether increased drug concentrations could suppress the probe signal.
[0374] WB Validation of EGFR Phosphorylation Inhibition for Drugs with Abnormal Screening Results or Detectable by the EGFR Platform
[0375] Non-covalent drugs with lower affinity (LA-8, LA-42, LA-50) , which failed screening even at elevated doses, and covalent drugs with higher affinity (LA-27, LA-31, LA-63) , which were effectively screened by the platform, were selected for EGFR phosphorylation inhibition assays via Western blot (WB) . This aimed to validate the platform’s feasibility and assess whether screening outcomes correlate with drug affinity. After cell digestion and counting, 3×10^5 cells per well were seeded in 1 mL medium. Cells were washed twice with 1 mL PBS, serum-starved for 24 h in 0.9 mL medium (1%FBS-DMEM) , then treated with 100 μL drug solution (1%DMSO) . A 500 nM EGF stock (10%DMSO) was prepared, and 100 μL was added to each well (final EGF concentration: 50 nM) . Cells were incubated for 30 min.
[0376] For EGF preparation: 50 μM EGF (DMSO) : 1 μL (10 mM) + 199 μL DMSO; 500 nM EGF (10%DMSO-DMEM) : 30 μL (50 μM) + 270 μL DMSO + 2700 μL DMEM. Cells were washed twice with ice-cold PBS, lysed with 100 μL RIPA buffer at 4℃ for 30 min, scraped from 12-well plates, and transferred to EP tubes. Lysates were diluted 15-fold and 30-fold for protein quantification. After adjusting protein concentration to 1.5 mg / mL with 5X loading buffer, samples were heated at 95℃ for 10-15 min. WB analysis: 30 μg protein (20 μL sample) per lane; p-EGFR (Tyr1086) primary antibody dilution: 1: 1000. (FIG. 12)
[0377] The results are shown in FIG. 7 to FIG. 12.
[0378] Experimental results demonstrated that the platform effectively screened both known EGFR-active drugs and novel potential compounds across EGFR-high-expressing and low-expressing cell lines. For instance, in the high-expression A431 cell line, the LA1562-P01 probe identified 23 positive ligands, including 20 previously reported EGFR-active drugs and 3 novel EGFR-related compounds. In the low-expression HeLa cells, the same probe detected 18 positive ligands, comprising 17 known drugs and 1 new compound. These findings highlight the platform’s high screening efficiency and robust adaptability. Further validation via phosphorylation Western blot (WB) assays confirmed the inhibitory effects of the screened compounds on EGFR phosphorylation activity. Additionally, for known inhibitors not initially detected by the platform, increasing drug concentrations partially restored their expected inhibitory activity, suggesting that their inactivity at lower doses might result from insufficient concentration. In conclusion, the platform reliably identifies both established and novel EGFR inhibitors while delivering stable and accurate outcomes across diverse cell lines. These attributes underscore its high potential for application in future drug development and biological research. Key findings are summarized as follows:
[0379] Using the wt-EGFR-high-expressing cell line (A431 cells) and the LA1562-P01 probe, the EGFR ligand screening platform was validated for both positive and negative controls. A total of 23 positive ligands were identified, including 20 previously reported EGFR-active drugs and 3 unreported compounds unrelated to EGFR in existing literature. The hit rate for known active drugs reached 74%, with successful identification of both covalent and non-covalent drugs (FIG. 7) .
[0380] The EGFR ligand screening platform was further validated in the wt-EGFR-low-expressing cell line (HeLa cells) using the LA1562-P01 probe. A total of 18 positive ligands were identified, comprising 17 previously reported EGFR-active drugs and 1 unreported compound with no prior EGFR association in the literature. The hit rate for known active drugs was 63%, with both covalent and non-covalent agents successfully detected. Screening outcomes in high-expression (A431) and low-expression (HeLa) cell lines exhibited comparable patterns, demonstrating the platform’s accuracy and stability across varying EGFR expression levels (FIG. 8) .
[0381] The EGFR ligand screening platform was validated using the wt-EGFR-high-expressing cell line (A431 cells) with the LA1560-P01 probe. A total of 21 positive ligands were identified, including 19 previously reported EGFR-active drugs and 2 unreported compounds with no documented EGFR association. The hit rate for known active drugs was 70%, with both covalent and non-covalent agents successfully detected. Consistent screening outcomes across different probes targeting the same receptor (e.g., LA1560-P01 vs. LA1560-MP01) further demonstrated the platform’s accuracy and stability (FIG. 9) .
[0382] Subsequent validation with the LA1560-MP01 probe under the same conditions identified 29 positive ligands, comprising 19 known EGFR-active drugs and 9 unreported compounds lacking prior EGFR-related evidence. The hit rate for known agents decreased to 65%, though both covalent and non-covalent drugs remained detectable. When the screening concentration was increased, 6 out of 9 previously undetected known inhibitors were successfully identified, indicating their initial omission was due to suboptimal effective concentrations. However, three compounds (LA-8, LA-42, LA-50) remained undetected even at elevated concentrations, necessitating further validation (FIG. 10) .
[0383] When the drug screening concentration was increased, 6 out of the 9 previously undetected known inhibitors were successfully identified, indicating that their initial omission was due to suboptimal effective concentrations. However, three compounds (LA-8, LA-42, LA-50) remained undetected even at elevated concentrations, necessitating further investigation (FIG. 11) .
[0384] Phosphorylation assays for LA-8, LA-42, LA-50, LA-27, LA-31, and LA-63 revealed that all six inhibitors exhibited concentration-dependent suppression of EGFR phosphorylation activity (FIG. 12) . Further analysis suggested that the failure of the platform to detect LA-8, LA-42, and LA-50 may be attributed to their non-covalent binding mechanism, whereas the LA1562-P01 probe is a covalent agent with higher EGFR affinity compared to non-covalent drugs. Additionally, these three compounds exhibited micromolar-range IC50 values, indicating weaker activity relative to other screened agents. Consequently, their inability to compete with the covalent probe for EGFR binding aligns with mechanistic expectations.
[0385] Example 3: Validation of Agonist EGF Detection
[0386] In previous examples, the method was primarily demonstrated using inhibitors competing with the probe-protein binding signal to identify molecules blocking protein activity. However, clinically and experimentally relevant compounds also include agonists or activators that enhance protein activity. These agents may strengthen probe-target binding by modulating protein conformation, stabilizing active pockets, or promoting dimerization. To validate the versatility of our screening platform, we selected epidermal growth factor (EGF) (HY-101450, CAS No.: 1035638-91-5) , a known agonist of wild-type EGFR (wt-EGFR) , and small molecules with potential activating effects (e.g., methylene blue) to assess their impact on probe signals. If a compound induces or stabilizes the activated protein state, the amount of probe-bound target protein would increase, leading to elevated detection signals compared to probe-only controls.
[0387] Cell Sample Preparation for EGF Agonist Testing with LA1562-P01 Probe
[0388] A431 cells were labeled with 1 μM LA1562-P01. EGF, a wt-EGFR agonist, was tested at concentrations of 10,000, 1,000, 100, 10, 1, and 0.1 nM. Cells were incubated with EGF for 1 h at 37℃, followed by a 1 h incubation with the probe.
[0389] Cell Sample Preparation for Methylene Blue Testing with LA1562-P01 Probe
[0390] Similarly, A431 cells labeled with 1 μM LA1562-P01 were treated with methylene blue (CAS No.: 61-73-4) at concentrations of 100, 60, 30, 10, 1, and 0.1 nM. Cells were incubated with methylene blue for 1 h at 37℃ prior to probe addition.
[0391] Cell Lysis
[0392] Same as in Example 1.
[0393] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0394] Same as in Example 1.
[0395] Detection of Probe-Protein Conjugates
[0396] Same as in Example 1.
[0397] Western Blot Validation of Methylene Blue-Induced EGFR Phosphorylation
[0398] Methylene blue was selected as the test compound, with LA1562-P01 as the probe. All other experimental procedures followed the protocol described in Example 2 (refer to FIG. 13 for methodological details) .
[0399] The results are shown in FIG. 13.
[0400] The agonist screening experiment demonstrates that the "probe-protein binding detection" method described in this invention is not only applicable to identifying competitive inhibitory ligands but also capable of screening compounds that enhance protein activity. In live-cell assays, the observed signal elevation further validates the platform's broad utility for compounds with diverse mechanisms of action (inhibition or activation) . Key findings are summarized as follows:
[0401] Experimental results revealed increased optical density (OD) values for both EGF and high-concentration methylene blue groups (FIGs. 13a-c) , with western blot (WB) confirming elevated phosphorylated EGFR (pEGFR) levels (FIG. 13d) . Minor signal fluctuations in low-concentration EGF groups (<10 nM) may be associated with ATP-dependent phosphorylation processes. These data collectively demonstrate the platform's ability to detect probe-binding amplification (i.e., signal upregulation) induced by agonists / activators, thereby expanding conventional screening paradigms limited to inhibitor detection.
[0402] Example 4: Screening for Mutation-Selective EGFR Ligands
[0403] This example further demonstrates the capability of the proposed method to screen ligands selectively targeting mutant EGFR variants. Clinically relevant EGFR mutations (e.g., L858R activation mutation and T790M resistance mutation) alter drug sensitivity, and developing selective inhibitors against these mutations represents a critical focus in anticancer research. To validate the platform's ability to differentiate ligand selectivity between wild-type and mutant EGFR, we utilized H1975 cells (ahuman non-small cell lung cancer cell line harboring both L858R and T790M mutations) as the mutant EGFR model and A431 cells (overexpressing wild-type EGFR) as the control. A novel probe (e.g., MP01 or LA1607-Y8) was designed to specifically target mutant EGFR. Its binding moiety was derived from known selective inhibitors (e.g., third-generation EGFR inhibitors such as osimertinib or nintedanib maleate) , enabling preferential interaction with T790M / L858R-mutated EGFR. The probe was functionalized with a photo-crosslinking group and a labeling moiety to ensure covalent tagging of mutant EGFR in live cells. Parallel screening assays were conducted in both H1975 (mutant EGFR) and A431 (wild-type EGFR) cell lines. Candidate drug selectivity was determined by comparing the probe signal inhibition rates between the two models. As anticipated, established mutant-targeting agents (e.g., osimertinib) demonstrated potent competitive effects on probe binding in H1975 cells while showing minimal activity in A431 cells. Conversely, wild-type-preferring inhibitors exhibited the opposite pattern. This differential discrimination validates the platform's capability to differentiate mutation-selective ligands, highlighting its utility in precision oncology drug discovery.
[0404] Synthesis of LA1607-Y8 Probe Molecule and Preparation of Working Solution
[0405] LA1607-Y8 is an activity-based probe derived from the third-generation EGFR inhibitor Mavelertinib (labeled as Inhibitor 3 in the figure) . It retains the core scaffold of Mavelertinib responsible for selective binding to mutant EGFR (T790M / L858R) , while incorporating an alkyne handle at terminal or side chain positions to enable downstream modifications via click chemistry or other bioorthogonal reactions. Structural confirmation protocols followed those described in Example 1.
[0406] LA1607-Y7:
[0407] LA1607-Y8:
[0408] LA1607-Y7 (50.00 mg, 0.09 mmol, 1.00 eq. ) was dissolved in tetrahydrofuran (1.00 ml) , potassium tert-butoxide (21.00 mg, 0.18 mmol, 2.00 eq. ) and dimethyl sulfoxide (0.50 ml) were added, and the reaction was carried out at room temperature for 1 h. Potassium tert-butoxide (2.63 mg, 0.02 mmol, 0.25 eq. ) was then added, and the reaction was carried out at room temperature for 1 h. The reaction was completed after confirmed by LCMS monitoring. THF was dried by rotary evaporation, and water and EA were added for extraction. The EA extraction was repeated three times. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phase was dried by rotary evaporation and sent to preparation (FA / ACN) to obtain a light yellow solid product LA1607-Y8 (3.91 mg, 9%yield) .
[0409] 1H NMR (500 MHz, DMSO-d6 ) δ 8.49 (d, J = 6.6 Hz, 1H) , 8.07 (s, 1H) , 7.95 (s, 1H) , 7.80 (s, 1H) , 6.26 –6.19 (m, 1H) , 6.17 –6.11 (m, 1H) , 5.65 –5.60 (m, 1H) , 5.19 –5.06 (m, 1H) , 4.48 –4.43 (m, 1H) , 4.10 (t, J = 6.8 Hz, 2H) , 3.86 –3.78 (m, 6H) , 3.67 (d, J = 12.0 Hz, 1H) , 3.61 (s, 3H) , 2.87 (s, 1H) , 2.65 –2.62 (m, 2H) .
[0410] MS (m / z) : MW calc’ d for ( [M+H] +) : C21H24ClFN9O2: 453.47, found: 453.2037.
[0411] Preparation of Candidate Drug Solutions
[0412] Candidate drugs LB-1~LB-7 (Table 3) were dissolved in DMSO, and diluted to 100 μM stock solution, then diluted to 1 μM working solution in DMEM medium when used.
[0413] Table 3 Candidate drugs LB-1~LB-7
[0414] Preparation of Solid Support (ELISA Plate) for Conjugate Detection
[0415] Same as in Example 1.
[0416] Preparation of Cell Samples
[0417] The experiment utilized the H1975 cell line with high expression of T790M / L858R-EGFR. All other experimental procedures followed those described in Example 1.
[0418] Cell Lysis
[0419] Same as in Example 1.
[0420] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0421] Same as in Example 1.
[0422] Detection of Probe-Protein Conjugates
[0423] Same as in Example 1.
[0424] Determination of EC50 for LA1607-Y8 Probe-Labeled T790M / L858R-EGFR Target Protein
[0425] The H1975 cell line and LA1607-Y8 probe were utilized. All other procedures followed Example 1.
[0426] Impact of LA1607-Y8 Probe Labeling on Antigen-Antibody Binding
[0427] The H1975 cell line and LA1607-Y8 probe were employed. Experimental protocols were consistent with Example 1.
[0428] IC50 Curve of LA1607-Y8 Parent Compound on Signal Inhibition
[0429] The H1975 cell line and LA1607-Y8 probe were used. Methodological details adhered to Example 1.
[0430] Optimization of LA1607-Y8 Probe Incubation Time
[0431] The H1975 cell line and LA1607-Y8 probe were selected. All steps referenced Example 1.
[0432] IC50 Profiling of Reported T790M / L858R-EGFR-Selective Inhibitors (LB-1 to LB-7)
[0433] Solutions of LB-1 to LB-7 were prepared at concentrations of 10, 100, 300, 1000, 3000, 10,000, and 100,000 nM. Drug efficacy was tested in parallel on two cell lines: T790M / L858R-EGFR-high-expressing H1975 cells, wt-EGFR-high-expressing A431 cells. The platform demonstrated robust discrimination between selective inhibitors (targeting T790M / L858R-EGFR) and non-selective inhibitors (active against both mutant and wild-type EGFR) , validating its specificity.
[0434] The results are shown in FIG. 14 to FIG. 15.
[0435] The results demonstrated that the optimal concentration of the LA1607-Y8 probe was 1 μM, with an optimal incubation time of 1 hour. Antibodies exhibited no significant preference for capturing labeled versus unlabeled proteins, confirming that probe labeling does not compromise antibody specificity. Furthermore, AlphaFold3-predicted structural models revealed high conformational similarity between the LA1607-Y8 probe and its parent compound Mavelertinib when bound to the T790M / L858R-EGFR mutant protein. The platform’s ability to distinguish selective inhibitors (targeting mutant EGFR) from non-selective inhibitors (active against both mutant and wild-type EGFR) was rigorously validated. Reported T790M / L858R-EGFR-selective inhibitors showed markedly different responses compared to non-selective inhibitors in this platform, demonstrating its dual capability to precisely quantify inhibitory potency (IC50) and discriminate drug selectivity profiles. In conclusion, this study successfully established a high-efficiency screening platform for EGFR mutation-targeted drug discovery, providing robust data to expand the applicability of the INTRAP platform.
[0436] The optimal concentration of the LA1607-Y8 probe was determined to be 1 μM (FIG. 14b) , with an optimal incubation time of 1 hour (FIG. 14c) . The ratio of antibody-labeled protein showed a linear positive correlation with detection signal, indicating that the antibody exhibited no significant preference for capturing labeled versus unlabeled proteins, and probe labeling did not interfere with antibody-mediated protein capture (FIG. 14d) . The parent compound (positive control drug) effectively suppressed the probe signal, confirming the specificity of probe labeling for the target protein (FIG. 14g) . When GFP antibody was premixed with EGFR antibody for plate coating, it did not alter the saturation coating capacity of the ELISA plate. However, protein amounts ≥60 ng / well were sufficient to saturate 40 ng of antibody (FIGs. 14e-f) .
[0437] Osimertinib (FIG. 15a) , Lazertinib (FIG. 15b) , and WZ8040 (FIG. 15c) demonstrated strong inhibitory effects on mutant EGFR with significantly weaker activity against wild-type (wt) EGFR, highlighting their high selectivity. Olmutinib (FIG. 15d) and Allitiniub tosylate (FIG. 15g) similarly exhibited preferential inhibition of mutant EGFR over wt-EGFR. BLU-945 (FIG. 15e) and PF-6274484 (FIG. 15f) showed moderate selectivity, particularly BLU-945, which displayed markedly stronger inhibition of mutant EGFR compared to wt-EGFR. By testing concentration-dependent inhibition curves of reported T790M / L858R-EGFR-selective inhibitors, non-selective inhibitors, and wt-EGFR-preferential inhibitors in this platform, the system was validated to robustly discriminate selective from non-selective inhibitors.
[0438] Example 5: Validation of EGFR Degrader Detection
[0439] This example demonstrates the platform's utility in identifying molecules that induce target protein degradation. Unlike traditional small-molecule inhibitors, which act by occupying the target protein's active site, PROTACs (proteolysis-targeting chimeras) recruit E3 ubiquitin ligases to the target protein, triggering its ubiquitination and proteasomal degradation, thereby reducing intracellular target protein levels (see FIG. 16 for the mechanism) . In this study, EGFR was chosen as the model target. A literature-reported EGFR-targeting PROTAC (composed of an EGFR ligand covalently linked to a VHL E3 ligase ligand) was evaluated for its ability to degrade EGFR. Experiments were conducted in A431 cells as follows: Cells were cultured to 90%confluency, washed with PBS to remove media, and incubated with the LA1562-P01 probe-containing medium for 1 hour at 37℃. After washing away unbound probe with PBS, cells were treated with Gefitinib-based PROTAC 3 (HY-123921, CAS No.: 2230821-27-7) and incubated for 24 hours at 37℃. Post-treatment, cells were washed with PBS, lysed, and subjected to sonication and protein concentration measurement. Protein concentrations were adjusted to 2 mg / mL, followed by click chemistry to conjugate probe-protein complexes. ELISA was performed to quantify the signal intensity of probe-EGFR complexes, reflecting residual EGFR levels. If the candidate PROTAC successfully induced EGFR degradation, the proportion of EGFR labeled by the intracellular probe would increase, and it was expected that the signal of the Protac / Gefitinib-treated group would be higher than that of the untreated group. During the implementation process, a control group without PROTAC was set up to determine the signal baseline of the probe binding to EGFR under normal circumstances; and a traditional EGFR inhibitor control of equal concentration could be added to compare the difference in the effects of the two (the inhibitor would immediately compete for binding, and the degrader would take a certain time to take effect but can eliminate the protein) . It was expected that in cells treated with EGFR PROTAC, the OD value read by ELISA would be significantly higher than that of untreated cells; if the candidate molecule did not have degradation activity, the signal would be close to the control. In this way, the platform of the present disclosure can be used to discover and verify new candidate drugs that can reduce the level of target proteins.
[0440] Preparation of Solid Support (ELISA Plate) for Conjugate Detection
[0441] Same as in Example 1.
[0442] Preparation of Cell Samples
[0443] The A431 cell line with high expression of wild-type EGFR (wt-EGFR) was selected. After cells reached 90%confluency, they were treated with varying concentrations of the LA1562-P01 probe (1000, 500 nM) and incubated at 37℃ for 1 hour in a cell culture incubator. Following incubation, the probe was washed away with PBS, and cells were treated with different concentrations (100,000; 10,000; 1,000; 100; 10 nM) of gefitinib or gefitinib-based PROTAC 3, followed by incubation at 37℃ for 24 hours.
[0444] Cell Lysis
[0445] Same as in Example 1.
[0446] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0447] Same as in Example 1.
[0448] Detection of Probe-Protein Conjugates
[0449] Same as in Example 1.
[0450] The results are shown in FIG. 17.
[0451] The results demonstrate that this platform is feasible for detecting protein degraders: as fewer probe-labeled proteins remain, the ELISA signal decreases, enabling quantitative assessment of degradation efficiency. This approach can be applied to screen lead compounds for PROTACs or other protein degradation technologies.
[0452] Gefitinib (atraditional inhibitor) showed dose-dependent suppression of probe signal, consistent with its mechanism of competitive binding to EGFR. Gefitinib-based PROTAC 3, however, exhibited dose-dependent enhancement of probe signal, suggesting it preferentially clears unprobed EGFR (proteins not occupied by the probe) . This increases the relative proportion of probe-bound EGFR in the sample, leading to higher OD values (FIG. 17b) . Color-coded curves in FIG. 17b represent different combinations of probe concentrations and drug treatments, directly contrasting the effects of PROTAC (degradation) versus gefitinib (competitive inhibition) on EGFR levels. The platform successfully distinguishes PROTAC-mediated degradation from traditional inhibition, proving its utility for high-throughput screening of protein degraders.
[0453] Example 6. EGFR Ligand Screening Based on qPCR Method
[0454] Preparation of DNA-Coupled Antibodies
[0455] Using the SiteClickTM Antibody Azido Modification Kit (Thermo Cat. No. S20026) , EGFR rabbit monoclonal antibody (Beyotime Cat. No. AG1810) was azido-modified according to the instructions provided, forming azido-modified antibodies. 2 μM DBCO-DNA (CATCGCCCTTGGACTAGCATACCCATGAACACAAGTTGCGTCACGATGAGACTGGA TGAA, 5 DBCO (SEQ ID NO. 1) ) was mixed with an equal volume of 0.54 mg / mL azido-modified antibody, incubated at room temperature for 1h to form DNA-coupled antibodies, then diluted 100 times with blocking buffer.
[0456] The synthesis of probe molecules and preparation of working solution, preparation of candidate drug (Table 4) working solution, preparation of cell samples, and click coupling of probe-protein conjugates with detectable molecules were the same as in Example 1.
[0457] Table 4 Candidate drugs LD-1~LD-80
[0458] Preparation of PCR Tube (Detectable Conjugate Solid Support)
[0459] Protein A was pre-diluted to 15 ng / μL with 0.15 M NaCl solution (5 M, Thermo Cat. No. AM9760G; diluted with deionized water to 0.15 M) . Glutaraldehyde (Anjie, Cat. No. W610607) was diluted to 0.8% (w / v) with deionized water, added to PCR tubes (Axygen, Cat. No. PCR-0208-C) , 20 μL per tube, and incubated at 37℃ for 5 h. After incubation, the liquid in the PCR tubes was discarded, washed 3 times with deionized water, then 20 μL of 15 ng / μL Protein A was added, incubated at room temperature for 1 h. After incubation, the liquid in the PCR tubes was discarded, washed 3 times with 200 μL of 0.15 M NaCl solution, then 30 μL of blocking buffer (Thermo Cat. No. 37580) was added, incubated at room temperature for 1 h. After blocking, the PCR tubes were washed 3 times with PBST, then 20 μL of DNA-coupled antibody was added, incubated at room temperature for 1 h. After incubation, washed 3 times with PBST, each tube was added with 200 μL PBST, and stored at 4℃.
[0460] Detection of Probe-Protein Conjugates
[0461] Ligation mix was prepared in advance: 10X ligation buffer (NEB Cat. No. B0202S) , T4 DNA ligase (NEB Cat. No. M0202L) , 1 μM PL-linker (A / rU / AGC / rU / ACCG / rU / GA / rU / / rU / CA / rU / CCAGTGAG (SEQ ID NO. 2) ) and nuclease-free water (Thermo Cat. No. AM9938) mixed in a volume ratio of 2: 1: 2: 15, stored at 4℃.
[0462] qPCR mix was prepared in advance: 2×Premix Ex Taq (Takara, Cat. No. RR390) , 10 μM Forward Primer (CATCGCCCTTGGACTAGCAT (SEQ ID NO. 3) ) , 10 μM Reverse Primer (GGACGGGAATCAAGGTAACG (SEQ ID NO. 4) ) , 10 μM FAM-probe (TGGATGAATCACGGTAGCATAAGGTGCA (SEQ ID NO. 5) , 56-FAM, 3BHQ1) and ddH2O mixed in a volume ratio of 10: 1: 1: 0.4: 7.6, stored at 4℃.
[0463] Placed PCR tubes coated with antibodies at room temperature for 15 minutes to bring them to room temperature. Then discarded the liquid in the wells and add 20 μL of cell lysis solution to each tube, and incubate at room temperature for 1 hour. After incubation, washed three times with PBST and then added 20 μL of 1 μM streptavidin (diluted from 10 mM with PBST, Thermo Cat. No. 434301) , and incubated at room temperature for 1 hr. After incubation, washed five times with PBST and then added 20 μL of 10 nM PL-P-bio (TCACGGTAGCATAAGGTGCACGTTACCTTGATTCCCGTCC (SEQ ID NO. 6) , 5' P, 3' Biotin) , and incubated at room temperature for 1 hr. After incubation, washed five times with PBST. Discarded the wash solution in the PCR tubes and added 20 μL of ligation mix, incubated at room temperature for 15 minutes, during which the 3’ end of the DNA on the antibody and the 5’ end of the DNA on the probe came close and connected due to the formation of the probe-protein conjugate. After incubation, discarded the liquid in the PCR tubes and added 0.5 μL of USER diluted ten-fold with PBST (NEB, Cat. No. M5505S) , incubated at room temperature for 15 minutes. After incubation, washed three times with PBST, then discarded the liquid in the PCR tubes and added 20 μL of qPCR mix, and detected using a real-time fluorescence quantitation instrument (Bio-Rad, CFX96 model) (PCR program: ① 95℃, 30 s; ② 95℃, 5 s; ③ 60℃, 60 s, signal collection; cycle 40 times between ② and ③) .
[0464] Comparison of ELISA and qPCR for Detecting Target Engagement
[0465] Using the H1975 cell line expressing T790M / L858R-mutated EGFR, cells were labeled with the 1 μM specific probe LA1607-Y8. The competitive drug selected was PF-6274484 (HY-101450, CAS No.: 1035638-91-5) , a known inhibitor of both EGFR-L858R / T790M and wild-type (wt) EGFR. PF-6274484 was prepared at concentrations of 100,000, 10,000, 5,000, 1,000, 500, 100, 10, 1, 0.1, and 0.01 nM in culture medium. Following the aforementioned methods and Example 1, inhibition curve assays were conducted on both ELISA and qPCR platforms, and the IC50 values obtained from the two methods (qPCR vs. ELISA) were compared.
[0466] Single-Point Screening with qPCR
[0467] Using the qPCR method, quantitative detection of the DNA linkage products in each well was performed (FIG. 18) . The average Ct value for the negative group was 18.81. It was statistically found that the Ct values in wells with 18 ligands such as LD-8, LD-12, LD-14 were above 20.69, indicating that the formation of the probe-protein conjugate was inhibited by these ligands. These molecules might be potential orthosteric ligands of the EGFR protein ATP binding pocket.
[0468] The results are shown in FIG. 18.
[0469] The results demonstrate that ELISA and qPCR showed high consistency in comparative detection of the same sample, indicating compatibility between the two platforms. In this study, 18 competitive ligands were screened, with 10 positive ligands identified as reported EGFR-active drugs, achieving a 100%hit rate for active drugs. This confirms the high sensitivity of qPCR detection, aligning with the extension criteria of the INTRAP assay methodology.
[0470] Example 7: Establishment of a HER2-Targeted INTRAP Screening
[0471] The intracellular probe-labeling screening method of the present disclosure was primarily applied to EGFR protein in previous examples. This example validated the feasibility and applicability of the technology for the HER2 (ErbB2) target. HER2, a member of the epidermal growth factor receptor (EGFR / ErbB1) family, is a receptor tyrosine kinase critically involved in cell proliferation and differentiation signaling. Unlike EGFR, HER2 lacks a known natural ligand but functions through dimerization with other family receptors. Overexpression or mutation of HER2 drives tumor growth in breast cancer, gastric cancer, and other malignancies, making it a key therapeutic target. Clinically approved HER2-targeted therapies include monoclonal antibodies (e.g., trastuzumab) , and small-molecule tyrosine kinase inhibitors (e.g., lapatinib, afatinib) . Experimental Workflow: conducted in HER2-high-expressing human breast cancer SK-BR-3 cells; systematically optimized probe labeling conditions (e.g., concentration, incubation time) ; evaluated activation / inhibition effects of different drugs using: Mass spectrometry (MS) for binding specificity and ELISA / qPCR for quantitative target engagement; performed pull-down assays to isolate probe-HER2 complexes; and validated interactions via WB.
[0472] Synthesis of LA1562-P01 Probe Molecule and Preparation of Working Solution
[0473] Same as in Example 1.
[0474] Discovery Studio Analysis of LA1562-P01 Binding Potential to HER2
[0475] The known sequence of HER2 and its 8u8x structure were downloaded from UniProt. Using Discovery Studio software, the binding interaction between LA1562-P01 and the HER2 protein was evaluated, with analysis focused on optimal binding conformations and binding affinity.
[0476] HER2 Antibody Selection
[0477] Beyotime (AG1862) and Abbkine (A21248) antibodies were used to detect HER2 protein abundance and antibody specificity across different cell lines (A431, H1975, HepG2, Hela, SKBR3) . Western blot (WB) procedures followed Example 2, excluding cell starvation or EGF stimulation.
[0478] Gel Fluorescence Imaging for LA1562-P01 Probe Labeling Optimization in SKBR3 Cells
[0479] SKBR3 cells were cultured to 90%confluence and treated with 10 μM LA1562-P01 probe in culture medium. Cells were incubated at 37℃ for 0, 0.25, 0.5, 1, 2, 3, 4 hours to assess time-dependent labeling. For concentration-dependent labeling, cells were treated with 0, 0.5, 1, 5, 10, 20, 30, 50 μM LA1562-P01 probe and incubated for 1 hour.
[0480] Mass Spectrometry Validation of LA1562-P01 Probe-Labeled Targets
[0481] SKBR3 cells were pre-treated with 20, 10, 1, 0.1, 0 μM afatinib in culture medium for 1 hour, followed by incubation with 10 μM LA1562-P01 probe for 1 hour. Sample preparation was performed for subsequent mass spectrometry analysis to validate probe-target interactions.
[0482] Cell Lysis
[0483] Same as in Example 1.
[0484] Click Coupling of Probe-Protein Conjugates with Detectable Molecules
[0485] Same as in Example 1.
[0486] SDS-PAGE Gel Detection
[0487] The procedure followed Example 2, but with click reagents replaced by TBTA, TCET, CuSO4, and Rhodamine. All other steps were performed as described in Example 2.
[0488] Preparation of Solid Support (ELISA Plate) for Conjugate Detection
[0489] The antibody was replaced with HER2-specific antibody, while other steps followed Example 1.
[0490] EC50 Determination of LA1562-P01 Probe-Labeled HER2 Target Protein
[0491] SKBR3 cells were treated with 300 nM LA1562-P01 probe, and subsequent steps followed Example 1.
[0492] Impact of LA1562-P01 Probe Labeling on Antigen-Antibody Binding
[0493] SKBR3 cells were treated with 300 nM LA1562-P01 probe, and subsequent steps followed Example 1.
[0494] Antibody Coating Optimization
[0495] Using SKBR3 cells and 300 nM LA1562-P01 probe, HER2-Ab coating concentrations on the ELISA plate were tested at 400, 300, 200, 100, 80, 60, 40, 20, 10, 0 ng under a fixed protein loading of 100 ng. Probe signal changes were measured, with other steps following Example 1.
[0496] LA1562-P01 Probe Incubation Time Optimization
[0497] SKBR3 cells were treated with 300 nM LA1562-P01 probe, and subsequent steps followed Example 1.
[0498] IC50 Curve of LA1562-P01 Probe Parent Drug for Signal Inhibition
[0499] SKBR3 cells were treated with LA1562-P01 probe, and subsequent steps followed Example 1.
[0500] Cell Sample Preparation for EGF Agonist Effects on LA1562-P01 Probe Signal
[0501] SKBR3 cells were labeled with 300 nM LA1562-P01 probe. The competitive drug used was EGF (HY-101450, CAS No.: 1035638-91-5) , a wild-type (wt) EGFR agonist. Cells were treated with EGF at concentrations of 10,000, 1,000, 100, 10, 1, 0.1 nM in culture medium, incubated at 37℃ for 1 hour, followed by 1-hour incubation with LA1562-P01 probe.
[0502] Preparation of Candidate Drug Solutions
[0503] Candidate drugs Z11~Z54 (Table 5) were dissolved in DMSO, and diluted to 100 μM stock solution, then diluted to 1 μM working solution in DMEM medium when used.
[0504] Table 5 Candidate drugs Z1~Z54
[0505] IC50 Curve Generation for Known Inhibitors Not Selected by HER2 Platform in Initial Screening (Inhibition Rate <25%)
[0506] Known inhibitors Z7, Z13, Z42, which were not selected by the HER2 platform during initial screening (inhibition rate <25%) , were prepared at concentrations of 100,000, 60,000, 30,000, 3,000, 300, 30, 3, 0 nM in cell culture medium. Cells were incubated with inhibitors for 1 hour, followed by 1-hour incubation with LA1562-P01 probe. IC50 testing was performed to validate whether increased inhibitor concentrations suppress probe signal.
[0507] WB Validation of 25 Reported HER2 Inhibitors on HER2 Phosphorylation
[0508] SKBR3 cells were treated with 300 nM LA1562-P01 probe and competed with 25 reported HER2 inhibitors. Cells were lysed, subjected to click reaction, and analyzed for protein quantification. Western blot (WB) was performed with primary antibodies against HER2, phospho-HER2 (q-HER2) , EGFR, phospho-EGFR (q-EGFR) , AKT, phospho-AKT (q-AKT) . Other steps followed Example 1.
[0509] LA1562-P01 Probe Labeling Efficiency for HER2 and p-HER2 in Live Cells
[0510] SKBR3 cells were used. ELISA plates coated with HER2-Ab (200 ng) or p-HER2-Ab (200 ng) were prepared as described in Example 1. After cell starvation and EGF stimulation, cells were treated with LA1562-P01 probe at concentrations of 10,000, 1,000, 500, 100, 10, 1, 0.1, 0 nM in culture medium for 1 hour. Cells were lysed, subjected to click reaction, and analyzed for protein quantification. Protein loading amounts were 40 μg for the HER2 platform and 100 μg for the phospho-HER2 (q-HER2) platform.
[0511] Impact of LA1562-P01 Probe on HER2 Phosphorylation
[0512] SKBR3 cells (HER2-expressing) were subjected to cell starvation and EGF stimulation, then treated with LA1562-P01 probe at concentrations of 10,000, 1,000, 500, 100, 10, 1, 0.1, 0 nM in culture medium for 1 hour. Cells were lysed, subjected to click reaction, and analyzed by WB using primary antibodies against HER2 and phospho-HER2 (q-HER2) . Other steps followed Example 1.
[0513] Pull-Down & WB Validation of LA1562-P01 Probe Labeling on HER2 in Live Cells
[0514] SKBR3 cells (HER2-expressing) were cultured to near-logarithmic growth phase. After cell starvation and stimulation with 270 μM EGF (to induce HER2 and p-HER2 expression) , cells were treated with 10 μM LA1562-P01 probe for 1 hour. Cells were lysed, subjected to click reaction, and magnetic bead pull-down was performed to isolate probe-bound protein complexes. The supernatant was collected post-pull-down. Pull-down samples and supernatant samples were analyzed by SDS-PAGE and WB, using specific antibodies against HER2 and phospho-HER2 to evaluate probe capture efficiency.
[0515] The results are shown in FIG. 19 to FIG. 24.
[0516] The results demonstrate that the probe screening method developed in this study can be directly applied to HER2-high-expressing cells for screening inhibitors or activators of diverse compounds, without requiring protein purification or genetic modification. The platform exhibits high sensitivity and specificity in practical applications and is proven to be compatible with RTK targets beyond EGFR, highlighting its broad utility. Detailed analyses are as follows:
[0517] In A431, H1975, HepG2, and HeLa cells (low HER2 protein abundance) , no protein bands were detected. In HER2-positive cell lines SKBR-3 and NCI-N87, distinct protein bands were observed. A non-specific band appeared in the gastric cancer cell line NCI-N87, potentially due to ubiquitinase-mediated degradation (FIG. 19b-c) . The full-protein PVDF membrane incubated with Abbkine antibodies showed clean backgrounds, confirming the antibody’s high specificity. Abbkine HER2 antibody was selected for subsequent experiments (FIG. 19c) . SKBR-3 cells exhibited strong and clear target band signals, making them suitable for further drug target validation (FIG. 19b-c) .
[0518] The labeling intensity of the probe toward the target protein gradually increased with incubation time, and higher concentrations did not induce significant non-specific bands, demonstrating time-dependent labeling efficacy. 1-hour incubation provided optimal labeling (clear bands, low background) (FIG. 20a) . The probe’s labeling efficacy for HER2 protein improved with increasing probe concentration, indicating concentration-dependent labeling. Within the 10 to 20 μM range, the probe achieved optimal HER2 labeling (sharp bands, clean background) , and 10 μM was selected as the optimized concentration (FIG. 20b) .
[0519] Mass spectrometry revealed that probe-protein binding was significantly competed by Afatinib in a concentration-dependent manner, confirming HER2 and EGFR as probe targets in SKBR3 cells (FIG. 21a) . Notably, 10 μM Afatinib completely displaced the probe, demonstrating potent inhibition of probe-target interaction. The EC50 for HER2 labeling by LA1562-P01 was determined to be 246.6 nM, justifying the use of 300 nM probe for competitive drug screening (FIG. 21b) . By optimizing incubation time, 1-hour incubation maximized probe-cell binding efficiency without compromising cell viability or morphology, establishing it as the optimal condition for subsequent experiments (FIG. 21c) . A linear correlation between antibody-labeled protein ratios and detection signals confirmed that probe labeling did not bias antibody-mediated protein capture (FIG. 21d) . The OD450nm value increased with antibody coating amount, plateauing at 200 ng (optimal signal: OD = 1.5) , which was recommended for subsequent experiments (FIG. 21e) . OD450nm values showed a positive correlation with protein loading, with a transient plateau at 120 μg / well and renewed increases at 160 μg / well. To balance signal strength and resource efficiency, 40 μg / well (OD ≈ 1) was selected (FIG. 21f) . High EGF concentrations enhanced HER2 phosphorylation pocket accessibility, promoting probe binding and increasing OD signals (FIG. 21g) . Elevated probe signals post-EGF stimulation (vs. probe-only controls) suggested that LA1562-P01 labels non-phosphorylated HER2, requiring further validation (FIG. 21h) .
[0520] The HER2 ligand screening platform (based on SKBR3 cells and LA1562-P01 probe) evaluated 54 drugs, including 25 reported active compounds, achieving an 88%hit rate (22 / 25) (FIG. 22a) . Both covalent and non-covalent inhibitors were identified, validating the platform’s accuracy. Outliers such as Z42 (competitive at higher concentrations) and Z7 / Z13 (non-competitive) were analyzed (FIG. 22b) . Subsequent WB validation confirmed that platform-identified inhibitors suppressed EGFR / HER2 phosphorylation, whereas Z7 / Z13 lacked such activity, likely due to outdated methodologies in their original studies (FIG. 23) . This underscores the platform’s high accuracy in identifying HER2 inhibitors.
[0521] LA1562-P01 exhibited concentration-dependent labeling of non-phosphorylated HER2 without binding phosphorylated HER2. Minor signal increases at higher probe concentrations may arise from non-specific binding (FIG. 24a) . Increasing probe concentration reduced p-HER2 levels while total HER2 remained unchanged, indicating that the probe blocks HER2 phosphorylation (rather than binding p-HER2) to modulate downstream signaling (FIG. 24b) . HER2 (but not p-HER2) was detected in pull-down eluates, confirming probe specificity for non-phosphorylated HER2. Absence of HER2 / p-HER2 in supernatants may result from high SDS concentration or insufficient protein loading (FIG. 24c) . These findings demonstrate that LA1562-P01 primarily labels non-phosphorylated HER2 and that the HER2 platform selectively identifies phosphorylation inhibitors, validating its mechanistic basis and practical utility.
[0522] In this disclosure, unless otherwise defined, all the specialized and scientific terms used herein are to be interpreted as commonly understood by those proficient in the relevant field. Furthermore, methods and materials similar or equivalent to those outlined in this document may be employed in the execution of this invention. The embodiments and materials described are primarily for illustrative purposes. The described and specific descriptions of these embodiments are not meant to limit the scope of this invention’s patent. It should be recognized that experts in this field can implement various modifications and enhancements without straying from the core principles of this invention, and such adaptations fall within the intended scope of protection for this invention.
Claims
1.A method of screening a ligand for a target biomolecule, which comprises the following steps:a1) adding a probe alone to a system comprising the target biomolecule, the probe binding to the target biomolecule thereby forming a target biomolecule-probe conjugate,a2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe,a3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule and / or the target biomolecule-probe conjugate to the solid support,a4) performing quantitative assay on the solid support to obtain a reference value T0;b1) adding a probe and a candidate ligand (s) to a system comprising the target biomolecule, the probe and the candidate ligand competing for binding to the target biomolecule thereby forming a target biomolecule-probe conjugate and / or a target biomolecule-candidate ligand conjugate and / or a target biomolecule-probe-candidate ligand conjugate,b2) adding a detectable molecule to the system, the detectable molecule being capable of coupling to the probe thereby forming a detectable target biomolecule-probe conjugate and / or a detectable probe and / or a detectable target biomolecule-probe-candidate ligand conjugate,b3) contacting the system with a solid support, which can bind to the target biomolecule thereby immobilizing the target biomolecule, the target biomolecule-probe conjugate and / or the target biomolecule-candidate ligand conjugate and / or the target biomolecule-probe-candidate ligand conjugate to the solid support,b4) performing quantitative assay on the solid support to obtain a measured value T1;if T1 < T0, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, andif T1 > T0, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule.2.The method according to claim 1, whereinif T1 ≤ T0 × (100-E) %, the candidate ligand is identified as a potential competitive ligand for the probe binding with the target biomolecule, orif T1 ≥ T0 × (100+E’) %, the candidate ligand is identified as a potential cooperative ligand for the probe binding with the target biomolecule,where E ≥ 5, for example, E ≥ 10, E ≥ 15, E ≥ 20, or E ≥ 25,E’≥ 5, for example, E’ ≥ 10, E’ ≥ 15, E’ ≥ 20, or E’ ≥ 25,E and E’ may be the same or different.3.The method according to claim 1 or 2, wherein the biomolecule comprises a nucleic acid, a carbohydrate, a lipid, a protein, or any combination thereof, preferably, the biomolecule comprises a protein or a variant thereof.4.The method according to any one of claims 1 to 3, wherein the biomolecule comprises a protein of a wild-type form, a mutated form with at least one amino acid mutation compared to the corresponding wild-type protein, or a post-translational modified form, optionally, the protein is a protein without an epitope tag.5.The method according to any one of claims 1 to 4, wherein the biomolecule comprises a protein selected from G protein-coupled receptors (GPCRs) , receptor tyrosine kinases (RTKs) , nuclear receptors, or a variant thereof, preferably selected from receptor tyrosine kinase (RTK) family comprising EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, a variant thereof, where the variant is a mutate with at least one amino acid mutation compared to the corresponding wild-type RTK.6.The method according to any one of claims 1 to 5, wherein the probe comprises a binding moiety, a reporter moiety, and optionally a reactive moiety.7.The method according to any one of claims 1 to 6, wherein the binding moiety is selected from a small molecule fragment, and a peptide.8.The method according to any one of claims 1 to 7, wherein the report moiety is selected from azadibenzocyclooctyne, benzocyclobutene, thiol, alkene, alkyne, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, or active ester including hydroxybenzotriazole ester.9.The method according to any one of claims 1 to 8, wherein the reactive moiety is selected from the group consisting of a photo-crosslinking group, sulfonyl fluoride, fluorosulfate, a Michael acceptor group, a leaving group, nickel NTA (nitrilotriacetic acid) .10.The method according to any one of claims 6 to 9, wherein the probe comprises a binding moiety, a reporter moiety, and optionally a reactive moiety,the binding moiety is a small molecule fragment derived from an inhibitor of the ErbB / HER protein family selected from the group consisting of Gefitinib, Afatinib, Mavelertinib, Erlotinib, Lapatinib, Afatinib, Dacomitinib, Neratinib, and Osimertinib, preferably Gefitinib, Afatinib, and Mavelertinib;the reporter portion is selected from the group of azadibenzocyclooctyne, benzocyclobutene, thiol, alkenyl, alkynyl, azide, tetrazine, trans-cyclooctene, (diphenylphosphine) aryl, (diphenylphosphine) alkyl, preferably alkynyl; andthe optional reactive moiety is a photo-crosslinking group selected from the group consisting of diazirine, benzophenone, aryl azides, psoralen derivatives, cyclopropene-diazirine hybrids, anthraquinones, and derivative and analogue thereof, preferably, diazirine.11.The method according to any one of claims 1 to 10, wherein the probe is selected from the group consisting of 12.The method according to any one of claims 1 to 10, wherein the detectable molecule is selected from the group consisting of fluorophores and related groups comprising non-fluorescent dye chromophores, fluorophores, fluorescent enzyme substrates, organic dyes, inorganic dyes, metal chelates, and quenchers;enzyme-linked systems comprising biotin-streptavidin conjugates;chemical tags comprising digoxigenin, sulfonate labels, and nickel nitrilotriacetic acid (Ni-NTA) ;nucleic acid-based markers: DNA or RNA probes and nucleic acid aptamers; andphysical detection entities: surface-enhanced Raman scattering (SERS) -active nanoparticles and radioisotopes.13.The method according to any one of claims 1 to 12, wherein the detectable molecule is selected from the group consisting of biotin, streptavidin conjugates including HRP, sulfonate label, fluorescent group, metal chelate, and a nucleic acid.14.The method according to any one of claims 1 to 13, wherein the solid support comprises a solid and a recognition moiety.15.The method according to any one of claims 1 to 14, wherein the solid is selected from the group consisting of a membrane, glass, plastic, synthetic polymer, eppendorf tube, a well of a multi-well plate, or a surface plasmon resonance chip.16.The method according to any one of claims 1 to 15, wherein the recognition moiety comprise an antibody, a DNA-conjugated probes, or a bioorthogonal handles.17.The method according to any one of claims 1 to 16, wherein the antibody includes a protein antibody, DNA-conjugated protein antibody, or DNA-conjugated nucleic acid aptamer.18.The method according to any one of claims 1 to 17, wherein the antibody is an antibody against a member of the receptor tyrosine kinase (RTK) family comprising EGFR (ErbB1) , HER2 (ErbB2) , HER3, HER4, or a variant thereof comprising at least one amino acid mutation compared to the corresponding wild-type RTK.19.The method according to any one of claims 1 to 18, wherein the quantitative assay is selected from the group consisting of enzyme-linked immunosorbent assay (ELISA) , quantitative polymerase chain reaction (qPCR) , loop-mediated isothermal amplification (LAMP) , recombinase polymerase amplification (RPA) , next-generation sequencing (NGS) , digital droplet ELISA (ddElisa) , digital droplet PCR (ddPCR) , immunoblotting, fluorescence microvolume analysis technique (FMAT) , chemiluminescence, surface-enhanced Raman spectroscopy (SERS) , and subcellular staining, preferably ELISA, qPCR, and chemiluminescence.20.The method according to any one of claims 1 to 19, wherein the method is performed in situ in cells, in organelles, or on crude cell extracts.21.The method according to any one of claims 1 to 20, wherein the system is a cell line comprising the target biomolecule.22.The method according to any one of claims 1 to 21, wherein the cell is optionally lysed prior step (a2) and (b2) .23.A compound selected from the group consisting of 24.The compound according to claim 22 for use as a probe for the method according to any one of claims 1 to 21.
Citation Information
Patent Citations
Detectable nucleic acid tag
CN101512016A
Sulfur-heterocycle exchange chemistry and uses thereof
CN113853372A
Nucleic acid aptamer of human papilloma virus, screening method, detection method and application
CN117025616A
Screening Methods
US20110274692A1
Novel chimeric polypeptides for screening and drug discovery purposes
US20150376261A1