Multi-zonal liver organoids
Multi-zonal liver organoids are created by co-culturing bilirubin-treated human liver organoids to replicate human liver zones, addressing the challenge of in vitro replication and offering advanced disease modeling and therapeutic utility.
Patent Information
- Application Number
- PCT/US2025/023001
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-03
- Filing Date
- 2025-04-03
- Publication Date
- 2025-10-09
AI Technical Summary
The challenge of replicating the spatially segregated metabolic functions of human liver zones in vitro remains unsolved, necessitating a system capable of modeling and interrogating metabolic diseases with zonal specificity, given the genetic and molecular differences between rodents and humans.
The development of multi-zonal liver organoids is achieved through co-culturing human liver organoids, one treated with bilirubin and optionally ascorbate or doxycycline, to create phenotypically distinct hepatocyte subpopulations mimicking zone 1, 2, and 3 hepatocytes, with controlled exposure to bilirubin and GULO expression to establish a zonal gradient.
The method produces liver organoids with observable boundaries between hepatocyte subpopulations, exhibiting functions characteristic of human liver zones, enabling advanced modeling of metabolic diseases and potential therapeutic applications.
Smart Images

Figure US2025023001_09102025_PF_FP_ABST
Abstract
Description
Attorney Docket No.: CHMC.P0026WO PCT MULTI-ZONAL LIVER ORGANOIDS STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH
[0001] This invention was made with government support under Grant No. DP2 DK128799-01 and R01 DK135478 awarded by the National Institutes of Health. The government has certain rights in the invention. PRIORITY
[0002] The present application claims the benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 573,895, MULTI-ZONAL LIVER ORGANOIDS, filed on filed April 3, 2024, which is currently co-pending herewith and which is incorporated by reference in its entirety. FIELD
[0003] Aspects of the present disclosure generally relate to advanced liver organoids prepared from human pluripotent stem cells, methods of preparation, and compositions including the same, as well as uses thereof. BACKGROUND
[0004] The liver is a multi-faceted organ with a wide range of functions, such as glycolysis and gluconeogenesis, lipogenesis and fatty acid oxidation, protein synthesis, and xenobiotic catabolism. These divergent and complex functions are spatially segregated through compartmentalization into distinct regions, called zone 1, zone 2, and zone 3 hepatocytes, based on their proximity from the central vein to the portal vein. For example, the maintenance of nitrogen level in the liver is precisely balanced between the input of nutrients and the output as ammonia, which is metabolized by the urea cycle, nitric oxide cycle, and glutamine synthesis. The urea cycle is primarily carried out in zone 1 and 2 hepatocytes, while glutamine synthesis takes place in zone 3 hepatocytes, and the nitric oxide cycle is primarily maintained in zone 2 and 3 hepatocytes. Citrulline is necessary for these pathways and its levels are maintained by the nitric oxide cycle, which is augmented by glutathione. As a consequence of this zonal segregation of hepatic functions, metabolic diseases tend to manifest within the particular zone in which thederangement is most significant. For the various distinct roles, the onset of metabolic diseases has zonal preference.
[0005] While much of the expression patterns are conserved between rodent and human liver zonation, some variations in metabolic compartmentalization exists due to the differences in metabolic demands. Specifically, only 35.3% of all genes expressed in the human liver have similar expression to those in mice, indicating the existence of unique genetic networks and transcriptional regulation. One example is glutamine synthetase (GLUL) and carbamoylphosphate synthetase (CPS1), which participate in nitrogen metabolism, and overlap in pericentral and periportal regions, respectively, in rat liver. However, the human liver contains an intermediate zone where neither enzyme is present. These inherent genetic and molecular differences necessitate a need for a human system capable of modeling and interrogating the development and disease that occur in patients.
[0006] Studying divergent (distinct) hepatocyte subpopulations across differential zones along the porto-central axis can allow for the understanding of metabolic homeostasis and disruption in the liver. However, in vitro replication of multi-zonal hepatocytes remains an unmet challenge. Such multi-zonal hepatocytes, if developed, can have tremendous implications and utility, for example, in studying liver disease and developing treatment strategies, as well as in transplantation. SUMMARY
[0007] Embodiments of the disclosure include methods of producing multi-zonal liver organoids, the methods including: co-culturing one or more first human liver organoid (HLO) with one or more second HLO, wherein the second HLO comprises a bilirubin-treated HLO; contacting the co-cultured first HLO and the bilirubin-treated second HLO with bilirubin for a period of time to provide a liver organoid with at least one phenotypically distinct (e.g. structurally distinct, and / or functionally distinct, etc.) hepatocyte subpopulation.
[0008] In some embodiments, the first HLO can be an ascorbate-treated HLO. In some embodiments, the first HLO can be a doxycycline-treated HLO. For example, in some embodiments, the first HLO is a functional L-gulonolactone oxidase (GULO)-expressing HLO. In some embodiments wherein the first HLO is a functional L-gulonolactone oxidase (GULO)- expressing HLO, a zonal gradient can be created in the multi-zonal liver organoid.
[0009] In some embodiments, the first HLO and / or the bilirubin-treated second HLO comprises an immature HLO. In some embodiments, the first HLO comprises an immature HLO. In some embodiments, the first HLO comprises an immature functional L-gulonolactone oxidase (GULO)-expressing HLO. In some embodiments, the bilirubin-treated second HLO comprises an immature HLO. In some embodiments, the first HLO comprises an immature HLO, and the bilirubin-treated second HLO comprises an immature HLO.
[0010] In some embodiments, the first HLO includes an ascorbate-enriched progenitor cell population, and the bilirubin-treated second HLO includes a bilirubin-enriched progenitor cell population.
[0011] In some embodiments, each phenotypically distinct hepatocyte subpopulation includes a zone 1 (Z1) or zone 1-like (Z1-like) hepatocyte subpopulation, a zone 2 (Z2) or zone 2- like (Z2-like) hepatocyte subpopulation, or a zone 3 (Z3) or zone 3-like (Z3-like) hepatocyte subpopulation. In some embodiments, there is an observable and / or measurable boundary between two or more phenotypically distinct hepatocyte subpopulations. In some embodiments, this boundary can be along the portal-central axis. In some embodiments, the co-cultured first HLO (e.g. a functional GULO-expressing HLO, optionally an immature HLO) and the bilirubin-treated second HLO (optionally another immature HLO) are contacted with bilirubin for a period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations. In some embodiments, the co-cultured first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to self-assemble. In some embodiments, the co-cultured first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to fuse into interconnected dual organoids. In some embodiments, the period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations, to self-assemble into multizonal HLOs, and / or to fuse into interconnected dual organoids can be at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days.
[0012] In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) includes a Z1 or Z1-like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation, and / or the bilirubin-treated second HLO includes a Z1 or Z1-like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation. In some embodiments, the multi-zonal liver organoid includes two or more hepatocyte subpopulations. In some embodiments, there is an observable and / or measurableboundary between two or more phenotypically distinct hepatocyte subpopulations. In some embodiments, the two or more hepatocyte subpopulations include a Z1 or Z1-like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation; or a Z1 or Z1-like hepatocyte subpopulation and a Z2 or Z2-like hepatocyte subpopulation; or a Z2 or Z2-like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation. In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) includes a Z1 or Z1-like hepatocyte subpopulation, and the bilirubin-treated second HLO includes a Z3 or Z3-like hepatocyte subpopulation. In some embodiments, the multi-zonal liver organoid includes three or more hepatocyte subpopulations. In some embodiments, the three or more hepatocyte subpopulations include a Z1 or Z1-like hepatocyte subpopulation, a Z2 or Z2-like hepatocyte subpopulation, and a Z3 or Z3-like hepatocyte subpopulation. In some embodiments, there is an observable and / or measurable boundary between two or more phenotypically distinct hepatocyte subpopulations.
[0013] In some embodiments, the liver organoid includes a tubular structure with a single lumen. In some embodiments, the liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
[0014] In some embodiments, during the co-culturing, the concentration of bilirubin can be maintained continuously. In some embodiments, during the co-culturing, the concentration of bilirubin can be refreshed through addition of exogenous bilirubin during every media change. In some embodiments, during the co-culturing, the concentration of bilirubin can be maintained continuously at a level less than or equal to about 5 mg / L. In some embodiments, during the co- culturing, the bilirubin concentration during the co-culturing step can be maintained continuously at about 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L, 0.7 mg / L, 0.8 mg / L, 0.9 mg / L, 1 mg / L, 1.1 mg / L, 1.2 mg / L, 1.3 mg / L, 1.4 mg / L, 1.5 mg / L, 1.6 mg / L, 1.7 mg / L, 1.8 mg / L, 1.9 mg / L, 2 mg / L, 2.1 mg / L, 2.2 mg / L, 2.3 mg / L, 2.4 mg / L, 2.5 mg / L, 2.6 mg / L, 2.7 mg / L, 2.8 mg / L, 2.9 mg / L, or 3 mg / L; preferably at about 1 mg / L. In some embodiments, the functional GULO-expressing HLO and bilirubin-treated HLO are co-cultured with bilirubin in a hepatocyte culture medium. In some embodiments, the hepatocyte culture medium includes HCM, hepatocyte growth factor, oncostatin M, and / or dexamethasone, or any combination thereof.
[0015] In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO are seeded for co-culturing at a density of greater than about 1×104cells / well, greater than about 0.5×105cells / well, greater than about 1×105cells / well, greater than about 2×105cells / well, greater than about 3×105cells / well, greater than about 4×105cells / well, greater than about 5×105cells / well, or higher. In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO are seeded for co- culturing at a density of greater than about 50-5000 organoids per well; preferably about 500-2000 organoids per well. In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO are seeded for co-culturing at a ratio of about 1:1; or 2:1, 3:1, 4:1, 5:1, or greater; or 1:2, 1:3, 1:4, 1:5, or greater; preferably at a ratio of about 1:1.
[0016] In some embodiments, the functional GULO-expressing HLO can be produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of a heterologous expression system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells under conditions to induce expression from the heterologous expression system, to provide the functional GULO-expressing HLO.
[0017] In some embodiments, the functional GULO-expressing HLO can be produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of an inducible system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with an induction agent, to provide the functional GULO-expressing HLO.
[0018] In some embodiments, the functional GULO-expressing HLO can be produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of an tetracycline inducible system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with doxycycline, to provide the functional GULO-expressing HLO.
[0019] In some embodiments, the functional GULO-expressing HLO produced from a genetically modified progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, is able to synthesize ascorbate. In some embodiments, the functional GULO protein is a Rodentia GULO, preferably a murine GULO (mGULO). In some embodiments, the culturing the posterior foregut cells under conditions to induce expression from the heterologousexpression system occurs on or about day 17 of culture of the progenitor cell population. In some embodiments, the functional GULO-expressing HLO can be engineered with the gene that encodes for the functional GULO protein using CRISPR. In some embodiments, the gene or mRNA, or both, that encodes for the functional GULO protein can be introduced to the functional GULO- expressing HLO by transfection.
[0020] In some embodiments, the bilirubin-treated HLO can be produced by: culturing a progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with bilirubin, to provide the bilirubin-treated HLO.
[0021] In some embodiments, the multi-zonal liver organoid can have: a) expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; b) expression of one or more Z2-associated genes and / or expresses one or more Z2-associated proteins; c) expression of one or more Z3-associated genes and / or expresses one or more Z3- associated proteins; and / or d) expression of one or more pan-hepatocyte-associated genes and / or expresses one or more pan-hepatocyte-associated proteins. In some embodiments, the multi-zonal liver organoid can have expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; and expression of one or more Z3-associated genes and / or expresses one or more Z3-associated proteins. In some embodiments, the multi-zonal liver organoid can have expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; expression of one or more Z2-associated genes and / or expresses one or more Z2- associated proteins; expression of one or more Z3-associated genes and / or expresses one or more Z3-associated proteins; and expression of one or more pan-hepatocyte-associated genes and / or expresses one or more pan-hepatocyte-associated proteins. In some embodiments, the Z3- associated genes and / or Z3-associated proteins function in xenobiotic metabolism, WNT signaling, glycolysis, and / or lipogenesis. In some embodiments, the Z1-associated genes and / or Z1-associated proteins function in gluconeogenesis, lipid catabolism, glutamine catabolism, and / or reactive oxygen species (ROS) metabolism. In some embodiments, the Z2-associated genes and / or Z2-associated proteins function in DNA repair, amino acid metabolism, and / or cell growth. In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) can have elevated expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; and / or wherein the bilirubin-treated second HLO can have elevated expression of one or more Z3-associated genes and / or expresses one or more Z3-associated proteins. In some embodiments, the one or more Z1-associated genes can be selected from Fumarylacetoacetase(FAH), 4-Hydroxyphenylpyruvate dioxygenase (HPD), Stearoyl-CoA desaturase (SCD), Acyl- coenzyme A synthetase 2 (ACSS2), Argininosuccinate lyase (ASL), Carbamoyl phosphate synthetase I (CPS1), Ornithine transcarbamylase (OTC), Stem-loop binding protein (SLBP), Glutaminase (GLS), and Rho family GTPase 3 (RND3) genes; the one or more Z1-associated proteins are selected from CPS1 and ACSS2; the one or more Z2-associated genes can be selected from Glutathione synthetase (GSS), Telomerase reverse transcriptase (TERT), and Aldo-keto reductase family 1 member C1 (AKR1C1); the one or more Z3-associated genes can be selected from Aldehyde dehydrogenase 6 family member A1 (ALDH6A1), Organic anion transporter polypeptide 2 (OATP2), Growth hormone receptor (GHR), Aldehyde dehydrogenase 1A2 (ALDH1A2), Glutamine synthetase (GLUL), Hypoxia-inducible factor 1-alpha (HIF1A), Sterol regulatory element-binding protein 1 (SREBF1), Cytochrome P450 family 3 subfamily A member 4 (CYP3A4), Cytochrome P450 family 1 subfamily A member 2 (CYP1A2), Butyrylcholinesterase (BCHE), and Regulator of calcineurin 1 (RCAN1); the one or more Z3- associated proteins are selected from GLUL and NR3C1 proteins; and / or the one or more pan- hepatocyte marker genes are selected from ACSS2, ALDH6A1, AKR1C1, Alpha-1 antitrypsin (A1AT), Haptoglobin-related protein (HPR), Hepatocyte nuclear factor 4 alpha (HNF4A), CCAAT enhancer binding protein alpha (CEBPA), Albumin (ALB), HNF1 homeobox A (HNF1A), Prospero homeobox 1 (PROX1), and Tubulin alpha-1A (TUBA1A).
[0022] In some embodiments, the multi-zonal liver organoid can have hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and / or glutamine metabolic functionality. In some embodiments, the multi-zonal liver organoid can have at least 5, at least 10, or at least 15 of the functionalities. In some embodiments, the multi-zonal liver organoid can have hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and glutamine metabolic functionality. In some embodiments, the multi-zonal liver organoid can be enriched for Notch signaling and / or Wnt signaling.
[0023] In some embodiments, the multi-zonal liver organoid includes hepatocytes and additionally includes one or more additional cell types selected from cholangiocytes, endothelial cells, macrophages, stellate cells, and mesenchyme cells. In some embodiments, the multi-zonal liver organoid includes hepatocytes and additionally includes cholangiocytes, endothelial cells, macrophages, stellate cells, and mesenchyme cells. In some embodiments, the multi-zonal liver organoid includes two or more cell types selected from pericentral or pericentral-like (Z3 or Z3- like) hepatocytes, periportal or periportal-like (Z1 or Z1-like) hepatocytes, and interzonal or interzonal-like (Z2 or Z2-like) hepatocytes. In some embodiments, the multi-zonal liver organoid includes: a) pericentral or pericentral-like (Z3 or Z3-like) hepatocytes, b) periportal or periportal- like (Z1 or Z1-like) hepatocytes, and c) interzonal or interzonal-like (Z2 or Z2-like) hepatocytes. In some embodiments, the multi-zonal liver organoid further includes hepatoblasts. In some embodiments, the hepatoblasts can be characterized as expressing fetal markers and / or growth mitogenic markers. In some embodiments, the fetal markers include Alpha-Fetoprotein (AFP) and the growth mitogenic markers include Insulin-like growth factor 2 (IGF2) and / or mitogen- activated protein kinase 2 (MAP2K2).
[0024] In some embodiments, the multi-zonal liver organoid is human. In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) and the bilirubin-treated second HLO have been differentiated from pluripotent stem cells, optionally embryonic stem cells and / or induced pluripotent stem cells (iPSCs).
[0025] In some embodiments, the first HLO (e.g. a functional GULO-expressing HLO) and / or the bilirubin-treated HLO has been made according to a method including: a) contacting definitive endoderm cells (DE) with an FGF signaling pathway activator and a Wnt signaling pathway activator for a first period of time; b) contacting the cells of step a) with the FGF signaling pathway activator, the Wnt signaling pathway activator, and a retinoic acid (RA) signaling pathway activator for a second period of time, thereby differentiating the DE to posterior foregut cells; and c) embedding the posterior foregut cells in a basement membrane matrix and culturing the posterior foregut spheroids for a third period of time to differentiate the posterior foregut cells to the first HLO (e.g. a functional GULO-expressing HLO) and / or the bilirubin-treated HLO.
[0026] Further embodiments of the disclosure include multi-zonal liver organoids, produced by any of the preceding methods. Further embodiments of the disclosure include artificial multi-zonal liver organoids, including Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes. In some embodiments, there is an observable and / or measurableboundary between two or more types of hepatocytes. In some embodiments, the hepatocytes self- assemble into the multi-zonal liver organoid. In some embodiments, the multi-zonal liver organoid includes a structure with a single lumen. In some embodiments, the multi-zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
[0027] In some embodiments, the multi-zonal liver organoid includes a hepatoblast population and at least two phenotypically distinct interzonal hepatocyte populations. In some embodiments, the multi-zonal liver organoid includes SERPINA1+ hepatocytes, KRT7+ cholangiocytes, PECAM1+ endothelial cells, LYZ+ macrophages, COL1A1+ stellate cells, and CD44+ mesenchyme. In some embodiments, at least a portion of the multi-zonal liver organoid includes a functional L-gulonolactone oxidase (GULO)-expressing cell population. In some embodiments, the multi-zonal liver organoid expresses one or more pan hepatocyte markers, one or more basal marker, and one or more apical marker; optionally wherein the one or more pan hepatocyte markers include ALB, HNF1A, A1AT, CEBPB, PROX1, HNF4A, and / or TUBA1A; and / or optionally wherein the one or more basal markers include CTNNB1; and / or optionally wherein the one or more apical markers include ZO-1. In some embodiments, the multi-zonal liver organoid expresses one or more periportal marker, one or more interzonal marker, and one or more pericentral zonal marker; optionally wherein said markers include TET1, GLS, GLS2, ALDH1A2, ALDH6A1, GHR, AR, CPS1, OTC, ACSS2, ARG1, GLUL, CYP2E1, and / or HIF1A. In some embodiments, the multi-zonal liver organoid has nitrogen, glucose and lipid metabolic activity; optionally wherein said activity includes urea cycle activity, glutathione S-transferase activity, and / or glutamine synthesis.
[0028] Further embodiments of the disclosure include cell compositions in the form of one or more three-dimensional artificial multi-zonal liver organoids, including Z1-like (periportal-like) hepatocytes, and / or Z3-like (pericentral-like) hepatocytes. In some embodiments, there is an observable and / or measurable boundary between two or more types of hepatocytes. In some embodiments, the hepatocytes self-assemble into the three-dimensional artificial multi-zonal liver organoid. In some embodiments, the three-dimensional artificial multi-zonal liver organoid includes a tubular structure with a single lumen. In some embodiments, the three-dimensional artificial multi-zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
[0029] Further embodiments of the disclosure include ex vivo compositions including one or more three-dimensional multi-zonal liver organoids, including Z1-like (periportal-like)hepatocytes, and Z3-like (pericentral-like) hepatocytes. In some embodiments, there is an observable and / or measurable boundary between two or more types of hepatocytes. In some embodiments, the hepatocytes self-assemble into the three-dimensional artificial multi-zonal liver organoid. In some embodiments, the three-dimensional artificial multi-zonal liver organoid includes a tubular structure with a single lumen. In some embodiments, the three-dimensional artificial multi-zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
[0030] In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions further include Z2-like (interzonal-like, mid-lobular-like) hepatocytes. In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions further include hepatoblasts. In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions further include cholangiocytes, endothelial cells, macrophages, stellate cells, and / or mesenchyme cells. In some embodiments, the Z1-like hepatocytes and / or Z3-like hepatocytes can be differentiated from pluripotent stem cells, preferably iPSCs. In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions further include ascorbate (vitamin C), and exogenously provided bilirubin. In some embodiments, the Z1-like hepatocytes can be engineered to express a heterologous functional GULO protein, and ascorbate is produced by the Z1-like hepatocytes.
[0031] In some embodiments of the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions, the composition includes exogenously provided bilirubin at a concentration of about 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L, 0.7 mg / L, 0.8 mg / L, 0.9 mg / L, 1 mg / L, 1.1 mg / L, 1.2 mg / L, 1.3 mg / L, 1.4 mg / L, 1.5 mg / L, 1.6 mg / L, 1.7 mg / L, 1.8 mg / L, 1.9 mg / L, 2 mg / L, 2.1 mg / L, 2.2 mg / L, 2.3 mg / L, 2.4 mg / L, 2.5 mg / L, 2.6 mg / L, 2.7 mg / L, 2.8 mg / L, 2.9 mg / L, or 3 mg / L; preferably at about 1 mg / L.
[0032] In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions include about 20-40% Z3-like (pericentral-like) cells, about 20-40% Z1-like (periportal-like) cells, about 20-40% hepatoblasts, and about 10-30% Z2-like (interzonal-like) cells. In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions include greater than or equal to 10% Z2-like cells, and / or greater than or equal to 20% hepatoblasts.In some embodiments, the multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions include less than or equal to 15% cholangiocytes.
[0033] Further embodiments of the disclosure include methods of treating a liver-related disease or disorder, the methods including: transplanting, into a subject having liver dysfunction and / or failure, a multi-zonal liver organoid, according to any of the aforementioned methods or processes. In some embodiments, the transplanted multi-zonal liver organoids engraft onto the liver of the subject. In some embodiments, the methods include transplanting including: a) ligating a bile duct in a subject; and b) transplanting the multi-zonal liver organoid at base of the liver.
[0034] In some embodiments, the liver-related disease or disorder includes one or more types of liver dysfunction and / or failure, hepatitis, viral hepatitis, cholangitis, fibrosis, hepatic encephalopathy, hepatic porphyria, cirrhosis, cancer, drug-induced cholestasis, metabolic disease, autoimmune liver disease, Wilson’s disease, metabolic-associated fatty liver disease, hyperammonemia, hyperbilirubinemia, Crigler-Najjar Syndrome, urea cycle disorders, Wolman disease, hepatic cancer, hepatoblastoma, metabolic dysfunction–associated liver disease (MASLD), MetALD, metabolic dysfunction-associated steatohepatitis (MASH), drug-induced liver injury (DILI), glycogen storage disease, hemorrhagic disease, hepatic cyst, and / or alcohol- associated liver disease. In some embodiments, the liver dysfunction and / or failure includes hyperammonemia and / or hyperbilirubinemia. In some embodiments, the metabolic disease includes nonalcoholic fatty liver disease (NAFLD). In some embodiments, the nonalcoholic fatty liver disease (NAFLD) includes metabolic dysfunction-associated steatohepatitis (MASH). In some embodiments, the hepatitis includes hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, hepatitis TT, and / or autoimmune hepatitis.
[0035] In some embodiments, the subject has improvements one or more of the liver- related disease or disorders following transplantation. In some embodiments, the subject has improvements in hyperammonemia and hyperbilirubinemia.
[0036] In some embodiments, the subject has reduced serum bilirubin and / or ammonia levels, and / or increased serum protein albumin following transplantation. In some embodiments, the subject has reduced serum bilirubin and ammonia levels following transplantation. In some embodiments, the subject has reduced serum bilirubin and ammonia levels, and increased serum protein albumin following transplantation. In some embodiments, the subject has improved symptoms of biliary stricture and / or liver regeneration following transplantation. In some embodiments, the subject has an increased survival rate following transplantation.
[0037] Further embodiments of the disclosure include use of the aforementioned multi- zonal liver organoids, as an in vitro human model system for studying hepatocyte function and developmental divergence; studying liver-related disease; identifying therapeutic targets; and / or identifying therapeutic compounds and / or compositions effective in treating a liver-related disease or disorder, and uses of the aforementioned multi-zonal liver organoids for treating a liver-related disease or disorder.
[0038] Further embodiments of the disclosure include the aforementioned multi-zonal liver organoids, for use in the manufacture of a medicament for the treatment of a liver-related disease or disorder.
[0039] Further embodiments of the disclosure include kits including means for performing any of the aforementioned methods, and kits including any of the aforementioned multi-zonal liver organoids, artificial multi-zonal liver organoids, cell compositions, and / or ex vivo compositions. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0041] Figure 1. Intracellular redox management enables CPS1+ hepatocyte specification in HLOs.
[0042] Fig. 1A. H&E histology, GLS2 IHC, and GS IHC images of liver sections are shown in panels from ODS od / od (GULO mutant) rat treated with 0.2% Ascorbic acid (AsA), ODS od / od rat treated without AsA. Scale bars indicate 100µm. The graph shows the GLS2 or GS positive area ratio versus the hematoxylin positive area in ODS od / od (GULO mutant) rat treated with 0.2% Ascorbic acid (AsA) and ODS od / od rat treated without AsA. Data points are shown for GLS2 area at portal vein (37 portal vein sections of + AsA rats, 27 portal vein sections of - AsA rats) and GS area in 8 images of + / - AsA rat.
[0043] Fig. 1B. Schematic for development of Z1-HLOs and doxycycline induction to induce CPS1+ hepatocyte specification (left). Brightfield and fluorescence images of mCherry expression in ascorbate depleted Dox (100 ng / ml) treated Z1-HLOs compared to HLOs with ascorbic acid depletion at day 20 and control HLOs (right).
[0044] Fig. 1C. ELISA for mGULO protein concentration in Dox treated Z1-HLOs compared to control HLOs. (n = 9 independent experiments)
[0045] Fig.1D. Cellular Antioxidant concentration in Dox treated Z1-HLOs compared to control HLOs. (n = 9 independent experiments)
[0046] Fig.1E. ROS levels in Dox treated and extracellular ascorbate induced Z1-HLOs compared to control HLOs. (n = 9 independent experiments)
[0047] Fig.1F. Heatmap of Zone 1 genes from RNAseq dataset for Dox treated Z1-HLOs compared to control.
[0048] Fig. 1G. Albumin ELISA for Z1-HLOs treated with Dox compared to control HLOs and PHH normalized by cell viability. (n = 9 independent experiments)
[0049] Fig.1H. Immunofluorescence images of Dox treated Z1-HLOs for CPS1, ACSS2 and CDH1 compared to control HLOs and primary liver. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0050] In Figs.1C-E and Fig.1G, data are represented as boxplots where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range). Figs.1C-E and 1G use one-way ANOVA with multiple comparisons and Tukey’s correction.
[0051] Figure 2. Engineering pluripotent stem cell (PSC)-derived human liver organoids with multi-zonal hepatocyte features.
[0052] Fig. 2A. Schematic for development of multi-zonal human liver organoids (mZ- HLOs) from doxycycline (Dox)-induced zone 1-human liver organoids (Z1-HLOs) and low dose bilirubin-treated zone 3-human liver organoids (Z3-HLOs).
[0053] Fig.2B. Brightfield images of Dox (100 ng / ml)-treated Z1-HLOs (left). RT-qPCR of ACSS2, ASL, CPS1 and OTC gene for Z1-HLOs compared to Primary Human Hepatocytes (PHH), Z3- and control HLOs (right). (Data is mean + SD, n = 9 independent 897 experiments).
[0054] Fig. 2C. Brightfield image of Z3-HLOs treated with low dose bilirubin (1mg / L) (left). RT-qPCR of ALDH1A2, GLUL, HIF1A and SREBF1 gene for Z3-HLOs compared to PHH, Z1- and control HLOs (right). (Data is mean + SD, n = 9 independent experiments).
[0055] Fig. 2D. Caspase 3 activity assay in Z3-HLOs compared to Z1-HLOs after treatment with Zone 1 toxin, Allyl alcohol, compared to control (left). Cell viability assay in Z3- HLOs compared to Z1-HLOs after treatment with Zone 1 toxin, Allyl alcohol, compared to control (right). (n = 9 independent experiments).
[0056] Fig. 2E. Caspase 3 activity assay in Z3-HLOs compared to Z1-HLOs after treatment with Zone 3 toxin, Acetaminophen, compared to control (left). Cell viability assay in Z3-HLOs compared to Z1-HLOs after treatment with Zone 3 toxin, Acetaminophen, compared to control (right). (n = 9 independent experiments).
[0057] Fig. 2F. Brightfield images (top) of progression of bilirubin induced fusion from Day 1 to Day 7. Fluorescent images of progression of organoid fusion from day 1 to day 7 when GFP+ Z3-HLOs were co-cultured with dox-treated mCherry+ Z1-HLOs (inset). Scale bar indicates 200 μm. Numbers on the bar indicate the percentage of fused organoids that express dual and single positivity for the indicated antigen staining.
[0058] Fig. 2G. Heatmap of fused organoid compared to Z1-, Z3-, and control HLOs depicting expression of all zonal genes in the fused organoids.
[0059] Fig. 2H. Immunofluorescence images of mZ-HLOs for pan liver markers: ALB, HNF4A, PROX1, HNF1A, A1AT, and CEBPB; Zone 1 markers: mCherry, TET1, and GLS; Zone 3 markers: GHR, AR, and ALDH6A1. Scale bar indicates 200 μm. Numbers on the bar indicate the percentage of fused organoids that express dual and single positivity for the indicated antigen staining.
[0060] Figure 3. Low dose bilirubin promotes GLUL+ hepatocyte specification in HLOs.
[0061] Fig.3A. Schematic for low dose bilirubin treatment and Z3-HLO development to induce GLUL+ expression.
[0062] Fig.3B. Cell viability assay with different concentration of bilirubin to titrate dose for maximal viability. (n = 9 independent experiments).
[0063] Fig. 3C. Brightfield image of Z3-HLOs treated with low dose bilirubin (1mg / L) compared to control, and luminal outline using ImageJ, arrows indicate luminal projections that are similar to bile canaliculi found in human liver. Scale bar indicates 200 µm.
[0064] Fig. 3D. Comparison of size and circularity of lumen of the control and 1 mg / L bilirubin treated Z3-HLOs. (Data is mean ^ SD, n = 9 independent experiments)
[0065] Fig.3E. Heatmap of Zone 3 genes from RNAseq dataset for bilirubin treated Z3- HLOs compared to control.
[0066] Fig. 3F, CYP3A4 activity assay in response to Rifampicin in control, Z1-, Z3- HLOs, and PHH (left). CYP1A2 activity assay in response to Omeprazole in control, Z1-, Z3- HLOs, and PHH (right). (n = 9 independent experiments).
[0067] Fig.3G, Immunofluorescence images of Z3-HLOs for GLUL, NR3C1 and CDH1 compared to control HLOs and primary liver. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0068] Fig.3H, Heatmap of Z1- and Z3- HLOs depicting expression of zonal genes and lack of consensus expression of markers such as ARG1 and AKR1C1.
[0069] In Fig. 3B and Fig. 3F, data are represented as boxplots where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range). Figs. 3B and 3F use one-way ANOVA with multiple comparisons and Tukey’s correction. Fig. 3D uses Kruskal–Wallis test (left) and unpaired two-tailed Student’s t-test (right).
[0070] Figure 4. Bilirubin induced fusion requires close proximity and cytoskeletal signaling.
[0071] Fig. 4A. Brightfield images of bilirubin induced fusion in high density HLOs compared to low density and no bilirubin treatment. Scale bar indicates 200 µm.
[0072] Fig. 4B. Comparison of mean segment length in high density HLOs compared to low density and no bilirubin treatment. (n = 9 independent experiments)
[0073] Fig. 4C. Brightfield and live staining images (NucBlue: dark, vs Cytoskeleton: light) show progression of organoid fusion after continued treatment with bilirubin (1 mg / L). Scale bar indicates 200 µm. (n = 3 independent experiments)
[0074] Fig.4D. Comparison of mean segment length of the HLOs from Day 1 to Day 7. (n = 9 independent experiments).
[0075] Fig.4E. NOTCH activity assay in bilirubin treated HLOs compared to control. (n = 9 independent experiments).
[0076] Fig. 4F. Percentage of fused organoids after bilirubin treatment in DAPT (Notch inhibitor) and NSC (Ezrin Inhibitor, NSC668394) treated HLOs compared to control. (n = 9 independent experiments).
[0077] Fig.4G. Brightfield images of bilirubin induced fused HLOs compared to DAPT or NSC668394 treatment and control HLOs. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0078] Fig. 4H. CLF assay for self-assembled organoids compared to control. Scale indicates 200 µm. (n = 3 independent experiments)
[0079] Fig.4I. Percentage of fused organoids for each type of organoid. (n = 9 independent experiments).
[0080] In Fig.4E, data are represented as boxplot where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range). Figs.4B and 4D use Kruskal-Wallis with multiple comparisons and Dunn-Holland-Wolfe correction. Fig. 4E uses unpaired two-tailed Student’s t-test. Fig.4I uses one-way ANOVA with multiple comparisons and Tukey’s correction.
[0081] Figure 5. Immunostaining of mZ-HLOs compared to neonatal liver show similar features.
[0082] Fig. 5A. Brightfield images of fused HLOs following continued treatment with bilirubin compared to single dose treatment after 10 days. (n = 3 independent experiments)
[0083] Fig. 5B. Immunofluorescence images (bottom) of mZ-HLOs depicting GFP, mCherry, PROX1 and A1AT. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0084] Fig. 5C. Immunofluorescence images of mZ-HLOs for pan liver markers: TUBA1A, CTNBB1, luminal marker: ZO-1 (depicting continuous lumen); Zone 1 markers: ARG1 and SLBP; Zone 2 marker TERT; Zone 3 markers: AHR, and MRP2; and Cholangiocyte marker CK7. Scale bar indicates 200 µm. Numbers on the bar indicate the percentage of fused organoids that express dual and single positivity for the indicated antigen staining. (n = 3 independent experiments)
[0085] Fig. 5D. Immunohistochemistry images of neonatal liver sections for pan liver marker TUBA1A; Cholangiocyte marker CK7; Zone 1 markers: ARG1, SLBP, and GLS2; Zone 2 marker TERT; and Zone 3 markers: AHR, ALDH6A1 and MRP2. Scale bar indicates 200 µm. (P: Portal vein, C: Central vein). (n = 3 independent experiments)
[0086] Figure 6. Single cell profiling of mZ-HLOs indicate the emergence of zonal like populations.
[0087] Fig. 6A. UMAP plot with the major populations (hepatocytes, cholangiocytes, endothelial cells, macrophages, stellate cells, and mesenchyme) of all nuclei in mZ-HLOs.
[0088] Fig. 6B. Distinct expression profile all populations in mZ-HLOs. The size of the circle indicates the percentage of nuclei in each population expressing each gene. The color represents the average expression level for the indicated gene.
[0089] Fig.6C. Heatmap showing scaled mean expression of all genes in each cluster. Top 10 marker genes in each cluster have been added as labels.
[0090] Fig. 6D. Expression of known hepatoblast and zonal hepatocyte marker genes in each population.
[0091] Fig. 6E. Violin plot for expression of AFP (hepatoblast gene), GSS (interzonal hepatocytes), GHR (pericentral hepatocyte), and GLS2 (periportal hepatocyte).
[0092] Figure 7. Single cell analysis of multi-zonal human liver organoids (mZ-HLO).
[0093] Fig. 7A. a, UMAP plot with the major populations (Hepatoblasts, Interzonal like hepatocytes, Pericentral like hepatocytes, and Periportal like hepatocytes) of parenchymal nuclei in mZ-HLOs. Velocyto force field showing the average differentiation trajectories (velocity) for nuclei located in different parts of the UMAP plot (left). Pseudotime trajectory graph showing the differentiation trajectory for nuclei in the UMAP plot (right). The color represents the pseudotime development stage.
[0094] Fig. 7B. Feature plots for pan liver makers: TTR and SERPINA1; Cholangiocyte marker: KRT7; Zone 1 marker: mCherry, GLS2, CPS1 and OTC; Zone 2 marker: GSS, TERT, and AKR1C1; and Zone 3 maker: GFP, GLUL, CYP2E1 and HIF1A.
[0095] Fig.7C. UMAPs for human hepatocytes from PSC-derived liver organoid cell atlas colored by organoid source and cell type. UMAPs displaying the maximum spearman correlation of fetal liver (left) and adult liver (right) dataset.
[0096] Fig.7D. Expression of genes related to zone specific functions in each population. The size of the circle indicates the percentage of nuclei in each population expressing each gene. The color represents the average expression level for the indicated gene.
[0097] Fig. 7E. Pathway enrichment analysis examining which cellular pathways represented in the hepatoblast, pericentral, periportal, and interzonal hepatocyte populations. Circles (nodes) represent pathways, sized by the number of genes included in that pathway. Related pathways, indicated by light lines, are grouped into a theme (black circle) and labeled. Intra-pathway and inter-pathway relationships are shown in light blue and represent the number of genes shared between each pathway.
[0098] Figure 8. Pseudo-spatial profiling of mZ-HLOs show similarity of zonal expression to primary liver tissue.
[0099] Fig. 8A. Spatial plot for TAT (zone 1), HAMP (zone 2), and CYP3A4 (zone 3) markers in 10X Xenium healthy human liver dataset (publicly available dataset).
[0100] Fig. 8B. UMAP plot of mZ-HLO with hepatocyte populations (top) and distribution of replicate data (bottom).
[0101] Fig.8C. Feature plot for TAT (zone 1), HAMP (zone 2), and CYP3A4 (zone 3) markers.
[0102] Fig. 8D. UMAP plot for zonal hepatocyte populations from primary liver (Andrews et al., 2022 Hepatology Communications 6, 821-840) and mZ-HLOs integrated together (top). UMAP plot depicting distribution for total hepatocyte populations from primary liver and mZ-HLOs integrated together (bottom).
[0103] Fig.8E. Expression of known hepatoblast and zonal hepatocyte marker genes in mZ-HLOs benchmarked against the Andrews et al., 2022 snRNAseq dataset referenced above.
[0104] Fig.8F. UMAP plot for all cell types (inset: sample distribution) from primary liver datasets and mZ-HLOs integrated together.
[0105] Fig.8G. Feature plot for GLS2 (zone 1), HAMP (zone 2), and GLUL (zone 3) markers.
[0106] Figure 9. RNA velocity and pseudotime analysis in mZ-HLOs.
[0107] Fig.9A. Phase portrait of AFP, GLUL, and GLS2 depicting the dynamics of the gene splicing in the nuclei with the velocity and expression of AFP, GLUL, and GLS2 in nuclei as feature plots.
[0108] Fig. 9B. SOM (Self Organizing Map) of single-nuclei transcriptome-derived zonation profiles for mZ-HLOs based on the different populations.
[0109] Fig. 9C. Boxplot showing the pseudotime of each nuclei population in mZ- HLOs.
[0110] In Fig.9C, data are represented as boxplot where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range), while data beyond the end of the whiskers are outlying points that are plotted individually.
[0111] Figure 10. EP300 differentially regulates zonal genes in mZ-HLOs in conjunction to distinct transcription factors.
[0112] Fig. 10A. Peak density plots showing EP300 bound loci, a marker of active enhancers. Profile plot of all peaks are in the top panel.
[0113] Fig.10B. Genome browser view of HNF4A (pan marker) showing the EP300 ChIPseq peak.
[0114] Fig.10C. Genome browser view of CTNNB1 (pan marker) showing the EP300 ChIPseq peak.
[0115] Fig. 10D. Genome browser view of SLBP (zone 1 gene) showing the EP300 ChIPseq peak.
[0116] Fig.10E. Genome browser view of AKR1C1 (zone 2 gene) showing the EP300 ChIPseq peak.
[0117] Fig. 10F. Genome browser view of GHR (zone 3 gene) showing the EP300 ChIPseq peak.
[0118] Fig. 10G. Top 10 upregulated Gene Ontology terms (Biological Process) for the gene regulated bound by EP300 in the Z1-HLOs.
[0119] Fig. 10H. Top 10 upregulated Gene Ontology terms (Biological Process) for the gene regulated bound by EP300 in the Z3-HLOs.
[0120] Figure 11. Bilirubin and Ascorbate regulate EP300 differentially in a spatial manner to evoke zonation.
[0121] Fig.11A. Genome browser view of ACSS2 (zone 1 gene) showing the EP300 ChIPseq peak.
[0122] Fig. 11B. Genome browser view of HPR (zone 2 gene) showing the EP300 ChIPseq peak.
[0123] Fig. 11C. Genome browser view of ALDH6A1 (zone 3 gene) showing the EP300 ChIPseq peak.
[0124] Fig. 11D. Top 10 upregulated Gene Ontology terms (Biological Process) for the gene regulated bound by EP300 in the mZ-HLOs.
[0125] Fig. 11E. Motif enrichment analysis of EP300 bound peaks analyzed by MEME-ChIP.
[0126] Fig.11F. Venn diagram depicting the intersection between EP300 bound peaks and upregulated genes obtained from RNAseq in Z1- and Z3-HLOs linked to motif enrichment analysis of EP300 bound peaks for upregulated genes in dox treated Z1-HLOs and in bilirubin treated Z3-HLOs analyzed by MEME-ChIP.
[0127] Fig.11G. RT-qPCR of ACSS2, and CPS1 gene for Z1-HLOs compared to mZ- HLOs with and without treatment with Bobcat 339 (TET inhibitor) (left). RT-qPCR of ALDH6A1,and GLUL gene for Z3-HLOs compared to mZ-HLOs with and without treatment with KC7F2 (HIF1A inhibitor) (right). (Data is mean ^ SD, n = 9 independent experiments).
[0128] Fig. 11H. Schematic for bilirubin and ascorbate mediated distinct epigenetic regulation leading to differential gene expression.
[0129] Figure 12. EP300 and partner transcription factors are important for zonal liver development.
[0130] Fig. 12A. Experimental timeline for testing role of EP300 in zonal liver development using Ad-shp300 (adenoviral vector for p300 shRNA, top). H&E stain for sections from rat liver injected with Ad-shSCR (adenoviral vector for scrambled shRNA, middle) and Ad- shp300 (adenoviral vector for p300 shRNA, bottom). Scale bar indicates 200 µm. (P: Portal vein, C: Central vein)
[0131] Fig. 12B. ICH stain for PROX1, ARG1, and GLUL of sections from rat liver injected with Ad-shSCR (adenoviral vector for scrambled shRNA, top) and Ad-shp300 (adenoviral vector for p300 shRNA, bottom). Scale bar indicates 200 µm. (P: Portal vein, C: Central vein)
[0132] Fig. 12C. RT-qPCR of ALB, ACSS2, ASL, CPS1, and OTC (zone 1) gene for Z1- and Z3-HLOs compared to freshly isolated PHH, H20 (20 um periportal hepatocytes) and H40 (40 um pericentral hepatocytes) (Data is mean ^ SD, n = 9 independent experiments).
[0133] Fig. 12D. RT-qPCR of ALDH1A2, ALDH6A1, HIF1A, SREBF1, and GLUL (zone 3) gene for Z1- and Z3-HLOs compared to freshly isolated PHH, H20 (20 um periportal hepatocytes) and H40 (40 um pericentral hepatocytes) (Data is mean ^ SD, n = 9 independent experiments).
[0134] Fig.12E. EP300-TF ChIP-reChIP-PCR for H20 (20 um periportal hepatocytes) and H40 (40 um pericentral hepatocytes). (n = 3 independent experiments)
[0135] Fig. 12F. EP300-TF ChIP-reChIP-qPCR for samples in Fig. 12E. Data are mean ± SD, n = 9 independent experiments.
[0136] Figs. 12C-D use one-way ANOVA with multiple comparisons and Tukey’s correction. Fig.12F uses unpaired two-tailed Student’s t-test.
[0137] Figure 13. Interzonal dependent nitrogen handling in mZ-HLOs.
[0138] Fig.13A. RT-qPCR of OTC and CPS1 (zone 1) gene for mZ-HLOs compared to Z1-, Z3-, control HLOs, and PHH in response to 10mM NH4CL (data is mean ^ SD and n = 9 independent experiments; one-way ANOVA with multiple comparisons and Tukey’s correction).
[0139] Fig. 13B. RT-qPCR of ARG1 (zone 1+2) and GSTA2 (zone 2) gene for mZ- HLOs compared to Z1-, Z3-, control HLOs, and PHH in response to 10mM NH4CL. (data is mean ^ SD and n = 9 independent experiments; one-way ANOVA with multiple comparisons and Tukey’s correction).
[0140] Fig. 13C. RT-qPCR of ALDH1A2 and GLUL (zone 3) gene for mZ-HLOs compared to Z1-, Z3-, control HLOs, and PHH in response to 10mM NH4CL. (data is mean ^ SD and n = 9 independent experiments; one-way ANOVA with multiple comparisons and Tukey’s correction.).
[0141] Fig. 13D. Glutathione assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (n= 9 independent experiments and data are represented as boxplots where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter- quartile range); one-way ANOVA with multiple comparisons and Tukey’s correction).
[0142] Fig. 13E. Ammonia assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (one-way ANOVA with multiple comparisons and Tukey’s correction).
[0143] Fig.13F. Urea assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (n= 9 independent experiments and data are represented as boxplots where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range); one-way ANOVA with multiple comparisons and Tukey’s correction).
[0144] Fig. 13G. Glutathione S-Transferase assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (data is mean ^ SE and n = 9 independent experiments).
[0145] Fig.13H. Glutamine synthetase activity assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (data is mean ^ SE and n = 9 independent experiments).
[0146] Fig. 13I. Glutamine assay for mZ-HLOs with and without BSO treatment compared to Z1-, Z3-, control HLOs, and PHH (n= 9 independent experiments and data are represented as boxplots where the middle line is the median, the lower and upper hinges correspondto the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter- quartile range); one-way ANOVA with multiple comparisons and Tukey’s correction).
[0147] Figure 14. Interzonal dependent lipid and glucose metabolism in mZ- HLOs.
[0148] Fig. 14A. Triglyceride assay for mZ-HLOs with and without Firsocostat treatment compared to Z1-, Z3-, control HLOs, and PHH (n = 9 independent experiments).
[0149] Fig. 14B. Lipase activity assay for mZ-HLOs with and without Firsocostat treatment compared to Z1-, Z3-, control HLOs, and PHH (n = 9 independent experiments).
[0150] Fig. 14C. Glucose assay for mZ-HLOs with and without FBPi treatment compared to Z1-, Z3-, control HLOs, and PHH (n = 9 independent experiments).
[0151] Fig. 14D. Glucokinase activity assay for mZ-HLOs with and without FBPi treatment compared to Z1-, Z3-, control HLOs, and PHH (n = 9 independent experiments).
[0152] In Figures 14A-C, data are represented as boxplots where the middle line is the median, the lower and upper hinges correspond to the first and third quartiles, the upper and lower whisker extends from the hinge to the largest and smallest value respectively no further than 1.5 × IQR from the hinge (where IQR is the inter-quartile range). Figs.14A and 14C use one-way ANOVA with multiple comparisons and Tukey’s correction.
[0153] Figure 15. mZ-HLOs exhibit zone specific regenerative potential in response to toxins.
[0154] Fig.15A. Experimental timeline for testing zonal regenerative potential of mZ- HLOs in response to zone specific toxins.
[0155] Fig. 15B. Immunofluorescence images of mZ-HLOs for proliferative marker Ki-67, GLUL, ARG1 and HAMP in response to Allyl Alcohol (Zone 1 toxin, left). Immunofluorescence images of mZ-HLOs for proliferative marker Ki-67, GLUL and ARG1 in response to Acetaminophen (Zone 3 toxin). Scale bar indicates 200 µm.
[0156] Fig. 15C. Comparison of Ki-67 + nuclei in different fluorescent regions in response to zone specific toxins. (Data is mean ^ SD, n = 9 independent experiments)
[0157] Fig.15D. Comparison of length of different fluorescent regions in response to zone specific toxins. (Data is mean ^ SD, n = 9 independent experiments)
[0158] Fig. 15E. Immunofluorescence images of CPS1, TET1, GLUL, NR3C1, and mCherry in Z1-HLOs with Dox treatment and after Dox withdrawal and persistent bilirubin treatment at Day 20 and 25. Scale bar indicates 200 µm.
[0159] Fig. 15F. RT-qPCR of ACSS2, CPS1, ALDH1A2 and GLUL gene for Z3- HLOs with Dox (Dox +) and with bilirubin after Dox withdrawal (Dox – Bilirubin +) compared to control HLOs (Data is mean ^ SD, n = 9 independent experiments).
[0160] Figs.15C-D use an unpaired two-tailed Student’s t-test. Fig.15F use one-way ANOVA with multiple comparisons and Tukey’s correction.
[0161] Figure 16. Orthotopic transplantation of mZ-HLOs improves multiple hepatocyte functions.
[0162] Fig.16A. Schematic for orthotopic transplantation of HLOs in bile duct ligated immunocompromised RRG rats.
[0163] Fig.16B. Kaplan-Meier survival curve for Z1-, Z3-, and mZ-HLO transplanted bile duct ligated RRG rats compared to sham. (n = 9 independent experiments) (log rank test).
[0164] Fig. 16C. Human Albumin ELISA on blood serum collected from rats at different time points after transplantation. (Data is mean ^ SE, n = 9 independent experiments).
[0165] Fig.16D. Bilirubin assay on blood serum collected from rats at different time points after transplantation. (Data is mean ^ SE, n = 9 independent experiments).
[0166] Fig.16E. Ammonia assay on blood serum collected from rats at different time points after transplantation. (Data is mean ^ SE, n = 9 independent experiments).
[0167] Figure 17. mZ-HLOs invade into the liver parenchyma of RRG rats after transplantation.
[0168] Fig. 17A. Immunofluorescence images for human TUBA1A of mZ-HLOs transplanted in RRG rat liver. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0169] Fig. 17B Immunofluorescence images for human ASGR1 of mZ-HLOs transplanted in RRG rat liver. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0170] Fig. 17C. Immunofluorescence images for GFP, mCherry, human ARG1 and GLUL of mZ-HLOs transplanted in RRG rat liver. Scale bar indicates 200 µm. (n = 3 independent experiments)
[0171] Fig.17D. Immunofluorescence images for human ASGR1 of Z1 and Z3-HLOs transplanted in RRG rat liver through the portal vein and inferior vena cava. Scale bar indicates200 µm. Numbers on the bar indicate the ratio of the area of integrated organoids and total area of the liver parenchyma in view in 103pixel2(Data is mean ^ SD, n = 9 independent experiments). DETAILED DESCRIPTION
[0172] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein.
[0173] The following description of various embodiments is exemplary and explanatory only and is not to be construed as limiting or restrictive in any way. Other embodiments, features, objects, and advantages of the present teachings will be apparent from the description and accompanying drawings, and from the claims.
[0174] The disclosure herein uses affirmative language to describe the numerous embodiments. The disclosure also includes embodiments in which subject matter is excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, or procedures.
[0175] It should be understood that any use of subheadings herein are for organizational purposes, and should not be read to limit the application of those subheaded features to the various embodiments herein. Each and every feature described herein is applicable and usable in all the various embodiments discussed herein and that all features described herein can be used in any contemplated combination, regardless of the specific example embodiments that are described herein. It should further be noted that exemplary description of specific features are used, largely for informational purposes, and not in any way to limit the design, subfeature, and functionality of the specifically described feature. Overview
[0176] As described herein, embodiments of the disclosure relate to advanced human liver organoids (HLOs) derived from human pluripotent stem cells, wherein the liver organoids havetwo or more types of hepatocyte subpopulations, where the types of hepatocyte subpopulations include zone 1 (periportal) hepatocytes, zone 2 (interzonal) hepatocytes, and / or zone 3 (pericentral) hepatocytes. Embodiments of the disclosure thus include multi‐zonal human liver organoids (mZ-HLOs), methods for their generation and preparation, and compositions including the same, as well as uses thereof.
[0177] Despite previous work using primary- and stem cell-derived hepatocytes, to date there has been no evidence of achieving multi-zone dependent functions in existing human hepatic tissue models. In particular, the present disclosure demonstrates the emergence of two or more, or three or more, phenotypically distinct (e.g. structurally distinct, and / or functionally distinct, etc.) hepatocyte subpopulations within the prepared mZ-HLOs. For example, mZ-HLOs can include zone 1 and zone 3 hepatocyte subpopulations, or zone 1, zone 2, and zone 3 hepatocyte subpopulations, as in the presently described dual organoid assembly models.
[0178] The mZ-HLOs described herein can be formed via dual liver organoid self- assembly systems developed by combining ascorbate- and bilirubin-enriched hepatic progenitors derived from human induced pluripotent stem cells, in order to employ differential inductive conditions. First, as described herein, organoid progenitors, e.g. immature organoids, can be separately established from iPSCs and / or normal iPSCs; for example, ascorbate-enriched, ascorbate-treated, and / or doxycycline-treated organoid progenitors, e.g. immature organoids, can be separately established from iPSCs and / or normal iPSCs. In some embodiments, the organoid progenitors, e.g. immature organoids, can be separately established from mGULO-expressing iPSCs and / or normal iPSCs. Respective organoid progenitors (e.g. immature organoids) from the iPSCs and normal iPSC lines can be mixed together in wells in the presence of bilirubin to self- assemble, forming interconnected dual organoids (mZ-HLOs). In some embodiments, respective organoid progenitors (e.g. immature organoids) from the mGULO-expressing iPSCs and normal iPSC lines can be mixed together in wells in the presence of bilirubin to self-assemble, forming interconnected dual organoids (mZ-HLOs). In some embodiments, the interconnected dual organoids (mZ-HLOs) formed from mixing respective organoid progenitors (e.g. immature organoids) from the mGULO-expressing iPSCs and normal iPSC lines in the presence of bilirubin can have a gradient between regions, such as between phenotypically distinct zones.
[0179] Unexpectedly, the emergence of three phenotypically distinct (e.g. structurally distinct, and / or functionally distinct, etc.) hepatocyte subpopulations, including zone 1, zone 2, and zone 3 (or zone 1-like, zone 2-like, and zone 3-like) hepatocytes, is observed in this dualorganoid assembly model. In contrast, previous organoid progenitors have not demonstrated multi- zonal properties, nor multifunctional properties, with functions corresponding to multiple zones.
[0180] This self-assembled dual organoid system can exhibit zone-specific functions associated with urea cycle, glutathione synthesis and / or glutamate synthesis. Single nucleus RNA sequencing analysis identified a hepatoblast differentiation trajectory towards interzonal-, periportal-, and pericentral-like cells.
[0181] In certain aspects, epigenetic and transcriptomic analysis showed the zonal divergence is orchestrated by ascorbate- or bilirubin-induced preferential binding of histone acetyltransferase p300 (EP300) to methylcytosine dioxygenase TET1 or hypoxia-inducible factor 1-alpha (HIF1^). Transplantation of the self-assembled zonally patterned human organoids can improve survival by ameliorating the hyperammonemia and hyperbilirubinemia caused by bile duct ligation in rats. Overall, the multi-zonal organoid system can serve as an effective in vitro human model to better recapitulate hepatic architecture relevant to liver development and disease and to study the functional ensemble across diverse hepatocytes in development and disease.
[0182] There are broad implications for the multi-zonal liver organoids developed as described herein for research and development, as well as treatment. For example, zone 1 hepatocytes represent the main target for metabolic diseases like NASH; zone 2 hepatocytes represent the main target for liver regeneration; and zone 3 hepatocytes can allow for studying and addressing alcoholic disease and / or drug-induced cholestasis. These are just a few representative examples of the respective use of each zone.
[0183] Therefore, the multi-zonal liver organoids described herein can advance disease modeling and drug discovery with superior resolution to previous organoid populations developed to date. Additionally, there are therapeutic benefits in the transplant context of having all three zones present within one organoid system, relative to conventional single zonal HLO systems, which have been described previously (see, for example, PCT Application No. PCT / US2022 / 033066, which is incorporated by reference herein in its entirety). Further detail is provided in the sections that follow, including Examples 1-8. Definitions of Terms
[0184] Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. For purposes of the present disclosure, the following terms are explained below.
[0185] The disclosure herein uses affirmative language to describe the numerous embodiments. The disclosure also includes embodiments in which subject matter is excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, or procedures.
[0186] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or “an” may mean one or more than one. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and / or methods of the disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined.
[0187] By “about” is meant a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 10% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
[0188] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.” For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is specifically contemplated that x, y, or z may be specifically excluded from an embodiment. As used herein “another” may mean at least a second or more.
[0189] The term “ones” means more than one.
[0190] As used herein, the term “plurality” may be 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.
[0191] As used herein, the term “set of” means one or more. For example, a set of items includes one or more items.
[0192] As used herein, the phrase “at least one of,” when used with a list of items, means different combinations of one or more of the listed items may be used and only one of the items in the list may be needed. The item may be a particular object, thing, step, operation, process, or category. In other words, “at least one of” means any combination of items or number of items may be used from the list, but not all of the items in the list may be required. For example, without limitation, “at least one of item A, item B, or item C” means item A; item A and item B; item B; item A, item B, and item C; item B and item C; or item A and C. In some cases, “at least one ofitem A, item B, or item C” means, but is not limited to, two of item A, one of item B, and ten of item C; four of item B and seven of item C; or some other suitable combination.
[0193] As used herein, “substantially” means sufficient to work for the intended purpose. The term “substantially” thus allows for minor, insignificant variations from an absolute or perfect state, dimension, measurement, result, or the like such as would be expected by a person of ordinary skill in the field but that do not appreciably affect overall performance. When used with respect to numerical values or parameters or characteristics that can be expressed as numerical values, “substantially” means within ten percent.
[0194] Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of” is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of” indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.
[0195] Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in various embodiments.
[0196] The terms “individual”, “subject”, or “patient” as used herein have their plain and ordinary meaning as understood in light of the specification, and mean a human or a non-human mammal, e.g., a dog, a cat, a mouse, a rat, a cow, a sheep, a pig, a goat, a non-human primate, or a bird, e.g., a chicken, as well as any other vertebrate or invertebrate. The term “mammal” is used in its usual biological sense. Thus, it specifically includes, but is not limited to, primates, includingsimians (chimpanzees, apes, monkeys) and humans, cattle, horses, sheep, goats, swine, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, or the like.
[0197] As used herein, the terms “treatment,” “treating,” “treat,” and the like, with respect to a disease or condition, can refer to obtaining a desired pharmacologic and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. For example, a treatment can include executing a protocol, which may include administering one or more drugs to a patient, in an effort to alleviate signs or symptoms of the disease. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis. Alleviation can occur prior to signs or symptoms of the disease or condition appearing, as well as after their appearance. Thus, “treating” or “treatment” may include “preventing” or “prevention” of disease or undesirable condition. In addition, “treating” or “treatment” does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.
[0198] “Treatment,” as used herein, thus can cover any treatment of a disease in a subject, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease and / or relieving one or more disease symptoms. “Treatment” can also encompass delivery of an agent or administration of a therapy in order to provide for a pharmacologic effect, even in the absence of a disease or condition.
[0199] The term “therapeutically effective” or “therapeutically effective amount” as used throughout this application can refer to an amount effective to achieve a desired and / or beneficial effect, and / or anything that promotes or enhances the well-being of the subject with respect to the medical treatment of a condition. This includes, but is not limited to, a reduction in the frequency or severity of one or more signs or symptoms of a disease. An effective amount can be administered in one or more administrations. In the methods, a therapeutically effective amount is an amount appropriate to treat an indication. By treating an indication is meant achieving any desirable effect, such as one or more of palliate, ameliorate, stabilize, reverse, slow, or delay disease progression, increase the quality of life, or to prolong life. Such achievement can be measured by any suitable method, such as measurement of tumor size or blood cell count, or any other suitable measurement.
[0200] The terms “effective amount” or “effective dose” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to that amount of a recited composition or compound that, results in an observable effect. Actual dosage levels of active ingredients in an active composition of the presently disclosed subject matter can be varied so as to administer an amount of the active composition or compound that, is effective to achieve the desired response for a particular subject and / or application. The selected dosage level wall depend upon a variety of factors including, but not limited to, the activity of the composition, formulation, route of administration, combination with other drugs or treatments, severity of the condition being treated, and the physical condition and prior medical history of the subject being treated. In some embodiments, a minimal dose is administered, and dose is escalated in the absence of dose-limiting toxicity to a minimally effective amount. Determination and adjustment of an effective dose, as well as evaluation of when and how to make such adjustments, are contemplated herein.
[0201] The term “disease state” as used herein, can generally refer to a condition that affects the structure or function of an organism. Disease states can include, for example, stages of a disease progression.
[0202] As used herein, the term “assessing” can include any form of measurement, and includes determining if an element is present or not. The terms “determining,” “measuring,” “evaluating,” “assessing” and “assaying” can be used interchangeably and can include quantitative and / or qualitative determinations.
[0203] As used herein, the terms “modulated” or “modulation,” or “regulated” or “regulation” and “differentially regulated” can refer to both up regulation (i.e., activation or stimulation, e.g., by agonizing or potentiating) and down regulation (i.e., inhibition or suppression, e.g., by antagonizing, decreasing or inhibiting), unless otherwise specified or clear from the context of a specific usage.
[0204] As used herein, the term “marker” or “biomarker” can refer to any measurable substance taken as a sample from a subject whose presence is indicative of some phenomenon. Non-limiting examples of such phenomenon can include a disease state, a condition, or exposure to a compound or environmental condition. In various embodiments described herein, biomarkers may be used for diagnostic purposes (e.g., to diagnose a disease state, a health state, an asymptomatic state, a symptomatic state, etc.). The term “biomarker” may be used interchangeably with the term “marker”. The term “marker” or “biomarker” can include a biological molecule,such as, for example, a nucleic acid, peptide, protein, hormone, and the like, whose presence or concentration can be detected and correlated with a known condition, such as a disease state. It can also be used to refer to a differentially expressed gene whose expression pattern can be utilized as part of a predictive, prognostic or diagnostic process in healthy conditions or a disease state, or which, alternatively, can be used in methods for identifying a useful treatment or prevention therapy.
[0205] As used herein, the term “cellular phenotype” can refer to any determinable, observable, and / or measurable characteristic associated with a cell population.
[0206] As used herein, a “model” can include one or more in vitro or in vivo disease models; a model can also include algorithms, one or more mathematical techniques, one or more machine learning algorithms, or a combination thereof. A model can be used in a process and / or applied to an assay, in accordance with various embodiments as disclosed herein.
[0207] As used herein, a “process” can include one or more steps involving one or more features of one or more model as disclosed herein.
[0208] The terms “function” and “functional” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to a biological, enzymatic, or therapeutic function.
[0209] The term “inhibit” as used herein has its plain and ordinary meaning as understood in light of the specification, and can refer to the reduction or prevention of a biological activity. The reduction can be by a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or an amount that is within a range defined by any two of the aforementioned values. As used herein, the term “delay” has its plain and ordinary meaning as understood in light of the specification, and refers to a slowing, postponement, or deferment of a biological event, to a time which is later than would otherwise be expected. The delay can be a delay of a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or an amount within a range defined by any two of the aforementioned values. The terms inhibit and delay may not necessarily indicate a 100% inhibition or delay, A partial inhibition or delay may be realized.
[0210] As used herein, the term “isolated” has its plain and ordinary meaning as understood in light of the specification, and can refer to a substance and / or entity that has been (1) separated from at least some of the components with which it was associated when initiallyproduced (whether in nature and / or in an experimental setting), and / or (2) produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from equal to, about, at least, at least about, not more than, or not more than about, 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated (or ranges including and / or spanning the aforementioned values). In some embodiments, isolated agents are, are about, are at least, are at least about, are not more than, or are not more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure (or ranges including and / or spanning the aforementioned values). As used herein, a substance that is “isolated” may be “pure” (e.g., substantially free of other components). As used herein, the term “isolated cell” can refer to a cell not contained in a multi -cellular organism or tissue.
[0211] As used herein, “in vivo” is given its plain and ordinary meaning as understood in light of the specification and can refer to the performance of a method inside living organisms, usually animals, mammals, including humans, and plants, as opposed to a tissue extract or dead organism.
[0212] As used herein, “ex vivo” is given its plain and ordinary meaning as understood in light of the specification and can refer to the performance of a method outside a living organism with little alteration of natural conditions.
[0213] As used herein, “in vitro” is given its plain and ordinary' meaning as understood in light of the specification and can refer to the performance of a method outside of biological conditions, e.g., in a petri dish or test tube.
[0214] The terms “nucleic acid” or “nucleic acid molecule” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, those that appear in a cell naturally, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or a combination of both. Modified nucleotides can have alterations in sugar moieties and / or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups,amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with statically and electronically similar structures, such as aza- sugars and carbocyclic sugar analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoramlidate, or phosphoramidate. The term “nucleic acid molecule” also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded. “Oligonucleotide” can be used interchangeable with nucleic acid and can refer to either double stranded or single stranded DNA or RNA. A nucleic acid or nucleic acids can be contained in a nucleic acid vector or nucleic acid construct (e.g. plasmid, virus, retrovirus, lentivirus, bacteriophage, cosmid, fosmid, phagemid, bacterial artificial chromosome (BAG), yeast artificial chromosome (YAC), or human artificial chromosome (HAG)) that can be used for amplification and / or expression of the nucleic acid or nucleic acids in various biological systems. Typically, the vector or construct will also contain elements including but not limited to promoters, enhancers, terminators, inducers, ribosome binding sites, translation initiation sites, start codons, stop codons, polyadenylation signals, origins of replication, cloning sites, multiple cloning sites, restriction enzyme sites, epitopes, reporter genes, selection markers, antibiotic selection markers, targeting sequences, peptide purification tags, or accessory genes, or any combination thereof.
[0215] A nucleic acid or nucleic acid molecule can comprise one or more sequences encoding different peptides, polypeptides, or proteins. These one or more sequences can be joined in the same nucleic acid or nucleic acid molecule adjacently, or with extra nucleic acids in between, e.g. linkers, repeats or restriction enzyme sites, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths. The term “downstream” on a nucleic acid as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being after the 3’-end of a previous sequence, on the strand containing the encoding sequence (sense strand) if the nucleic acid is double stranded. The term “upstream” on a nucleic acid as used herein has its plain and ordinarymeaning as understood in light of the specification and refers to a sequence being before the 5’- end of a subsequent sequence, on the strand containing the encoding sequence (sense strand) if the nucleic acid is double stranded. The term “grouped” on a nucleic acid as used herein has its plain and ordinary meaning as understood in light of the specification and refers to two or more sequences that occur in proximity either directly or with extra nucleic acids in between, e.g. linkers, repeats, or restriction enzyme sites, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths, but generally not with a sequence in between that encodes for a functioning or catalytic polypeptide, protein, or protein domain.
[0216] The nucleic acids described herein comprise nucleobases. Primary, canonical, natural, or unmodified bases are adenine, cytosine, guanine, thymine, and uracil. Other nucleobases include but are not limited to purines, pyrimidines, modified nucleobases, 5- methylcytosine, pseudouridine, dihydrouridine, inosine, 7-methylguanosine, hypoxanthine, xanthine, 5,6-dihydrouracil, 5-hydroxymethylcytosine, 5-bromouracil, isoguanine, isocytosine, aminoallyl bases, dye-labeled bases, fluorescent bases, or biotin-labeled bases.
[0217] The terms “peptide”, “polypeptide”, and “protein” as used herein have their plain and ordinary meaning as understood in light of the specification and refer to macromolecules comprised of amino acids linked by peptide bonds. The numerous functions of peptides, polypeptides, and proteins are known in the art, and include but are not limited to enzymes, structure, transport, defense, hormones, or signaling. Peptides, polypeptides, and proteins are often, but not always, produced biologically by a ribosomal complex using a nucleic acid template, although chemical syntheses are also available. By manipulating the nucleic acid template, peptide, polypeptide, and protein mutations such as substitutions, deletions, truncations, additions, duplications, or fusions of more than one peptide, polypeptide, or protein can be performed. These fusions of more than one peptide, polypeptide, or protein can be joined in the same molecule adjacently, or with extra amino acids in between, e.g. linkers, repeats, epitopes, or tags, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths. The term “downstream” on a polypeptide as used hereinhas its plain and ordinary meaning as understood in light of the specification and refers to a sequence being after the C-terminus of a previous sequence. The term “upstream” on a polypeptide as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being before the N- terminus of a subsequent sequence.
[0218] The term “purity” of any given substance, compound, or material as used herein has its plain and ordinary meaning as understood in light of the specification and can refer to the actual abundance of the substance, compound, or material relative to the expected abundance. For example, the substance, compound, or material may be at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% pure, including all decimals in between. Purity may be affected by unwanted impurities, including but not limited to nucleic acids, DNA, RNA, nucleotides, proteins, polypeptides, peptides, amino acids, lipids, cell membrane, cell debris, small molecules, degradation products, solvent, carrier, vehicle, or contaminants, or any combination thereof. In some embodiments, the substance, compound, or material is substantially free of host cell proteins, host cell nucleic acids, plasmid DNA, contaminating viruses, proteasomes, host cell culture components, process related components, mycoplasma, pyrogens, bacterial endotoxins, and adventitious agents. Purity' can be measured using technologies including but not limited to electrophoresis, SDS-PAGE, capillary electrophoresis, PCR, rtPCR, qPCR, chromatography, liquid chromatography, gas chromatography, thin layer chromatography, enzyme-linked immunosorbent assay (ELISA), spectroscopy, UV-visible spectrometry, infrared spectrometry, mass spectrometry, nuclear magnetic resonance, gravimetry, or titration, or any combination thereof.
[0219] The term “yield” of any given substance, compound, or material as used herein has its plain and ordinary meaning as understood in light of the specification and can refer to the actual overall amount of the substance, compound, or material relative to the expected overall amount. For example, the yield of the substance, compound, or material is, is about, is at least, is at least about, is not more than, or is not more than about 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the expected overall amount, including ail decimals in between. Yield may be affected by the efficiency of a reaction or process, unwanted side reactions, degradation, quality of the input substances, compounds, or materials, or loss of the desired substance, compound, or material during any step of the production.
[0220] As used herein, “pharmaceutically acceptable” has its plain and ordinary meaning as understood in light of the specification and refers to carriers, excipients, and / or stabilizers thatare nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed or that have an acceptable level of toxicity. A “pharmaceutically acceptable” “diluent,” “excipient,” and / or “carrier” as used herein have their plain and ordinary meaning as understood in light of the specification and are intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with administration to humans, cats, dogs, or other vertebrate hosts. Typically, a pharmaceutically acceptable diluent, excipient, and / or carrier is a diluent, excipient, and / or carrier approved by a regulatory agency of a Federal, a state government, or other regulatory agency, or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans as well as non-human mammals, such as cats and dogs. The term diluent, excipient, and / or “carrier” can refer to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical diluent, excipient, and / or carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water, saline solutions and aqueous dextrose and glycerol solutions can be employed as liquid diluents, excipients, and / or carriers, particularly for injectable solutions. Suitable pharmaceutical diluents and / or excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. A non-limiting example of a physiologically acceptable carrier is an aqueous pH buffered solution. The physiologically acceptable carrier may also comprise one or more of the following: antioxidants, such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids, carbohydrates such as glucose, mannose, or dextrins, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®. The composition, if desired, can also contain minor amounts of wetting, bulking, emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, sustained release formulations and the like. The formulation should suit the mode of administration.
[0221] Cryoprotectants are cell composition additives to improve efficiency and yield of low temperature cryopreservation by preventing formation of large ice crystals. Cryoprotectants include but are not limited to DMSO, ethylene glycol, glycerol, propylene glycol, trehalose,formamide, methyl-formamide, dimethyl-formamide, glycerol 3-phosphate, proline, sorbitol, diethyl glycol, sucrose, triethylene glycol, polyvinyl alcohol, polyethylene glycol, or hydroxyethyl starch. Cryoprotectants can be used as part of a cryopreservation medium, which include other components such as nutrients (e.g. albumin, serum, bovine serum, fetal calf serum [FCS]) to enhance post-thawing survivability of the cells. In these cryopreservation media, at least one cryoprotectant may be found at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or any percentage within a range defined by any two of the aforementioned numbers.
[0222] Additional excipients with desirable properties include but are not limited to preservatives, adjuvants, stabilizers, solvents, buffers, diluents, solubilizing agents, detergents, surfactants, chelating agents, antioxidants, alcohols, ketones, aldehydes, ethylenediaminetetraacetic acid (EDTA), citric acid, salts, sodium chloride, sodium bicarbonate, sodium phosphate, sodium borate, sodium citrate, potassium chloride, potassium phosphate, magnesium sulfate sugars, dextrose, fructose, mannose, lactose, galactose, sucrose, sorbitol, cellulose, serum, amino acids, polysorbate 20, polysorbate 80, sodium deoxycholate, sodium taurodeoxycholate, magnesium stearate, octylphenol ethoxylate, benzethonium chloride, thimerosal, gelatin, esters, ethers, 2-phenoxyethanol, urea, or vitamins, or any combination thereof. Some excipients may be in residual amounts or contaminants from the process of manufacturing, including but not limited to serum, albumin, ovalbumin, antibiotics, inactivating agents, formaldehyde, glutaraldehyde, β-propiolactone, gelatin, cell debris, nucleic acids, peptides, amino acids, or growth medium components or any combination thereof. The amount of the excipient may be found in composition at a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% w / w or any percentage by weight in a range defined by any two of the aforementioned numbers.
[0223] The term “pharmaceutically acceptable salts” has its plain and ordinary meaning as understood in light of the specification and includes relatively non-toxic, inorganic and organic acid, or base addition salts of compositions or excipients, including without limitation, analgesic agents, therapeutic agents, other materials, and the like. Examples of pharmaceutically acceptablesalts include those derived from mineral acids, such as hydrochloric acid and sulfuric acid, and those derived from organic acids, such as ethanesulfonic acid, benzenesulfonic acid, p- toluenesulfonic acid, and the like. Examples of suitable inorganic bases for the formation of salts include the hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, zinc, and the like. Salts may also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. For example, the class of such organic bases may include but are not limited to mono-, di-, and trialkylamines, including methylamine, dimethylamine, and triethylamine; mono-, di-, or trihydroxyalkylamines including mono-, di-, and triethanolamine; amino acids, including glycine, arginine and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; N-benzylphenethylamine; trihydroxymethyl aminoethane.
[0224] Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art including, but not limited to, enteral, oral, rectal, topical, sublingual, buccal, intraaural, epidural, epicutaneous, aerosol, parenteral delivery, including intramuscular, subcutaneous, intra-arterial, intravenous, intraportal, intra-articular, intradermal, peritoneal, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal or intraocular injections. Pharmaceutical compositions will generally be tailored to the specific intended route of administration.
[0225] As used herein, a “carrier” has its plain and ordinary meaning as understood in light of the specification and refers to a compound, particle, solid, semi-solid, liquid, or diluent that facilitates the passage, delivery and / or incorporation of a compound to cells, tissues and / or bodily organs.
[0226] As used herein, a “diluent” has its plain and ordinary meaning as understood in light of the specification and refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and / or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.
[0227] The term “% w / w” or “% wt / wt” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a percentage expressed in terms of the weight of the ingredient or agent over the total weight of the composition multiplied by 100. The term “% v / v” or “% vol / vol” as used herein has its plain and ordinary meaning as understood in the light of the specification and refers to a percentage expressed in terms of the liquid volume of the compound, substance, ingredient, or agent over the total liquid volume of the composition multiplied by 100.
[0228] The term “basement membrane matrix” or “extracellular matrix” as used herein has its plain and ordinary meaning in light of the specification and refers to any biological or synthetic compound, substance, or composition that enhances cell attachment and / or growth. Any extracellular matrix, as well as any mimetic or derivative thereof, known in the art can be used for the methods disclosed herein. Some examples of extracellular matrices, or mimetics or derivative thereof, include but are not limited to cell-based feeder layers, polymers, proteins, polypeptides, nucleic acids, sugars, lipids, poly-lysine, poly-ornithine, collagen, collagen IV, gelatin, fibronectin, vitronectin, laminin, laminin-511 elastin, tenascin, heparan sulfate, entactin, nidogen, osteopontin, perlecan, fibrin, basement membrane, Matrigel®, hydrogel, PEI, WGA, or hyaluronic acid, or any combination thereof. A common basement membrane matrix that is used in laboratories are those isolated from murine Engelbreth-Holm-Swarm (EHS) sarcoma cells. However, these basement membrane matrices are derived from non-human animals and therefore contain xenogeneic components that prevent its use towards humans. They are also not defined, which can lead to variability in manufacturing, as well as potentially harbor pathogens. Accordingly, in some embodiments, the methods for culturing cells may involve the use of synthetic and / or defined alternatives to these xenogeneic basement membrane matrices. The use of non-xenogeneic basement membrane matrices or mimetics or derivatives thereof enables manufacturing of biological products better suited for human use.
[0229] The terms “passage” and “passaging” as used herein have their plain and ordinary meaning as understood in light of the specification, and refer to the conventional approaches performed in biological cell culture methods to maintain a viable population of cells for prolonged periods of time. As cells are generally proliferative in cell culture, they undergo multiple cycles of mitosis until occupying the available space, which is typically a surface of a cell culture container (e.g., a plate, dish, or flask) submerged under culture medium. For example, the cells may grow out as a monolayer on a cell culture container surface. If the growing cells occupy the entireavailable space of surface, they cannot proliferate further and may exhibit senescent behavior. In order to continue growth of the cells, which may be performed to maintain the viability and proliferative nature of the cells and / or to expand the number of cells for downstream purposes, the cells may be passaged by taking a fraction of the cells and seeding this fraction onto a fresh surface (e.g., of a cell culture container) in culture medium. This fraction of the cells will continue to proliferate and multiply until they occupy the available space of the new surface, upon which this passaging can be repeated successively.
[0230] The microscopic architecture of the liver is made up of polygonal structures called “hepatic lobules”. Classically, these lobules take on a hexagonal structure, although other geometric shapes are observed depending on tissue specification. Each lobule unit comprises plates or layers of hepatocytes surrounding an internal central vein and encapsulated by bundles of vessels called portal triads, which are made up of a portal vein, hepatic artery, and bile duct. Hepatic activity occurs as blood flows from the portal triads at the periphery, across the hepatocytes, and into the central vein to return to the circulatory system. Due to the asymmetric organization of these lobules, the layers of hepatocytes are divided into three zones. Cells in the “periportal zone” (zone 1) are closest to the portal triad and receive the most oxygenated blood, the pericentral zone (zone 3) are closest to the central vein and therefore receive the least amount of oxygenated blood, and the transition zone (zone 2) is in between zone 1 and 3. Due to this separation, each zone of hepatocytes exhibit differing activities. For example, zone 1 hepatocytes are involved in oxidative liver functions such as gluconeogenesis and oxidative metabolism of fatty acids, whereas zone 3 hepatocytes are involved in glycolysis, lipogenesis, and cytochrome P450-mediated detoxification. In some embodiments, the liver organoids disclosed herein exhibit a periportal-like identity resembling the tissue found in the periportal zone of liver lobules, including the functional and cellular marker characteristics of the periportal zone.
[0231] The term “bilirubin” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to the naturally occurring metabolite created by normal catabolic degradation of heme. Bilirubin arises from the catalysis of biliverdin by biliverdin reductase. In the liver, bilirubin is conjugated with glucuronic acid by a family of enzymes called UDT-glucuronosyltransferases (UGTs). This conjugation renders bilirubin water soluble, enabling it to be carried in bile to the small intestine and colon, whereby it is further metabolized to waste products. Dysfunctional bilirubin metabolism, particularly due to abnormal function of UGTs preventing conjugation of bilirubin, leads to accumulation of bilirubin and is associated withvarious diseases characterized by hyperbilirubinemia. Notably, however, while excessive bilirubin is detrimental, bilirubin also has antioxidant capabilities and therefore may have beneficial effects in reducing oxidative damage in cells.
[0232] The term “hyperbilirubinemia” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to the condition of elevated levels of bilirubin, which is a natural product of heme catabolism. Bilirubin is filtered from the blood by the liver and is converted to water soluble intermediates, which are then released to the intestinal tract in bile, metabolized by microbiota, and excreted as waste. In neonates, bilirubin levels, which were originally cleared by the mother through the placenta, might not be adequately cleared by the immature liver. Excessive levels of bilirubin may potentially cause severe neurological damage (kernicterus). In adults, hyperbilirubinemia may also result from diseases affecting the liver, such as hepatitis and cirrhosis. Neonatal hyperbilirubinemia is treated by phototherapy, or with blood transfusion in extreme cases, whereas treatments in adults are directed to the underlying cause.
[0233] The term “L-gulonolactone oxidase” and “GULO” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to the enzyme that catalyzes L-gulonolactone to produce L-xylo-hex-3-gulonolactone and hydrogen peroxide. The L-xylo-hex- 3-gulonolactone then spontaneously converts to ascorbate (vitamin C). Accordingly, this enzyme is involved in the biosynthesis of vitamin C, which is an essential nutrient that is involved in many biological functions such as use as a cofactor for several important enzymes and as an antioxidant. Notably, humans, as well as other haplorrhine primates, certain species of bats, and Guinea pigs have evolved to harbor a non-functional GULO gene. Therefore, these organisms are unable to synthesize ascorbate and require vitamin C intake from diet or supplementation, where a deficiency of vitamin C can lead to scurvy. As applied to the disclosure herein, a “functional GULO protein” is a GULO protein that has L-gulonolactone catalytic activity to result in the production of ascorbate. Conversely, an “inactive” GULO protein or “non-functional” GULO protein is one that does not have the catalytic activity to produce ascorbate. Humans and cells that are derived from humans comprise a non-functional GULO protein and do not have the ability to synthesize ascorbate. However, as disclosed herein, human cells may be engineered to express a functional GULO protein to enable ascorbate synthesis ability. These functional GULO proteins may be expressed in human cells (or other cells that are unable to normally synthesize ascorbate) through conventional methods of cloning, such as genetically engineering cells to have genetic sequences that encode for a functional GULO protein.
[0234] The term “exogenous” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to external factors that originate outside of a biological specimen (e.g., a cell, population of cells, organoid, etc.), as opposed to being naturally occurring and / or produced by the biological specimen itself. As used herein, exogenous components, reagents, and / or conditions, are components, reagents, and / or conditions that are added to compositions described herein, although this does not necessarily preclude the possibility of the same components, reagents, and / or conditions also being present through a function endogenous to a biological specimen.
[0235] The terms “liver organoid” and “hepatocyte organoid” are used interchangeably herein, and refer to populations of cells differentiated in vitro to form self-organizing structures, which generally are three-dimensional (3D), and include one or more functional cell types. Liver organoids differ from naturally occurring liver tissue in a number of ways. For example, as compared with naturally occurring liver tissue, liver organoids can have a structure having a single lumen and generally a spherical shape, and can include a basement membrane which is unnatural. The single lumen of a liver organoid contains 3D tissues but generally does not make any hepatic lobular structure nor cord-like structure, as with naturally occurring liver tissue. Liver organoids also generally do not contain hematopoietic tissue and acquired immune cell subsets, such as T cell lineages. Further, as compared with naturally occurring liver tissue, liver organoids can have different efflux mechanisms, as a liver organoid can have a three-dimensional structure with a luminal structure but no ejection mechanism. In addition, liver organoids generally cannot receive dietary inputs, as they lack a gut and connected vascular channel. Organoids differ from embryonic bodies (EBs) in that organoids are composed of a majority of endoderm-derivatives (more than 50%).
[0236] The relative maturity of a liver organoid can be based on one or more of several factors, including key marker expressions, protein secretion, and functional enzyme activity. The term “immature liver organoid” refers, in general, to a population of organoids that produce a low amount of albumin, or a reduced amount of albumin as compared to a mature liver organoid. An immature liver organoid also generally can have reduced expression of ALB, HNF4A, MRP2, BSEP, GLS2, and / or PCK, and increased expression of SOX9 and / or CDX2, as compared to a mature liver organoid. In addition to reduced albumin secretion, an immature liver organoid can also have decreased drug metabolism (CYP450 activity), urea production, and bile acid synthesis and excretion, as compared to a mature liver organoid. In contrast, a “mature liver organoid” canproduce a high amount of albumin, and can have increased expression of ALB, HNF4A, MRP2, BSEP, GLS2, and / or PCK, and reduced expression of SOX9 and / or CDX2. In addition to increased albumin secretion, a mature liver organoid can also have increased drug metabolism (CYP450 activity), urea production, and bile acid synthesis and excretion. A mature liver organoid can also have a structure including ZO-1, and / or MRP2 protein localization along the luminal lining.
[0237] Liver organoids can be derived from pluripotent stem cells (PSCs), including at least embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs). Liver organoids may also be formed from liver-derived stem cells. In general, liver organoids can self-organize through cell sorting and spatially restricted lineage commitment in a manner similar to that which occurs in vivo, but as directed in vitro by thoughtful introduction of exogenous and / or endogenous differentiating factors and / or conditions as described herein, optionally through one or more directed steps, optionally involving introduction of one or more components.
[0238] The term “mature liver organoid” as used herein refers to liver organoids which have continued to develop from a liver organoid to include, in various embodiments, luminal projections that resemble bile canaliculi, and / or a structure having a single lumen and generally a spherical shape. Mature liver organoids may exhibit lumens with smaller sizes and reduced circularity when compared to lumens of liver organoids. In some embodiments, mature liver organoids may be generated through addition of exogenous bilirubin and / or amino acid supplementation as described herein. In some embodiments, a mature liver organoid may be characterized as expressing reduced levels of AFP, CDX2, and / or NANOG relative to liver organoids, and / or as expressing increased levels of ALB, SLC4A2 and / or HO-1 relative to liver organoids. In some embodiments, a mature liver organoid may be characterized as expressing CYP2E1, CYP7A1, PROX1, MRP3, MRP3, and / or OATP2. In some embodiments, a mature liver organoid may exhibit increased CYP3A4 and / or CYP1A2 protein levels and / or enzymatic activity relative to liver organoids.
[0239] The term “hyperbilirubinemia liver organoid” as used herein refers to liver organoids which have been exposed to high concentrations of bilirubin, generally provided exogenously through one or more dosings, to mimic a hyperbilirubinemia state. In some embodiments, hyperbilirubinemia liver organoids comprise genetic abnormalities that alter bilirubin metabolism, such as resulting in increased levels of bilirubin anabolism and / or reduced levels of bilirubin catabolism. Hyperbilirubinemia liver organoids can be characterized asexpressing elevated levels of UGT1A1 and / or NRF2, relative to liver organoids not exposed to high concentrations of bilirubin.
[0240] The term “tissue culture surface” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a substrate surface on which cells may aggregate and / or adhere to facilitate cell growth, differentiation, and / or function.
[0241] The term “engineered” as used herein refers to an entity that is generated by the hand of man, including a cell, nucleic acid, polypeptide, vector, and so forth. In at least some cases, an engineered entity is synthetic and comprises elements that are not naturally present or configured in the manner in which it is utilized in the disclosure. In certain embodiments, a construct and / or vector is engineered through recombinant nucleic acid technologies, and a cell is engineered through transfection or transduction of an engineered vector. Cells may be engineered to express heterologous proteins that are not naturally expressed by the cells, either because the heterologous proteins are recombinant or synthetic or because the cells do not naturally express the proteins.
[0242] The terms “Z1-like”, “Zone 1-like”, and “periportal-like” hepatocytes are used interchangeably herein, and refer to cells that have developed expression and / or developmental phenotypes similar to and / or potentially not significantly distinguishable from, those observed in naturally occurring Z1 (periportal) hepatocytes. These Z1-like cells may have oxidative liver functions such as gluconeogenesis and / or oxidative metabolism of fatty acids metabolic capacity. Z1-like cells may express increased levels of Fumarylacetoacetase (FAH), 4- Hydroxyphenylpyruvate dioxygenase (HPD), Stearoyl-CoA desaturase (SCD), Acyl-coenzyme A synthetase 2 (ACSS2), Argininosuccinate lyase (ASL), Carbamoyl phosphate synthetase I (CPS1), Ornithine transcarbamylase (OTC), Stem-loop binding protein (SLBP), Glutaminase (GLS), and / or Rho family GTPase 3 (RND3) gene products (e.g., coding and / or non-coding transcripts, polypeptides, proteins, etc.) relative to other hepatocyte cell types. In some embodiments, Z1-like hepatocytes may be Z1 hepatocytes. Any mention of “zone 1” or “Z1” as used herein can also encompass “Z1-like.”
[0243] The terms “Z2-like”, “Zone 2-like”, and “interzonal-like” hepatocytes are used interchangeably herein, and refer to cells that have developed expression and / or developmental phenotypes similar to and / or potentially not significantly distinguishable from, those observed in naturally occurring Z2 (interzonal) hepatocytes. Z2-like cells may produce hepatoblasts and / or be involved in proliferation and / or differentiation of hepatocytes. Z2-like cells may express increasedlevels of Glutathione synthetase (GSS), Telomerase reverse transcriptase (TERT), Apolipoprotein M (APOM), and / or Aldo-keto reductase family 1 member C1 (AKR1C1) gene products (e.g., coding and / or non-coding transcripts, polypeptides, proteins, etc.) relative to other hepatocyte cell types. In some embodiments, Z2-like hepatocytes may be Z2 hepatocytes. Any mention of “zone 2” or “Z2” as used herein can also encompass “Z2-like.”
[0244] The terms “Z3-like, “Zone 3-like”, and “pericentral-like” hepatocytes are used interchangeably herein, and refer to cells that have developed expression and / or developmental phenotypes similar to and / or potentially not significantly distinguishable from, those observed in naturally occurring Z3 (pericentral) hepatocytes. These Z3-like cells may have glycolysis, lipogenesis, and / or cytochrome P450-mediated detoxification metabolic capacity. Z3-like cells may express increased levels of Aldehyde dehydrogenase 6 family member A1 (ALDH6A1), Organic anion transporter polypeptide 2 (OATP2), Growth hormone receptor (GHR), Aldehyde dehydrogenase 1A2 (ALDH1A2), Glutamine synthetase (GLUL), Hypoxia-inducible factor 1- alpha (HIF1A), Sterol regulatory element-binding protein 1 (SREBF1), Cytochrome P450 family 3 subfamily A member 4 (CYP3A4), Cytochrome P450 family 1 subfamily A member 2 (CYP1A2), Butyrylcholinesterase (BCHE), Glucocorticoid receptor (NR3C1), and / or Regulator of calcineurin 1 (RCAN1) gene products (e.g., coding and / or non-coding transcripts, polypeptides, proteins, etc.) relative to other hepatocyte cell types. In some embodiments, Z3-like hepatocytes may be Z3 hepatocytes. Any mention of “zone 3” or “Z3” as used herein can also include “Z3- like.”
[0245] The terms “multi-zonal liver organoid” or “mZ-LO” are used interchangeably herein, and refer to organoids that have developed expression and / or developmental phenotypes characteristics of two or more liver zones, including the genetic, functional, and / or cellular marker characteristics of the two or more zones. Multi-zonal liver organoids may comprise discretely identifiable Z1, Z2, Z3, Z1-like, Z2-like, and / or Z3-like cell populations or subpopulations, which may be distinguished spatially and / or phenotypically. In some embodiments, there is an observable and / or measurable boundary between two or more types of hepatocytes, and / or phenotypically distinct hepatocyte subpopulations. mZ-LO may be derived from human cells, and referenced as mZ-HLO. Multi-zonal liver organoids may also comprise and / or develop additional cell types, including cholangiocytes, endothelial cells, macrophages, stellate cells, mesenchyme cells, and / or hepatoblasts. Multi-zonal liver organoids may maintain a tubular structure and / or a continuous lumen, and may display differential expression of zone-specific liver markers, indicating thevariable functionality of the various zones. Multi-zonal liver organoids may also comprise populations of cells expressing pan-hepatocyte marker genes such as ACSS2, ALDH6A1, AKR1C1, Alpha-1 antitrypsin (A1AT), Haptoglobin-related protein (HPR), Hepatocyte nuclear factor 4 alpha (HNF4A), CCAAT enhancer binding protein alpha (CEBPA), Albumin (ALB), HNF1 homeobox A (HNF1A), Prospero homeobox 1 (PROX1), and / or Tubulin alpha-1A (TUBA1A). A multi-zonal liver organoid may develop functional capacity for hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and / or glutamine metabolism. Differentiation of Zonal Hepatocytes in Human Liver Organoid Systems
[0246] Handling both the synthesis and degradation of a multitude of metabolites requires precise compartmentalization, a feature that is achieved in the liver by a process called zonation. In zonation, the hepatocytes are specialized into periportal hepatocytes (zone 1) located near the portal vein, pericentral hepatocytes (zone 3) near the central vein, and a small population of interzonal hepatocytes in the intermediate region. The periportal hepatocytes develop in an oxygen- and nutrient-rich environment, and vice versa for pericentral hepatocytes.
[0247] Studies have indicated that zonation in the adult liver is maintained by the availability of nutrients and oxygenation status delimited by the portal and central veins. The candidate signaling cascade responsible for proper zonation of the pericentral hepatocytes is the Wnt family molecules, while the Hedgehog (Hh) and Notch signaling pathway are linked to periportal hepatocytes and cholangiocytes. However, the principal transcriptional regulators of zonal fate determination have yet to be defined, hindering the ability to effectively model zonal hepatocyte differentiation in human tissues. Efforts to model this zonality are underway in animal and human cell culture with attempts to create oxygen, chemical, and gene gradient conditions. The exact upstream mechanism that directs the fate of zonal hepatocytes is still unclear, hindering the controlled differentiation of zonal hepatocytes in humans.
[0248] Ascorbic acid, which is an essential antioxidant for hepatocyte development, regulates the expression of several Zone 1 specific liver genes. Periportal hepatocytes are principally responsible for functions, including gluconeogenesis, cholesterol synthesis, and fatty acid oxidation are potentiated by the activity of ascorbate, whereas lipogenesis, attributed to pericentral hepatocytes, is inhibited by ascorbic acid. Ascorbate is also known for the activationof Tet1 (Tet methylcytosine dioxygenase 1) in the liver, which in turn activates Hh signaling essential for the activation of periportally-enriched gene expression in late embryogenesis. These lines of evidence indicate that stabilized ascorbic acid exposure can promote the expression of periportal specific metabolic pathway genes.
[0249] In contrast, bilirubin, a metabolic waste product made from heme, has a potential to enrich metabolic activities located in the pericentral areas. For example, bilirubin can promote the expression of Zone 3-enriched specific CYP enzymes directly or indirectly through Wnt signaling activation. Thus, ascorbate and bilirubin can prime differential zone-specific programs. The Wnt activating role of bilirubin is explained by its pro-angiogenic properties, thereby activating the Akt-NOS3 signaling pathway. Moreover, bilirubin is known to activate both transcription and translation of HIF1α in even normoxic conditions to emulate the after-effects on exposure to hypoxia. Given that GLUL+ pericentral hepatocytes are HIF1α positive, bilirubin can be involved in sustaining the expression of Zone 3 specific programs.
[0250] As described herein, in order to employ differential inductive conditions, the disclosure relates to dual organoid systems developed by combining ascorbate- and bilirubin- enriched progenitors (e.g. immature HLOs) derived from human induced pluripotent stem cells (hiPSCs). Ascorbate-enriched progenitors can be derived by genetic manipulation, ascorbate supplementation, hedgehog signal activation, Notch signal activation, Wnt inhibition, Tet activation, hyperoxia any / or the like. Bilirubin-enriched progenitors can be derived by exposure to bilirubin, genetic manipulation, hypoxia culture, Wnt supplementation, Hedgehog inhibition, Notch inhibition, manipulation of any gene listed in Fig.11, and / or the like. In some embodiments, an ascorbate-treated HLO can be prepared by manipulation of one or more genes listed in Fig.11; In some embodiments, a bilirubin-treated HLO can be prepared by manipulation of one or more genes listed in Fig.11. For example, periportal identity for the ascorbate-enriched progenitors can be evoked using a tetracycline (TET)-inducible active GULO knock-in hiPSC line (Reza, H. A. et al. Synthetic augmentation of bilirubin metabolism in human pluripotent stem cell-derived liver organoids. Stem Cell Reports (2023)) or the like. For example, standard hiPSC lines can be exposed to bilirubin to prime into pericentral lineage for the bilirubin-enriched progenitors.
[0251] The transcriptomic, epigenetic and functional profile of the resulting generated organoids demonstrate multi-zonal phenotypes and functions. For example, fatal total liver dysfunction was shown to be ameliorated upon transplantation in immunosuppressed rodent models.
[0252] The mZ-HLO platform described herein can be used for studying development and zonal functionality using human liver organoids from pluripotent stem cells. These data indicate that bilirubin and ascorbate are able to drive epigenetic and transcriptional programs towards the development of zonal hepatocyte identity.
[0253] mZ-HLOs prepared as described herein are equipped with the urea cycle, glutathione, and / or glutamine metabolic functions to exert concerted efforts to control nitrogen availability as seen in vivo. As the multi-zonal liver organoid system, processes creating the same, and products developed using said processes, as described herein, are tractable and manipulable, the mZ-HLO organoid system allows for the study of development and disease affecting divergent hepatocyte subpopulations in humans.
[0254] Emerging single cell genomics approaches have revealed the high-resolution signatures that define the zonation pattern in the liver. For example, snRNAseq has been used to characterize iPSC-derived epithelial components in organoids. The snRNAseq dataset showed divergent parenchymal populations including hepatoblasts, interzonal, pericentral, and periportal hepatocyte-like cells, which were annotated based on the aforementioned datasets and well-known genetic markers. Moreover, when compared to primary liver snRNAseq dataset, the zonal hepatocyte population are found to be highly concordant with subpopulations found in the mZ- HLO, with the exception of the hepatoblast population. The genes and pathways activated in zonal subpopulations are largely in agreement with existing knowledge related to specialized molecular markers, though with lower expression of TTR, CEBPB, APOA1 and ARG1 when compared to publicly available primary liver-derived datasets, likely due to immaturity or differences between snRNAseq and scRNAseq.
[0255] The developmental lineage predictions supported the theory that zonal hepatocytes originate from hepatoblasts after differentiation through the interzonal hepatocyte fates. The trajectory model of the mZ-HLOs depicted the development trajectory of early zonal liver development. Adult hepatocytes have been reported to transdifferentiate into different zonal hepatocytes. Consistent with this, alternating zonal-priming treatment at day 20 induced switching of zone1 and zone3 phenotypes, however, in some examples, this plastic nature was lost beyond day 25 of organoid development when the zonal features start to become more pronounced. Regardless, new evidence suggests that interzonal hepatocytes are the primary source of other zonal hepatocytes during liver regeneration which is very similar to the disclosed mZ-HLO model. Collectively, multi-zonal organoids together with single cell genomics can provide a frameworkto study the developmental divergence of hepatocytes in humans and model liver-related diseases and disorders.
[0256] The epigenetic landscape determines the differentiation into zonal hepatocytes in the liver. The disclosure relates to the finding that EP300, a histone acetyltransferase, is one such epigenetic modifier that acetylates enhancer regions and activates transcription leading to hepatoblast differentiation. EP300 marks poised and active enhancers and activates expression of zonal genes. For instance, periportal metabolic functions, such as gluconeogenesis and beta- oxidation of fatty acids, can be activated by EP300. On the other hand, EP300 can contribute to the upregulation of genes involved in glycolysis and lipogenesis, which are functions specific to pericentral hepatocytes. Similarly, EP300 can bind to enhancers upstream of zonal genes, such as ALDH6A1, ACSS2 and HPR, in a context-dependent manner to differentially activate gene expression. In certain aspects, the integrated RNAseq and ChIPseq data showed that the top targets were HIF1A and TET1 in the dox-treated Z1-HLOs and bilirubin-treated Z3-HLOs, respectively. Developmentally, the Tet1 deletion impairs periportal identity and function in the liver, whilst repressing the pericentral characters regulated through Hedgehog signaling. Inversely, bilirubin possesses signaling properties that can activate HIF and WNT signaling cascades. which are important for pericentral hepatocytes. Following these developmental patterns, mZ-HLOs exposed to inhibitors specific to HIF1A (KC7F2) and TET1 (Bobcat 339) were found to lead to the loss of zonal identities. ). Moreover, a mouse siRNA model revealed that EP300 is integral to zonal liver development which further validated results. Finally, freshly isolated size fractionated PHH showed that H20 (periportal hepatocytes) had a TET1 binding site upstream of ACSS2, while H40 (pericentral hepatocytes) had a HIF1A binding site upstream of ALDH6A1 identical to our mZ- HLOs. These results corroborate the developmental role of HIF1A and TET1 in executing zonal program.
[0257] Hepatocyte transplantation has been used to treat liver diseases, but the difficulty in obtaining compatible primary human hepatocytes makes this an impractical approach. Recently, stem cell-derived tissues have been used to treat a multitude of hepatic diseases (Reza, H. A., Okabe, R. & Takebe, T. Organoid transplant approaches for the liver. Transplant International 34, 2031-2045 (2021)). However, the most therapeutic proof-of-concept has aimed at correcting monogenic conditions by targeting one particular disease parameter.
[0258] The presently described mZ-HLO model, endowed with the multi-zonal functionality, can ameliorate multiple aspects of liver failure for example, in vivo in a bile duct-ligated immunodeficient rat model. There was significant reduction in serum bilirubin and ammonia levels as detected in the rat, while serum protein albumin was secreted. This translated into an increased survival rate of the rats that received the mZ-HLO transplantation when compared to the sham.
[0259] Interestingly, zone-1 or zone-3 primed organoid transplants only offer either hyperammonemia or hyperbilirubinemia improvements resulting in reduced survival benefit. However, mZ-HLO transplants offer improvements in both hyperammonemia and hyperbilirubinemia. Furthermore, the mZ-HLOs integrate into the parenchyma of the rat liver in a tubular morphology while retaining their zonal characteristics as indicated by the expression of mCherry, GFP, ARG1, and GLUL. Finally, the Z1-HLOs showed a preferential integration near the portal vein, while the Z3-HLOs exhibited a slightly higher affinity for the central vein region. Overall, that the disclosed mZ-HLOs are able to engraft into the resident liver and maintain zonal- specific functionality and augment the survival rate in rodents following biliary duct ligation. Thus, the mZ-HLOs can be used as a tool to recapitulate zonal identity and function, which is critical in the study and treatment of hepatic disease.. Human Liver Organoids
[0260] The microscopic architecture of the liver is made up of polygonal structures called “hepatic lobules”. Classically, these lobules take on a hexagonal structure, although other geometric shapes are observed depending on tissue specification. Each lobule unit comprises plates or layers of hepatocytes surrounding an internal central vein and encapsulated by bundles of vessels called portal triads, which are made up of a portal vein, hepatic artery, and bile duct. Hepatic activity occurs as blood flows from the portal triads at the periphery, across the hepatocytes, and into the central vein to return to the circulatory system. Due to the asymmetric organization of these lobules, the layers of hepatocytes are divided into three zones. Cells in the “periportal zone” (zone 1) are closest to the portal triad and receive the most oxygenated blood, the “pericentral zone” (zone 3) are closest to the central vein and therefore receive the least amount of oxygenated blood, and the “transition zone” (zone 2) is in between zone 1 and 3. Due to this separation, each zone of hepatocytes exhibit differing activities. For example, zone 1 hepatocytes are involved in oxidative liver functions such as gluconeogenesis and oxidative metabolism of fatty acids, whereas zone 3 hepatocytes are involved in glycolysis, lipogenesis, and cytochrome P450-mediated detoxification.
[0261] Human liver organoids (HLOs) can be derived from progenitor cells, such as, for example, patient-derived induced pluripotent stem cells (iPSCs), where the patient can be healthy or having a diseased condition, and are identical in genetic content to the respective patient. They express most liver markers that are expressed in the pre-natal stages of development. Furthermore, they are clonal and therefore reacts similarly to external stimuli and biochemical perturbations. These HLOs are highly scalable and tractable, allowing screening approaches to test a vast array of drugs and small molecules.
[0262] HLOs are easy to work with as model systems and have very low variation across batches. Large batches of HLOs can be generated within a couple of weeks. Leveraging these qualities, several drugs can be tested within a short span of time to identify pathways involved in liver diseases and disorders. In contrast, breeding model organisms such as mice and rats takes months of work and planning, and the chance of getting the desired genotype is relatively low. Furthermore, model organisms show high variations in responses to biochemical perturbations over generations. These rodents also run the risk of losing the desired genotype when bred over long periods of time, and also require complex training and procedures to model diseases and evaluate the efficacy of treatments. Compared to model organisms, genetic modifications are much easier in iPSC cell lines and they can be maintained easily over longer periods before differentiation into organoids.
[0263] Vitamin C, which is involved in the formation of the periportal zone of the liver, is synthesized by the naturally occurring enzyme L-gulonolactone oxidase (GULO). Because this enzyme is non-functional in human and some other animals such as Guinea pigs, exogenous vitamin C supplementation (typically through the diet) is necessary. As shown in Guinea pig animal models, vitamin C deficiency causes significant metabolic disorders.
[0264] Bilirubin is the naturally occurring metabolite created by normal catabolic degradation of heme. Bilirubin arises from the catalysis of biliverdin by biliverdin reductase. In the liver, bilirubin is conjugated with glucuronic acid by a family of enzymes called UDT- glucuronosyltransferases (UGTs). This conjugation renders bilirubin water soluble, enabling it to be earned in bile to the small intestine and colon, whereby it is further metabolized to waste products. Dysfunctional bilirubin metabolism, particularly due to abnormal function of UGTs preventing conjugation of bilirubin, leads to accumulation of bilirubin and is associated with various diseases characterized by hyperbilirubinemia. Notably, however, while excessive bilirubinis detrimental, bilirubin also has antioxidant capabilities and therefore may have beneficial effects in reducing oxidative damage in cells.
[0265] The enzyme L-gulonolactone oxidase (GULO) catalyzes L-gulonolactone to produce L-xylo-hex-3-gulonolactone and hydrogen peroxide. The L- xylo-hex-3-gulonolactone then spontaneously converts to ascorbate (vitamin C). Accordingly, this enzyme is involved in the biosynthesis of vitamin C, which is an essential nutrient that is involved in many biological functions such as use as a cofactor for several important enzymes and as an antioxidant. Notably, humans, as well as other haplorrhine primates, certain species of bats, and Guinea pigs have evolved to harbor a non-functional GULO gene. Therefore, these organisms are unable to synthesize ascorbate and require vitamin C intake from diet or supplementation, where a deficiency of vitamin C can lead to scurvy. As applied to the disclosure herein, a “functional GULO protein” is a GULO protein that has L-gulonolactone catalytic activity to result in the production of ascorbate. Conversely, an “inactive” GULO protein or “non-functional” GULO protein is one that does not have the catalytic activity to produce ascorbate. Humans and cells that are derived from humans comprise a non-functional GULO protein and do not have the ability to synthesize ascorbate. However, as disclosed herein, human cells may be engineered to express a functional GULO protein to enable ascorbate synthesis ability. These functional GULO proteins may be expressed in human cells (or other cells that are unable to normally synthesize ascorbate) through conventional methods of cloning, such as genetically engineering cells to have genetic sequences that encode for a functional GULO protein.
[0266] Taking advantage of this, iPSC-derived organoids expressing a functional L- gulonolactone oxidase (GULO), such as murine GULO (mGULO), have been generated. When the iPSCs and organoids are human in origin, the expression of the functional L-gulonolactone allows for ascorbate synthesis, which is normally inactive in humans. These mGULO organoids exhibit increased efficiency in conjugating bilirubin and exhibited improved viability when treated with bilirubin. The production of ascorbate in mGULO organoids reduces oxidative stress in the organoids and drives expression of NRF2, which is a master regulator of cellular detoxification pathways and in turn promotes expression of UGT1A1, which catalyzes bilirubin conjugation. These mGULO organoids are otherwise genetically identical to the patients from which they are derived, and encompass the aspects of human bilirubin metabolism. Accordingly, these organoids can be used as model systems for elucidating the mechanistic development of liver-related diseases and disorders and developing therapeutic treatments thereto.
[0267] Previously described HLOs have been shown to exhibit a specific hepatocyte subpopulation, such as periportal (zone 1) hepatocytes. Heretofore, there has been no evidence of HLOs with multi-zonal characteristics, such as HLOs which have, for example, periportal (zone 1) hepatocytes as well as pericentral (zone 3) hepatocytes and / or interzonal hepatocytes.
[0268] Accordingly, the disclosure describes the formation of a multi-zonal liver organoid, co-culturing an first HLO, such as an ascorbate-enriched HLO with a bilirubin-treated HLO. In particular embodiments, the first HLO can be an ascorbate-enriched HLO such as the mGULO organoids described previously, which can be formed by treatment with doxycycline, When the two types of HLOs, which have an ascorbate-enriched progenitor cell population and a bilirubin- enriched progenitor cell population, respectively, are cultured together in the presence of bilirubin, the HLOs self-assemble and fuse into interconnected dual organoids having two or more phenotypically distinct (e.g. structurally distinct, and / or functionally distinct, etc.) hepatocyte subpopulations. Fusion of the organoids can be indicated by rearrangement and interaction of cytoskeleton proteins, increase in mean segment length. This fusion can occur by maintaining a continuous lumen. Fused organoids can expand canalicular connectivity. The fused organoid can include structures carrying bilirubin in the lumen. Activation of Notch signaling or Ezrin can increase fusion. Thus, in some aspects Notch activators, Ezrin activators, any of the like can be added to the co-culture; for example, such activators can be added once or more during day 15 through day 20 (D15-D20), optionally at 37Cº. For example, DAPT is an exemplary Notch activator which can be used, at an appropriate concentration. In some embodiments, DAPT can be used at a concentration of 0.1µM- 10µM, or 0.01µM-100µM, or a larger range.
[0269] These liver organoids exhibit characteristics of two or more zones, including the genetic, functional, and cellular marker characteristics of the two or more zones. For example, the doxycycline-treated HLO can include a zone 1 hepatocyte subpopulation, while the bilirubin- treated HLO can include a zone 3 hepatocyte subpopulation. This is beneficial, as for example, the liver organoids disclosed herein can have a periportal-like identity resembling the tissue found in the periportal zone of liver lobules, including the genetic, functional, and cellular marker characteristics of the periportal zone, as well as a pericentral-like identity resembling the tissue found in the pericentral zone of liver lobules, including the genetic, functional, and cellular marker characteristics of the pericentral zone. Further, in some embodiments, the liver organoids disclosed herein can have a periportal-like identity resembling the tissue found in the periportal zone of liver lobules, including the genetic, functional, and cellular marker characteristics of the periportal zone,as well as a pericentral-like identity resembling the tissue found in the pericentral zone of liver lobules, including the genetic, functional, and cellular marker characteristics of the pericentral zone, and a transition zone-like identity resembling the tissue found in the transition zone of liver lobules, including the genetic, functional, and cellular marker characteristics of the transition zone. Furthermore, the multi-zonal liver organoids of the disclosure can include multiple cell types in addition to pericentral, periportal, and interzonal hepatocytes, such as cholangiocytes, endothelial cells, macrophages, stellate cells, mesenchyme cells, and hepatoblasts.
[0270] The benefits of having a multi-zonal liver organoid are demonstrated by the versatility of the system and broad applicability to liver disease models in general, as well as transplantation. For example, these multi-zonal liver organoids can have expression of zone 1-, zone 2-, and / or zone 3-associated genes, and / or can express zone 1-, zone 2-, and / or zone 3- associated proteins. They can also have expression of pan-hepatocyte-associated genes and / or can express pan-hepatocyte-associated proteins. In particular, these multi-zonal liver organoids can have expression of zone 1-, zone 2-, and zone 3-associated genes, and can express zone 1-, zone 2-, and zone 3-associated proteins, in addition to expression of pan-hepatocyte-associated genes and pan-hepatocyte-associated proteins.
[0271] On account of their diverse zonal character, including diverse gene expression, these multi-zonal liver organoids have rich functionality. For example, the multi-zonal liver organoids of the disclosure have been shown to have hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and / or glutamine metabolic functionality, and various combinations thereof. the multi-zonal liver organoids of the disclosure have been shown to be enriched for Notch signaling and / or Wnt signaling. Methods of Producing Liver Organoids
[0272] Methods of producing liver organoids have been explored previously in, for example, Ouchi et al. “Modeling Steatobepatitis in Humans with Pluripotent Stem Cell-Derived Organoids” Cell Metabolism (2019) 30(2):374~384; Shinozawa et al. “High-Fidelity Drug- Induced Liver Injury Screen Using Human Pluripotent Stem Cell Derived Organoids” Gastroenterology (2021) 160(3) 831-846; PCX Publications WO 2018 / 085615, WO 2018 / 191673, WO 2018 / 226267, WO 2019 / 126626, WO 2020 / 023245, WO 2020 / 069285, WO 2020 / 243613,WO 2021 / 030373, and WO 2021 / 262676, each of which is hereby expressly- incorporated by references in its entirety. Disclosure of liver organoid compositions and methods of making thereof are applicable to the human liver organoids (PILOs) described herein.
[0273] Embodiments of methods for producing multi-zonal liver organoids are provided herein. In some embodiments, the methods include a) contacting definitive endoderm cells (DE) with an FGF signaling pathway activator and a Wnt signaling pathway activator for a first period of tune; b) contacting the cells of step a) with the FGF signaling pathway activator, the Wnt signaling pathway activator, and a retinoic acid (RA) signaling pathway activator for a second period of time, thereby differentiating the DE to posterior foregut cells; and c) embedding the posterior foregut cells in a basement membrane matrix and culturing the posterior foregut spheroids for a third period of time to differentiate the posterior foregut cells to the multi-zonal liver organoid. In some embodiments, the DE has been derived from pluripotent stem cells. In some embodiments, the pluripotent stem cells are embryonic stem cells and / or induced pluripotent stem cells. In some embodiments, the first period of time is, is about, is at least, is at least about, is not more than, or is not more than about, 0.5, 1, 2, 3, or 4 days, or a range defined by any two of the preceding values, for example 0.5-4, 1-4, 0.5-2, or 3-4 days. In some embodiments, the second period of time is, is about, is at least, is at least about, is not more than, or is not more than about 0.5, 1, or 2 days. In some embodiments, the third period of time is, is about, is at least, is at least about, is not more than, or is not more than about, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 days, or a range defined by any two of the preceding values, for example 4-30, 10-30, 20-30, 4-17, 4-12, or 10-25 days. In some embodiments, the basement membrane matrix is Matrigel. In some embodiments, the liver organoid, DE, and / or pluripotent stem cells are derived from a patient.
[0274] In some embodiments of the methods of making multi-zonal liver organoids, the FGF signaling pathway activator is selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF4, FGF 5, FGF6, FGF7, FGF8, FGF8, FGF9, FGF 10, FGF 11, FGF 12, FGF13, FGF 14, FGF 15, FGF 16, FGF 17, FGF 18, FGF 19, FGF20, FGF21 , FGF22, and FGF23. in some embodiments, the FGF signaling pathway activator is FGF4. In some embodiments, the FGF signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations, including 100-1000 ng / mL, 100-500ng / mL, 500-1000 ng / mL, 250-750 ng / mL, or 400-600 ng / mL, In some embodiments, the FGF signaling pathway activator is contacted at a concentration of 500 ng / mL or about 500 ng / mL.
[0275] In some embodiments of the methods of making multi-zonal liver organoids, the Wnt signaling pathway activator is selected from the group consisting of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, Wntl6, BML 284, IQ-1, WAY 262611, CHIR99021, CHIR98014, AZD2858, BIO, AR-A014418, SB 216763, SB 415286, aloisine, indirubin, alsterpaullone, kenpaullone, lithium chloride, TDZD 8, and TWS119. In some embodiments, the Wnt signaling pathway activator is CHIR99021. In some embodiments, the Wnt signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, or 3.5 mM, or any concentration within a range defined by any two of the aforementioned concentrations, including 0.5-3.5 mM, 0.5-2 mM, 2-3.5 mM, 1-3 mM, or 1.5-2.5 mM. In some embodiments, the Wnt signaling pathway activator is contacted at a concentration of 2 mM or about 2 mM.
[0276] In some embodiments of the methods of making multi-zonal liver organoids, the RA signaling pathway activator is selected from the group consisting of retinoic acid, all-trans retinoic acid, 9-eis retinoic acid, CD437, EC23, BS 493, TTNPB, and AMS 80. In some embodiments, the RA signaling pathway activator is RA. In some embodiments, the RA signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.9, or 3 mM, or any concentration within a range defined by any two of the aforementioned concentrations, including 1-3 mM, 1-2 mM, 2-3 mM, or 1.5-2.5 mM. In some embodiments, the RA signaling pathway activator is contacted at a concentration of 2 mM or about 2 mM. Maturation of Liver Organoids
[0277] Liver organoids prepared from pluripotent stem cells using previous methods may comprise cell types reminiscent of certain zonal types, but do not have a multi-zonal liver state. Disclosed herein are methods of maturing multi-zonal liver organoids by co-culturing a first HLO with a bilirubin-treated second HLO, and then contacting in the co-culture with a concentration of bilirubin, thereby producing multi-zonal liver organoids. In some embodiments, the first HLO isan ascorbic acid- and / or ascorbate-treated HLO; optionally wherein the HLO is treated via doxycycline mediated induction of functional GULO.
[0278] In some embodiments, the concentration of bilirubin is a human physiological concentration of bilirubin. In some embodiments, the concentration of bilirubin is, is about, is less than, or is less than about, 0.1 to 1 mg / L, 0.5 to 1 mg / L, or 1 mg / L. In some embodiments, the concentration of bilirubin is, is about, is less than, or is less than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg / L, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 1 mg / L, 0.1 to 0.5 mg / L, 0.5 to 1 mg / L, 0.3 to 0.7 mg / L, or 0.4 to 0.6 mg / L. In some embodiments, the concentration of bilirubin is, is about, is less than, or is less than about, 0.1 to 3 mg / L, 0.5 to 3 mg / L, or 3 mg / L. In some embodiments, the concentration of bilirubin is, is about, is less than, or is less than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or 3.0 mg / L, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 3 mg / L, 0.5 to 2.0 mg / L, 0.5 to 1.5 mg / L, 0.3 to 2.5 mg / L, or 0.5 to 1.75 mg / L. In some embodiments, the multi- zonal liver organoid is differentiated from pluripotent stem cells (such as iPSCs or ESCs) according to a culture process that occurs over the span of 12, 13, 14, 15, 16, 17, 18, 19 or 20 days. In some embodiments, the multi-zonal liver organoid is, is about, is at least, or is at least about, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days old, or a range defined by any two of the aforementioned values, for example, 12-20, 14-16, or 15-18 days old, when used in the methods disclosed herein. In some embodiments, the multi-zonal liver organoids are contacted with the concentration of bilirubin for a period of time that is, is about, is at least, or is at least about, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, or a range defined by any two of the aforementioned values, for example, 12- 20, 14-16, or 15-18 days, to mature into the multi-zonal liver organoids.
[0279] In some embodiments, the multi-zonal liver organoid has expression of one or more zone 1-associated genes and / or expresses one or more zone 1-associated proteins; expression of one or more zone 2-associated genes and / or expresses one or more zone 2-associated proteins; expression of one or more zone 3-associated genes and / or expresses one or more zone 3-associated proteins; and expression of one or more pan-hepatocyte-associated genes and / or expresses one or more pan-hepatocyte-associated proteins. In some embodiments, the one or more zone 1- associated genes are selected from FAH, HPD, SCD, ACSS2, ASL, CPS1, OTC, ACSS2, SLBP, and RND3 genes; the one or more zone 1-associated proteins are selected from CPS1 and ACSS2; the one or more zone 3-associated genes are selected from ALDH6A1, OATP2, GHR, ALDH1A2,GLUL, HIF1A, SREBF1, CYP3A4, CYP1A2, GHR, BCHE, and RCAN1; the one or more zone 3-associated proteins are selected from GLUL and NR3C1 proteins; and / or the one or more pan- hepatocyte marker genes are selected from ACSS2, ALDH6A1, AKR1C1, A1AT, HPR, HNF4A, CEBPA, ALB, HNF1A, PROX1, and TUBA1A.
[0280] In some embodiments, one or more HLO used to produce the multi-zonal liver organoid can be engineered to express a functional GULO protein, which improves organoid viability and function as disclosed herein. In some embodiments, the multi-zonal liver organoid can include a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, whereby the multi-zonal liver organoid is able to synthesize ascorbate. In some embodiments, the functional GULO protein is murine GULO (mGULO). However, the functional GULO may alternatively be derived from any other animal species that includes a functional GULO protein. In some embodiments, the gene that encodes for the functional GULO protein is conditionally expressed. In some embodiments, the gene is conditionally expressed using a tetracycline inducible system or any other system for conditional expression generally known in the art. In some embodiments, the multi-zonal liver organoid can be engineered to include the gene that encodes for the functional GULO protein using CRISPR or any other method of genetic engineering generally known in the art. In some embodiments, the gene or mRNA, or both, that encodes for the functional GULO protein is introduced to the HLO by transfection. In some embodiments, the multi-zonal liver organoid includes the functional GULO protein expresses increased levels of NRF2 relative to a liver organoid that does not include the functional GULO protein. In some embodiments, the multi-zonal liver organoid including the functional GULO protein expresses reduced levels of IL1B, IL6, or TNFa, or any combination thereof, relative to a liver organoid that does not include the functional GULO protein, optionally when cultured in ascorbate-depleted medium. In some embodiments, the multi-zonal liver organoid including the functional GULO protein exhibits reduced caspase-3 activity relative to a liver organoid that does not include the functional GULO protein, optionally when cultured in ascorbate-depleted medium. In some embodiments, the multi-zonal liver organoid including the functional GULO protein expresses increased levels of ALB relative to a liver organoid that does not include the functional GULO protein. In some embodiments, the multi-zonal liver organoid including the functional GULO protein resembles periportal liver tissue and expresses periportal liver markers. In some embodiments, the periportal markers can include FAH, ALB, PAH, CPS1, HGD, or any combination thereof. In some embodiments, the multi-zonal liver organoid including the functionalGULO protein exhibits increased CYP3A4 and CYP1A2 activity relative to a liver organoid that does not include the functional GULO protein. In some embodiments, the multi-zonal liver organoid including the functional GULO protein exhibits increased bilirubin conjugation activity relative to a liver organoid that does not include the functional GULO protein, in some embodiments, the multi-zonal liver organoid including the functional GULO protein exhibits increased viability in culture relative to a liver organoid that does not include the functional GULO protein.
[0281] In some embodiments, a HLO or co-culture of HLOs is contacted with a concentration of bilirubin in a hepatocyte culture medium. Representative compositions of these hepatocyte culture media (i.e. growth media that is designed for supporting hepatic tissues) are generally known in the art. In some embodiments, the hepatocyte culture medium includes hepatocyte growth factor, oncostatin M, dexamethasone, or any combination thereof.
[0282] In some embodiments, the multi-zonal liver organoid is human. In some embodiments, the multi-zonal liver organoid includes one or more HLO that has been differentiated from pluripotent stem cells. In some embodiments, the pluripotent stem cells are embryonic stem cells or induced pluripotent stem cells. In some embodiments, the pluripotent stem cells include a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, whereby the pluripotent stem cells are able to synthesize ascorbate.
[0283] Exemplary methods for producing liver organoids from pluripotent stem cells have been disclosed herein and are otherwise generally known in the art. In some embodiments, the HLOs co-cultured into a multi-zonal liver organoid have been made according to a method comprising: a) contacting definitive endoderm ceils (DE) with an FGF signaling pathway activator and a Wnt signaling pathway activator for a first period of time; b) contacting the cells of step a) with the FGF signaling pathway activator, the Wnt signaling pathway activator, and a retinoic acid (RA) signaling pathway activator for a second period of time, thereby differentiating the DE to posterior foregut cells; and c) embedding the posterior foregut cells in a basement membrane matrix and culturing the posterior foregut spheroids for a third period of time to differentiate the posterior foregut cells to an HLO.
[0284] Also disclosed herein are the multi-zonal liver organoids provided through any of the methods described herein.
[0285] In some embodiments, provided herein are compositions comprising artificial multi-zonal liver organoids, comprising Z1-like (periportal-like) hepatocytes, and Z3-like(pericentral-like) hepatocytes. In some embodiments, compositions provided herein comprise hepatocytes that have self-assembled into artificial multi-zonal liver organoids. In some embodiments, provided herein are artificial multi-zonal liver organoids comprising a structure that includes a single lumen. In some embodiments, provided herein are multi-zonal liver organoids comprising more than one distinctly observable (e.g., spatially, genetically, and / or phenotypically) hepatocyte population, such as Z1, Z2, Z3, and / or hepatoblasts populations. In some embodiments, artificial multi-zonal liver organoids do not comprise hematopoietic tissue and / or acquired immune cells. In some embodiments, artificial multi-zonal liver organoids may develop and / or be colonized by hematopoietic tissue and / or acquired immune cells following introduction of the artificial multi- zonal liver organoid to a subject. Liver-Related Diseases and Disorders
[0286] The multi-zonal liver organoids of the disclosure can be used in treatment and / or studying or modeling liver-related diseases and disorders, for which their diverse zonal character and functionality is particularly advantageous and renders them applicable to a wide range of conditions. In some embodiments, the methods include administering any of the multi-zonal liver organoids or liver cells disclosed herein. Also disclosed herein are the multi-zonal liver organoids or liver cells disclosed herein for use in the manufacture of a medicament for the treatment of a liver-related disease or disorder. Also disclosed herein are the liver organoids or liver cells disclosed herein for use in the treatment of a liver-related disease or disorder in a subject in need thereof.
[0287] Liver-related diseases and disorders relevant to the disclosure can include conditions such as liver dysfunction and / or failure (e.g. hyperammonemia and / or hyperbilirubinemia, and the like), hepatitis (e.g. hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, hepatitis TT, and / or autoimmune hepatitis, and the like), viral hepatitis, cholangitis, fibrosis, hepatic encephalopathy, hepatic porphyria, cirrhosis, cancer, drug-induced cholestasis, metabolic disease (e.g. metabolic dysfunction–associated liver disease (MASLD), MetALD, nonalcoholic fatty liver disease (NAFLD), metabolic dysfunction-associated steatohepatitis (MASH), and the like), autoimmune liver disease, Wilson’s disease, metabolic- associated fatty liver disease, hyperammonemia, hyperbilirubinemia, Crigler-Najjar Syndrome, urea cycle disorders, Wolman disease, hepatic cancer, hepatoblastoma, drug-induced liver injury (DILI), glycogen storage disease, hemorrhagic disease, hepatic cyst, and / or alcohol-associatedliver disease. One skilled in the art will appreciate other liver-related diseases and conditions for which the liver organoids disclosed herein could have relevance.
[0288] For example, the multi-zonal liver organoid can be transplanted into a subject having liver dysfunction and / or failure, where the transplanted multi-zonal liver organoids engraft onto the liver of the subject. Following transplantation, the subject can have reduced serum bilirubin and / or ammonia levels, and / or increased serum protein albumin, and / or improved symptoms of biliary stricture and / or liver regeneration, and can also have increased survival rate.
[0289] For example, these multi-zonal liver organoids can be used an in vitro human model system for studying hepatocyte function and developmental divergence, studying liver- related disease, identifying and / or screening for therapeutic targets, and / or identifying therapeutic compounds and / or compositions effective in treating a liver-related disease or disorder. Accordingly, the multi-zonal liver organoids of the disclosure can allow for new developments in liver disease treatment and study. Stem Cells
[0290] The term “totipotent stem cells” (also known as omnipotent stem cells) as used herein has its plain and ordinary meaning as understood in light of the specification and are stem cells that can differentiate into embryonic and extra-embryonic cell types. Such cells can construct a complete, viable organism. These cells are produced from the fusion of an egg and sperm cell. Cells produced by the first few divisions of the fertilized egg are also totipotent.
[0291] The term “embryonic stem cells (ESCs),” also commonly abbreviated as ES cells, as used herein has its plain and ordinary meaning as understood in light of the specification and refers to cells that are pluripotent and derived from the inner cell mass of the blastocyst, an early- stage embryo. For purpose of the present disclosure, the term "ESCs" is used broadly sometimes to encompass the embryonic germ cells as well.
[0292] The term “pluripotent stem cells (PSCs)” as used herein has its plain and ordinary' meaning as understood in light of the specification and encompasses any cells that can differentiate into nearly all cell types of the body, i.e., cells derived from any of the three germ layers (germinal epithelium), including endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epidermal tissues and nervous system), PSCs can be the descendants of inner cell mass cells of the preimplantation blastocyst or obtained through induction of a non-pluripotent cell, such as an adult somatic cell, by forcing the expression of certain genes. Pluripotent stem cells can be derived from any suitable source.Examples of sources of pluripotent stem cells include mammalian sources, including human, rodent, porcine, and bovine.
[0293] The term “induced pluripotent stem cells (iPSCs),” also commonly abbreviated as iPS cells, as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a type of pluripotent stem cells artificially derived from a normally non- pluripotent cell, such as an adult somatic cell, by inducing a "forced" expression of certain genes. hiPSC refers to human iPSCs. In some methods known in the art, iPSCs may be derived by transfection of certain stem cell-associated genes into non-pluripotent cells, such as adult fibroblasts. Transfection may be achieved through viral transduction using viruses such as retroviruses or lentiviruses. Transfected genes may include the master transcriptional regulators Oct-3 / 4 (PUU5F1) and Sox2, although other genes may enhance the efficiency of induction. After 3-4 weeks, small numbers of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are typically isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. As used herein, iPSCs include first generation iPSCs, second generation iPSCs in mice, and human induced pluripotent stem cells. In some methods, a retroviral system is used to transform human fibroblasts into pluripotent stem cells using four pivotal genes: Oct3 / 4, Sox2, Klf4, and c-Myc. In other methods, a lentiviral system is used to transform somatic cells with GCT4, SOX2, NANOG, and LIN28. Genes whose expression are induced in iPSCs include but are not limited to Oct-3 / 4 (POU5F1); certain members of the Sox gene family (e.g., Soxl, Sox2, Sox3, and Soxl5); certain members of the Klf family (e.g., Klfl, Klf2, Klf4, and Klf5), certain members of the Mye family (e.g., C-myc, L-myc, and N- myc), Nanog, LIN28, Tert, Fbxl5, ERas, EC ATI 5-1, ECAT15-2, Tell, b-Catenm, EC ATI, Esgi, Dnmt3L, EC ATS, Gdf3, Fthll7, Sall4, Rexl, UTF1, Stella, Stat3, Grb2, Prdml4, Nr5al, Nr5a2, or E-cadherin, or any combination thereof.
[0294] The term “precursor cell” as used herein has its plain and ordinary meaning as understood in light of the specification and encompasses any cells that can be used in methods described herein, through which one or more precursor cells acquire the ability to renew itself or differentiate into one or more specialized cell types. In some embodiments, a precursor cell is pluripotent or has the capacity to becoming pluripotent. In some embodiments, the precursor cells are subjected to the treatment of external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, a precursor cell can be a totipotent (or omnipotent) stem cell; a pluripotent stem cell (induced or non-induced); a multipotent stem cell; an oligopotent stem cells and aunipotent stem cell. In some embodiments, a precursor cell can be from an embryo, an infant, a child, or an adult. In some embodiments, a precursor cell can be a somatic cell subject to treatment such that pluripotency is conferred via genetic manipulation or protein / peptide treatment. Precursor cells include embryonic stem cells (ESC), embryonic carcinoma cells (ECs), and epiblast stem cells (EpiSC).
[0295] In some embodiments, one step can include obtaining stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, pluripotent stem cells are derived from embryonic stem cells, which are in turn derived from totipotent cells of the early mammalian embryo and are capable of unlimited, undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early-stage embryo. Methods for deriving embryonic stem cells from blastocytes are well known in the art. It would be understood by one of skill in the art that the methods and systems described herein are applicable to any stem cells.
[0296] Additional stem cells that can be used in embodiments in accordance with the present disclosure include but are not limited to those provided by or described in the database hosted by the National Stem Cell Bank (NSCB), Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF); WISC cell Bank at the Wi Cell Research Institute; the University of Wisconsin Stem Cell and Regenerative Medicine Center (IJW- SCRMC); Novocell, Inc. (San Diego, Calif.); Cellartis AB (Goteborg, Sweden); ES Cell International Pte Ltd (Singapore); Techmon at the Israel Institute of Technology (Haifa, Israel); and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania. Exemplary embryonic stem cells that can be used in embodiments in accordance with the present disclosure include but are not limited to SA01 (SA001); SA02 (SA002); ESDI (HES-1); ES02 (HES-2); ES03 (HES-3); ES04 (HES-4); ES05 (HES-5); ES06 (HES-6); BG01 (BGN-01); BG02 (BGN-02); BG03 (BGN-03); TE03 (13); TE04 (14); TE06 (16); UCOl (HSF1); UC06 (HSF6); WA01 (HI); WA07 (H7); WA09 (H9); WA13 (HI 3); WA14 (HI 4). Exemplary human pluripotent cell lines include but are not limited to TkDA3-4, 1231 A3, 317-D6, 317-A4, CDH1, 5-T-3, 3-34- 1, NAFLD27, NAFLD77, NAFLD150, WD90, WD91, WD92, 1.20012. C213, 1383D6, FF, or 317-12 cells.
[0297] In developmental biology, cellular differentiation is the process by which a less specialized cell becomes a more specialized cell type. As used herein, the term “directed differentiation” describes a process through which a less specialized cell becomes a particularspecialized target cell type. The particularity of the specialized target cell type can be determined by any applicable methods that can be used to define or alter the destiny of the initial cell Exemplary methods include but are not limited to genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.
[0298] In some embodiments, an adenovirus can be used to transport the requisite four genes, resulting in iPSCs substantially identical to embryonic stem cells. Since the adenovirus does not combine any of its own genes with the targeted host, the danger of creating tumors is eliminated, in some embodiments, non-viral based technologies are employed to generate iPSCs. In some embodiments, reprogramming can be accomplished via plasmid without any virus transfection system at all, although at very low efficiencies. In other embodiments, direct deliver}' of proteins is used to generate iPSCs, thus eliminating the need for viruses or genetic modification. In some embodiment, generation of mouse iPSCs is possible using a similar methodology: a repeated treatment of the cells with certain proteins channeled into the cells via poly-arginine anchors was sufficient to induce pluripotency. In some embodiments, the expression of pluripotency induction genes can also be increased by treating somatic cells with FGF2 under low oxygen conditions.
[0299] The term “feeder cell” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to cells that support the growth of pluripotent stem cells, such as by secreting growth factors into the medium or displaying on the cell surface. Feeder cells are generally adherent cells and may be growth arrested. For example, feeder cells are growth-arrested by irradiation (e.g. gamma rays), mitomycin-C treatment, electric pulses, or mild chemical fixation (e.g. with formaldehyde or glutaraldehyde). However, feeder cells do not necessarily have to be growth arrested. Feeder cells may serve purposes such as secreting growth factors, displaying growth factors on the cell surface, detoxifying the culture medium, or synthesizing extracellular matrix proteins. In some embodiments, the feeder cells are allogeneic or xenogeneic to the supported target stem cell, which may have implications m downstream applications. In some embodiments, the feeder cells are mouse cells. In some embodiments, the feeder cells are human cells. In some embodiments, the feeder cells are mouse fibroblasts, mouse embryonic fibroblasts, mouse STO cells, mouse 3T3 cells, mouse SNL 76 / 7 cells, human fibroblasts, human foreskin fibroblasts, human dermal fibroblasts, human adipose mesenchymal cells, human bone marrow mesenchymal cells, human amniotic mesenchymal cells, human amniotic epithelial cells, human umbilical cord mesenchymal cells, human fetal muscle cells,human fetal fibroblasts, or human adult fallopian tube epithelial cells. In some embodiments, conditioned medium prepared from feeder cells is used in lieu of feeder cell co-culture or in combination with feeder cell co-culture. In some embodiments, feeder cells are not used during the proliferation of the target stem cells. Differentiation of PSCs
[0300] Known methods for producing definitive endoderm from pluripotent cells (e.g., iPSCs or ESCs) are applicable to the methods described herein. In some embodiments, pluripotent cells are derived from a morula. In some embodiments, pluripotent stem cells are stem cells. Stem cells used in these methods can include, but are not limited to, embryonic stem cells or induced pluripotent stem cells. Embryonic stem cells can be derived from the embryonic inner cell mass or from the embryonic gonadal ridges. Embryonic stem cells or germ cells can originate from a variety of animal species including, but not limited to, various mammalian species including humans. In some embodiments, human embryonic stem cells are used to produce definitive endoderm. In some embodiments, human embryonic germ cells are used to produce definitive endoderm. In some embodiments, iPSCs are used to produce definitive endoderm. in some embodiments, human iPSCs (hiPSCs) are used to produce definitive endoderm.
[0301] In some embodiments, PSCs, such as ESCs and iPSCs, undergo directed differentiation into embryonic germ layer cells, organ tissue progenitor cells, and then into tissue such as liver tissue or any other biological tissue. In some embodiments, the directed differentiation is done in a stepwise manner to obtain each of the differentiated cell types where molecules (e.g. growth factors, ligands, agonists, antagonists) are added sequentially as differentiation progresses. In some embodiments, the directed differentiation is done in a non- stepwise manner where molecules (e.g. growth factors, ligands, agonists, antagonists) are added at the same time. In some embodiments, directed differentiation is achieved by selectively activating certain signaling pathways in the PSCs or any downstream cells.
[0302] In some embodiments, the embryonic stem cells or germ cells or iPSCs are treated with one or more small molecule compounds, activators, inhibitors, or growth factors for a time that is, is about, is at least, is at least about, is not more than, or is not more than about, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 120 hours, 150 hours, 180 hours, 240 hours, 300 hours or any time within a range defined by any two of the aforementioned times, for example 6 hours to 300 hours, 24 hours to 120 hours, 48 hours to 96 hours, 6 hours to 72 hours, or 24 hours to 300 hours, in some embodiments, more than onesmall molecule compounds, activators, inhibitors, or growth factors are added. In these cases, the more than one small molecule compounds, activators, inhibitors, or growth factors can be added simultaneously or separately.
[0303] In some embodiments, the embryonic stem cells or germ cells or iPSCs are treated with one or more small molecule compounds, activators, inhibitors, or growth factors at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 10 ng / mL, 20 ng / mL, 50 ng / mL, 75 ng / mL, 100 ng / mL, 120 ng / mL, 150 ng / mL, 200 ng / mL, 500 ng / mL, 1000 ng / mL, 1200 ng / mL, 1500 ng / mL, 2000 ng / mL, 5000 ng / mL, 7000 ng / niL, 10000 ng / mL, or 15000 ng / mL, or any concentration that is within a range defined by any two of the aforementioned concentrations, for example, 10 ng / mL to 15000 ng / mL, 100 ng / mL to 5000 ng / mL, 500 ng / mL to 2000 ng / mL, 10 ng / mL to 2000 ng / mL, or 1000 ng / mL to 15000 ng / mL. In some embodiments, concentration of the one or more small molecule compounds, activators, inhibitors, or growth factors is maintained at a constant level throughout the treatment. In some embodiments, concentration of the one or more small molecule compounds, activators, inhibitors, or growth factors is varied during the course of the treatment. In some embodiments, more than one small molecule compounds, activators, inhibitors, or growth factors are added. In these cases, the more than one small molecule compounds, activators, inhibitors, or growth factors can differ in concentrations.
[0304] In some embodiments, the ESCs or iPSCs, or the ESCs, germ cells, or iPSCs are cultured in growth media that supports the growth of stem cells. In some embodiments, the ESCs or iPSCs, or the ESCs, germ cells, or iPSCs, are cultured in stem cell growth media. In some embodiments, the stem cell growth media is RPMI 1640, DMEM, DMEM / F12, or Advanced DMEM / F12. In some embodiments, the stem cell growth media comprises fetal bovine serum (FBS). In some embodiments, the stem cell growth media comprises FBS at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0,6%, 0.7%, 0.8%, 0,9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, or any percentage within a range defined by any two of the aforementioned concentrations, for example 0% to 20%, 0.2% to 10%, 2% to 5%, 0% to 5%, or 2% to 20%. In some embodiments, the stem cell growth media does not contain xenogeneic components. In some embodiments, the growth media comprises one or more small molecule compounds, activators, inhibitors, or growth factors.
[0305] In some embodiments, populations of cells enriched in definitive endoderm cells are used. In some embodiments, the definitive endoderm cells are isolated or substantially purified. In some embodiments, the isolated or substantially purified definitive endoderm cells express one or more (e.g. at least 1, 3) of SOX17, FOXA2, or CXRC4 markers to a greater extent than one or more (e.g. at least 1, 3, 5) of GCT4, AFP, I'M, SPARC, or SGX7 markers.
[0306] In some embodiments, pluripotent stem cells are prepared from somatic cells. In some embodiments, pluripotent stem cells are prepared from biological tissue obtained from a biopsy. In some embodiments, the pluripotent stem cells are cryopreserved. In some embodiments, the somatic cells are cryopreserved. In some embodiments, pluripotent stem cells are prepared from PBMCs. In some embodiments, human PSCs are prepared from human PBMCs. In some embodiments, pluripotent stem cells are prepared from cryopreserved PBMCs. In some embodiments, PBMCs are grown on a feeder cell substrate. In some embodiments, PBMCs are grown on a mouse embryonic fibroblast (MEF) feeder cell substrate. In some embodiments, PBMCs are grown on an irradiated MEF feeder cell substrate.
[0307] In some embodiments, stem cells are treated with one or more growth factors to differentiate to definitive endoderm cells. Such growth factors can include growth factors from the TGF-beta superfamily. In some embodiments, the one or more growth factors comprise the Nodal / Activin and / or the BMP subgroups of the TGF-beta superfamily of growth factors. In some embodiments, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, BMP4, Wnt3a or combinations of any of these growth factors. In some embodiments, the stem cells are contacted with Activin A. In some embodiments, the stem cells are contacted with Activin A and BMP4.
[0308] In some embodiments, activin-induced definitive endoderm (DE) can further undergo anterior endoderm pattering, foregut specification and morphogenesis, dependent on FGF, Wnt, or retinoic acid, or any combination thereof, or on FGF, Wnt, BMP, or retinoic acid, or any combination thereof, and a liver culture system that promotes liver growth, morphogenesis and cytodifferentiation. In some embodiments, human PSCs are efficiently directed to differentiate in vitro into liver epithelium and mesenchyme, it will be understood that molecules such as growth factors can be added to any stage of the development to promote a particular type of hepatic tissue formation.
[0309] It will be understood by one of skill in the art that altering the concentration, expression or function of one or more Wnt signaling proteins in combination with altering theconcentration, expression, or function of one or more FGF proteins can give rise to directed differentiation in accordance with the present disclosure. In some embodiments, cellular constituents associated with the FGF, Wnt, or retinoic acid (RA) signaling pathways, or with the FGF, Wnt, BMP, or retinoic acid (RA) signaling pathways, for example, natural inhibitors, antagonists, activators, or agonists of the pathways can be used to result in inhibition or activation of the FGF, Wnt, or retinoic acid signaling pathways, or of the FGF, Wnt, BMP, or retinoic acid signaling pathways. In some embodiments, siRNA and / or shRNA targeting cellular constituents associated with the FGF, Wnt, or retinoic acid signaling pathways, or the FGF, Wnt, BMP, or retinoic acid signaling pathways, are used to inhibit or activate these pathways.
[0310] In some embodiments, pluripotent stem cells, definitive endoderm, posterior foregut spheroids, or downstream liver cell types are contacted with a Wnt signaling pathway activator or Wnt signaling pathway inhibitor. In some embodiments, the Wnt signaling pathway activator comprises a Wnt protein, in some embodiments, the Wnt protein comprises a recombinant Wnt protein. In some embodiments, the Wnt signaling pathway activator comprises Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, WntSa, WntSb, Wnt6, Wnt7a, Wnt7b, Wnt8a, WntSb, Wnt9a, Wnt9b, WntlOa, WntlOb, Wnt11 Wnt16, BML 284, IQ-1, WAY 262611, or any combination thereof. In some embodiments, the Wnt signaling pathway activator comprises a GSK3 signaling pathway inhibitor. In some embodiments, the Wnt signaling pathway activator comprises CHIR99Q21, CfflR 98014, AZD2858, BIO, AR-A014418, SB 216763, SB 415286, aloisine, indirubin, alsterpaullone, kenpauilone, lithium chloride, TDZD 8, or TWS119, or any combination thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises C59, PNU 74654, KY-02111, PRI-724, FH-535, DIF-1, or XAV939, or any combination thereof. In some embodiments, the cells are not treated with a Wnt signaling pathway activator or Wnt signaling pathway inhibitor. The Wnt signaling pathway activator or Wnt signaling pathway inhibitor provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.
[0311] In some embodiments, pluripotent stem cells, definitive endoderm, posterior foregut spheroids, or downstream liver cell types are contacted with an FGF signaling pathway activator. In some embodiments, the FGF signaling pathway activator comprises an FGF protein. In some embodiments, the FGF protein comprises a recombinant FGF protein. In some embodiments, the FGF signaling pathway activator comprises one or more of FGF1 , FGF2, FGF3, FGF4, FGF4, FGF 5, FGF6, FGF7, FGF 8, FGF8, FGF9, FGF 10, FGF11, FGF 12, FGF 13, FGF14, FGF 15 (FGF 19, FGF15 / FGF19), FGF 16, FGF 17, FGF 18, FGF20, FGF21, FGF22, or FGF23. In some embodiments, the cells are not treated with an FGF signaling pathway activator. The FGF signaling pathway activator provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.
[0312] In some embodiments, pluripotent stem cells, definitive endoderm, posterior foregut spheroids, or downstream liver cell types are contacted with a retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor. In some embodiments, the retinoic acid signaling pathway activator comprises retinoic acid, all-trans retinoic acid, 9-cis retinoic acid, CD437, EC23, BS 493, TTNPB, or AM580, or any combination thereof, in some embodiments, the retinoic acid signaling pathway inhibitor comprises guggulsterone. In some embodiments, the cells are not treated with a retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor. The retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.
[0313] In some embodiments, pluripotent stem cells are converted into liver cell types via a “one step” process. For example, one or more molecules that can differentiate pluripotent stem cells into DE culture (e.g., Activin A) are combined with additional molecules that can promote directed differentiation of DE culture (e.g., FGF4, CHIR99021, RA; or e.g., FGF4, Wnt, Noggin, RA) to directly treat pluripotent stem cells.
[0314] In some embodiments, iPSCs are expanded in cell culture. In some embodiments, pluripotent stem cells are expanded in a basement membrane matrix. In some embodiments, iPSCs are expanded in Matrigel, In some embodiments, the iPSCs are expanded in cell culture comprising a ROCK inhibitor (e.g. Y-27632). In some embodiments, the iPSCs are differentiated into definitive endoderm cells. In the iPSCs are differentiated into definitive endoderm cells by- contacting the iPSCs with Activin A, BMP4, or both. In some embodiments, the iPSCs are contacted with a concentration of Activin A that is, is about, is at least, is at least about, is not more than, or is not more than about, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of Activin A within a range defined by any two of the aforementioned concentrations, for example, 10 to 200 ng / mL, 10 to 100 ng / mL, 100 to 200 ng / mL, or 50 to 150 ng / mL. In some embodiments, the pluripotent stem cells are contacted with Activin A at a concentration of 100 ng / mL or about 100 ng / mL. In someembodiments, the iPSCs are contacted with a concentration of BMP4 that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of BMP4 within a range defined by any two of the aforementioned concentrations, for example, 1 to 200 ng / mL, 1 to 100 ng / mL, 25 to 200 ng / mL, 1 to 80 ng / mL, or 25 to 100 ng / mL, In some embodiments, the pluripotent stem cells are contacted with BMP4 at a concentration of 50 ng / mL or about 50 ng / mL.
[0315] In some embodiments, the PSCs are differentiated into definitive endoderm cells. In some embodiments, the PSCs are differentiated into posterior foregut cells, in some embodiments, the PSCs are differentiated into a liver organoid.
[0316] In some embodiments, any of the cells disclosed herein may be cryopreserved for later use. The cells can be cryopreserved according to methods generally known in the art, optionally including one or more cryoprotectants.
[0317] Cryoprotectants are cell composition additives to improve efficiency and yield of low temperature cryopreservation by preventing formation of large ice crystals. Cryoprotectants include but are not limited to DMSO, ethylene glycol, glycerol, propylene glycol, trehalose, formamide, methyl-formamide, dimethyl-formamide, glycerol 3 -phosphate, proline, sorbitol, diethyl glycol, sucrose, triethylene glycol, polyvinyl alcohol, polyethylene glycol, or hydroxy ethyl starch. Cryoprotectants can be used as part of a cryopreservation medium, which include other components such as nutrients (e.g. albumin, serum, bovine serum, fetal calf serum (FCS)) to enhance post-thawing survivability of the cells, in these cryopreservation media, at least one cryoprotectant may be found at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or any percentage within a range defined by any two of the aforementioned numbers. Gene Editing
[0318] Embodiments of the disclosure can include PSCs, iPSCs, definitive endoderm cells, posterior foregut spheroids, or organoids which have been or which can be genetically modified or edited according to methods known in the art. For example, gene editing using CRISPR nucleases such as Cas9 are explored in PCT Publications WO 2013 / 176772, WO 2014 / 093595, WO 2014 / 093622, WO 2014 / 093655, WO 2014 / 093712, WO 2014 / 093661, WO 2014 / 204728,WO 2014 / 204729, WO 2015 / 071474, WO 2016 / 115326, WO 2016 / 141224, WO 2017 / 023803, and WO 2017 / 070633, each of which is hereby expressly incorporated by reference in its entirety. Pharmaceutical Compositions
[0319] Embodiments of the disclosure can include pharmaceutical compositions. Such pharmaceutical compositions can include one or more additional pharmaceutically acceptable components, which can include carriers, excipients, and / or stabilizers that are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed or that have an acceptable level of toxicity. A “pharmaceutically acceptable” “diluent,” “excipient,” and / or “carrier” as used herein have their plain and ordinary meaning as understood in light of the specification and are intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with administration to humans, cats, dogs, or other vertebrate hosts. Typically, a pharmaceutically acceptable diluent, excipient, and / or carrier is a diluent, excipient, and / or earner approved by a regulatory agency of a Federal, a state government, or other regulatory agency, or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans as well as non-human mammals, such as cats and dogs. The term diluent, excipient, and / or “carrier” can refer to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical diluent, excipient, and / or earners can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water, saline solutions and aqueous dextrose and glycerol solutions can be employed as liquid diluents, excipients, and / or carriers, particularly for injectable solutions. Suitable pharmaceutical diluents and / or excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. A non-limiting example of a physiologically acceptable carrier is an aqueous pH buffered solution. The physiologically acceptable carrier may also comprise one or more of the following: antioxidants, such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, ammo acids, carbohydrates such as glucose, mannose, or dextrins, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®. The composition, if desired, can also contain minor amounts of wetting, bulking,emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, sustained release formulations and the like. The formulation should suit the mode of administration.
[0320] Additional excipients with desirable properties include but are not limited to preservatives, adjuvants, stabilizers, solvents, buffers, diluents, solubilizing agents, detergents, surfactants, chelating agents, antioxidants, alcohols, ketones, aldehydes, ethylenediaminetetraacetic acid (EDTA), citric acid, salts, sodium chloride, sodium bicarbonate, sodium phosphate, sodium borate, sodium citrate, potassium chloride, potassium phosphate, magnesium sulfate sugars, dextrose, fructose, mannose, lactose, galactose, sucrose, sorbitol, cellulose, serum, amino acids, polysorbate 20, polysorbate 80, sodium deoxycholate, sodium taurodeoxycholate, magnesium stearate, octylphenol ethoxylate, benzethonium chloride, thimerosal, gelatin, esters, ethers, 2-phenoxyethanol, urea, or vitamins, or any combination thereof. Some excipients may be in residual amounts or contaminants from the process of manufacturing, including but not limited to serum, albumin, ovalbumin, antibiotics, inactivating agents, formaldehyde, glutaraldehyde, b-propiolactone, gelatin, cell debris, nucleic acids, peptides, ammo acids, or growth medium components or any combination thereof. The amount of the excipient may be found in composition at a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% w / w or any percentage by weight in a range defined by any two of the aforementioned numbers.
[0321] Pharmaceutical compositions can include one or more “pharmaceutically acceptable salts”, which can include relatively non-toxic, inorganic and organic acid, or base addition salts of compositions or excipients, including without limitation, analgesic agents, therapeutic agents, other materials, and the like. Examples of pharmaceutically acceptable salts include those derived from mineral acids, such as hydrochloric acid and sulfuric acid, and those derived from organic acids, such as ethanesulfonic acid, benzenesulfonic acid, p- toluenesulfonic acid, and the like. Examples of suitable inorganic bases for the formation of salts include the hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, zinc, and the like. Salts may also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. For example, the class of such organic bases may include but are not limited to mono-, di-, and trialkylamines, includingmethylamine, dimethylamine, and triethylamine; mono-, di-, or trihydroxyalkylamines including mono-, di-, and triethanolamine; ammo acids, including glycine, arginine and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; N-benzylphenethylamine; trihydroxymethyl ammoethane.
[0322] Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art including, but not limited to, enteral, oral, rectal, topical, sublingual, buccal, intraaural, epidural, epicutaneous, aerosol, parenteral delivery, including intramuscular, subcutaneous, intra-arterial, intravenous, intraportal, intra-articular, intradermal, peritoneal, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal or intraocular injections. Pharmaceutical compositions will generally be tailored to the specific intended route of administration.
[0323] As used herein, a “carrier” has its plain and ordinary meaning as understood in light of the specification and can refer to a compound, particle, solid, semi-solid, liquid, or diluent that facilitates the passage, delivery and / or incorporation of a compound to cells, tissues and / or bodily organs.
[0324] As used herein, a “diluent” has its plain and ordinary meaning as understood in light of the specification and can refer to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and / or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood. Dosage and Administration Routes
[0325] Embodiments of the disclosure can include methods of administering or treating an animal, which can involve administering an amount of at least one treatment, that is effective to treat the disease, condition, or disorder that the organism has, or is suspected of having, or is susceptible to, or to bring about a desired physiological effect. In some embodiments, the disease, condition, or disorder can be a liver-related disease or disorder.
[0326] In some embodiments, at least one treatment can include a composition or pharmaceutical composition, which can be administered to an animal (e.g., mammals, primates, monkeys, or humans) in an amount of about 0.005 to about 50 mg / kg body weight, about 0.01 to about 15 mg / kg body weight, about 0.1 to about 10 mg / kg body weight, about 0.5 to about 7 mg / kg body weight, about 0.005 mg / kg, about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 3 mg / kg, about 5 mg / kg, about 5.5 mg / kg, about 6 mg / kg, about 6.5 mg / kg, about 7 mg / kg, about 7.5 mg / kg, about 8 mg / kg, about 10 mg / kg, about 12 mg / kg, or about 15 mg / kg. In regard to some conditions, the dosage can be about 0.5 mg / kg human body weight or about 6.5 mg / kg human body weight. In some instances, some subjects (e.g., mammals, mice, rabbits, feline, porcine, or canine) can be administered a dosage of about 0.005 to about 50 mg / kg body weight, about 0.01 to about 15 mg / kg body weight, about 0.1 to about 10 mg / kg body weight, about 0.5 to about 7 mg / kg body weight, about 0.005 mg / kg, about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, about 1 mg / kg, about 5 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 80 mg / kg, about 100 mg / kg, or about 150 mg / kg. Of course, those skilled in the art will appreciate that it is possible to employ many concentrations in the methods of the present disclosure, and using, in part, the guidance provided herein, will be able to adjust and test any number of concentrations in order to find one that achieves the desired result in a given circumstance. In some embodiments, a dose or a therapeutically effective dose of a compound disclosed herein will be that which is sufficient to achieve a plasma concentration of the compound or its active metabolite(s) within a range set forth herein, e.g., about 1-10 nM, 10- 100 nM, 0.1-1 µM, 1-10 µM, 10-100 µM, 100-200 µM, 200-500 µM, or even 500-1000 µM, preferably about 1-10 nM, 10-100 nM, or 0.1-1 µM.
[0327] In other embodiments, a treatment can be administered in combination with one or more other therapeutic agents for a given disease, condition, or disorder.
[0328] The compounds and pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories. For treatment of a subject, depending on activity of the compound, manner of administration, nature and severity of the disease or disorder, age and body weight of the subject, different daily doses can be used.
[0329] Under certain circumstances, however, higher or lower daily doses can be appropriate. The administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administrations of subdivided doses at specific intervals.
[0330] A treatment can be administered locally or systemically in a therapeutically effective dose. Amounts effective for this use will, of course, depend on the severity of the disease or disorder and the weight and general state of the subject. Typically, dosages used in vitro can provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models can be used to determine effective dosages for treatment of particular disorders.
[0331] Various considerations are described, e. g. , in Langer, 1990, Science, 249: 1527; Goodman and Gilman's (eds.), 1990, Id., each of which is herein incorporated by reference and for all purposes. Dosages for parenteral administration of active pharmaceutical agents can be converted into corresponding dosages for oral administration by multiplying parenteral dosages by appropriate conversion factors. As to general applications, the parenteral dosage in mg / mL times 1.8 = the corresponding oral dosage in milligrams (“mg”). As to oncology applications, the parenteral dosage in mg / mL times 1.6 = the corresponding oral dosage in mg. An average adult weighs about 70 kg. See e.g., Miller-Keane, 1992, Encyclopedia & Dictionary of Medicine, Nursing & Allied Health, 5th Ed., (W. B. Saunders Co.), pp.1708 and 1651.
[0332] It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
[0333] In some embodiments, the administration can include a unit dose of one or more treatments in combination with a pharmaceutically acceptable carrier and, in addition, can include other medicinal agents, pharmaceutical agents, carriers, adjuvants, diluents, and excipients. In certain embodiments, the carrier, vehicle or excipient can facilitate administration, delivery and / or improve preservation of the composition. In other embodiments, the one or more carriers, include but are not limited to, saline solutions such as normal saline, Ringer's solution, PBS (phosphate- buffered saline), and generally mixtures of various salts including potassium and phosphate salts with or without sugar additives such as glucose. Carriers can include aqueous and non-aqueous sterile injection solutions that can contain antioxidants, buffers, bacteriostats, bactericidal antibiotics, and solutes that render the formulation isotonic with the bodily fluids of the intended recipient; and aqueous and non-aqueous sterile suspensions, which can include suspending agents and thickening agents. In other embodiments, the one or more excipients can include, but are not limited to water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. Nontoxicauxiliary substances, such as wetting agents, buffers, or emulsifiers may also be added to the composition. Oral formulations can include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate.
[0334] The quantity of active component in a unit dose preparation can be varied or adjusted from 0.1 mg to 10000 mg, more typically 1.0 mg to 1000 mg, most typically 10 mg to 500 mg, according to the particular application and the potency of the active component. The composition can, if desired, also contain other compatible therapeutic agents.
[0335] A treatment can be administered to subjects by any number of suitable administration routes or formulations. The treatment, such as an immunotherapy, can also be used to treat subjects for a variety of diseases. Subjects include but are not limited to mammals, primates, monkeys (e.g., macaque, rhesus macaque, or pig tail macaque), humans, canine, feline, bovine, porcine, avian (e.g., chicken), mice, rabbits, and rats. In particular embodiments described herein, the subject is a human.
[0336] The route of administration of the compounds of the treatments described herein can be of any suitable route. Administration routes can be, but are not limited to the oral route, the parenteral route, the cutaneous route, the nasal route, the rectal route, the vaginal route, and the ocular route. In other embodiments, administration routes can be parenteral administration, a mucosal administration, intravenous administration, subcutaneous administration, topical administration, intradermal administration, oral administration, sublingual administration, intranasal administration, or intramuscular administration. The choice of administration route can depend on the compound identity (e.g., the physical and chemical properties of the compound) as well as the age and weight of the animal, the particular disease (e.g., type of cancer), and the severity of the disease (e.g., stage or severity of cancer). Of course, combinations of administration routes can be administered, as desired.
[0337] Some embodiments of the disclosure include a method for providing a subject with a treatment which comprises one or more administrations of one or more compositions; the compositions may be the same or different if there is more than one administration. Toxicity
[0338] The ratio between toxicity and therapeutic effect for a particular treatment is its therapeutic index and can be expressed as the ratio between LD50 (the amount of compound lethal in 50% of the population) and ED50 (the amount of compound effective in 50% of the population).Compounds that exhibit high therapeutic indices are preferred. Therapeutic index data obtained from in vitro assays, cell culture assays and / or animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds preferably lies within a range of plasma concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. See, e.g. Fingl et al., In: THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, Ch.1, p.l, 1975. The exact formulation, route of administration, and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used. For in vitro formulations, the exact formulation and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used. Compositions
[0339] In some embodiments, also provided herein are compositions for performing any of the methods disclosed herein. In some embodiments, also provided herein are compositions produced according to processes provided in any of the methods disclosed herein. It is expressly contemplated that, in certain embodiments, any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined.
[0340] In some embodiments, provided herein are cell compositions in the form of a three- dimensional artificial multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes. In some embodiments, provided herein are ex vivo compositions comprising a three-dimensional multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes.
[0341] In some embodiments, provided herein are compositions, such as cell compositions and / or multi-zonal liver organoids, that further comprise Z2-like (interzonal-like, mid-lobular- like) hepatocytes. In some embodiments, provided herein are ex vivo compositions including a three-dimensional multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes. In some embodiments, provided herein are compositions, such as cell compositions and / or multi-zonal liver organoids, that further comprise hepatoblasts. In some embodiments, provided herein are compositions, such as cell compositions and / or multi-zonal liver organoids, that further comprise cholangiocytes, endothelial cells, macrophages, stellate cells, and / or mesenchyme cells. In some embodiments, the hepatocytes self-assemble into the three-dimensional artificial multi-zonal liver organoid. In some embodiments, the three-dimensional artificial multi-zonal liver organoid includes a structure with a single lumen. In some embodiments, the three-dimensional artificial multi-zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
[0342] In some embodiments compositions provided herein may comprise cell populations differentiated from pluripotent stem cells. In some embodiments compositions provided herein may comprise cell populations differentiated from induced pluripotent stem cells (iPSCs). In some embodiments, compositions provided herein comprise exogenously added and / or transgenically produced ascorbate (vitamin C), and / or exogenously provided bilirubin. In some embodiments, provided herein are compositions comprising Z1-like hepatocytes that are engineered to express a heterologous functional GULO protein, and ascorbate is produced by the Z1-like hepatocytes. In some embodiments, provided herein are compositions comprising exogenously provided bilirubin at a concentration of about 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L, 0.7 mg / L, 0.8 mg / L, 0.9 mg / L, 1 mg / L, 1.1 mg / L, 1.2 mg / L, 1.3 mg / L, 1.4 mg / L, 1.5 mg / L, 1.6 mg / L, 1.7 mg / L, 1.8 mg / L, 1.9 mg / L, 2 mg / L, 2.1 mg / L, 2.2 mg / L, 2.3 mg / L, 2.4 mg / L, 2.5 mg / L, 2.6 mg / L, 2.7 mg / L, 2.8 mg / L, 2.9 mg / L, or 3 mg / L. In some embodiments, provided herein are compositions comprising exogenously provided bilirubin at a concentration of about 1 mg / L.
[0343] In some embodiments, provided herein are compositions comprising multiple cell types, including at least Z3-like hepatocytes, Z1-like hepatocytes, Z2-like hepatocytes, and hepatoblasts. In some embodiments, compositions provided herein comprise greater than or equal to, exactly or about, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40%, or any range derivable therein, Z1-like hepatocytes. In some embodiments, compositions provided herein comprise greater than or equal to, exactly or about, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40%, or any range derivable therein, Z3-like hepatocytes. In some embodiments, compositions provided herein comprise greater than or equal to, exactly or about, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35%, or any range derivable therein, Z2-like hepatocytes. In some embodiments, compositions provided herein comprise greater than or equal to, exactly or about, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%,32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40%, or any range derivable therein, hepatoblasts. In some embodiments, compositions provided herein comprise less than or equal to 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, or 5%, or any range derivable therein, cholangiocytes.
[0344] In some embodiments, compositions provided herein are in vitro compositions, created outside of a multicellular living organism. In some embodiments, compositions provided herein may be introduced into a multicellular living organism. In some embodiments, compositions provided herein comprise exogenously provided components, reagents, and / or conditions. In some embodiments, compositions provided herein comprise exogenously provided components, reagents, and / or conditions that mimic in vivo characteristics desirable for inducing specific cellular differentiation and / or organoid organization.
[0345] In some embodiments, provided herein are compositions comprising a tissue culture surface that is coated with a basement membrane matrix or component thereof. In some embodiments, a basement membrane matrix or component thereof does not comprise non-human animal components. In some embodiments, a basement membrane matrix or component thereof does not comprise non-human animal components such that the basement membrane matrix or component thereof is xenogeneic to humans. In some embodiments, a basement membrane matrix or component thereof is not isolated from murine Engelbreth-Holm-Swarm (EHS) sarcoma cells, is not Matrigel®, is not Cultrex®, and / or is not Geltrex®. In some embodiments, a basement membrane matrix or component thereof comprises human laminin, collagen IV, entactin, perlecan, fibrin, and / or hydrogel.
[0346] In some embodiments, provided herein are compositions that include an exogenous TGF-b pathway inhibitor. In some embodiments, an exogenous TGF-b pathway inhibitor comprises, consists essentially of, or consists of A83-01, RepSox, LY365947, and / or SB431542. In some embodiments, an exogenous TGF-b pathway inhibitor comprises, consists essentially of, or consists of TGF-b pathway inhibitor A83-01. In some embodiments, a composition comprises a TGF-b pathway inhibitor at a concentration of, or of about, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nM, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, a composition comprises a TGF-b pathway inhibitor at a concentration of, or of about, 500 nM.
[0347] In some embodiments, provided herein are compositions that include an exogenous FGF pathway activator. In some embodiments, a composition comprises an exogenous FGFpathway activator that comprises, consists essentially of, or consists of FGF1, FGF2, FGF3, FGF4, FGF4, FGF5, FGF6, FGF7, FGF8, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and / or FGF23. In some embodiments, an exogenous FGF pathway activator comprises, consists essentially of, or consists of FGF2. In some embodiments, a composition comprises a FGF pathway activator at a concentration of, or of about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, a composition comprises a FGF pathway activator at a concentration of, or of about 5 ng / mL.
[0348] In some embodiments, provided herein are compositions that include an exogenous Wnt pathway activator. In some embodiments, a composition comprises an exogenous Wnt pathway activator that comprises, consists essentially of, or consists of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, Wnt16, BML 284, IQ-1, WAY 262611, CHIR99021, CHIR 98014, AZD2858, BIO, AR-A014418, SB 216763, SB 415286, aloisine, indirubin, alsterpaullone, kenpaullone, lithium chloride, TDZD 8, and / or TWS119. In some embodiments, a composition comprises an exogenous Wnt pathway activator that comprises, consists essentially of, or consists of CHIR99021. In some embodiments, a composition comprises a Wnt pathway activator at a concentration of, or of about, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, or 8 µM, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, In some embodiments, a composition comprises a Wnt pathway activator at a concentration of, or of about, 3 µM.
[0349] In some embodiments, provided herein are compositions that include an exogenous VEGF pathway activator. In some embodiments, a composition comprises an exogenous VEGF pathway activator that comprises, consists essentially of, or consists of VEGF and / or GS4012. In some embodiments, a composition comprises an exogenous VEGF pathway activator that comprises, consists essentially of, or consists of VEGF. In some embodiments, a composition comprises a VEGF pathway activator at a concentration of, or of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, a composition comprises a VEGF pathway activator at a concentration of, or of about 10 ng / mL.
[0350] In some embodiments, provided herein are compositions that include an exogenous EGF. In some embodiments, provided herein are compositions that do not include an exogenousEGF. In some embodiments, provided herein are compositions comprising EGF at a concentration of, or of about, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, provided herein are compositions comprising EGF at a concentration of, or of about, 20 ng / mL.
[0351] In some embodiments, provided herein are compositions that include exogenous and / or transgenically produced ascorbic acid. In some embodiments, provided herein are compositions that do not include exogenous and / or transgenically produced ascorbic acid. In some embodiments, provided herein are compositions comprising ascorbic acid at a concentration of, or of about, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 µg / mL or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, provided herein are compositions comprising ascorbic acid at a concentration of, or of about, 50 µg / mL.
[0352] In some embodiments, provided herein are compositions that include a ROCK inhibitor. In some embodiments, provided herein are compositions that do not include a ROCK inhibitor. In some embodiments, a ROCK inhibitor comprises, consists essentially of, or consists of Y-27632. In some embodiments, provided herein are compositions comprising a ROCK inhibitor at a concentration of, or of about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 µM, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, provided herein are compositions comprising a ROCK inhibitor at a concentration of, or of about, 10 µM.
[0353] In some embodiments, provided herein are compositions comprising liver organoids that have and / or that are being differentiated from stem cells. In some embodiments, provided herein are compositions comprising liver organoids that have and / or that are being differentiated from induced pluripotent stem cells. In some embodiments, provided herein are compositions comprising liver organoids comprising cells that have been passaged 1 time, 2 times, or 3 times. In some embodiments, provided herein are compositions comprising liver organoids comprising cells that have been passaged less than 4 times.
[0354] In some embodiments, provided herein are compositions comprising A83-01, FGF2, CHIR99021, VEGF, and / or Y-27632, optionally further comprising iPSCs, PSCs, and / or posterior foregut cells and / or posterior foregut endoderm cells.
[0355] In some embodiments, provided herein are compositions comprising: a) posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liverorganoids, and b) a medium, wherein the medium optionally comprises hepatocyte culture medium and is optionally supplemented with a cMET tyrosine kinase receptor agonist, an IL-6 family cytokine, and a corticosteroid, and wherein the composition optionally additionally comprises c) a retinoic acid pathway activator. In some embodiments, compositions provided herein comprise a cMET tyrosine kinase receptor agonist. In some embodiments, compositions provided herein comprise a cMET tyrosine kinase receptor agonist that comprises, consists essentially of, or consists of hepatocyte growth factor (HGF), PG-001, fosgonimeton, terevalefim, recombinant InlB321 protein, and / or an agonist c-Met antibody (e.g., LMH85).
[0356] In some embodiments, provided herein are compositions comprising an IL-6 family cytokine. In some embodiments, an IL-6 family cytokine comprises, consists essentially of, or consists of IL-6, Oncostatin M (OSM), leukemia inhibitory factor (LIF), cardiotrophin-1, ciliary neurotrophic factor (CTNF), and / or cardiotrophin-like cytokine (CLC).
[0357] In some embodiments, provided herein are compositions comprising a corticosteroid. In some embodiments, a corticosteroid comprises, consists essentially of, or consists of dexamethasone, beclometasone, betamethasone, fluocortolone, halometasone, and / or mometasone.
[0358] In some embodiments, provided herein are compositions comprising a hepatocyte culture media supplemented with HGF, OSM, and / or dexamethasone. In some embodiments, provided herein are compositions comprising a hepatocyte culture media supplemented with dexamethasone. In some embodiments, provided herein are compositions comprising a hepatocyte culture media supplemented with HGF. In some embodiments, provided herein are compositions comprising a hepatocyte culture media supplemented with OSM.
[0359] In some embodiments, provided herein are compositions comprising a retinoic acid pathway activator. In some embodiments, a retinoic acid pathway activator comprises, consists essentially of, or consists of retinoic acid, all-trans retinoic acid, 9-cis retinoic acid, CD437, EC23, BS 493, TTNPB, and / or AM580. In some embodiments, a retinoic acid pathway activator comprises, consists essentially of, or consists of retinoic acid. In some embodiments, compositions comprise a retinoic acid pathway activator at a concentration of, or of about, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 µM, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, compositions comprise a retinoic acid pathway activator at a concentration of, or of about, 2.0 µM.
[0360] In some embodiments, compositions comprise HGF. In some embodiments, compositions comprise HGF at a concentration of, or of about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, compositions comprise HGF at a concentration of, or of about 10 ng / mL.
[0361] In some embodiments, compositions comprise OSM. In some embodiments, compositions comprise OSM at a concentration of, or of about, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, compositions comprise OSM at a concentration of, or of about 20 ng / mL.
[0362] In some embodiments, compositions comprise dexamethasone. In some embodiments, compositions comprise dexamethasone at concentration of, or of about, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nM, or any concentration within a range defined by any two of the aforementioned concentrations. In some embodiments, compositions comprise dexamethasone at a concentration of, or of about 100 nM.
[0363] In some embodiments, compositions comprise exogenous bilirubin. In some embodiments, compositions comprise both exogenous bilirubin and endogenous bilirubin. In some embodiments, compositions comprise a low concentration of exogenous bilirubin. In some embodiments, a low concentration of exogenous bilirubin is at or near a human fetal physiological concentration of bilirubin. Human fetal bilirubin levels are thought to be generally around 1 mg / L (0.1 mg / dL), which rises rapidly to 3-10 mg / L (0.3-1.0 mg / dL) 24 hours after birth. In some embodiments, compositions comprise bilirubin, exogenous and / or endogenous, that is, is about, is less than, or is less than about: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or 3.0 mg / L, or at any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 3 mg / L, 0.5 to 2.0 mg / L, 0.5 to 1.5 mg / L, 0.3 to 2.5 mg / L, or 0.5 to 1.75 mg / L; or 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg / L, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 1 mg / L, 0.1 to 0.5 mg / L, 0.5 to 1 mg / L, 0.3 to 0.7 mg / L, or 0.4 to 0.6 mg / L. In some embodiments, compositions comprise exogenous bilirubin at a concentration that is, is about, is less than, or is less than about: 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or 3.0 mg / L, or at any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 3 mg / L, 0.5 to 2.0 mg / L, 0.5 to 1.5 mg / L, 0.3to 2.5 mg / L, or 0.5 to 1.75 mg / L; or 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mg / L, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 0.1 to 1 mg / L, 0.1 to 0.5 mg / L, 0.5 to 1 mg / L, 0.3 to 0.7 mg / L, or 0.4 to 0.6 mg / L.
[0364] In some embodiments, provided herein are compositions comprising mature liver organoids. In some embodiments, provided herein are compositions comprising mature liver organoids that exhibit luminal projections that resemble bile canaliculi, and / or a structure having a single lumen and generally a spherical shape. In some embodiments, provided herein are compositions comprising mature liver organoids that were produced through contact with a exposure to exogenous bilirubin.
[0365] Also provided herein, in some embodiments, are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids that have been engineered to comprise a functional L-gulonolactone oxidase (GULO) protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids are able to synthesize ascorbate. In some embodiments, provided herein are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids engineered to express functional GULO protein, wherein the functional GULO protein is murine GULO (mGULO). In some embodiments, a gene that encodes for a functional GULO protein is conditionally expressed. In some embodiments, a gene that encodes for a functional GULO protein is constitutively expressed. In some embodiments, a gene that encodes for a functional GULO protein is conditionally expressed using a tetracycline inducible system.
[0366] In some embodiments, provided herein are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids that are engineered to comprise a gene that encodes for a functional GULO protein using CRISPR mediated knock-in. In some embodiments, provided herein are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids comprising a functional GULO encoding gene or mRNA, or both, that encodes for a functional GULO protein, wherein the functional gene was introduced to the posterior foregut cells and / or posterior foregut endoderm cells, liver organoids, mature liver organoids, and / or precursor cells by transfection. In some embodiments, provided herein are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoidsthat are engineered to comprise a gene that encodes for a functional GULO protein using adenovirus mediated gene transfection. In some embodiments, provided herein are compositions comprising posterior foregut cells and / or posterior foregut endoderm cells, liver organoids and / or mature liver organoids that are engineered to comprise a gene that encodes for a functional GULO protein using adeno-associated virus mediated gene transfection.
[0367] In some embodiments, compositions provided herein comprise liver organoids and / or mature liver organoids comprising a functional GULO protein, wherein said liver organoids and / or mature liver organoids express increased levels of NRF2 relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, compositions provided herein comprise liver organoids and / or mature liver organoids comprising a functional GULO protein, wherein the liver organoids and / or mature liver organoids express reduced levels of IL1B, IL6, or TNFa, or any combination thereof, relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein exhibit reduced caspase-3 activity relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein express increased levels of ALB relative to liver organoids and / or mature liver organoids that do not comprise the functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein resemble periportal liver tissue and / or express periportal liver markers. In some embodiments, periportal liver markers comprise or consist of FAH, ALB, PAH, CPS1, HGD, or any combination thereof. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein exhibit increased CYP3A4 and / or CYP1A2 protein levels and / or enzymatic activity relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein exhibit increased bilirubin conjugation activity relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids comprising a functional GULO protein exhibit increased viability in culture relative to liver organoids and / or mature liver organoids that do not comprise a functional GULO protein. In some embodiments, liver organoids and / or mature liver organoids have been differentiated from pluripotent stem cells comprising a functional GULO protein and / or a gene or mRNA, or both,that encodes for the functional GULO protein, whereby the pluripotent stem cells are able to synthesize ascorbate. Kits
[0368] In some embodiments, also disclosed herein are kits providing means for performing any of the methods described herein. In some embodiments, also disclosed herein are kits comprising any of the compositions or means of producing the compositions described herein.
[0369] In some embodiments, a kit can be prepared from readily available components and reagents. For example, such kits can comprise any one or more of the following components and / or reagents: enzymes, reaction tubes, buffers, detergent, primers, probes, antibodies, cell culture media, differentiation induction reagents, amino acid mixtures / supplements, engineered constructs and / or polynucleotides, transcription induction agents, bilirubin, ascorbic acid, ascorbate, retinoic acid pathway activators, corticosteroids, cMET tyrosine kinase receptor agonists, IL-6 family cytokines, TGF-b pathway inhibitors, FGF pathway activators, Wnt pathway activators, VEGF pathway activators, ROCK inhibitors, organoids, and / or cells. In some embodiments, components and reagents may be packaged together in any combination, and / or may be packaged individually. In some embodiments, kits may include components and reagents concentrated above the working concentrations disclosed herein, or at the working concentrations provided herein. In some embodiments, individual components may also be provided in a kit in concentrated amounts; in some aspects, a component is provided individually in the same concentration as it would be in a solution with other components. In some embodiments, concentrations of components may be provided as 1x, 2x, 5x, 10x, or 20x or more. In some embodiments, a kit may comprise components, which may be individually packaged or placed in a container, such as a tube, bottle, vial, syringe, or other suitable container means.
[0370] In some embodiments, a kit is housed in a container. Kits may further comprise instructions for using the kit for assessing expression and / or differentiation of cells. Agents in a kit for measuring expression and / or determining differentiation may comprise a plurality of PCR probes and / or primers for qRT-PCR and / or a plurality of antibody or fragments thereof for assessing expression of biomarkers appropriate for classifying cell states.
[0371] In some embodiments, kits are created using and comply with good manufacturing practice (GMP).
[0372] Having described the embodiments in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of theembodiments defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples. EXAMPLES
[0373] The following non-limiting examples are provided to further illustrate embodiments disclosed herein. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches that have been found to function well in the practice of the embodiments, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the embodiments disclosed herein. EXAMPLE 1 Materials and Methods Animals
[0374] All animal experiments were conducted with the approval of the Institutional Review Board (IRB) and Institutional Animal Care and Use Committee (IACUC) of the Cincinnati Children's Hospital Medical Center. Adult Il2rg-deficient, Rag1-deficient RRG (SD / Crl) rats (breeding pairs, 9-12 weeks old) were housed in standard rat cages with paper bedding and maintained at a temperature of 20-24 °C and relative humidity of 45-55%, under a 12 h:12 h light:dark cycle. All animals had ad libitum access to dox chow before study. All animals were treated in accordance with the guidelines and regulations of the institution. Three or four-week- old male ODS (ODS / Shi Jcl-od / od) rats were purchased from CLEA Japan, Inc.(Tokyo, Japan). They were housed in individual cages and maintained at temperature and humidity with 12 hours of light exposure each day from 7 a.m. to 7p.m. They were given free access to water and a purified diet. The compositions of the diet (AsA 0mg / kg, AsA-free diet) and with or without 2% AsA (Wako-Fujifilm, Japan) contained water. After 1 week or 2 weeks of feeding, they were anesthetized with isoflurane and sampling liver with a perfusion fix of 4% Paraformaldehyde (Nacalai, Japan). Animal care and experimental procedures were approved by the Animal Research Committee of TMDU (approval number A2023554). Human samples
[0375] All human samples including human foreskin fibroblasts and human liver samples were collected with informed consent from the corresponding patients and the approval of the Institutional Review Board (IRB) of the Cincinnati Children's Hospital Medical Center. mGULO editing
[0376] The murine GULO (L-gulonolactone oxidase) cDNA sequence was retrieved from NCBI. The 5′ linker and Kozak sequence were added to the start of the sequence, with HA tags to the end of the sequence. Additionally, a P2A-mCherry was added after the HA tag and a 3′ linker to the very end. The custom gene was then synthesized and cloned into the pAAVS1-NDi- CRISPRi (Gen1) PCSF#117 vector using the restriction sites AflII and AgeI. The vector has a TetON system and a Neor selectable marker was then inserted using the Gateway technology. mGULO iPSC generation and general iPSC maintenance
[0377] Experiments using iPSCs were approved by the Ethics Committees of Cincinnati Children's Hospital Medical Center. The 1383D6 used in this study was kindly provided by CiRA, Kyoto University. The iPSCs 72.3, and 72.3-GFP were obtained from patient foreskin fibroblasts and reprogrammed into iPSC by Cincinnati Children’s Hospital Medical Center pluripotent stem cell core. The PCSF#117 vector with the modified mGULO sequence was then inserted into the AAVS1 locus of the 72.3 iPSC cell line using a lentiviral mediated CRISPR / Cas9. The correct clones were then selected using G418. The surviving clones were then verified for correct insertion, random insertion and copy number using PCR, and verified by DNA sequencing. The iPSCs were then maintained on Laminin iMatrix-511 Silk (REPROCELL USA Inc.) coated cell culture plates and maintained with StemFit Basic04 Complete Type (Ajinomoto Company) media with Y-45127632 (Stem Cell Technologies). The cells were passaged every 7 days with Accutase (Sigma-Aldrich) until passage 40 (p40). Organoid generation
[0378] The p40 cells were plated on a 24 well plate coated with Laminin iMatrix-511 Silk at a density of 2×105 cells / well and maintained with Stemfit media with Y-27632. On Day 2, the media was replaced with fresh Stemfit. The following day, the cells were treated with RPMI 1640 (Gibco) media mixed with Activin A (Shenandoah Biotechnology) and BMP4 (R&D Systems) to generate definitive endoderm. On the 4th day, the media was replaced with RPMI, Activin A and 0.2% dFBS (HyClone) which was changed to 2% dFBS on day 5. From Day 6-8, the cells were fed with FGF-4 (Shenandoah Biotechnology) and CHIR99021 (PeproTech) in Adv. DMEM(Advanced DMEM / F-12 (Gibco) with B27 (Gibco), N2 (Gibco), 10mM HEPES (Gibco), 2 mM L-glutamine (Gibco), and GA-1000 (Lonza)) to induce posterior foregut. On Day 9, the cells were dissociated into a single cell suspension using Accutase treatment. This single cell suspension was then mixed with 50% Matrigel and 50% EP media and plated as 50 ul drops in a 6-well plate. These cells were fed with EP media every 48 hrs for 4 days to generate organoids. These organoids were then treated with Adv. DMEM and 2 μM RA (Sigma-Aldrich) every 48 hours for 4 days to specify the hepatic lineage. The organoids were then fed with HCM (Lonza), HGF (PeproTech), Oncostatin M (PeproTech) and Dexamethasone (Sigma-Aldrich) every 3-4 days to generate HLOs and passaged as necessary. Generating Multi-Zonal Human Liver Organoids (mZ-HLOs) with Zonal Diversity
[0379] For generation of multi-zonated structures, the immature HLOs (i.e., low albumin producing HLOs) were treated with low conc. bilirubin (1 mg / L) in HCM on Day 20. The bilirubin treatment was maintained with every media change onwards by keeping the cells at 37°C in 5% CO2 with 95% air. The Z1-HLOs (Zone 1) were maintained with Dox starting at Day 17 and co- cultured on Day 22 with the bilirubin treated 72.3-GFP (GFP+) Z3-HLOs (Zone 3) in a 1:1 ratio at higher density, i.e.2× the number of organoids with continuous bilirubin and Dox treatment in HCM to obtain chimeric organoids that had dual zonal characteristics. These mZ-HLOs and HLOs were visualized by using fluorescent microscopy BZ-X810 (Keyence, Osaka, Japan) and harvested for downstream analysis. The images were analyzed with Fiji (v1.53f) for morphometric and quantitative measurements. Live cell imaging and functional assay
[0380] For live imaging of organoids, the CellDiscoverer 7 (Zeiss) was used to image every 30 min for 7 days. Observing organoid fusion necessitated looking at the cytoskeleton, the HLOs were incubated with 2 drops / ml NucBlue (Hoechst 33342) (Invitrogen, R37605) and 1 μM Cytoskeleton Kit (SiR-Actin and SiR-Tubulin) (Cytoskeleton Inc., CYSC006) and imaged over 5 days. For functional assay of lipid transport, the HLOs were incubated with fresh media containing 50 nM CLF (Corning, 451041) before imaging them every 30 min for 2 days. RNA extraction, RT-qPCR, and RNA sequencing
[0381] RNA was isolated using the RNeasy mini kit (Qiagen, Hilden, Germany). Reverse transcription was carried out using the High-Capacity cDNA Reverse Transcription Kit for RT- PCR (Applied Biosystems) according to manufacturer’s protocol. qPCR was carried out usingTaqMan gene expression master mix (Applied Biosystems) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems). All the samples were amplified with TaqMan Gene Expression Assays and normalized with 18S rRNA Endogenous Control. The list of TapMan probes utilized appears in Table 1. Human primary hepatocytes (Lonza Catalog #: HUCPG and Sigma-Aldrich’s Catalog #: MTOXH1000) were used as PHH control. For RNA sequencing, the service was outsourced to Novogene (USA), the extracted RNA quality was evaluated with an Agilent 2100 Bioanalyzer (Agilent). A sequence library was prepared using a TruSeq Stranded mRNA kit (Illumina) and sequenced using NovaSeq 6000 (Illumina). Reads were aligned to human genome assembly hg38 and quantified using the quasi-mapper Salmon (v1.8.0). Gene-expression analysis was performed using the R Bioconductor package DESeq2 (v1.36.0). The read count matrix was normalized by size factors, and a variance stabilizing transformation (VST) was applied to the normalized expression data. The data was visualized using clusterProfiler (v4.4.2) and pheatmap (v1.0.12) packages.Table 1. List of TaqMan probes used for qPCR. Gene Gene name TaqMan probe (Catalog #) ACSS2 Acyl-coenzyme A synthetase short-chain family Hs01122829 m1ChiP-reChIP (-PCR, and -qPCR), ChIP-seq and analysis
[0382] ChIP experiments were performed using the High Sensitivity ChiP Kit (Abcam, ab185913). Briefly, organoids were fixed with PFA and whole chromatin was prepared and then sonicated to an optimal size of 300bp which was confirmed by gel electrophoresis. Chromatin was used for immunoprecipitation (IP) with either EP300 antibody (ab14984) or IgG1 isotype control. For the ChIP-reChIP, the ACSS2 (Abcam, ab133543) and ALDH6A1 (Abcam, ab12618) antibody was crosslinked to Protein A Dynabeads (Invitrogen, 10002D). The ChIP assay was then carried out on extracts from organoids as described above. At the end of the first ChIP, DNA was eluted with elution buffer supplemented with 10 mM DTT. The eluate was then diluted in 2 volumes of wash buffer supplemented with 1x Protease Inhibitor Cocktail and 1 mM DTT. The 2nd ChIP assay was then carried out as described above. For ChIP sequencing the service was outsourced to MedGenome (USA), the quality of the DNA was analyzed with Qubit (Invitrogen) and TapeStation (Agilent). A sequence library was prepared using a NEB Next Ultra II DNA kit and sequenced using NovaSeq 6000 (Illumina). Reads were trimmed and quality-checked using TrimGalore (v0.6.6) and then aligned to hg38 using bwa (v0.7.17). The aligned files were filtered, sorted and indexed using SAMtools (v1.15.1), and unmapped and low quality (MAPQ<30) reads were discarded. The duplicates were then marked and removed with Picard (v2.27.3). For visualization, deepTools (v3.5.1) was used to generate BigWig files which were visualized using IGV (v2.13.0). Peaks were identified using MACS2 (v2.2.7.1) and annotated with ChIPseeker (v1.32.0) to generate BED and BEDgraph files for visualization with IGV. For differential bindinganalysis, DiffBind (v3.6.1) was used to call statistically significant differential peaks after normalization and differential regions were selected based on DESeq2 method FDR531 corrected q-value of 0.05. Heatmap and profile plots were generated with EnrichedHeatmap (v1.26.0). The functional analyses of GO term and KEGG pathway were performed using clusterProfiler. De novo motif analysis was then carried out on centered 100 bp regions from the peak summits using MEME Suite (v5.4.1). snRNA-seq and analysis
[0383] For snRNA-seq, 25-30 mg samples were pulverized with liquid nitrogen and nuclei were prepared using Nuclei EZ Lysis buffer (NUC-101; Sigma-Aldrich). The nuclei were filtered through a 10 μm filter, sorted, and counted before the library was generated using the Chromium 3′ v3 GEM Kit (10x Genomics, CG000183RevC). Sequencing was performed by the CCHMC DNA Sequencing core using the NovaSeq 6000 (Illumina) sequencing platform with an S4 flow cell to obtain approximately 320 million reads per sample. The demultiplexing, barcode processing, gene counting, and aggregation were done and the fastq files were aligned to the GRCh38 human reference transcriptome using cellranger v7.0.1, alevin-fry v0.8.0, and starsolo v2.7.9a. to extract the UMI and nuclei barcodes. SoupX v1.6.0 was used to remove ambient RNA and other technical artifacts from the count matrices. The UMIs were quantified per-gene and per- nuclei for normalization. The dataset was then analyzed using Seurat v4.2.0 in RStudio v4.1.1. Quality control was then carried out by using filtering parameters where nuclei with features less than 200 and greater than 4000 or more than 0.5 percentage mitochondrial genes were discarded. In the end, 45,223 parenchymal nuclei were isolated out from a total of 120,195 nuclei. The dataset was then normalized, and top 2000 highly variable genes were selected using the ‘VST’ method. The dataset was then scaled, and principal component analysis (PCA) was run for dimensional reduction. Elbow plots and JackStraw plots were then used to determine the number of PCs to be used. The nuclei were then clustered using Louvain algorithm and KNN. Uniform Manifold Approximation and Projection (UMAP) projections were then used to visualize the clusters. Nulcei clusters were annotated based on gene expression levels of known markers and markers detected in previously published datasets (MacParland, S. A. et al. Single cell RNA sequencing of human liver reveals distinct intrahepatic macrophage populations. Nature Communications 9, 4383 (2018); Wei, Y. et al. Liver homeostasis is maintained by midlobular zone 2 hepatocytes. Science 371, eabb1625 (2021)). GSEA analysis was then carried out using clusterProfiler v4.4.2; the rank files were then extracted to group highly related pathways to the specific clusters in Cytoscapev3.9.1. For integration, previously published dataset was merged with our dataset, normalized, integration features and anchors were computed, scaled, dimensions reduced, clusters created and finally projected as UMAP reductions. For trajectory analysis, monocle3 v1.2.9 was employed to convert the dataset to ‘cds’ objects, partitions were created, the trajectory graph was learnt in an unsupervised fashion, and finally the nuclei were ordered in psuedotime. Concurrently, the dataset was imported into scanpy v1.9.1 as ‘anndata’ and trajectory was analyzed using scvelo v0.2.4 by projecting the computed RNA velocity onto the previously generated UMAP reduction. Integrated dataset of published human liver organoids and primary liver reference
[0384] For integration 8 different protocol-based human PSC-derived liver organoid and 4 primary adult and fetal datasets were collected according to the descriptions in the original publications 28,34-38. Briefly, available data (either raw FASTQ files, count matrices, H5AD, or Cell Ranger outputs such as “filtered_feature_bc_matrix” files) was obtained for each organoid from databases such as GEO, ArrayExpress, and the Human Cell Atlas (HCA). For FASTQ files, we used Cell Ranger to align and quantify the sequencing reads with the same parameters described in the original publication, generating UMI count data. Subsequent data processing was performed in Seurat using default settings. Metadata was curated for all organoid data, including cell barcodes, sample names, cell type annotations, and cell cycle phase. The public organoid data with was normalized and combined with the mZ-HLO data. Concurrently, the top 3,000 variable genes from the primary liver data was identified and applied these to the organoid dataset. Cell type annotations were based on the original publication and assigned into hepatocytes, hepatoblasts, endothelial cells, cholangiocytes, macrophage, mesenchyme, and stellate cells, which were added as new metadata. Using Seurat RPCA integration, the organoid data comprising 29,526 cells and the primary liver data comprising 8,656 cells was integrated. The same configurations were used to integrate the mZ-HLO dataset. After integration, Louvain clustering and re-annotated cell types was performed based on the expression of known marker genes. For further comparative analyses, the integrated organoid data was used as the query and the primary liver data as the reference. To benchmark the mZ-HLO model against existing models, the miloR and scrabbitr R packages was used to compute neighborhood graphs, compare neighborhoods based on similar features, and map neighborhood comparison defined by k-NN graph using UMAP embeddings for primary adult and fetal liver dataset. The neighborhood correlations were computed using 3000 highly variable genes that were found in the highly variable genes in eitheradult or fetal primary liver compared as reference. The transcriptional similarity graph was computed using 30 dimensional nearest neighbors and UMAP embeddings of cells, while other parameters were implemented as default. Adenovirus mediated gene silencing of p300 in vivo
[0385] The BLOCK-iT adenoviral RNA interference expression system (Invitrogen, Carlsbad, California) was used to construct adenoviral short hairpin RNA (shRNA) for p300 and scrambled shRNA as previously described 62. Rat pups aged ~ P0-P1 were then placed on a sterile heating pad, sanitized using isopropyl alcohol and iodine tincture to clean the skin surface. Finally, a 32G 1 inch needle was used to inject the adenoviruses (10 μg = 1.25X1013 vg) via the retro- orbital route. The rat pups were then returned to the mother by rubbing them with the nesting material to prevent pup rejection. Finally, the pups were sacrificed, and the livers were harvested at age P5, as most pups died at P7, to be fixed in 4% PFA and stained. Isolation of freshly isolated PHH for benchmarking
[0386] A fresh healthy human transplant rejected liver was harvested and cut into 1 g pieces. The liver pieces were chopped into a fine paste like consistency and submerged in Liver Digest Medium (Gibco, 17703034) for 15 min at 37 °C to isolate single cells 44. The cells were then passed through a 100 μm strainer on ice and centrifuged at 50 × g for 3 min at 4 °C. Next the H40 fraction was isolated by passing the cells through a 40 μm strainer on ice again, while the H20 fraction was isolated by passing the cells through a 20 μm strainer on ice. Finally, the isolated cells were immediately used for gene expression profiling using RT-qPCR and epigenetic profiling by ChIP. Organoid transplantation
[0387] The HLOs and mZ-HLOs were harvested right after co-culture on Day 23 and dissociated into chunks by repeated pipetting, washed with PBS and resuspended with HCM containing 2% FBS and CEPT cocktail to increase viability. On the day of surgery, the RRG rats were fully anesthetized, and an exploratory laparotomy was performed via midline incision followed by bowel evisceration to expose the portal triad, including the portal vein. The bile duct was ligated using nylon suture proximally and distally. The HLOs and mZ-HLOs (5 × 106cells) were then transplanted orthotopically at the base of the liver in close proximity to the portal vein using TISSEEL fibrin glue (Baxter), for stabilization. Conversely, for Z1- and Z3-HLO affinitytesting, the HLOs were injected through the portal vein or inferior vena cava using a 32G 1 inch needle in a 200 μL infusion. Bleeding was controlled by application of a bulldog clamp distal to the site of injection. The incision was then closed in two layers with 5-0 vicryl coated surgical sutures (Ethicon) and GLUture (Zoetis), and Buprenorphine (0.1 mg / kg) was administered as an analgesic. The animal was maintained on ad libitum dox chow until the day of harvest. Blood was collected regularly by the retro-orbital method as needed before the liver was harvested on Day 30. For antegrade and retrograde intravenous transplantation, the RRG rats were fully anesthetized, and an exploratory laparotomy was performed for transplantation through two different routes: portal vein (antegrade) or IVC (retrograde). With the portal vein or IVC exposed, a 32G 1 inch needle was used to inject 3 × 103organoids (roughly 5 × 105cells) in a 200-μL infusion into the portal vein. Bleeding was controlled by application of a bulldog clamp distal to the site of injection. This also assisted with preferential flow into the liver. Excessive blood loss was controlled by application of a SURGICEL SNoW Absorbable Hemostat (Ethicon). The incision was then closed in two layers with 5-0 vicryl-coated surgical sutures (Ethicon) and GLUture (Zoetis) and buprenorphine (0.1 mg / kg) was administered as an analgesic. The animal was then maintained on Dox (20 mg / kg) and tacrolimus injections every 3–4 days until the day of harvest. Blood was collected regularly by the retro-orbital method as needed. Immunostaining
[0388] The organoid samples were fixed with 4% paraformaldehyde for 2 hours and washed with PBS for 10 mins three times. The samples were hydrated and permeabilized with 0.1% Triton X-100 / PBS and then blocked with 5% normal donkey serum. The samples were incubated with primary and secondary antibodies (as listed in Table 2) overnight at 4 °C with gentle shaking. The samples were counterstained with DAPI, washed with PBS and cleared with refractive index matching solution (RIMS) as needed. Finally, the samples were imaged on Nikon A1R Inverted LUNV Confocal Laser Scanning Microscope.Table 2. List of antibodies used for immunostaining (IC), and ChIP-seq (ChIP) in 1110 organoid experiment Antibody Host Source Catalog # Dilution Method EP300 ChIP Rabbit abcam ab14984 5 ug ChIP C C C C C C C C C AAnti-Rabbit Alexa Donkey Invitrogen A-21206 1:500 IF Fluor 488Gene Gene name TaqMan probe (Catalog #)Table 5: List of Custom primers used for ChIP-PCR Orientation SequenceReverse ALDH6A1 CCTTACGCGGATGTTGAGGT (SEQ ID NO: 4)Orientation Sequence Forward ACSS2 GGAGGTTCTGTGAAGGAAGAAT (SEQ ID NO: 5) QProtein expression assays
[0389] Albumin secretion was measured by collecting 200 μl of the supernatant from the HLOs cultured in HCM and stored at −80°C until use. The supernatant was assayed with Human Albumin ELISA Quantitation Set (Bethyl Laboratories, Inc) according to the manufacturer’s instructions. For murine GULO expression assay, the organoids were dissociated and washed with PBS. The cells were then lysed with RIPA Lysis and Extraction Buffer and Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific) to extract total protein and assayed with Mouse GULO / L-Gulonolactone Oxidase ELISA Kit (MyBioSource.com, MBS2890736) according to the manufacturer’s instructions. Metabolite assays
[0390] Bilirubin levels were measured by collecting the supernatant from HLOs treated with bilirubin and serum from the rats. The supernatant and serum were assayed with Bilirubin Assay Kit (Total and Direct, Colorimetric) (Abcam, ab235627) and Bilirubin Assay Kit (Sigma- Aldrich, MAK126) according to the manufacturer’s instructions. Cellular antioxidant levels were measured by harvesting the HLOs, washing in PBS, and plating them into a 96 well assay plate. The levels were then quantitated using Cellular Antioxidant Assay Kit (ab242300) according to the manufacturer’s instructions. The nitrogen related metabolite assays were carried out by harvesting the HLOs, washing in PBS, and plating them into a 96 well assay plate. The glutathione, ammonia, urea, glutamine, glucose and triglyceride levels were then assayed by using the corresponding glutathione, ammonia, urea, glutamine, glucose and triglyceride assay kits (Abcam ab65322, ab83360, ab83362, ab197011, ab65333, and ab65336) according to the manufacturer’s instructions. Metabolic activity assays
[0391] CYP3A4 and CYP1A2 assays were performed by harvesting the HLOs, washing in PBS, plating them into a 96 well assay plate, and treating them with rifampicin and omeprazole respectively for 24 hrs. The assays were then performed using P450-Glo CYP3A4 and CYP1A2 Assay (Promega, V8802 and V8422) and normalized using CellTiter-Glo Luminescent Cell Viability Assay (G7572) according to the manufacturer’s instructions. The Notch1 assay was carried out by transfecting the HLOs with the experimental, reporter and negative vectors from the Human Notch1 Pathway Reporter kit (amsbio, 79503) using Lipofectamine 3000 and Opti-MEM I according to the manufacturer’s instructions. Dual Luciferase Assay System (amsbio, 60683-2)for Notch1 assay was then used to measure the Firefly luciferase activity and compared to Renilla luciferase activity to normalize the transfection efficiency. The luciferase assay indicates Notch activity using a CSL (CBF1 / RBPJK) luciferase reporter vector, Notch pathway responsive reporter. Notch1 is cleaved by gamma secretase and NICD is released into the nucleus which is detected by the luciferase reporter as active Notch signaling. The nitrogen metabolism related enzyme assays were carried out by harvesting the HLOs, washing in PBS, and plating them into a 96 well assay plate. The GS activity and GST activity levels were then assayed by using the Glutamine Synthetase Activity and Glutathione S Transferase Activity, Lipase Activity, and Glucokinase Activity Assay Kit (abcam ab284572, ab65325, ab102524, ab273303) according to the manufacturer’s instructions. The apoptosis assay was carried out by lysing the HLOs and assaying the lysate with a Caspase-3 Assay Kit (Colorimetric) (ab39401) according to the manufacturer’s instructions. Finally, rat serum was assayed with AST and ALT Activity Assay Kit (Sigma-Aldrich, MAK055 and MAK052) and quantified by a BioTek® Synergy H1 plate reader. Zonal toxicity assay
[0392] The HLOs were induced with 3-MC (50 μM) for alcohol degradation and drug conjugation metabolism 24 hours prior to the toxicity assay. After induction a toxic dose of the zone 1 toxin allyl alcohol (200 μM) was supplemented for 2 hr at 37 °C. On the other hand, a toxic dose of the zone 3 toxin acetaminophen (10 mM) was supplemented for 4 hr at 37 °C on different batches. However, for the mZ-HLO regenerative potential assay the toxins were incubated for 1 hr at 37 °C. Subsequently, organoids were supplied with fresh media and the organoids were fixed after 24 hr in 4% PFA and stained. The cultures were then tested for Caspase 3 activity using the cellular lysate collected from the organoid culture. Separately, the cultures were also tested for viability using CellTiter-Glo Luminescent Cell Viability Assay. Plasticity assay
[0393] The HLOs were treated with Dox starting at Day 17 and some organoids were fixed in 4% PFA before Dox withdrawal on Day 20. On Day 20 one group of organoids were continually treated with Dox every 2-3 days, whereas another group was withdrawn from Dox and treated with continuous low dose bilirubin (e.g. less than 5 mg / L, or less than 10 mg / L) until Day 25. On Day 25 the organoids were harvested for extraction of RNA, while some organoids were fixed and stained for zonal markers using immunostaining and visualized using a fluorescent microscope. Quantification and statistical analysis
[0394] Statistical analyses were mainly performed using R software v4.2.0 with unpaired two tailed Student’s t-test, one-way Anova and post hoc Tukey's test. Statistical analyses for non- normally distributed measurements were performed using non-parametric Kruskal-Wallis and post hoc Dunn-Holland-Wolfe test. For comparisons between unpaired groups, when groups were independent and the data was right skewed and censored, non-parametric log rank test was performed. P values < 0.05 were considered statistically significant. n value refers to biologically independent replicates. The image analyses were non-blinded. Statistical parameters are found in the figures and figure legends where ns = P > 0.05, * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001, and **** = P ≤ 0.0001. Using G*Power software, for each experiment, the minimum sample size was determined to collect the data for using the preliminary effect sizes, α = 0.05 and power = 0.8. For each experimental data, a post hoc power analysis was conducted to determine whether our design had enough power. There was enough power (power > 0.8) for all our experiments. Data availability
[0395] The RNA-seq, ChIP-seq and snRNA-seq data reported in this paper have been deposited to NCBI Gene Expression Omnibus (GEO) with the following accession number: GSE222654. Publicly available datasets were downloaded from the following sources: Camp et al. (GSE96981), Guan et al. (GSE154883), Harrison et al. (GSE245379), Hess et al. (GSE207889), Shinozawa et al. (GSE141183), Zhang et al. (GSE188541), and Smith et al. (PRJNA239635). For primary adult and fetal datasets, we downloaded H5AD data deposited in the Human Cell Atals (https<colon slash slash> collections<dot> cellatlas<dot> io<slasht> liver-development). The hg38 human reference genome is available at NCBI Genome under accession number GCF_000001405.26.. Code availability
[0396] Reference codes for bioinformatics analyses can be found at https <colon slash slash> github <dot> com <slash> hasanwraeth. EXAMPLE 2 Intracellular ascorbate specifies CPS1+ in Z1-HLOs
[0397] The Osteogenic Disorder Shionogi (ODS) rat is an animal model that has a genetic defect in hepatic L-gulonolactone oxidase with impaired hepatic metabolism. To test the importance of gulo in zonal identity, key periportal and pericentral markers, Glutaminase2 (GLS2)and Glutamate Synthetase (GS) were stained with or without dietary ascorbic acid supplementation. 7-14 days after ascorbic acid deprivation, GLS2+ve periportal hepatocyte fractions significantly reduced, whereas GS+ve pericentral fraction modestly increased (Fig.1A). To examine the role of gulo in zone-priming effect, stem cell differentiation models were employed next. First, an iPSC cell line with the murine Gulo (mGULO) transgene inserted into the AAVS1 locus using CRISPR-Cas9 and the pAAVS1-NDi-CRISPRi plasmid was employed (Reza, H. A. et al. Synthetic augmentation of bilirubin metabolism in human pluripotent stem cell- derived liver organoids. Stem Cell Reports (2023)). These mGULO iPSCs were used to induce posterior foregut cells based on previously published protocols (Kimura, M. et al. En masse organoid phenotyping informs metabolic-associated genetic susceptibility to NASH. Cell 185, 4216-4232 e4216 (2022); Ouchi, R. et al. Modeling Steatohepatitis in Humans with Pluripotent Stem Cell-Derived Organoids. Cell Metab 30, 374-384 e376 (2019); Shinozawa, T. et al. High- Fidelity Drug-Induced Liver Injury Screen Using Human Pluripotent Stem Cell-Derived Organoids. Gastroenterology 160, 831-846 e810 (2021)), and eventually generate putative Zone 1-like human liver organoids (Z1-HLOs) by continued Doxycycline (dox) induction beginning on Day 17 (Fig.1B and Fig.2A). Presumptive mGULO was paralleled by the mCherry expression. In ascorbate-deprived conditions, the iPSCs lacking mGulo transgene failed to differentiate into HLO properly, whereas the mGULO containing iPSCs generated healthy viable HLOs without ascorbate (Fig.1B and Fig.2B).
[0398] The expression of dox-induced mGULO contributed to higher cellular antioxidant concentration and lower ROS levels when compared to exogenous ascorbate supplements in medium (Fig.1C-E). These Z1-HLOs had higher expression of zone 1 liver genes, such as FAH (Fumarylacetoacetase), HPD (4-Hydroxyphenylpyruvate dioxygenase), and SCD (Stearoyl-CoA desaturase) (Fig. 1F). Compared to mGULO absent HLOs, the Z1-HLOs showed higher expression of urea cycle genes, such as ACSS2 (Acyl-coenzyme A synthetase 2), ASL (Argininosuccinate lyase), CPS1, and OTC (Ornithine transcarbamylase), which was approaching to those in to primary hepatocytes (PHH) (Fig.2B).
[0399] ELISA assay showed that the Z1-HLOs synthesized much higher levels of albumin compared to control HLOs and primary human hepatocytes (PHH), a characteristic prominent in periportal hepatocytes (Fig. 1G). More importantly, the Z1-HLOs expressed CPS1 and ACSS2 proteins, as verified by immunofluorescence and compared to control HLOs (Fig. 1H). Overall,these data demonstrated that functional mGULO induction with elevated intracellular ascorbate primed differentiation into CPS1+ periportal hepatocyte in Z1-HLOs. EXAMPLE 3 Extracellular bilirubin specifies GLUL+ in Z3-HLOs
[0400] In parallel with Example 2, a separate batch of HLOs expressing constitutive GFP was treated with bilirubin at around Day 20, and 1 mg / L was found to be the concentration that enabled the greatest cellular survival in the HLOs (Fig.2A and Fig.3A-B). Morphological analysis of the organoids revealed that they were more compact resulting in a smaller irregular lumen (Fig. 2C and Fig.3C-D).
[0401] Aside from the morphological changes, the bilirubin-treated human liver organoid expressed more zone 3 genes, such as ALDH6A1 (Aldehyde dehydrogenase 6A1), OATP2 (Organic anion transporter polypeptide 2), and GHR (Growth hormone receptor), hereafter defined as Z3-HLOs (Fig. 3E). Additionally, the Z3-HLOs expressed zone 3-specific ALDH1A2 (Aldehyde dehydrogenase 1A2), GLUL, HIF1A, and SREBF1 (Sterol regulatory element-binding transcription factor 1), which were higher when compared to control HLOs and similar to PHH expression (Fig.2C). Moreover, these Z3-HLOs exhibited higher CYP3A4 and CYP1A2 activity when compared to control, Z1-HLOs, and PHH (Fig. 3F). Finally, the Z3-HLOs expressed pericentral specific GLUL and NR3C1 proteins (Fig.3G). Taken together, the data demonstrated that exposure to 1 mg / L bilirubin facilitated the differentiation into a GLUL+ pericentral hepatocyte like population.
[0402] To further profile Z1- and Z3-HLOs, RNAseq analyses were conducted over the respective HLOs. First, pan-hepatocyte marker genes, such as A1AT, HNF4A, and CEBPA, were found to be consistently expressed in both Z1- and Z3-HLO. The Z3-HLOs, however, expressed more pericentral specific genes, such as GHR, BCHE (Butyrylcholinesterase), and RCAN1 (Regulator of calcineurin 1), while Z1-HLOs expressed ACSS2, SLBP (Stem-loop binding protein), and RND3; however, they lacked expression of widespread markers, such as ARG1 and interzonal markers, such as AKR1C1 (Aldo-keto reductase 1C1) and APOM (Apolipoprotein M) (Fig.3H).
[0403] Primary hepatocyte culture systems have been previously used to show that allyl alcohol and acetaminophen are toxic to zone 1 and zone 3 respectively due to differential alcohol and drug metabolism activity. Leveraging this pharmacological approach demonstrated that theZ1-HLOs were sensitive to the zone 1 toxin, namely allyl alcohol, while Z3-HLOs were sensitive to the zone 3 toxin, namely acetaminophen, as evidenced by the increased Caspase 3 activity (0.29 and 0.27 vs 0.02 relative activity) and reduced cell viability (225 and 250 vs 450 RLUX105) (Fig. 2D-E ). These results provided evidence for the acquisition of zone 1-like or zone 3-like identity in HLOs under the specific inductive conditions described herein. EXAMPLE 4 Assembling Multi-zonal human liver organoids
[0404] In a subsequent experiment, a compartmentalized dual zonal organoid system was generated (Fig. 2A). Upon further evaluation, it was observed that the continuous bilirubin and Dox treatment induced the HLOs to self-assemble together, which was dependent on seeded organoid density under the persistent exposure to bilirubin (Fig. 4A-B). Real time imaging over time showed that individual organoids fused together by the interaction of cytoskeletal proteins while maintaining a continuous lumen (Fig. 4C). With continuous 1 mg / L bilirubin treatment, it was observed that the HLOs tend to fuse together, indicated by the increase in mean segment length (Fig.4D).
[0405] Approximately 75% of the bilirubin-treated organoids underwent fusion accompanied by increased Notch activity (Fig. 4E-F). With inhibition of Notch signaling and Ezrin, the organoids failed to fuse together as observed over the course of 7 days indicating a role of Notch and Ezrin in cytoskeletal rearrangements (Fig.4F-G). About 75% of the bilirubin-treated organoids underwent fusion, compared to <5% fusion when treated with DAPT or NSC668394. Thus, bilirubin-induced Notch and Ezrin signaling activated cytoskeletal rearrangement to induce fusion. These fused organoids expanded canalicular connectivity as was observed in a fluorescently labelled bile acid analogue transport assay (Fig.4H). Quantification of self-assembly efficiency indicated the preferential fusion efficiency in the cell line-derived HLOs as follows: Z3- Z3 HLO (60%), Z3-Z1 HLO (35%), and Z1-Z1 HLO (5%) (Fig.4I).
[0406] The self-assembled dual organoids generated from the bilirubin-treated Z3-HLOs and the dox-treated Z1-HLOs were then further characterized (Fig.2F). The fused organoids thus generated had more comprehensive expression of Zone 1, Zone 2, Zone 3, and pan-liver markers (e.g., ACSS2, ALDH6A1, AKR1C1, and HNF4A), by bulk RNAseq (Fig.2G).
[0407] Over the course of 10 days of continuous dual treatment, the most fused organoids generated structures carrying bilirubin in the lumen (Fig. 5A). These putative multi-zonalorganoids (mZ-HLOs) had a GFP+ zone 1 and a mCherry+ zone 3 side while expressing pan liver marker A1AT (Alpha-1 antitrypsin) and PROX1 (Prospero homeobox 1) along the entire axis (Fig. 5B). The mZ-HLOs also expressed several pan hepatocyte markers: ALB, HNF1A, A1AT, CEBPB (CCAAT / enhancer-binding protein beta), PROX1, HNF4A, and TUBA1A (Tubulin alpha-1A) (Fig. 2H). They maintained a tubular structure, as indicated by the basal marker CTNNB1, and a continuous lumen, as indicated by the ZO-1 (Zonula occludens 1) apical marker (Fig.5C). Immunofluorescence also confirmed protein expression of three distinct regions within the newly generated mZ-HLOs: ARG1 (Arginase 1)-positive region, TERT-positive region, and AHR (Aryl hydrocarbon receptor)-positive region, consistent with periportal, interzonal and pericentral zonal marker expression (Fig.5C), indicating the emergence of multi-zonal properties. Other zone-specific liver markers, such as apical MRP2 (Multidrug resistance-associated protein 2) and nuclear SLBP indicate the variable hepatic characters, while only a tiny proportion of the cells were found to express the cholangiocyte marker CK7 (Keratin-7) (Fig.5C). Furthermore, the mCherry+ zone 1 side expressed the zone 1 markers TET1 and GLS (Glutaminase), while the GFP+ zone 3 side exhibited expression of the zone 3 markers ALDH6A1, GHR, and AR (Androgen receptor) (Fig. 2H). These stains were consistant with the spatial patterning of TUBA1A, CK7, SLBP, GLS, ALDH6A1, ARG1, TERT, AHR, and MRP2 in human neonatal liver tissue (Fig.5D). EXAMPLE 5 snRNAseq of mZ-HLOs reveal zonal features
[0408] To detail the hepatic populations in the mZ-HLOs, the samples were run through a single-nucleus (sn)RNAseq pipeline and retained 120,195 high-quality nuclei following stringent filtering for downstream analysis. The mZ-HLOs contained phenotypically distinct (e.g. structurally distinct, and / or functionally distinct, etc.) populations that were like SERPINA1+ hepatocytes (55%), KRT7+ cholangiocytes (11%), PECAM1+ endothelial cells (12%), LYZ+ macrophages (7%), COL1A1+ stellate cells (7%), and CD44+ mesenchyme (8%) that exhibited discrete gene expression profiles (Fig.6A-B).
[0409] The study aimed to characterize the different hepatocyte identity, illuminate their functionally-relevant gene sets, and explore their developmental trajectory using the snRNAseq dataset. Using unsupervised clustering and past hepatocyte expression profiles, the pericentral (28%) and periportal (24%) hepatocytes were identified, as well as a hepatoblast population (30%)and two phenotypically distinct interzonal hepatocyte populations (18%) (Fig.7A). Hepatoblasts are the most immature population in mZ-HLO and enriched for fetal markers such as AFP, and other growth mitogenic markers such as IGF2 (Insulin-like growth factor 2), and MAP2K2 (mitogen-activated protein kinase 2), which regulate the growth and differentiation of the cells. Interzonal hepatocytes are known for expressing glutathione and DNA repair enzymes and as such express TERT and GSS.
[0410] Finally, the periportal hepatocytes expressed GLS2, CPS1, OTC, ACSS2 and ARG1, while the pericentral hepatocyte population expressed GLUL, CYP2E1, HIF1A, ALDH1A2, ALDH6A1, and AR (Fig. 6C-E and Fig. 7B). TAT, HAMP, and CYP3A4 are localized in the periportal, interzonal and pericentral hepatocyte populations as cross-referenced by primary liver spatial transcriptomic dataset. (Fig. 7A and Fig. 8A-C) Cholangiocyte marker KRT7 was expressed at a minimal level in the hepatoblast population only (Fig. 7B), while extensive expression of TTR (Transthyretin) and SERPINA1 was observed throughout the populations (Fig.7B) along with zonal expressions of periportal GLS, CPS1, and OTC; interzonal GSS, TERT, and AKR1C1; and pericentral GLUL, CYP2E1 and HIF1A (Fig. 7B). Hepatoblast and interzonal hepatocyte populations were predicted to be mostly involved in hepatocyte proliferation and differentiation, with interzonal cells more involved in DNA repair mechanisms.
[0411] Periportal and pericentral hepatocytes were, however, vastly different. The periportal cells were involved in gluconeogenesis, lipid and glutamine catabolism, ROS and oxygen response, and was enriched for Notch signaling. On the other hand, xenobiotic and pigment metabolism, glutamine biosynthesis, and Wnt signaling were more enriched in the pericentral population (Fig. 6D). Additionally, the mZ253 HLO dataset was integrated with multiple previously published adult and fetal hepatocyte snRNAseq datasets (Andrews, T. S. et al. Single- Cell, Single-Nucleus, and Spatial RNA Sequencing of the Human Liver Identifies Cholangiocyte and Mesenchymal Heterogeneity. Hepatology Communications 6, 821-840 (2022); Aizarani, N. et al. A human liver cell atlas reveals heterogeneity and epithelial progenitors. Nature 572, 199-204 (2019); MacParland, S. A. et al. Single cell RNA sequencing of human liver reveals distinct intrahepatic macrophage populations. Nature Communications 9, 4383 (2018); Wesley, B. T. et al. Single-cell atlas of human liver development reveals pathways directing hepatic cell fates. Nature Cell Biology 24, 1487-1498 (2022)). Upon integration with the Andrews et al. dataset, a significant overlap of mZ-HLO-derived periportal, interzonal and pericentral hepatocyte populations was found with their primary counterparts, and the hepatoblast population clearlyseparated out into a different cluster (Fig. 8D). Moreover, the periportal population expressed GLS2, CDH1, CPS1 and TET1 same as Andrews et al, and the pericentral population also expressed ALDH1A2, GHR, GLUL, and HIF1A similar to Andrews et al, while the interzonal profile was also alike (Fig. 8E). Looking at global integration with all 4 datasets, there were considerable overlaps particularly in terms of zonal hepatocytes (Fig.8F). There were noticeable overlaps between some of the adult liver zonal populations and the mZ-HLO zonal hepatocytes particularly in both pericentral and periportal hepatocytes in terms of GLUL and GLS2 expression (Fig.8G). The mZ-HLOs also contain a hepatoblast population which is found in fetal liver along with other zonal features.
[0412] Furthermore, as evidence of this mZ-HLO model against existing models, an integrated dataset was constructed using a collection of 8 publicly available human PSC-derived liver organoid datasets using neighborhood graph correlation mapping (Fig.7C). With respect to the status of hepatocytes, the mZ-HLO showed a higher correlation with adult primary liver tissue (Fig.7C), albeit the hepatoblast population exhibited higher correlation with fetal liver tissue.
[0413] The lineage progression into multi-zonal populations was further determined using RNA velocity and pseudotime analysis, which is based on the kinetics of the splicing rate of mRNA and the expression of each gene (Fig.7A and Fig.9A-B). Both methods predicted that the zonal hepatocytes originated from hepatoblasts through the interzonal hepatocytes population (Fig. 7A and Fig. 9C). Finally, with the goal to predict the function of these individual populations, Gene Set Enrichment Analysis (GSEA) was applied to identify the functional pathways and profiles of each set (Fig.7D-E). Hepatoblast and interzonal hepatocyte populations were predicted to be mostly involved in hepatocyte proliferation and differentiation with interzonal cells more involved in DNA repair mechanisms. Periportal and pericentral hepatocytes were however vastly different. The periportal cells were involved in gluconeogenesis, lipid and glutamine catabolism, ROS and oxygen response, and was enriched for Notch signaling. On the other hand, Xenobiotic and pigment metabolism, Glutamine biosynthesis, and Wnt signaling were more enriched in the pericentral population (Fig.7D-E). Thus, the presently described self-assembled organoids were shown to harbor divergent cells expressing zonal hepatocyte-like markers.EXAMPLE 6 EP300 regulation executes zonal transcription
[0414] To understand the differential transcriptional mechanisms leading to zonation, the epigenetic landscape of the mZ-HLOs was investigated. EP300 (E1A-associated protein p300) is a histone acetyltransferase that acetylates enhancer regions and activates transcription leading to hepatoblast differentiation. EP300 marks poised and active enhancers and activates expression of zonal genes.
[0415] EP300 ChIPseq analysis revealed that the presently described mZ-HLOs had increased binding of EP300 at putative enhancer sites (7875 binding sites) as compared to controls and singly treated HLOs (2852, 4891 and 5219 binding sites) (Fig.10A). Pan liver markers, such as HNF4A and CTNNB1 (β-catenin), had EP300 peaks upstream of the TSS (Transcription Start Site) in all the samples similar to the PHH dataset in Smith et al. (Fig. 10B-C). However, many zone-specific genes, such as ACSS2 (zone 1), ALDH6A1 (zone 3), and HPR (Haptoglobin-related protein) (zone 2), were recapitulated in mZ-HLOs, while Z1- and Z3-HLOs had active enhancers upstream of only their respective zonal genes (Fig. 11A-C). Furthermore, this pattern was again observed for SLBP (zone 1), GHR (zone 3), and AKR1C1 (zone 2) as well (Fig.10D-F). GSEA analysis of the peaks revealed enrichment for mixed zonal processes in the mZ-HLOs while the Z1- and Z3-HLOs had zone specific biological process enrichment (Fig. 10G-H and Fig. 11D). Motif analysis of the peaks also revealed that EP300 bound peaks were enriched for genes (HNF1AI, HNF4A, and TBX2) that regulate functional differentiation of hepatocytes (Fig.11E).
[0416] The RNAseq dataset was then integrated with the ChIPseq dataset to look at the regulation of upregulated RNA in each condition (Fig. 11F). The Z3-HLOs exhibited HIF1A, TBX3 (T-box transcription factor TBX3), and AHR as the top motifs co-occupied by EP300, while Z1-HLOs revealed TET1, NRF1 (Nuclear respiratory factor 1), and TFEB (Transcription factor EB) as the top motifs (Fig.11F).
[0417] Bobcat339, a TET inhibitor, was found to cause downregulation of ACSS2 and CPS1 in the Z1- and mZ-HLOs, while inhibition of HIF1A with KC7F2, a HIF inhibitor, downregulated ALDH6A1 and GLUL (zone 3) expression in the mZ- and the Z3-HLOs (Fig. 11G).
[0418] For in vivo verification of the role of EP300 in zonal hepatocyte development, Ad- shp300 was injected into ~P0-P1 rat pups via the retro-orbital route (Fig.12A). The p300 shRNA mediated EP300 silencing resulted in impaired liver development where the hepatocytesunderwent over proliferation and under differentiation causing portal and central vein ambiguity, i.e., zonal impairment. This was further elucidated in the disrupted porto-central polarity mediated by EP300 silencing as evident in the aberrant expression of PROX1, ARG1, and GLUL. Here either PROX1 nuclear specificity or expression was lost in some hepatic cells, while for ARG1 and GLUL the zone-specific expression was altered to spotty non-zone-specific expression (Fig. 12A-B). Furthermore, the Z1- and Z3-HLO gene expression profile was compared with size fractionated freshly isolated primary human hepatocytes. The Z1-HLOs had similar expression of ACSS2, ALB, ASL, CPS1, and OTC when compared to < 20 μm periportal hepatocytes (H20) (Fig.12C). On the other hand, the Z3-HLOs expressed ALDH1A2, ALDH6A1, GLUL, HIF1A, and SREBF1 similar to the < 40 μm pericentral hepatocytes (H40) (Fig.12D). Using human zonally- enriched PHH, the ChIP-reChIP-PCR and ChIP-reChIP-qPCR showed that H20 had increased binding of TET1 upstream of ACSS2 (1 vs 0.45-fold difference), while H40 had increased binding of HIF1A upstream of ALDH6A1 (1 vs 0.2-fold difference) similar to Z1- and Z3-HLO respectively (Fig. 12E-F). Together, these results indicated that EP300 co-ordinates with other TFs such as HIF1A and TET1 to mediate the preferential activation and repression of zone-specific programs (Fig.11H). EXAMPLE 7 Zone-specific programs work in concert
[0419] Nitrogen metabolism in the liver occurs across multiple zones where ammonia is removed in the form of urea or glutamine. The urea cycle and glutathione metabolism pathways are intricately linked and required for proper nitrogen handling. Given the development of an organoid model with dual zonal functionality, it was subsequently tested whether the mZ-HLOs could handle nitrogen metabolism that spans across multiple zones.
[0420] The mZ-HLOs were found to express urea cycle genes, such as CPS1, OTC, and ARG1, while expressing detoxification genes, such as GSTA2 (Glutathione S-transferase A2), ALDH1A2, and GLUL as well in response to 10mM NH4CL when compared to PHH and control HLOs (Fig. 13A-C). This allowed the mZ-HLOs to synthesize the highest levels of glutathione, which can be inhibited by buthionine sulphoximine (BSO) (Fig. 13D). The mZ-HLOs therefore metabolized the highest amount of ammonia, while BSO inhibits ammonia removal (Fig. 13E). This is reflected in the high urea levels detected in mZ-HLOs and the loss of urea production with BSO treatment (Fig.13F).
[0421] However, although the urea cycle was inhibited with BSO treatment, ammonia levels were appreciably lower in the mZ-HLOs. The mZ-HLOs were found to have significant glutathione S-transferase activity and glutamine synthesis (Fig. 13G-H). This allowed the mZ- HLOs to upregulate glutamine synthesis to remove excess ammonia even in the presence of BSO treatment (Fig.13I).
[0422] Furthermore, since lipid and glucose metabolism are maintained differentially by the zonal hepatocytes, we wanted to see whether the mZ-HLOs exhibit this metabolic balance. Consequently, we performed a triglyceride assay which showed that mZ-HLOs had intermediate levels of triglyceride (4.5 nmol) when compared to Z1- (2.5 nmol) and Z3-HLOs (5.5 nmol). Firsocostat (Acetyl-CoA Carboxylase inhibitor) treatment resulted in inhibition of lipid biosynthesis and the lowest levels of triglyceride due to the high lipase activity of the mZ-HLOs (Fig.14A-B). On the other hand, for glucose metabolism the glucose levels were observed where mZ-HLOs had intermediate levels of glucose (23 nmol) as well compared to other zonal HLOs. FBPi (Fructose 1,6-bisphosphatase inhibitor) treatment inhibited the gluconeogenetic process resulting in lower levels of glucose due to enhanced glycolytic activity of the mZ-HLOs (Fig.14C- D). Collectively, the mZ-HLOs are not only able to maintain dual zonal (zone1 and 3) functionality but also interzonal (zone2) dependent functions that are native to the nitrogen, glucose and lipid metabolism in the human liver.
[0423] Next, the zone-specific damage-induced responses were tested upon treatment with Allyl Alcohol (Zone 1 toxin) and Acetaminophen (Zone 3 toxin) (Fig.15A). It was found that with the allyl alcohol, the GFP–ve regions had positive expression of Ki-67 starting at the intermediate region. Conversely, the acetaminophen transient treatment resulted in Ki-67 expression primarily in the GFP +ve regions (Fig.15B-C). This resulted in elongation of the GFP -ve ARG1 region and the GFP +ve GLUL region following treatment of allyl alcohol and acetaminophen respectively (Fig.15B and 15D). Furthermore, the Z1-HLO exhibited zone 3 features as evident in switching of CPS1 and TET1 expression to GLUL and NR3C1 expression at Day 25 following doxycycline withdrawal and persistent bilirubin treatment starting at Day 20 when the zone1 features started to appear (Fig.15E). This switch was also observed in reduced expression of ACSS2 and increased expression of ALDH1A2 following doxycycline withdrawal and bilirubin treatment (Fig. 15F). Overall, this indicated that zone-specific damage responses and plasticity are observed in the mZ- HLOs of the disclosure.EXAMPLE 8 Transplantating of mZ-HLOs after bile duct ligation rats
[0424] To determine multi-zonal functionality in vivo, post-transplant mZ-HLO metabolic performance was evaluated in ammonium and bilirubin removal relative to a singular zonal HLO system. In choosing a model, bile duct ligation (BDL) was adopted because BDL in rats exhibits hyperammonemia and hyperbilirubinemia, leading to the progression of total hepatic dysfunction. The ligation results in large accumulation of bilirubin and ammonia in the serum that accelerates liver injury.
[0425] Since the mZ-HLOs exhibited dual zonal functionality, it was explored whether mZ-HLOs can be used in an in vivo setting for the amelioration of disease. To this end, the mZ- HLOs were transplanted orthotopically on the liver in close proximity of the portal vein using fibrin glue as a scaffold in bile duct ligated Il2rg-deficient, Rag1-deficient rats, which were observed for 30 days (Fig.16A). The mZ-HLO-transplanted rats had a higher survival rate (55.6%, p = 0.049) as compared to Z3-HLO (33.3%), Z1-HLO (22.2%), and sham transplants (22.2%) (Fig. 16B). The transplanted rats exhibited approximately 350 ng / ml peak human albumin in their serum at Day 20, thus indicating functional engraftment (Fig. 16C). Moreover, the transplanted mZ- HLOs were observed to invade into the hepatic parenchyma and retained their structure as indicated by the TUBA1A and ASGR1 stain (Fig.17A-B). These partially integrated mZ-HLOs retained their mCherry and GFP expression which also expressed ARG1 and GLUL (Fig. 17C). The Z1-HLO integrated into the parenchyma of the liver more efficiently when transplanted through the portal vein route, whereas the Z3-HLOs integrated better near the central vein by retrograde transplantation via the inferior vena cava route (Fig. 17D). Consistent with in vitro performance, reduction in levels of the elevated bilirubin (down from approximately 13 to 6.5 mg / L) and ammonia (down from approximately 160 to 70 μM) was observed at Day 20 most notably in the mZ-HLO transplanted groups (Fig.16D-E). Overall, these data demonstrated that the transplantation of the multi-zonal mZ-HLOs offered better metabolic performance in removing excess ammonia and bilirubin than non-multi-zonal tissue transplant.
[0426] The various methods and techniques described above provide a number of ways to carry out the embodiments disclosed herein. Of course, it is to be understood that not necessarily all objectives or advantages described can be achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that themethods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as taught or suggested herein. A variety of alternatives are mentioned herein. It is to be understood that some preferred embodiments specifically include one, another, or several features, while others specifically exclude one, another, or several features, while still others mitigate a particular feature by inclusion of one, another, or several advantageous features.
[0427] Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be employed in various combinations by one of ordinary skill in this art to perform methods in accordance with the principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.
[0428] Although the application has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments disclosed herein extend beyond the specifically disclosed embodiments to other alternative embodiments and / or uses and modifications and equivalents thereof.
[0429] In some embodiments, the numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the application are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.
[0430] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the application (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein,each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the application and does not pose a limitation on the scope of the application otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the application.
[0431] Preferred embodiments of this application are described herein. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the application can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the application unless otherwise indicated herein or otherwise clearly contradicted by context.
[0432] All patents, patent applications, publications of patent applications, and other material, such as articles, books, specifications, publications, documents, things, and / or the like, referenced herein are hereby incorporated herein by this reference in their entirety for all purposes, excepting any prosecution file history associated with same, any of same that is inconsistent with or in conflict with the present document, or any of same that may have a limiting affect as to the broadest scope of the claims now or later associated with the present document. By way of example, should there be any inconsistency or conflict between the description, definition, and / or the use of a term associated with any of the incorporated material and that associated with the present document, the description, definition, and / or the use of the term in the present document shall prevail.
[0433] In closing, it is to be understood that the embodiments of the application disclosed herein are illustrative of the principles of the embodiments disclosed herein. Other modifications that can be employed can be within the scope of the application. Thus, by way of example, but not of limitation, alternative configurations of the embodiments of the application can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present application are not limited to that precisely as shown and described. Recitation of Embodiments
[0434] Exemplary embodiments of the present disclosure are provided in the following numbered embodiments. 1. An embodiment for producing a multi-zonal liver organoid, the method comprising: co-culturing one or more first human liver organoid (HLO) with one or more second HLO, wherein the second HLO is a bilirubin-treated HLO; and contacting the co-cultured first HLO and the bilirubin-treated second HLO with bilirubin for a period of time to provide a liver organoid with at least one phenotypically distinct hepatocyte subpopulation. 2. Embodiment 1, wherein the first HLO comprises an ascorbate-treated HLO. 3. Embodiment 1 or 2, wherein the first HLO is a functional L-gulonolactone oxidase (GULO)- expressing HLO. 4. Any of embodiments 1-4, wherein the first HLO is treated with doxyclcine. 5. Any of embodiments 1-5, wherein the first HLO and / or the bilirubin-treated second HLO comprises an immature HLO. 6. Any of embodiments 1-5, wherein the first HLO comprises an ascorbate-enriched progenitor cell population, and wherein the bilirubin-treated second HLO comprises a bilirubin-enriched progenitor cell population. 7. Any of embodiments 1-6, wherein each phenotypically distinct hepatocyte subpopulation comprises a zone 1 (Z1) or zone 1-like (Z1-like) hepatocyte subpopulation, a zone 2 (Z2) or zone 2-like (Z2-like) hepatocyte subpopulation, or a zone 3 (Z3) or zone 3-like (Z3-like) hepatocyte subpopulation. 8. Any of embodiments 1-7, wherein the co-cultured first HLO and bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations.9. Any of embodiments 1-8, wherein the co-cultured first HLO and bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to self- assemble. 10. Any of embodiments 1-9, wherein the co-cultured first HLO and bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to fuse into interconnected dual organoids. 11. Any of embodiments 8-10, wherein the period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations, to self-assemble into multizonal HLOs, and / or to fuse into interconnected dual organoids is equal to or at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days. 12. Any of embodiments 1-11, wherein first HLO comprises a Z1 or Z1-like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation, and / or wherein the bilirubin-treated HLO comprises a Z1 or Z1-like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation. 13. Any of embodiments 1-12, wherein the multi-zonal liver organoid comprises two or more hepatocyte subpopulations. 14. Embodiment 13, wherein the two or more hepatocyte subpopulations comprise a Z1 or Z1- like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation; or a Z1 or Z1-like hepatocyte subpopulation and a Z2 or Z2-like hepatocyte subpopulation; or a Z2 or Z2-like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation. 15. Any of embodiments 1-14, wherein the first HLO comprises a Z1 or Z1-like hepatocyte subpopulation, and wherein the bilirubin-treated second HLO comprises a Z3 or Z3-like hepatocyte subpopulation. 16. Any of embodiments 1-15, wherein the multi-zonal liver organoid comprises three or more hepatocyte subpopulations.17. Embodiment 16, wherein the three or more hepatocyte subpopulations comprise a Z1 or Z1- like hepatocyte subpopulation, a Z2 or Z2-like hepatocyte subpopulation, and a Z3 or Z3-like hepatocyte subpopulation. 18. Any of embodiments 1-17, wherein the liver organoid comprises a tubular structure with a single lumen. 19. Any of embodiments 1-18, wherein the liver organoid does not contain hematopoietic tissue and / or acquired immune cells. 20. Any of embodiments 1-19, wherein, during the co-culturing, the concentration of bilirubin is maintained continuously. 21. Any of embodiments 1-20, wherein, during the co-culturing, the concentration of bilirubin...
Claims
CLAIMS What is claimed is:
1. A method of producing a multi-zonal liver organoid, the method comprising: co-culturing one or more first human liver organoid (HLO) with one or more second HLO, wherein the second HLO comprises a bilirubin-treated HLO; and contacting the co-cultured first HLO and the bilirubin-treated second HLO with bilirubin for a period of time to provide a liver organoid with at least one phenotypically distinct hepatocyte subpopulation.
2. The method of claim 1, wherein the first HLO comprises an ascorbate-treated HLO.
3. The method of claim 1 or claim 2, wherein the first HLO is a functional L-gulonolactone oxidase (GULO)-expressing HLO.
4. The method of any preceding claim, wherein the first HLO is treated with doxycycline.
5. The method of any one of the preceding claims, wherein the first HLO and / or the bilirubin- treated second HLO comprises an immature HLO.
6. The method of any one of the preceding claims, wherein the first HLO comprises an ascorbate- enriched progenitor cell population, and wherein the bilirubin-treated second HLO comprises a bilirubin-enriched progenitor cell population.
7. The method of any one of the preceding claims, wherein each phenotypically distinct hepatocyte subpopulation comprises a zone 1 (Z1) or zone 1-like (Z1-like) hepatocyte subpopulation, a zone 2 (Z2) or zone 2-like (Z2-like) hepatocyte subpopulation, or a zone 3 (Z3) or zone 3-like (Z3-like) hepatocyte subpopulation, optionally wherein there is an observable and / or measurable boundary between two or more phenotypically distinct hepatocyte subpopulations.
8. The method of any one of the preceding claims, wherein the co-cultured first HLO and bilirubin- treated second HLO are contacted with bilirubin for a period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations.
9. The method of any one of the preceding claims, wherein the co-cultured first HLO and bilirubin- treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to self-assemble.
10. The method of any one of the preceding claims, wherein the co-cultured first HLO and bilirubin-treated second HLO are contacted with bilirubin for a period of time sufficient for the co-cultured HLOs to fuse into interconnected dual organoids.
11. The method of any one of claims 8-10, wherein the period of time sufficient to develop two or more phenotypically distinct hepatocyte subpopulations, to self-assemble into multizonal HLOs, and / or to fuse into interconnected dual organoids is equal to or at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days.
12. The method of any one of the preceding claims, wherein the first HLO comprises a Z1 or Z1- like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation, and / or wherein the bilirubin-treated second HLO comprises a Z1 or Z1-like, Z2 or Z2-like, or Z3 or Z3-like hepatocyte subpopulation.
13. The method of any one of the preceding claims, wherein the multi-zonal liver organoid comprises two or more hepatocyte subpopulations, optionally wherein there is an observable and / or measurable boundary between two or more phenotypically distinct hepatocyte subpopulations.
14. The method of claim 13, wherein the two or more hepatocyte subpopulations comprise a Z1 or Z1-like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation; or a Z1 or Z1- like hepatocyte subpopulation and a Z2 or Z2-like hepatocyte subpopulation; or a Z2 or Z2-like hepatocyte subpopulation and a Z3 or Z3-like hepatocyte subpopulation.
15. The method of any one of the preceding claims, wherein the first HLO comprises a Z1 or Z1- like hepatocyte subpopulation, and wherein the bilirubin-treated HLO comprises a Z3 or Z3-like hepatocyte subpopulation.
16. The method of any one of the preceding claims, wherein the multi-zonal liver organoid comprises three or more hepatocyte subpopulations, optionally wherein there is an observable and / or measurable boundary between two or more phenotypically distinct hepatocyte subpopulations.
17. The method of claim 16, wherein the three or more hepatocyte subpopulations comprise a Z1 or Z1-like hepatocyte subpopulation, a Z2 or Z2-like hepatocyte subpopulation, and a Z3 or Z3- like hepatocyte subpopulation.
18. The method of any one of the preceding claims, wherein the liver organoid comprises a tubular structure with a single lumen and / or or interaction or rearrangement of cytoskeletal proteins.
19. The method of any one of the preceding claims, wherein the liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
20. The method of any one of the preceding claims, wherein, during the co-culturing, the concentration of bilirubin is maintained continuously.
21. The method of any one of the preceding claims, wherein, during the co-culturing, the concentration of bilirubin is refreshed through addition of exogenous bilirubin during every media change.
22. The method of any one of the preceding claims, wherein, during the co-culturing, the concentration of bilirubin is maintained continuously at a level less than or equal to about 5 mg / L.
23. The method of any one of the preceding claims, wherein, during the co-culturing, the bilirubin concentration during the co-culturing step is maintained continuously at about 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L, 0.7 mg / L, 0.8 mg / L, 0.9 mg / L, 1 mg / L, 1.1 mg / L, 1.2 mg / L, 1.3 mg / L, 1.4 mg / L, 1.5 mg / L, 1.6 mg / L, 1.7 mg / L, 1.8 mg / L, 1.9 mg / L, 2 mg / L, 2.1 mg / L, 2.2 mg / L, 2.3 mg / L, 2.4 mg / L, 2.5 mg / L, 2.6 mg / L, 2.7 mg / L, 2.8 mg / L, 2.9 mg / L, or 3 mg / L; preferably at about 1 mg / L.
24. The method of any one of the preceding claims, wherein the first HLO and the bilirubin-treated second HLO are co-cultured with bilirubin in a hepatocyte culture medium.
25. The method of claim 24, wherein the hepatocyte culture medium comprises hepatocyte growth factor, oncostatin M, dexamethasone, or any combination thereof.
26. The method of any one of the preceding claims, wherein the first HLO and the bilirubin-treated second HLO are seeded for co-culturing at a density of greater than about 1×104cells / well, greater than about 0.5×105cells / well, greater than about 1×105cells / well, greater than about 2×105cells / well, greater than about 3×105cells / well, greater than about 4×105cells / well, greater than about 5×105cells / well, or higher.
27. The method of any one of the preceding claims, wherein the first HLO and the bilirubin-treated second HLO are seeded for co-culturing at a density of greater than about 50-5000 organoids per well; preferably about 500-2000 organoids per well.
28. The method of any one of the preceding claims, wherein the first HLO and the bilirubin-treated second HLO are seeded for co-culturing at a ratio of about 1:1; or 2:1, 3:1, 4:1, 5:1, or greater; or 1:2, 1:3, 1:4, 1:5, or greater; preferably at a ratio of about 1:
1.
29. The method of any one of the preceding claims, wherein the first HLO is a functional GULO- expressing HLO and is produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of a heterologous expression system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells under conditions to induce expression from the heterologous expression system, to provide the functional GULO-expressing HLO.
30. The method of any one of the preceding claims, wherein the first HLO is a functional GULO- expressing HLO and is produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of an inducible system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with an induction agent, to provide the functional GULO-expressing HLO.
31. The method of any one of the preceding claims, wherein the first HLO is a functional GULO- expressing HLO and is produced by: genetically modifying a progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, that encodes for the functional GULO protein, wherein the functional GULO protein and / or a gene or mRNA, or both, are under the control of an tetracycline inducible system; culturing the genetically modified progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with doxycycline, to provide the functional GULO- expressing HLO.
32. The method of any one of claims 29-31, wherein the functional GULO-expressing HLO produced from a genetically modified progenitor cell population with a functional GULO protein and / or a gene or mRNA, or both, is able to synthesize ascorbate.
33. The method of any of claims 29-32, wherein the functional GULO protein is a Rodentia GULO, preferably a murine GULO (mGULO).
34. The method of any one of claims 29-33, wherein the culturing the posterior foregut cells under conditions to induce expression from the heterologous expression system occurs on or about day 17 of culture of the progenitor cell population.
35. The method of any of claims 29-34, wherein the functional GULO-expressing HLO is engineered with the gene that encodes for the functional GULO protein using CRISPR.
36. The method of any one of claims 29-35, wherein the gene or mRNA, or both, that encodes for the functional GULO protein is introduced to the functional GULO-expressing HLO by transfection.
37. The method of any one of the preceding claims, wherein the bilirubin-treated HLO is produced by: culturing a progenitor cell population to form posterior foregut cells; and culturing the posterior foregut cells with bilirubin, to provide the bilirubin-treated HLO.
38. The method of any one of the preceding claims, wherein the multi-zonal liver organoid has: a) expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; b) expression of one or more Z2-associated genes and / or expresses one or more Z2-associated proteins; c) expression of one or more Z3-associated genes and / or expresses one or more Z3-associated proteins; and / or d) expression of one or more pan-hepatocyte-associated genes and / or expresses one or more pan-hepatocyte-associated proteins.
39. The method of any one of the preceding claims, wherein the multi-zonal liver organoid has expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; and expression of one or more Z3-associated genes and / or expresses one or more Z3- associated proteins.
40. The method of any one of the preceding claims, wherein the multi-zonal liver organoid has expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; expression of one or more Z2-associated genes and / or expresses one or more Z2- associated proteins; expression of one or more Z3-associated genes and / or expresses one or moreZ3-associated proteins; and expression of one or more pan-hepatocyte-associated genes and / or expresses one or more pan-hepatocyte-associated proteins.
41. The method of claim 40, wherein the Z3-associated genes and / or Z3-associated proteins function in xenobiotic metabolism, WNT signaling, glycolysis, and / or lipogenesis.
42. The method of claim 40 or 41, wherein the Z1-associated genes and / or Z1-associated proteins function in gluconeogenesis, lipid catabolism, glutamine catabolism, and / or reactive oxygen species (ROS) metabolism.
43. The method of any one of claims 40-42, wherein the Z2-associated genes and / or Z2-associated proteins function in DNA repair, amino acid metabolism, and / or cell growth.
44. The method of any one of the preceding claims, wherein the first HLO has elevated expression of one or more Z1-associated genes and / or expresses one or more Z1-associated proteins; and / or wherein the bilirubin-treated second HLO has elevated expression of one or more Z3-associated genes and / or expresses one or more Z3-associated proteins.
45. The method of any of claims 38-44, wherein, the one or more Z1-associated genes are selected from Fumarylacetoacetase (FAH), 4-Hydroxyphenylpyruvate dioxygenase (HPD), Stearoyl-CoA desaturase (SCD), Acyl- coenzyme A synthetase 2 (ACSS2), Argininosuccinate lyase (ASL), Carbamoyl phosphate synthetase I (CPS1), Ornithine transcarbamylase (OTC), Stem-loop binding protein (SLBP), Glutaminase (GLS), and Rho family GTPase 3 (RND3) genes; the one or more Z1-associated proteins are selected from CPS1 and ACSS2; the one or more Z2-associated genes are selected from Glutathione synthetase (GSS), Telomerase reverse transcriptase (TERT), and Aldo-keto reductase family 1 member C1 (AKR1C1); the one or more Z3-associated genes are selected from Aldehyde dehydrogenase 6 family member A1 (ALDH6A1), Organic anion transporter polypeptide 2 (OATP2), Growth hormone receptor (GHR), Aldehyde dehydrogenase 1A2 (ALDH1A2), Glutamine synthetase (GLUL), Hypoxia-inducible factor 1-alpha (HIF1A), Sterol regulatory element-binding protein 1(SREBF1), Cytochrome P450 family 3 subfamily A member 4 (CYP3A4), Cytochrome P450 family 1 subfamily A member 2 (CYP1A2), Butyrylcholinesterase (BCHE), and Regulator of calcineurin 1 (RCAN1); the one or more Z3-associated proteins are selected from GLUL and NR3C1 proteins; and / or the one or more pan-hepatocyte marker genes are selected from ACSS2, ALDH6A1, AKR1C1, Alpha-1 antitrypsin (A1AT), Haptoglobin-related protein (HPR), Hepatocyte nuclear factor 4 alpha (HNF4A), CCAAT enhancer binding protein alpha (CEBPA), Albumin (ALB), HNF1 homeobox A (HNF1A), Prospero homeobox 1 (PROX1), and Tubulin alpha-1A (TUBA1A).
46. The method of any preceding claim, wherein the multi-zonal liver organoid has hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and / or glutamine metabolic functionality.
47. The method of claim 46, wherein the multi-zonal liver organoid has at least 5, at least 10, or at least 15 of the functionalities.
48. The method of claim 46, wherein the multi-zonal liver organoid has hepatocyte proliferation, hepatocyte differentiation, urea cycle, ammonia removal, glycolysis, bilirubin removal, lipid catabolism, glutamine catabolism and biosynthesis, reactive oxygen species (ROS) catabolism and / or metabolism, oxygen response, xenobiotic metabolism, DNA repair, pigment metabolism, lipogenesis, gluconeogenesis, glutathione, and glutamine metabolic functionality.
49. The method of any one of the preceding claims, wherein the multi-zonal liver organoid is enriched for Notch signaling and / or Wnt signaling.
50. The method of any one of the preceding claims, wherein the multi-zonal liver organoid comprises hepatocytes and additionally comprises one or more additional cell types selected from cholangiocytes, endothelial cells, macrophages, stellate cells, and mesenchyme cells.
51. The method of claim 50, wherein the multi-zonal liver organoid comprises hepatocytes and additionally comprises cholangiocytes, endothelial cells, macrophages, stellate cells, and mesenchyme cells.
52. The method of any one of the preceding claims, wherein the multi-zonal liver organoid comprises two or more cell types selected from pericentral or pericentral-like (Z3 or Z3-like) hepatocytes, periportal or periportal-like (Z1 or Z1-like) hepatocytes, and interzonal or interzonal- like (Z2 or Z2-like) hepatocytes.
53. The method of claim 52, wherein the multi-zonal liver organoid comprises: a) pericentral or pericentral-like (Z3 or Z3-like) hepatocytes, b) periportal or periportal-like (Z1 or Z1-like) hepatocytes, and c) interzonal or interzonal-like (Z2 or Z2-like) hepatocytes.
54. The method of any one of the preceding claims, wherein the multi-zonal liver organoid further comprises hepatoblasts.
55. The method of claim 54, wherein the hepatoblasts are characterized as expressing fetal markers and / or growth mitogenic markers.
56. The method of claim 55, wherein the fetal markers comprise Alpha-Fetoprotein (AFP) and the growth mitogenic markers comprise Insulin-like growth factor 2 (IGF2) and / or mitogen-activated protein kinase 2 (MAP2K2).
57. The method of any one of the preceding claims, wherein the multi-zonal liver organoid is human.
58. The method of any one of the preceding claims, wherein the first HLO and the bilirubin-treated second HLO have been differentiated from pluripotent stem cells, optionally embryonic stem cells and / or induced pluripotent stem cells (iPSCs).
59. The method of any one of the preceding claims, wherein the first HLO and / or the bilirubin- treated second HLO has been made according to a method comprising: a) contacting definitive endoderm cells (DE) with an FGF signaling pathway activator and a Wnt signaling pathway activator for a first period of time; b) contacting the cells of step a) with the FGF signaling pathway activator, the Wnt signaling pathway activator, and a retinoic acid (RA) signaling pathway activator for a second period of time, thereby differentiating the DE to posterior foregut cells; and c) embedding the posterior foregut cells in a basement membrane matrix and culturing the posterior foregut spheroids for a third period of time to differentiate the posterior foregut cells to the first HLO and / or the bilirubin-treated second HLO.
60. A multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes, produced by the method of any of the preceding claims.
61. An artificial multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes.
62. The multi-zonal liver organoid of claim 60 or claim 61, wherein the hepatocytes self-assemble into the artificial multi-zonal liver organoid, optionally wherein there is an observable and / or measurable boundary between two or more types of hepatocytes.
63. The multi-zonal liver organoid of any of claims 60-62, wherein the multi-zonal liver organoid comprises a tubular structure with a single lumen.
64. The multi-zonal liver organoid of any of claims 60-63, wherein the multi-zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
65. The multi-zonal liver organoid of any of claims 60-63, wherein the multi-zonal liver organoid comprises a hepatoblast population and at least two phenotypically distinct interzonal hepatocyte populations.
66. The multi-zonal liver organoid of any of claims 60-65, wherein the multi-zonal liver organoid comprises SERPINA1+ hepatocytes, KRT7+ cholangiocytes, PECAM1+ endothelial cells, LYZ+ macrophages, COL1A1+ stellate cells, and CD44+ mesenchyme.
67. The multi-zonal liver organoid of any of claims 60-66, wherein at least a portion of the multi- zonal liver organoid comprises a functional L-gulonolactone oxidase (GULO)-expressing cell population.
68. The multi-zonal liver organoid of any of claims 60-67, wherein the multi-zonal liver organoid expresses one or more pan hepatocyte markers, one or more basal marker, and one or more apical marker; optionally wherein the one or more pan hepatocyte markers comprise ALB, HNF1A, A1AT, CEBPB, PROX1, HNF4A, and / or TUBA1A; and / or optionally wherein the one or more basal markers comprise CTNNB1; and / or optionally wherein the one or more apical markers comprise ZO-1.
69. The multi-zonal liver organoid of any of claims 60-68, wherein the multi-zonal liver organoid expresses one or more periportal marker, one or more interzonal marker, and one or more pericentral zonal marker; optionally wherein said markers comprise TET1, GLS, GLS2, ALDH1A2, ALDH6A1, GHR, AR, CPS1, OTC, ACSS2, ARG1, GLUL, CYP2E1, and / or HIF1A.
70. The multi-zonal liver organoid of any of claims 60-69, wherein the multi-zonal liver organoid has nitrogen, glucose and lipid metabolic activity; optionally wherein said activity comprises urea cycle activity, glutathione S-transferase activity, and / or glutamine synthesis.
71. A cell composition in the form of a three-dimensional artificial multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes.
72. The cell composition of claim 71, wherein the hepatocytes self-assemble into the three- dimensional artificial multi-zonal liver organoid, optionally wherein there is an observable and / or measurable boundary between two or more types of hepatocytes.
73. The cell composition of claim 71 or 72, wherein the three-dimensional artificial multi-zonal liver organoid comprises a tubular structure with a single lumen.
74. The cell composition of any of claims 71-73, wherein the three-dimensional artificial multi- zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
75. An ex vivo composition comprising a three-dimensional multi-zonal liver organoid, comprising Z1-like (periportal-like) hepatocytes, and Z3-like (pericentral-like) hepatocytes.
76. The ex vivo composition of claim 75, wherein the hepatocytes self-assemble into the three- dimensional artificial multi-zonal liver organoid, optionally wherein there is an observable and / or measurable boundary between two or more types of hepatocytes.
77. The ex vivo composition of claim 75 or 76, wherein the three-dimensional artificial multi-zonal liver organoid comprises a tubular structure with a single lumen.
78. The ex vivo composition of any of claims 75-77, wherein the three-dimensional artificial multi- zonal liver organoid does not contain hematopoietic tissue and / or acquired immune cells.
79. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-78, further comprising Z2-like (interzonal-like, mid- lobular-like) hepatocytes.
80. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-79, further comprising hepatoblasts.
81. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-80, further comprising cholangiocytes, endothelial cells, macrophages, stellate cells, and / or mesenchyme cells.
82. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-81, wherein the Z1-like hepatocytes and / or Z3-like hepatocytes are differentiated from pluripotent stem cells, preferably iPSCs.
83. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-82, further comprising ascorbate (vitamin C), and exogenously provided bilirubin.
84. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-83, wherein the Z1-like hepatocytes are engineered to express a heterologous functional GULO protein, and ascorbate is produced by the Z1-like hepatocytes.
85. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-84, wherein the composition comprises exogenously provided bilirubin at a concentration of about 0.1 mg / L, 0.2 mg / L, 0.3 mg / L, 0.4 mg / L, 0.5 mg / L, 0.6 mg / L, 0.7 mg / L, 0.8 mg / L, 0.9 mg / L, 1 mg / L, 1.1 mg / L, 1.2 mg / L, 1.3 mg / L, 1.4 mg / L, 1.5 mg / L, 1.6 mg / L, 1.7 mg / L, 1.8 mg / L, 1.9 mg / L, 2 mg / L, 2.1 mg / L, 2.2 mg / L, 2.3 mg / L, 2.4 mg / L, 2.5 mg / L, 2.6 mg / L, 2.7 mg / L, 2.8 mg / L, 2.9 mg / L, or 3 mg / L; preferably at about 1 mg / L.
86. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-85, comprising about 20-40% Z3-like (pericentral- like) cells, about 20-40% Z1-like (periportal-like) cells, about 20-40% hepatoblasts, and about 10- 30% Z2-like (interzonal-like) cells.
87. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-86, comprising greater than or equal to 10% Z2-like cells, and / or greater than or equal to 20% hepatoblasts.
88. The multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition of any one of claims 60-87, comprising less than or equal to 15% cholangiocytes.
89. A method of treating a liver-related disease or disorder, the method comprising: transplanting, into a subject having liver dysfunction and / or failure, a multi-zonal liver organoid. according to any one of claims 60-88.
90. The method of claim 89, wherein the multi-zonal liver organoid is according to any one of claims 60-88.
91. The method of claim 89 or 90, wherein the transplanting comprises: a) ligating a bile duct in a subject; and b) transplanting the multi-zonal liver organoid at a base of a liver in the subject.
92. The method of any one of claims 89-91, wherein the liver-related disease or disorder comprises one or more types of liver dysfunction and / or failure, hepatitis, viral hepatitis, cholangitis, fibrosis, hepatic encephalopathy, hepatic porphyria, cirrhosis, cancer, drug-induced cholestasis, metabolic disease, autoimmune liver disease, Wilson’s disease, metabolic-associated fatty liver disease, hyperammonemia, hyperbilirubinemia, Crigler-Najjar Syndrome, urea cycle disorders, Wolman disease, hepatic cancer, hepatoblastoma, metabolic dysfunction–associated liver disease (MASLD), MetALD, metabolic dysfunction-associated steatohepatitis (MASH), drug-induced liver injury (DILI), glycogen storage disease, hemorrhagic disease, hepatic cyst, and / or alcohol- associated liver disease.
93. The method of claim 92, wherein the liver dysfunction and / or failure comprises hyperammonemia and / or hyperbilirubinemia.
94. The method of claim 92, wherein the metabolic disease comprises nonalcoholic fatty liver disease (NAFLD).
95. The method of claim 92, wherein the nonalcoholic fatty liver disease (NAFLD) comprises metabolic dysfunction-associated steatohepatitis (MASH).
96. The method of claim 92, wherein the hepatitis comprises hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, hepatitis TT, and / or autoimmune hepatitis.
97. The method of any one of claims 92-96, wherein the subject has improvements one or more of the liver-related disease or disorders following transplantation.
98. The method of any one of claims 92-97, wherein the subject has improvements in hyperammonemia and hyperbilirubinemia.
99. The method of any of claims 92-98, wherein the subject has reduced serum bilirubin and / or ammonia levels, and / or increased serum protein albumin following transplantation.
100. The method of claim 99, wherein the subject has reduced serum bilirubin and ammonia levels following transplantation.
101. The method of claim 100, wherein the subject has reduced serum bilirubin and ammonia levels, and increased serum protein albumin following transplantation.
102. The method of any of claims 91-101, wherein the subject has improved symptoms of biliary stricture and / or liver regeneration following transplantation.
103. The method of any of claims 91-102, wherein the subject has an increased survival rate following transplantation.
104. The method of any of claims 91-103, wherein the transplanted multi-zonal liver organoids engraft onto the liver of the subject.
105. Use of the multi-zonal liver organoid according to any one of claims 60-88, as an in vitro human model system for studying hepatocyte function and developmental divergence; studying liver-related disease; identifying therapeutic targets; and / or identifying therapeutic compounds and / or compositions effective in treating a liver-related disease or disorder.
106. Use of the multi-zonal liver organoid according to any one of claims 60-88, for treating a liver-related disease or disorder.
107. The multi-zonal liver organoid according to any one of claims 60-88, for use in the manufacture of a medicament for the treatment of a liver-related disease or disorder.
108. A kit comprising means for performing the method according to any one of claims 1-59 or 89-104.
109. A kit comprising the multi-zonal liver organoid, artificial multi-zonal liver organoid, cell composition, and / or ex vivo composition according to any one of claims 60-88.
Citation Information
Patent Citations
PROCEDURE FOR THE PREPARATION OF 6-CYCLOPROPYL1,3-DIHYDRO-1-METHYL-5-PHENYL-2-OXO-2H-THIENO(2,3-E) DIAZEPIN
DK197801354A
Redundancy systems for small fly-by-wire vehicles
US20220033066A1
Catcher device for condiment mill
US5709346A
Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
WO2013176772A1
Crispr-CAS component systems, methods and compositions for sequence manipulation
WO2014093595A1