Novel phytase and use thereof

Abstract

The present application relates to: a phytic acid hydrolysis method comprising a step of treating a substrate with a polypeptide having an amino acid sequence with at least 90% identity to at least one amino acid sequence of SEQ ID NO: 20 to SEQ ID NO: 22; a method for producing a phytic acid hydrolysate; a reaction composition for reaction with phytic acid, comprising at least one of the polypeptide and a host cell including the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof; a composition for hydrolysis of a substrate containing phytic acid; and uses of the polypeptide and the host cell for hydrolyzing phytic acid.

Description

Novel phytase and its use

[0001] The present application relates to a method for hydrolyzing phytic acid, comprising a step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NOs: 20 to 22; a method for producing a phytic acid hydrolysate; a composition for reacting with phytic acid, comprising at least one of the polypeptide; the polypeptide, a polynucleotide encoding the polypeptide, or a host cell comprising a combination thereof; a composition for hydrolyzing a substrate comprising phytic acid; and uses of the polypeptide and the host cell for hydrolyzing phytic acid.

[0002]

[0003] Phytic acid is an organic form of phosphorus found in grains and oilseeds. It is not broken down in the digestive tract of monogastric animals, causing mineral deficiencies in humans and livestock. It is also discharged as manure, causing eutrophication of rivers and lakes in densely populated livestock areas, resulting in water pollution.

[0004] Accordingly, chemical treatment was attempted as a method to decompose phytic acid, but it was not put into practical use because it destroyed coexisting nutrients. Afterwards, phytase (myo-inositol hexakisphosphate phosphohydrolase), a phosphatase enzyme that catalyzes the hydrolysis of phytic acid and releases usable inorganic phosphorus (Mullaney EJ, et al., Advances in Applied Microbiology, Volume 47, 2000, Pages 157-199., 2000), was proven to be the most effective means of decomposing phytic acid without adverse nutritional effects on food or feed, and research to discover microorganisms that produce phytase has been conducted since the 1960s.

[0005] Accordingly, phytase has been widely used industrially, especially in poultry feed, and has been continuously used for more than 20 years. It is expected to form a market worth more than 2 billion dollars by 2024, so research for the development of new phytase is still necessary.

[0006]

[0007] One aspect of the present application provides a method for hydrolyzing phytic acid, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0008] Another aspect of the present application provides a method for producing a phytic acid hydrolysate, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0009] Another aspect of the present application provides a composition for reaction, comprising: a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 for reaction with phytic acid; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

[0010] Another aspect of the present application provides a composition for hydrolyzing a substrate comprising phytic acid, comprising at least one of a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

[0011] Another aspect of the present application provides a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof, for use in hydrolyzing phytic acid.

[0012]

[0013] One aspect of the present application provides a method for hydrolyzing phytic acid, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0014] Another aspect of the present application provides a method for producing a phytic acid hydrolysate, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0015] Another aspect of the present application provides a composition for reaction, comprising: a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 for reaction with phytic acid; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

[0016] Another aspect of the present application provides a composition for hydrolyzing a substrate comprising phytic acid, comprising at least one of a polypeptide having an amino acid sequence having at least 90% identity with any one or more of the amino acid sequences of SEQ ID NOs: 20 to 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

[0017] Another aspect of the present application provides a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof, for use in hydrolyzing phytic acid.

[0018]

[0019] This application provides a phytase with high activity, which can efficiently utilize phosphoric acid.

[0020]

[0021] Figure 1 is a diagram showing the results of a sequence comparison between the phytase of the present application and a known phytase.

[0022]

[0023] The specific details for implementing the invention are as follows. Furthermore, each description and embodiment disclosed in this application can be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0024] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments of the present application described herein. Furthermore, such equivalents are intended to be encompassed by this application.

[0025]

[0026] definition

[0027]

[0028] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless the context clearly dictates otherwise, the singular terms include the plural and the plural terms include the singular. In the specification and appended claims of this application, unless the context clearly dictates otherwise, the use of "or" is intended to include "and / or."

[0029]

[0030] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.

[0031]

[0032] In this application, the terms "first, second, third...", "i), ii), iii) ...", or "(a), (b), (c), (d) ..." are used to distinguish similar configurations, and these terms do not imply that they are performed consecutively or in order. For example, when the terms are used in relation to steps of a method, use, or analysis, these steps may be performed simultaneously, without a time interval, or may be performed at intervals of seconds, minutes, hours, days, or months.

[0033]

[0034] In this application, the term "consisting essentially of" means that a non-specific component may be present if the characteristics of the subject matter claimed in this application are not substantially affected by the presence of the non-specific component.

[0035] In this application, the term "consisting of" means that the proportion of a specific component(s) totals 100%. The components or features listed below the term "consisting of" may be essential or mandatory. In some specific examples, other than the components or features listed below "consisting of," other optional or nonessential components may be excluded.

[0036] In this application, the term "comprising" means the presence of a feature, step, or component described below, and does not exclude the presence or addition of one or more features, steps, or components. The components or features described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential components or features may be further included.

[0037] In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of.”

[0038] In the present application, with respect to an amino acid sequence, even if it is described as a polypeptide “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number, it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be used in the present application, as long as it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it may be a case in which the amino acid sequence has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution thereof, but is not limited thereto.

[0039]

[0040] In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably with "amino acid sequence."

[0041] In some cases, an amino acid sequence that exhibits activity may be referred to as an "enzyme." In this application, amino acid sequences are described in N-terminal → C-terminal orientation, unless otherwise indicated.

[0042]

[0043] In relation to a cell, nucleic acid, polypeptide, or vector, the term "recombinant" in this application means that the cell, nucleic acid, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by alteration of a native nucleic acid or polypeptide, or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the native (non-recombinant) form of the cell, or may express a native gene that is expressed or not expressed at all, or otherwise abnormally expressed.

[0044]

[0045] In this application, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0046]

[0047] Throughout this application, the conventional one-letter and three-letter codes for naturally occurring amino acids are used. Furthermore, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

[0048]

[0049] Alanine Ala, A Arginine Arg, R

[0050] Asparagine Asn, N Aspartic acid Asp, D

[0051] Cysteine ​​Cys, C Glutamic acid Glu, E

[0052] Glutamine Gln, Q Glycine Gly, G

[0053] Histidine His, H Isoleucine Ile, I

[0054] Leucine Leu, L Lysine Lys, K

[0055] Methionine Met, M Phenylalanine Phe, F

[0056] Proline Pro, P Serine Ser, S

[0057] Threonine Thr, T Tryptophan Trp, W

[0058] Tyrosine Tyr, Y Valine Val, V

[0059]

[0060] Meanwhile, any amino acid can be written as Xaa, X.

[0061] Additionally, the generally accepted three-letter codes for other amino acids, such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), and α-methyl-glutamic acid, may be used, as well as for naturally occurring amino acids.

[0062]

[0063] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Accordingly, amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0064] For example, among the amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; among the amino acids having uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the nonpolar amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine.

[0065] As used herein, the term "gene" refers to a polynucleotide encoding a polypeptide and a polynucleotide comprising regions preceding and following the coding region. In some embodiments, a gene may have a sequence (intron) inserted between each coding region (exon).

[0066]

[0067] As used herein, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0068] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons considered codon degeneracy.

[0069] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET AL / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using, but is not limited to, BLAST of the National Center for Biotechnology Information Database, or ClustalW.

[0070] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program are (1) unitary matrices (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1-bit integers, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0071] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, but are not limited thereto).

[0072]

[0073] In the present application, the term "mature polypeptide" refers to a polypeptide in a form that lacks a signal sequence or a propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. A mature polypeptide may be a final form that has undergone post-translational or post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, and leader sequence removal.

[0074]

[0075] The term "nucleic acid construct" in this application means a single or double-stranded nucleic acid molecule that contains one or more regulatory sequences and is artificially synthesized, engineered to contain a specific sequence in a manner that does not exist in nature, or isolated from nature.

[0076]

[0077] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0078] As used herein, the term "expression vector" means a linear or circular nucleic acid molecule comprising a coding sequence and regulatory sequences operably linked thereto for expression thereof.

[0079]

[0080] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately to direct the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target in accordance with the known or desired activity.

[0081]

[0082] As used herein, the term "cDNA" refers to a DNA sequence that can be produced by reverse transcription from a mature, spliced ​​mRNA molecule, which can be obtained from a eukaryotic or prokaryotic cell. The cDNA sequence does not include intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA before being processed through a series of steps, including splicing, to form the mature, spliced ​​mRNA.

[0083]

[0084] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary for the expression of a coding sequence. Each regulatory sequence may be native to the coding sequence (having the same origin) or foreign (derived from another gene). Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0085]

[0086] In this application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 35" may be described as "position 35," "amino acid 35," or "35th amino acid." Furthermore, for example, if the amino acid at position 35 is alanine (A), it may be described as "A35" or "Ala35."

[0087] Any amino acid at a particular position can be referred to as "X". For example, X35 refers to any amino acid at position 35.

[0088]

[0089] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the protein or polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0090] In the present application, any one or more of SEQ ID NOs: 20 to 22 may be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

[0091] That is, any one or more of the sequences of SEQ ID NO: 20 to SEQ ID NO: 22 disclosed in the present application can be used to determine the corresponding amino acid residue in a polypeptide having any phytase activity, and unless otherwise indicated in the present application, the residues of a particular amino acid sequence are numbered based on any one of the sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0092] For example, any amino acid sequence can be aligned with the sequence of SEQ ID NO: 20, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 20. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it with a query sequence (also referred to as a “reference sequence”).

[0093] These alignments can be performed using, but are not limited to, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), and Trends Genet. 16: 276-277).

[0094] Multiple sequence alignment can also be used to identify corresponding amino acid residues in other phytases. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.

[0095] Additionally, if an enzyme diverged from a polypeptide sequence having a sequence of any one of SEQ ID NOs: 20 to 22 and their relationship cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms may be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for this purpose.

[0096] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or Combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).

[0097] The above methods are examples and are not limiting.

[0098]

[0099] Hereinafter, specific examples of the present application will be described in more detail as follows.

[0100]

[0101] One aspect of the present application provides a method for hydrolyzing phytic acid, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0102] The above processing step may be a step of contacting or reacting the polypeptide with a substrate, and a polypeptide having an amino acid sequence having 90% or more identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 of the present application may be a phytase.

[0103] In this application, “Phytase” means an enzyme that catalyzes the reaction myo-inositol hexakisphosphate + H2O ⇔ 1D-myo-inositol 1,2,3,5,6-pentakisphosphate + phosphate. It can be classified under EC 3.1.3.26.

[0104] In the present application, phytase enzyme activity can be measured and evaluated using methods known in the art, including the embodiments described in the present application.

[0105] In the present application, "enzymatic activity" refers to at least one catalytic activity. Specifically, k cat / It may be, but is not limited to, the conversion efficiency of the enzyme, which is mainly expressed as Km.

[0106] k cat When the enzyme is completely saturated with the substrate, it refers to the catalytic constant for the conversion of a single enzyme into a product per unit time, also called the turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

[0107] As an example of how to express enzyme activity, specific activity (umol of converted substrate x mg) -1 x min -1 ) or volumetric activity (umol of converted substrate x mL -1 x min -1 ) etc.

[0108] However, defining enzyme activity is not limited to the above-mentioned content, and can be defined and evaluated based on known content such as Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; AG Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, WH Freeman, 1999; Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet ef a / ., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity.

[0109] The term "specific activity" in this application refers to the activity of an enzyme per unit weight of protein, which can be expressed as unit / mg (which can be used interchangeably with U / mg). Protein quantification can be performed, for example, using SDS-PAGE or the Bradford assay.

[0110] As an example of implementation, the polypeptide of the present application may have excellent phytase enzyme activity not only under normal conditions but also under acidic conditions, so that the polypeptide provided by the present application may have phytase enzyme activity at, but not limited to, pH 7 or lower, about pH 2 to 7, pH 2 to 6.5, pH 2 to 6, pH 2.5 to 7, pH 2.5 to 6.5, pH 2.5 to 6, pH 3 to 6, or pH 3 to 5.5.

[0111] In one implementation example, the phytase or polypeptide provided in the present application may have phytase enzyme activity in a range of about 20°C to 80°C, 20°C to 40°C, 30°C to 40°C, 35°C to 40°C, or 37°C, but is not limited thereto.

[0112]

[0113] In the present application, the phytase may be a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0114] It is known that the above sequence numbers 20 to 22 may be histidine acid phosphatase, but it is the first time in this application that it has been discovered that they may be phytase.

[0115] Specifically, the phytase of the present application may be a naturally occurring polypeptide, a wild-type polypeptide, a mature polypeptide thereof, a non-naturally occurring polypeptide, or an artificial polypeptide, but is not limited thereto as long as it has phytase activity and an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0116] More specifically, the phytase of the present application may consist of, consist essentially of, have, or include one or more amino acid sequences from SEQ ID NO: 20 to SEQ ID NO: 22. In addition, if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence from SEQ ID NO: 20 to SEQ ID NO: 22, a polypeptide consisting of, consisting essentially of, having, or including a polypeptide having an amino acid sequence having at least about 90%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence from SEQ ID NO: 20 to SEQ ID NO: 22 may also be included in the scope of the phytase of the present application without limitation.

[0117]

[0118] The polypeptides of the above sequence numbers 20 and 21 may be derived from the genus Turicimonas, specifically Turicimonas muris, and the polypeptide of the sequence number 22 may be derived from a bacterium of the order Burkholderia, but is not limited thereto, and may be an amino acid sequence excluding a signal sequence.

[0119] The aforementioned Turicimonassp., Turicimonas muris, and Burkholderiales bacterium are examples of microorganisms from which the phytase provided in the present application can be derived, and regardless of the name of the microorganism, it also includes microorganisms taxonomically homologous thereto.

[0120] In the present application, a sequence "derived from" a particular microorganism is not limited to a sequence that is naturally produced or can be produced in the microorganism, but also includes a sequence encoded by a gene that is produced and isolated from the microorganism containing the gene.

[0121] For example, a phytase derived from the genus Thurisimonas includes not only enzymes having phytase activity that are naturally produced by microorganisms of the genus Thurisimonas, but also those produced from sources of the genus Thurisimonas, and those produced in other host cells through genetic modification known in the art (e.g., transformation with a sequence encoding the enzyme).

[0122] As an example of implementation, the polypeptide of the present application may consist of 340 to 370 amino acids and may include, but is not limited to, any one or more of the following sequences: from the N-terminus of SEQ ID NO: 20,

[0123] i) amino acids corresponding to positions 35 to 37 are ASW;

[0124] ii) EKG with amino acids corresponding to positions 48 to 50;

[0125] iii) The amino acid corresponding to positions 80 to 85 is NPNEVE;

[0126] iv) The amino acid corresponding to positions 101 and 102 is IS;

[0127] v) EGN, an amino acid corresponding to positions 167 to 169;

[0128] vi) IPG with amino acids corresponding to positions 210 to 212;

[0129] vii) amino acids corresponding to positions 250 and 251 are GA; and

[0130] viii) The amino acid corresponding to positions 336 to 340 is PVETQ.

[0131]

[0132] While typical phytases are composed of more than 400 amino acids, the polypeptide of the present application is the first phytase to be discovered and differs in that it has 400 amino acids or fewer. Furthermore, the phytase of the present application may include a conserved sequence, such as any one or more of the above-described i) to viii).

[0133]

[0134] As an example of implementation, the polypeptide of the present application may have phytase enzyme activity under acidic conditions as well as under normal conditions.

[0135] If phytic acid cannot be broken down under the digestive conditions inside the stomach of livestock, it may form compounds with metal ions as the pH increases in the small intestine, reducing digestibility. Therefore, activity under acidic conditions may be important for the efficient functioning of feed phytase. The polypeptide of the present application exhibits excellent enzymatic activity under acidic conditions, suggesting that it is also effective as a feed phytase.

[0136] Specifically, the polypeptide of the present application may have, but is not limited to, an increased (e.g., 1.5-fold increase) phytase activity toward phytic acid at pH 3 compared to the activity at pH 5.5.

[0137]

[0138] As an example of implementation, the hydrolysis method of the present application may be performed at a pH of 7 or less, specifically at a pH of 2 to 7, pH of 2 to 6, pH of 3 to 6, or pH of 3 to 5.5, but is not limited thereto.

[0139] The hydrolysis method of the present application may be performed at about 20°C to 80°C, 20°C to 40°C, 30°C to 40°C, 35°C to 40°C, or 37°C, but is not limited thereto.

[0140] The hydrolysis method of the present application may be one in which phytic acid is decomposed into inositol and inorganic phosphorus.

[0141] The substrate of the present application may include phytin (myo-inositol hexakisphosphate), and is not limited in type as long as it includes phytic acid.

[0142]

[0143] Meanwhile, the polypeptide treatment of the present application may be treating a substrate with at least one of a polypeptide having an amino acid sequence having at least 90% identity with any one or more of the amino acid sequences of SEQ ID NOs: 20 to 22 of the present application; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, or a combination thereof.

[0144] Additionally, the polypeptide of the present application may be produced from a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, or a combination thereof.

[0145] The polynucleotide may have various modifications in the coding region within a range that does not change the amino acid sequence of the polypeptide having an amino acid sequence having 90% or more identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 due to codon degeneracy or taking into account codons preferred in an organism that is to express the polypeptide.

[0146] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the base sequence, so long as it is a sequence encoding the polypeptide of the present application.

[0147] The above "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0148] For example, conditions under which polynucleotides having a high degree of homology or identity hybridize with each other, specifically with a homology or identity of 40% or more, specifically with a homology or identity of 90% or more, more specifically with a homology or identity of 95% or more, 96% or more, 97% or more, 98% or more, and even more specifically with a homology or identity of 99% or more, and polynucleotides having a lower degree of homology or identity than that hybridize with each other, or conditions under which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C 1XSSC, 0.1% SDS, specifically with 60°C 0.1XSSC, 0.1% SDS, and more specifically with 68°C 0.1XSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, can be listed.

[0149] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0150] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0151] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0152] For example, the polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 20 to SEQ ID NO: 22 of the present application may consist of, consist essentially of, have, or include, or be a degenerate sequence of SEQ ID NO: 35 to 37, respectively.

[0153]

[0154] The nucleic acid construct provided in the present application comprises a polynucleotide encoding a polypeptide provided in the present application, operably linked to one or more regulatory sequences that direct the expression of the coding sequence (a sequence encoding a polypeptide having an amino acid sequence having at least 90% identity to any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22) in a host cell under appropriate conditions.

[0155] Polynucleotides can be manipulated in a variety of ways to enable polypeptide expression. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide before inserting it into the vector. Such manipulations can be performed using methods known in the art.

[0156]

[0157] The "vector" provided in the present application refers to a DNA construct containing a base sequence of a polynucleotide encoding the polypeptide of the present application, operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the polypeptide of the present application in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0158] The vector that can be used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pDC series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pET28, pDC, pDCM2, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pPICZ(alpha) vectors, etc. can be used.

[0159] For example, a polynucleotide encoding a polypeptide provided in the present application can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0160]

[0161] The host cell of the present application may include, without limitation, any cell capable of expressing the polypeptide of the present application.

[0162] The host cell of the present application may comprise a polypeptide of the present application, a polynucleotide encoding the polypeptide, a nucleic acid construct comprising the same, and / or a vector.

[0163] The nucleic acid construct or vector may be integrated into a chromosome as described above, or may be maintained as an extrachromosomal vector that replicates autonomously.

[0164] The host cell of the present invention includes any progeny of the parent cell that are not identical to the parent cell due to mutations that occur during replication.

[0165] The host cell of the present application may be any cell useful for producing a polypeptide, for example, a prokaryotic cell or a eukaryotic cell.

[0166] The prokaryotic host cell can be any gram-positive or gram-negative bacterium.

[0167] Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

[0168] Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, Vibrio (e.g., Vibrio natriegens), and Ureaplasma.

[0169] In one specific example, the bacterial host cell can be a Bacillus genus host cell, specifically including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells.

[0170] In one specific example, the bacterial host cell can be a Streptococcus genus host cell, specifically including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subspecies Zooepidemicus cells.

[0171] In one specific example, the bacterial host cell can be a host cell of the genus Streptomyces, specifically including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicol, Streptomyces griseus and Streptomyces lividans cells.

[0172] In one specific example, the bacterial host cell may be a host cell of the genus Corynebacterium, such as Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes. ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0173] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0174] The host cell may be a fungal cell. In the present application, "fungus" includes the Ascomycota, Basidiomycota, Fasciomycota, and Zygomycota, as well as the Oomycota and all imperfect fungi.

[0175] The fungal host cell may be a yeast cell. The term "yeast" in the present application includes yeasts belonging to the order ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and Fungi imperfecti (Blastomycetes). However, this classification may vary and may be defined according to the Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0176] The yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, Schizosaccharomyces or Yarrowia cell, for example, Pichia pastoris, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, It may be a cell of Saccharomyces norbensis, Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica.

[0177] The fungal host cell may be a filamentous fungal cell. The term "filamentous fungi" encompasses all filamentous forms of the phylum Fungi and the subphylum Oomycota. Filamentous fungi are typically characterized by hyphal walls composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbonation is strictly aerobic. In contrast, vegetative growth in yeasts, such as Saccharomyces cerevisiae, is by germination of unicellular thalluses, and carbonation may be fermentative.

[0178] The filamentous fungal host cells are Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycellioptora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, It may be a cell of Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.

[0179] For example, the filamentous fungal host cells include Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Mysellioptora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum,It may be a cell of Trichoderma reesei or Trichoderma viride, but is not limited thereto.

[0180] As an example of implementation, the host cell may be one or more selected from the group consisting of bacteria, yeast, and fungi.

[0181]

[0182] Another aspect of the present application provides a method for producing a hydrolysate of phytic acid, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22.

[0183] The above polypeptides and substrates, etc. are as described in other aspects.

[0184] The above hydrolyzate is not limited to the type of hydrolyzate of phytic acid, and may include inositol and inorganic phosphorus, and may also include a hydrolyzate of a substrate including phytic acid.

[0185]

[0186] Another aspect of the present application provides a composition for reaction, comprising: a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 for reaction with phytic acid; and at least one of the polypeptide, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, or a host cell comprising a combination thereof.

[0187] The above polypeptides, polynucleotides, vectors, and host cells are as described in other aspects.

[0188] The reactive composition of the present application can be used for a substrate containing phytic acid and can be used to convert phytic acid into its hydrolyzate.

[0189]

[0190] Another aspect of the present application provides a composition for hydrolyzing a substrate comprising phytic acid, comprising at least one of a polypeptide having an amino acid sequence having at least 90% identity with any one or more of the amino acid sequences of SEQ ID NOs: 20 to 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

[0191] The above polypeptides, polynucleotides, vectors, host cells, and substrates are as described in other aspects.

[0192] As an example of implementation, the substrate may include, but is not limited to, phytin.

[0193]

[0194] The composition of the present application (including both the reaction composition and the hydrolysis composition; hereinafter the same) may additionally include other components in addition to the polypeptide and / or host cell provided in the present application. Those skilled in the art can appropriately select the components added to the composition of the present application.

[0195] As a specific example, the composition of the present application may further comprise any component suitable for converting phytic acid into its hydrolyzate or converting a substrate comprising phytic acid into its hydrolyzate.

[0196] As a specific example, the composition of the present application may further comprise any component suitable for application in various compositions including foods, feeds, pharmaceuticals, and detergents.

[0197] Examples of substances that may be added include, but are not limited to, citrates, stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, admixtures, lubricants, disintegrants, excipients, solubilizers, suspending agents, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, diluents, lubricants, preservatives, and the like.

[0198] In one specific example, the composition provided in the present application may further include a naturally occurring substance or a non-naturally occurring substance in addition to the polypeptide and host cell provided in the present application.

[0199] In one specific example, the composition provided in the present application may further comprise, in addition to the polypeptide and host cell provided in the present application, additional enzymes used in various compositions including foods, feeds, pharmaceuticals, and detergents.

[0200] For example, the additional enzyme may further comprise one or more enzymes selected from the group consisting of beta-amylase, cellulase (beta-glucosidase, cellobiohydrolase and endoglucanase), glucoamylase, hemicellulase (e.g., xylanase), isoamylase, isomerase, lipase, other phytases, proteases, pullulanases and / or alpha-amylase together with other enzymes useful in commercial processes.

[0201]

[0202] The polypeptide of the present application, a host cell expressing the same, and / or a composition comprising the same can be used to convert a substrate (e.g., phytin) into a final product (e.g., 1D-myo-inositol 1,2,3,5,6-pentakisphosphate). In the substrate hydrolysis step, in addition to the polypeptide of the present application and the host cell, cofactors, coenzymes, etc. can be added. The substrate hydrolysis step can be performed under optimal pH, temperature, etc. conditions, and those skilled in the art can select appropriate conditions.

[0203] Meanwhile, the polypeptide and / or host cell of the present application can be used to process feed containing grains and oilseeds containing phytic acid. Such feed can be used by mixing one or more of organic acids such as citric acid, fumaric acid, adipic acid, and lactic acid; phosphates such as potassium phosphate, sodium phosphate, and polymeric phosphate; and natural antioxidants such as polyphenols, catechins, tocopherols, vitamin C, green tea extract, chitosan, and tannic acid for administration. Other conventional additives such as anti-influenza agents, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, or lubricants can be additionally added to formulate the feed into injectable formulations such as aqueous solutions, suspensions, and emulsions, capsules, granules, or tablets. In addition, the above feed can be used with various auxiliary ingredients such as amino acids, minerals, vitamins, antioxidants, antifungals, antibacterial agents, etc., as auxiliary ingredients, and plant-based protein feed such as ground or crushed wheat, barley, corn, etc., animal-based protein feed such as blood meal, meat meal, fish meal, etc., animal fats and plant-based fats, in addition to the main ingredients, nutritional supplements, growth promoters, digestion and absorption promoters, and disease preventive agents. The treatment can provide mineral sufficiency for humans and livestock through decomposition in the digestive tract of single-animal animals, and prevent eutrophication and water pollution in rivers and lakes in densely populated areas.

[0204]

[0205] Another aspect of the present application provides a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof, for use in hydrolyzing phytic acid.

[0206] The above polypeptide, polynucleotide, and host cell, etc. are as described in other aspects.

[0207]

[0208] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0209]

[0210] Example 1: Construction of expression vectors and expression strains for candidate phytases

[0211] A codon-optimized polynucleotide for expression in Pichia pastoris was synthesized based on the amino acid sequence (SEQ ID NO: 1 to 28) of a protein known to be histidine acid phosphatase (Cosmogenetech Co., Ltd). During polynucleotide synthesis, the sequence AGAGGCTGAAGCT (SEQ ID NO: 38) was added to the N-terminus and CTCGAGCATCATCAT (SEQ ID NO: 39) was added to the C-terminus for infusion cloning with the expression vector pPICZ (alpha). Thereafter, the synthesized polynucleotide and vector were cloned using the Infusion HD Cloning Kit (Takara, Cat. No. 639650) to construct a recombinant plasmid.

[0212] Each constructed recombinant plasmid was introduced into Pichia pastoris (Pichia pastorisbg10, Ravinder Kumar, Yeast, 2019, 36(6):399-410) by electroporation, and plated on YPD medium (Yeast extract 1%, peptone 2%, Dextrose 2%, Agar 2%) containing the antibiotic zeocin, and incubated at 30°C for 3 days. The introduction of the recombinant plasmid into the transformants was confirmed using the primer set in Table 1 below.

[0213]

[0214] Sequence name Primer sequence (5'→3') pPICZ-N ​​(SEQ ID NO: 40) ACAGCACAAATAACGGGTTATTGTTTATAAAT pPICZ-C (SEQ ID NO: 41) AATGATTTCCCAAACCCCTACCACAAGATATTC

[0215]

[0216] Example 2: Expression and purification of candidate phytases

[0217] The transformants produced in Example 1 were inoculated into 5 ml of 1% BMGY medium and pre-cultured for 24 hours at 30°C and 220 rpm. 1 ml of the pre-culture was then cultured in 20 ml of 1% BMGY medium at 28°C for 24 hours at 220 rpm. After 24 hours, 0.3 ml of 100% methanol was added to the main culture for induction, and 0.3 ml of methanol was added every 24 hours. 72 hours after methanol induction, the culture was stopped, and the culture was centrifuged to separate the bacteria and the supernatant. In addition, only pure candidate phytase was isolated from the supernatant using the following Ni-NTA purification method: Specifically, the supernatant was passed through Ni-NTA resin (Qiagen, Cat no. 30230) for adsorption, and then washed with wash buffer (imidazole 20 mM) and elution buffer (imidazole 250 mM) sequentially to obtain purified polypeptide.

[0218]

[0219] Example 3: Activity evaluation of candidate phytases

[0220] 3-1. Evaluation of enzyme activity under normal conditions

[0221] For enzyme activity evaluation, a reaction solution containing 2 mM phytic acid (Merck, Cat no. 593648) and 250 mM buffer (pH 3.0: Biosesang, Cat no. G2009-3.0 or pH 5.5: Invitrogen, Cat no. AM9740) was previously kept at 37°C in a thermomixer (Eppendorf, EP5382000023). An appropriate amount of each purified enzyme obtained in Example 2 was mixed with the reaction solution, reacted for a certain period of time, and then the reaction was stopped with a color development buffer. To prepare a color buffer, 65 to 68% nitric acid (Merck, Cat no. 609323), 100 g / L ammonium molybdate (Merck, Cat no. 277908), and 2.35 g / L ammonium metavanadate (Merck, Cat no. 205559) were mixed in a volume ratio of 2:1:1.

[0222] The absorbance was measured at 415 nm 10 minutes after the reaction was stopped, and the results obtained are shown in Table 2 below.

[0223]

[0224] - Activity: Defined as Unit / mg, where Unit is the amount of enzyme that releases 1 μmol of phosphate per minute.

[0225] - Relative activity: Enzyme activity of each sequence number shown in Table 2 / Enzyme activity of sequence number 21 X 100 (%)

[0226]

[0227] 시이번다유래(Origin)자이(Activity)(pH5.5, Unit / mg)상대적자자 (%)1Pandoraea fibrosis5112Kosakonia sacchari1,415233Kosakonia radicincitans1,605264Jejubacter calystegiae27445Enterobacteriaceaebacterium RIT7111,436236Trinickia diaoshuihuensis31857Acidipila sp. 4G-K138018Prevotella309Serratia odorifera432710unclassifiedPantoea251411unclassifiedPantoea143212Pantoea102213Yersiniaceae165314Caulobacter sp.8015Serratia rubidaea378616Serratia sp.FGI9412017Serratia sp.ATCC 390067001118Erwinia iniecta525919Acidipila sp.4G-K1358120Turicimonas muris1,7132821Turicimonas muris6,13510022Burkholderialesbacterium5,2198523Burkholderialesbacterium0024Burkholderiaceaebacterium0025Parasutterella0026Parasutterella sp.139227Proteobacteria bacterium9028Parasutterella excrementihominisCAG:2333506

[0228] Although it is known that all of SEQ ID NOs: 1 to 28 can be histidine acid phosphatases, as a result of enzyme evaluation under normal conditions (pH 5.5), as shown in Table 2 above, polypeptides having sequences of SEQ ID NOs: 1, 7, 8, 14, 16, 19, 23, 24, 25, and 27 had extremely low or almost no phytase activity. Enzymes with less than 90% homology to SEQ ID NO: 21 (i.e., enzymes other than SEQ ID NOs: 20 to 22) had low relative activity overall, whereas enzymes with more than 90% homology to SEQ ID NO: 21 (SEQ ID NOs: 20 to 22) showed high specific activity (relative activity) compared to other enzymes.

[0229]

[0230] 3-2. Evaluation of enzyme activity under acidic conditions

[0231] The activity of the phytase of sequence number 21, which showed the highest activity under normal conditions (pH 5.5), and the enzymes of representative sequences (sequence numbers 20 to 28) showing high homology thereto under acidic conditions (pH 3.0) were compared and evaluated. The results are shown in Table 3 below.

[0232]

[0233] Sequence number derived activity (pH 3.0, U / mg) activity (pH 5.5, U / mg) sequence identity (%) 20 Turicimonas muris 3,6391,713100 21 Turicimonas muris 10,7636,13595 22 Burkholderialesbacterium 10,6045,21996 23 Burkholderialesbacterium 15051 24 Burkholderiaceaebacterium 221058 25 Parasutterella 415060 26 Parasutterella sp. 73813960 27 Proteobacteriabacterium 767960 28 Parasutterella excrementihominis CAG:2331,61335060

[0234] As shown in Table 3 above, proteins with high homology to SEQ ID NO: 21 (SEQ ID NOs: 20 to 22) have more than 90% identity with each other, and surprisingly, they not only exhibited high enzyme activity at pH 5.5, but also exhibited very high activity under acidic conditions of pH 3, which was confirmed to be up to 212% higher than that at pH 5.5. Meanwhile, for SEQ ID NOs: 2, 3, and 5, the phytase enzyme activity at pH 3.0 was confirmed to be similar to or lower than that at pH 5.5.

[0235]

[0236] Example 4: Sequence comparison with known enzymes

[0237] The results of comparing the identity of the sequence of the enzyme known to have phytase activity with the sequence of SEQ ID NO: 21 are shown in Table 4 below.

[0238]

[0239] PDB IDOrigin Sequence identity (%) SEQ ID NO: 21 Turicimonas muris 100 SEQ ID NO: 29 (2WU0) Klebsiella sp. ASR 128 SEQ ID NO: 30 (1QWO) Aspergillus fumigatus 19 SEQ ID NO: 31 (1DKM) Escherichia coli 39 SEQ ID NO: 32 (1U26) Selenomonas ruminantium 22 SEQ ID NO: 33 (3ZHC) Citrobacter braakii 34 SEQ ID NO: 34 (3K4P) Aspergillus niger 18

[0240] In particular, as shown in Table 4 and Fig. 1, it was confirmed that the phytases of SEQ ID NOs: 20, 21, and 22 have very low sequence similarity with phytase enzymes discovered so far. In addition, while the amino acid sequence length of general phytase exceeds 400, SEQ ID NOs: 20, 21, and 22 have less than 400 amino acids.

[0241]

[0242] Sequence numbers 20 to 22 of the present application have sequences with 90% or more identity to each other, and from the above results, it was confirmed that a polypeptide with 90% or more identity to any one or more amino acid sequences of SEQ ID NOs 20 to 22 is a novel phytase with low sequence identity to polypeptides known to have existing phytase activity, and that it not only exhibits high enzyme activity under normal conditions but also has very high enzyme activity under acidic conditions.

[0243]

[0244] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A method for hydrolyzing phytic acid, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO:

22.

2. In the first paragraph, the polypeptide is composed of 340 to 370 amino acids and comprises at least one sequence among the following i) to viii): From the N-terminus of sequence number 20, i) The amino acid corresponding to positions 35 to 37 is ASW ii) EKG with amino acids corresponding to positions 48 to 50; iii) The amino acid corresponding to positions 80 to 85 is NPNEVE; iv) The amino acid corresponding to positions 101 and 102 is IS; v) EGN, an amino acid corresponding to positions 167 to 169; vi) IPG with amino acids corresponding to positions 210 to 212; vii) amino acids corresponding to positions 250 and 251 are GA; and viii) The amino acid corresponding to positions 336 to 340 is PVETQ.

3. A hydrolysis method according to claim 1, wherein the polypeptide has phytase activity under acidic conditions.

4. A hydrolysis method according to claim 1, wherein the polypeptide has increased phytase activity toward phytic acid at pH 3 compared to the activity at pH 5.

5.

5. A hydrolysis method according to claim 1, wherein the method is performed at a pH of 7 or lower.

6. A hydrolysis method in the first paragraph, wherein the phytic acid is decomposed into inositol and inorganic phosphorus.

7. A hydrolysis method according to claim 1, wherein the polypeptide treatment is performed by treating a substrate with at least one of the polypeptide, a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

8. A hydrolysis method according to claim 1, wherein the substrate comprises phytin.

9. A method for producing a phytic acid hydrolysate, comprising the step of treating a substrate with a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO:

22.

10. A composition for reaction, comprising a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22 for reaction with phytic acid; and at least one of a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

11. A composition for hydrolyzing a substrate containing phytic acid, comprising a polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof.

12. A composition for hydrolysis according to claim 11, wherein the substrate comprises phytin.

13. A polypeptide having an amino acid sequence having at least 90% identity with any one or more amino acid sequences of SEQ ID NO: 20 to SEQ ID NO: 22; and a host cell comprising the polypeptide, a polynucleotide encoding the polypeptide, or a combination thereof, for use in hydrolyzing phytic acid.

Images