Single-cell transcriptome and proteome co-analysis method based on double microspheres

Through the double-microsphere capture-release-capture technology, high-throughput and high-sensitivity analysis of single-cell transcriptomes and proteomes was achieved, which solved the problems of limited detection sensitivity and experimental complexity in existing methods, simplified experimental operations, and studied the interaction effects between cells.

WO2025213299A1PCT designated stage Publication Date: 2025-10-16GUANGZHOU NAT LAB
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/086424
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-04-07
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Existing single-cell transcriptome and proteome analysis methods are unable to simultaneously detect the relationship between intracellular RNA and proteins with high throughput and high sensitivity. The experimental process is cumbersome and relies on the detection of cell membrane proteins or secretory proteins, which has limited sensitivity.

Method used

A dual-microsphere capture-release-capture method is used to capture nucleic acid and protein information through the first particle, and nucleic acid amplification is performed on the second particle to achieve simultaneous capture and sequencing of single-cell transcriptomes and proteomes, simplifying experimental operations.

Benefits of technology

It achieves high-throughput and high-sensitivity analysis of single-cell transcriptomes and proteomes, simplifies the experimental process, reduces costs, and enables the study of interaction effects between cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024086424_16102025_PF_FP_ABST
    Figure CN2024086424_16102025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to a single-cell transcriptome and proteome co-analysis method based on double microspheres. The present disclosure provides a single-cell transcriptome and proteome co-analysis method, comprising: providing, in a single compartment in a separated manner, first particles comprising capture reagents, a single cell from a sample, and a protein detection reagent with a label, wherein the capture reagents include a nucleic acid capture reagent and a protein capture reagent that can respectively directly or indirectly capture a nucleic acid and a protein from the single cell; enabling the nucleic acid and the protein from the single cell to be in contact with the first particles and the protein detection reagent; and enabling the first particles to capture protein information by means of the protein capture reagent and the protein detection reagent, and to capture nucleic acid information by means of the nucleic acid capture reagent. The present disclosure can acquire a secreted protein from a single cell and transcriptome information of the single cell, and also can co-capture a single-cell intracellular protein and the transcriptome information.
Need to check novelty before this filing date? Find Prior Art

Description

Dual microsphere-based single-cell transcriptome and proteome co-analysis method TECHNICAL FIELD

[0001] The present disclosure relates to the field of single-cell analysis. In particular, the present disclosure relates to the field of single-cell transcriptome and proteome analysis. BACKGROUND

[0002] In life science research, understanding the transcriptome and proteome information of individual cells is crucial for revealing cell function and regulatory mechanisms. Traditional transcriptomic and proteomic methods often rely on population average data, which cannot provide information at the single-cell level. However, the heterogeneity and individual differences between different cells are essential for understanding the complexity of biological processes.

[0003] In recent years, the rapid development of single-cell analysis technology has provided researchers with a breakthrough opportunity to conduct comprehensive transcriptome and proteome assays on individual cells. Single-cell transcriptomic methods are mainly based on RNA sequencing technology, which can simultaneously determine the expression levels of thousands of genes in a single cell, but often only provide transcriptome information and cannot directly measure protein abundance. At the same time, proteins are the main executors that determine cell function and signal transduction. Therefore, single-cell analysis of proteomics has become increasingly important. Currently, some proteomic techniques have been applied to single-cell level research, such as mass spectrometry and immunofluorescence staining. However, these methods often require complex sample processing and instrument equipment, limiting their application in large-scale single-cell analysis. Therefore, a high-throughput, high-sensitivity method that can simultaneously detect transcriptome and proteome is needed to achieve comprehensive analysis of individual cells. Such a method will enable researchers to better understand the interrelationship between RNA and protein within cells and reveal the complexity of cell regulatory networks.

[0004] Unlike nucleic acid detection, proteins cannot be amplified in abundance through amplification, so enzymes or other molecules are needed to amplify the signal. Currently, single-cell transcriptomics uses poly T sequences on coded microspheres to capture mRNA released after cell lysis. To achieve co-analysis of transcriptome and proteome at the single-cell level, the mainstream method is to convert protein detection into nucleic acid detection. This method can increase the sensitivity of protein detection on the one hand, and capture nucleic acid molecules with protein information together with mRNA by coded microspheres, thereby achieving single-cell level transcriptome and proteome analysis. The emergence of antibody-oligonucleotide conjugates (AOC) has promoted the progress of this information conversion.

[0005] Prior art such as CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by sequencing) 1,2 uses antibodies labeled with nucleic acids to target cell membrane surface proteins. After the antibodies are sufficiently bound to the membrane proteins, the excess antibodies are washed away, and the cells and encoding microspheres are encapsulated in droplets with the help of the 10x Genomic system to obtain transcriptome information and proteome information. A similar method is TRAPS-seq (Time-Resolved Assessment of Protein Secretion from single cells by sequencing) 3 , which labels capture antibodies on the cell surface to capture secreted proteins from cells. Then antibodies with nucleic acid modifications are added to give secreted proteins identity information. After the cells are wrapped with encoding microspheres, the transcriptome information and secreted protein information in each cell will be captured by the encoding microspheres. The idea of these technologies to achieve co-analysis of transcriptome and proteome is to bind protein information to the cell surface. However, these methods have the following limitations: 1) only membrane protein information or secreted protein species can be detected, and the detection sensitivity is limited by the number and types of membrane proteins; 2) the experimental process is complicated, and it is necessary to incubate cells with antibodies first. SEC-seq (secretion-encoded single-cell sequencing) 4 encapsulates cells into hydrogel nanoparticles, so that the cells adhere to the cavity wall of the nanoparticles. When the cells secrete proteins, the modified capture antibodies on the cavity wall can capture them. Subsequently, the nanoparticles are separated and combined with 10x gel beads to enrich the transcriptome and proteome information of individual cells. Although SEC-seq eliminates the dependence on cell membrane proteins, the complexity of the experiment does not decrease.

[0006] References:

[0007] 1. Stoeckius, M.; Hafemeister, C.; Stephenson, W.; Houck-Loomis, B.; Chattopadhyay, P. K.; Swerdlow, H.; Satija, R.; Smibert, P., Simultaneous epitope and transcriptome measurement in single cells. Nat. Methods 2017, 14 (9), 865-868.

[0008] 2. Peterson, V. M.; Zhang, K. X.; Kumar, N.; Wong, J.; Li, L.; Wilson, D. C.; Moore, R.; McClanahan, T. K.; Sadekova, S.; Klappenbach, J. A., Multiplexed quantification of proteins and transcripts in single cells. Nat. Biotechnol. 2017, 35 (10), 936-939.

[0009] 3. Wu, T.; Womersley, H. J.; Wang, J. R.; Scolnick, J.; Cheow, L. F., Time-resolved assessment of single-cell protein secretion by sequencing. Nat. Methods 2023, 20 (5), 723-734.

[0010] 4. Udani, S.; Langerman, J.; Koo, D.; Baghdasarian, S.; Cheng, B.; Kang, S.; Soemardy, C.; de Rutte, J.; Plath, K.; Di Carlo, D., Associating growth factor secretions and transcriptomes of single cells in nanovials using SEC-seq. Nature nanotechnology 2023.

[0011] SUMMARY

[0012] In some non-limiting embodiments, the present disclosure relates to a double microsphere capture-release-capture based single cell transcriptome and proteome co-analysis technique, which does not rely on cell membrane surface proteins for proteome information, nor requires co-incubation of cells with antibodies or other carriers. Single cell secreted proteins, transcriptome information can be obtained, and co-capture of single cell intracellular proteins and transcriptome information can also be achieved.

[0013] In some embodiments, the present disclosure encompasses one or more of the following.

[0014] 1. A single cell transcriptome and proteome co-analysis method, comprising:

[0015] contacting nucleic acids and proteins from a single cell with the first particle and the protein detection reagent to allow the first particle to capture the protein information by the protein capture reagent and the protein detection reagent, and to capture nucleic acid information by the nucleic acid capture reagent.

[0016] contacting nucleic acids and proteins from a single cell with the first particle and the protein detection reagent to allow the first particle to capture the protein information by the protein capture reagent and the protein detection reagent, and to capture nucleic acid information by the nucleic acid capture reagent.

[0017] 2. The method of item 1, further comprising:

[0018] contacting the first particle, which has captured the protein information and the nucleic acid information, with a second particle in a single compartment, wherein the second particle comprises a universal sequence, and a nucleic acid amplification reaction is performed by the universal sequence, so that the second particle captures the nucleic acid and protein information from the single cell.

[0019] 3. The method of item 1 or 2, wherein 1) the particle comprises a microsphere, 2) the compartment comprises a droplet, 3) the nucleic acid comprises mRNA, 4) the nucleic acid capture reagent comprises a universal sequence and poly T, and optionally a unique molecular identifier UMI, 5) the protein capture reagent and / or the protein detection reagent comprises an antibody, and / or 6) the tag comprises an oligonucleotide tag comprising a PCR-handle, a barcode capable of recognizing the antibody from a single cell, a universal sequence, and optionally a unique molecular identifier UMI.

[0020] 4. The method of item 2, wherein the second particle comprises a universal sequence, a PCR handle sequence, and a barcode.

[0021] 5. The method of any one of items 1-4, wherein the protein is a cell secreted protein, the method comprising: after capturing the secreted protein, adding a cell lysis solution to the compartment to allow the first particle to capture the protein and nucleic acid information.

[0022] 6. The method of any one of items 1-4, comprising: partitioning a cell lysis solution with the first particle and the protein detection reagent in a single compartment, contacting nucleic acids and proteins from a single cell with the first particle and the protein detection reagent by lysing the cell, and optionally further comprising a step of incubation after lysing the cell.

[0023] 7. The method of any one of items 1-6, comprising: partitioning a reverse transcription reagent with the first particle and the protein detection reagent in a single compartment, and obtaining cDNA by reverse transcription.

[0024] 8. The method of any one of items 2-7, comprising: partitioning the random primers with the first and second particles in a single compartment, extending nucleic acid fragments with universal sequences and optional UMI information from the random primers.

[0025] 9. The method of any one of items 2-8, comprising the step of releasing nucleic acid information from the protein capture reagent and the protein detection reagent by reagent or light cleavage.

[0026] 10. The method of any one of items 2-9, further comprising correlating the nucleic acid and protein information from the single cell captured by the second particle to the same cell.

[0027] 11. The method of any one of items 1-10, further comprising the steps of library construction and sequencing analysis.

[0028] 12. A kit for single cell analysis, comprising the particles defined in any one of items 1-11 and the protein detection reagent with label, optionally comprising additional components defined in any one of items 1-11.

[0029] In the methods of the present disclosure, the capture of both single cell transcriptome and proteome information can be done in droplets, which maximally simplifies the experimental operation, and enables the simultaneous capture and sequencing of single cell transcriptome and proteome with low cost, high throughput and high sensitivity. The present disclosure can also be used for cell pairing, to study the interaction effects between cells. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1: Microsphere surface and antibody modification, wherein a represents microsphere 1, b represents microsphere 2, and c represents detection antibody of nucleic acid label.

[0031] Figure 2: First round of wrapping, microsphere capturing protein and mRNA.

[0032] Figure 3: Second round of wrapping, single cell information is transferred from microsphere 1 to microsphere 2.

[0033] Figure 4: Post-modification characterization of microsphere 1 conjugated antibody and nucleic acid, wherein a shows that the modified microsphere 1 can capture poly A probe, and b shows that the modified microsphere 1 can capture protein.

[0034] Figure 5: Post-modification characterization of microsphere 2.

[0035] Figure 6: Antibody-nucleic acid conjugation characterization, wherein a shows that after antibody-nucleic acid conjugation, the absorption peak shifts from 280 nm to 260 nm, and b shows that the non-denaturing SDS-PAGE gel can see the conjugated antibody band shifted upward. DETAILED DESCRIPTION

[0036] The specific embodiments of the present disclosure are described in detail by referring to the following definitions and examples. Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0037] The terms "nucleic acid", "polynucleotide" used herein can be used interchangeably, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Ribonucleic acid (RNA) can include messenger RNA (mRNA) and non-coding RNA. When used for transcriptome analysis, nucleic acid can include the collection of all transcriptional products in a cell in a broad sense, thus can include messenger RNA, ribosomal RNA, transfer RNA and non-coding RNA, and in a narrow sense can refer to the collection of all mRNA.

[0038] The term "particle" used herein can include microparticles capable of directly or indirectly capturing nucleic acid and / or protein of a cell, which can have a diameter of about 0.1 to 100 μm. In some embodiments, the microparticles can include microspheres, such as magnetic microparticles, hydrogel microparticles, agarose microparticles, etc. In some embodiments, the microparticles can comprise (or be coupled to) polynucleotides and / or antibodies as capture reagents.

[0039] The term "nucleic acid and / or protein from a single cell" used herein can include the transcriptome and / or proteome of a single cell.

[0040] The term "capture" used herein can include specific recognition and binding of nucleic acid and / or protein (also including polypeptide) in a cell by nucleic acid capture reagents and protein capture reagents on a particle.

[0041] The term "capture reagent" used herein can include reagents capable of directly or indirectly capturing nucleic acid and / or protein in a single cell, which can be nucleic acid and / or protein with specific recognition ability. For example, nucleic acid capture reagents can include a complementary sequence (such as poly T) that specifically recognizes a target sequence (such as poly A), which can be of any appropriate length as long as it can specifically bind and separate the target sequence. For example, protein capture reagents can be antibodies, such as monoclonal antibodies, that specifically recognize target proteins. In some embodiments, protein capture reagents can be directly linked to particles or linked to particles through appropriate linkers. In some embodiments, nucleic acid capture reagents can bind to mRNA in a single cell, and protein capture reagents can bind to proteins in a single cell. In some embodiments, capture reagents can be linked to additional functional moieties (e.g. functional sequences). For example, nucleic acid capture reagents can be linked to universal sequences (such as adaptors) and / or UMIs; protein capture reagents can be linked to linkers, which in turn are linked to particles.

[0042] In some embodiments, the protein detection reagent can be linked to a tag. The term "tag" as used herein can be any molecular moiety capable of specifically conveying the identity information of the protein detected by the protein detection reagent. In some embodiments, the tag can include an oligonucleotide tag. In some embodiments, the tag such as an oligonucleotide can include one or more of a barcode for antibodies from a single cell (Ab-Barcode), a universal sequence (such as an adaptor), a unique molecular identifier (UMI), a PCR handle sequence.

[0043] The term "compartment" as used herein can include a separate micro-space that encloses a single cell and a particle, which can include, for example, a micro-oil droplet, a microemulsion droplet, and a well of a multi-well plate, and can be formed by a microfluidic device.

[0044] The term "barcode" as used herein can include a nucleic acid molecule of about 2-30 bases, used to provide a unique identification or origin information for a sample such as a cell or a macromolecule such as a protein or a nucleic acid. The barcode can be an artificial sequence or a natural sequence, and there can be multiple barcodes, such as 1, 2, 3, 4, 5, or more.

[0045] The term "molecular specific recognition sequence" as used herein can include a nucleic acid sequence that specifically recognizes a molecule, including, for example, a unique molecular identifier (UMI).

[0046] The term "universal sequence" as used herein can include a common base sequence used in the analysis process, used for sequence amplification or sequencing analysis, etc. As known by those skilled in the art, the universal sequence (such as an adaptor) is capable of connecting the DNA fragment to be tested to the flow cell, and can include the same or complementary fragments P5 / P7 as the oligonucleotide chain on the flow cell, sequencing primer binding portion read 1 / 2, an index sequence for distinguishing different samples, so that the resulting sequencing fragment can include a universal adaptor, an insertion sequence, an index sequence adaptor, etc.

[0047] The term "single-cell transcriptome and proteome co-analysis method" as used herein is used in the broadest sense and can include, for example, any protocol involved in the process of single-cell transcriptome and proteome analysis, and can be used in appropriate combination with any single-cell analysis, transcriptome analysis, proteome analysis, library construction and / or sequencing method known in the art. For example, the single-cell transcriptome and proteome co-analysis method mentioned in the present disclosure can include a single-cell transcriptome and proteome information capture method, a single-cell library front-end adaptor labeling method, a library construction and / or sequencing method, etc., as long as it includes the steps described in the method of the present disclosure.

[0048] In some embodiments, the present disclosure provides a single cell transcriptome and proteome co-analysis method, comprising: partitioning a first particle comprising a capture reagent, a single cell from a sample, and a labeled protein detection reagent in a single compartment, wherein the capture reagent comprises a nucleic acid capture reagent and a protein capture reagent capable of directly or indirectly capturing nucleic acid and protein from the single cell, contacting the nucleic acid and protein from the single cell with the first particle and the protein detection reagent, to allow the first particle to capture the protein information by the protein capture reagent and the protein detection reagent, and capture the nucleic acid information by the nucleic acid capture reagent.

[0049] In some embodiments, the capture reagent, such as the nucleic acid capture reagent and / or the protein capture reagent, can comprise a universal sequence, such as an adaptor. In some embodiments, the nucleic acid capture reagent can comprise a universal sequence and a poly T, and optionally a unique molecular identifier (UMI). In some embodiments, the protein capture reagent and / or the protein detection reagent can comprise an antibody, such as a monoclonal antibody. In some embodiments, the protein detection reagent can be linked to a tag sequence by any protein and nucleic acid linking method known in the art. In some embodiments, the tag can comprise an oligonucleotide tag, which can comprise one or more of a barcode capable of identifying a single cell, a universal sequence (such as an adaptor), a unique molecular identifier (UMI). In some embodiments, the labeled protein detection reagent comprises an antibody and a barcode, a UMI, and a universal sequence linked thereto. In some embodiments, a protein or polypeptide can be labeled with a tag by standard amine coupling chemistry methods. In some embodiments, the tag can comprise a reactive group (e.g., for conjugation to a solid phase surface, a multifunctional linker, or a macromolecule), an adaptor, a universal primer sequence, a barcode, an optional UMI, and a spacer sequence, facilitating information transfer. In some embodiments, a protein can be first labeled with a universal DNA tag, and a barcode is subsequently linked to the protein by an enzymatic or chemical coupling step. The universal DNA tag can comprise a short nucleotide sequence for labeling a protein, and can serve as an attachment point for a barcode. In some embodiments, the universal DNA tag can be a universal primer sequence. Upon hybridization of the universal DNA tag on a labeled protein to a complementary sequence, the annealed universal DNA tag can be amplified by primer extension, transferring the tag information to the DNA-labeled protein.

[0050] In some embodiments, the analysis method of the present disclosure can further comprise partitioning the first particle capturing the protein information and the nucleic acid information with a second particle in a single compartment, wherein the second particle comprises a universal sequence, performing a nucleic acid amplification reaction by the universal sequence, such that the second particle captures the nucleic acid and protein information from the single cell.

[0051] In some embodiments, the second particle can comprise a PCR handle sequence (a consensus sequence used as a starting position for PCR and sequencing), a barcode, and an universal sequence (adatpor).

[0052] In some embodiments, when the protein is a cell secreted protein, the method of the present disclosure can comprise adding a cell lysis solution to the compartment after capturing the secreted protein, to allow the first particle to capture both protein and nucleic acid information.

[0053] In some embodiments, the analysis method of the present disclosure can comprise partitioning a cell lysis solution with the first particle and a protein detection reagent in a single compartment, contacting nucleic acid and protein from a single cell with the first particle and the protein detection reagent by lysing the cell, optionally further comprising a step of incubation after lysing the cell.

[0054] In some embodiments, the analysis method of the present disclosure can comprise partitioning a reverse transcription reagent with the first particle and the protein detection reagent in a single compartment, obtaining cDNA by reverse transcription.

[0055] In some embodiments, the analysis method of the present disclosure can comprise partitioning a random primer with the first particle and the second particle in a single compartment, extending a nucleic acid fragment with universal sequence and optional UMI information by the random primer.

[0056] In some embodiments, the analysis method of the present disclosure can comprise a step of releasing nucleic acid information from the protein capture reagent and the protein detection reagent by reagents or light cleavage.

[0057] In some embodiments, the analysis method of the present disclosure can comprise correlating the nucleic acid and protein information from the single cell captured by the second particle to the same cell.

[0058] In some embodiments, the analysis method of the present disclosure can comprise a library construction and sequencing analysis step.

[0059] In some embodiments, the present disclosure provides a kit for single cell analysis, which can comprise one or more components suitable for carrying out the methods of the present disclosure, such as the first and / or second particles, buffers, PCR reagents, etc. In some embodiments, the kits of the present disclosure can include, for example, the first particles and the labeled protein detection reagents. In some embodiments, the kits can further include the second particles. In some embodiments, the kits can also optionally further include any one or more of the following components: a microfluidic chip for generating compartments such as droplets, a cell lysis solution, reverse transcription reagents (which can include reverse transcriptase, etc.), a wash such as PBST, PCR reagents (which can include primers such as random primers and polymerase, etc.), cleavage reagents for releasing nucleic acids from the protein capture reagents and / or protein detection reagents, buffers, library building reagents, and / or sequencing reagents, etc. In some embodiments, the kits can include one or more containers and a label or package insert on or associated with the container(s). In some embodiments, the containers can be made of a variety of materials such as glass or plastic. In some embodiments, the various components in the kits can be contained in different or the same containers.

[0060] In some embodiments, the present disclosure can employ a combined approach of capturing in droplets, with two rounds of microsphere capture to accomplish sequencing of the proteome and transcriptome of single cells. In some embodiments, the two microspheres (microsphere 1, microsphere 2) are surface modified as shown in FIG. 1, the surface of microsphere 1 can be coupled with universal sequence, UMI and poly T sequence and corresponding target protein capture antibody; the surface of microsphere 2 can be coupled with sequence structure including PCR amplification sequence, barcode capable of identifying single cells and a segment of universal sequence. Detection antibody can be coupled with molecular tag and universal sequence, labeling secreted proteins or intracellular proteins of cells. In this way, different secreted proteins carry independent molecular tags, and in subsequent single cell sequencing, the tags are disassembled and analyzed to trace back to the corresponding protein species.

[0061] In some embodiments, the present disclosure can include the following specific schemes:

[0062] First round of encapsulation: Microsphere 1 (containing cell lysis solution, reverse transcription ingredients, etc.) and cell and nucleic acid labeled detection antibodies are encapsulated in droplets by a three-channel microfluidic chip. Then the cells are lysed to release intracellular proteins and mRNA. The droplets are incubated at room temperature for several hours to ensure that the capture antibodies, proteins, and detection antibodies are fully bound. At this stage, microsphere 1 captures both protein information and transcript information (as shown in FIG. 2). Then the droplets are placed in a 42°C environment for reverse transcription, converting mRNA to cDNA. The droplets are broken and microsphere 1 is washed multiple times with PBST to remove free unbound detection antibodies. If you want to detect cell secreted proteins, do not add cell lysis solution and other ingredients when microsphere 1 is paired with cells. After the surface capture antibodies of microsphere 1 fully capture the secreted proteins, add lysis and reverse transcription ingredients to the droplets by microinjection, and microsphere 1 can capture both transcriptome information and secreted protein information.

[0063] Second round of encapsulation: Microsphere 2 is a soft hydrogel sphere. Microsphere 1, microsphere 2, and random primers are encapsulated into droplets using a three-channel chip. Due to the superior material of microsphere 2, they can be densely arranged, so that each droplet contains microsphere 2. This ensures that all information in microsphere 1 can be transferred to microsphere 2, thereby reducing the loss rate of information transfer. After the droplets are generated, the random primers target the cDNA on microsphere 1 and extend nucleic acid fragments with universal sequences and UMI information. Through reagent or light cutting, the "identity code" on the antibody is released. After incubation for a period of time, microsphere 2 acquires both mRNA and protein information on its surface. With the barcode modified on microsphere 2, mRNA and protein information can be associated with the same cell (as shown in FIG. 3).

[0064] In some embodiments, further library construction and sequencing can be performed on the basis of the above steps, i.e., co-analysis of single cell transcriptome and proteome can be achieved.

[0065] For further illustration, the methods and products of the present disclosure are described in detail in conjunction with the following examples, but they should not be construed as limiting the scope of protection of the present invention.

[0066] Example 1

[0067] Reagents and instrument sources used in Example 1: Microspheres 1 were purchased from Spherotech, streptavidin magnetic microspheres, catalog number MP16S08; antigen, antibody pair were purchased from Fupeng Biological, catalog numbers PCT-Ag1, PCT-REAB-G1-010, PCT-REAB-G1-027 respectively; PCR instrument for nucleic acid amplification was Thermo Fisher QuanStudio3, amplification program was 95°C for 2 min, (95°C for 15 s-60°C for 60 s) for 10 cycles; PBS in PBST cleaning solution was purchased from Shengong Biological, catalog number E607008-0500, Tween 20 was purchased from Sigma-Aldrich, catalog number 655206; nucleic acid sequence was synthesized from Shengong Biological, nucleic acid capture sequence was 5’CTACATGCCGAACAAACAAGNNNNNNNNNNTTTTTTTTTTTTTTTTTTTV (SEQ ID NO: 1), detection antibody modified nucleic acid sequence was 5’ATGGCTACGATCCGACTATAGGGATATGGCTCTACACGACGCTCTTCCGATCTGGCTTGTTTGTTCGGCATGTAG (SEQ ID NO: 2), wherein N represents any one of the four bases A, T, C, G, and V represents any one of the three bases A, C, G;

[0068] Microspheres 1 were coupled with antibodies and nucleic acids, and the steps were as follows:

[0069] 1) The naked microspheres 1 were equilibrated at room temperature, and the microsphere surface modification group could be amino, carboxyl, biotin, streptavidin or others.

[0070] 2) Taking streptavidin magnetic beads as an example, according to the number of magnetic bead surface groups, biotinylated antibodies and nucleic acid sequences were added to the reaction system at a molar ratio of 1:1. Incubate at room temperature for 2 hours to ensure that the magnetic beads are fully modified.

[0071] 3) A nucleic acid sequence containing poly A (5’ end modified with a fluorescent group) was used to simulate the capture of mRNA by microspheres 1, and naked microspheres without modification were used as controls. As shown in Figure 4a, the modified microspheres 1 can capture the poly A probe.

[0072] 4) The corresponding antigen standard was used to simulate the capture of intracellular proteins released after cell lysis by microspheres 1. Microspheres 1, antigens, and nucleic acid modified detection antibodies were incubated at 37°C for several hours, and then the free detection antibodies were washed away and subjected to PCR amplification. As shown in Figure 4b, the NTC group without added antigen did not peak, while the group with added antigen peaked at eight cycles. This proves that the modified microspheres 1 can capture proteins.

[0073] Example 2

[0074] Reagent sources used in Example 2: Acrylamide solution, Acrylamide / Bis-acrylamide solution, Coagulant TEMED (used for photocuring), Initiator APS (used for thermal curing) were all purchased from Sigma-Aldrich, with item numbers A4058-100mL, A9926-100mL, T7024-50L, A9164 respectively; Acrylamide-modified PCR handle, Barcode1, Barcode2-Universal sequence were synthesized from Sangon Biotech (Shanghai) Co., Ltd., with the sequence of PCR handle being 5'-Acrylamide TTTTTCGAACGACATGGCTACGATCCGACTTTCT (SEQ ID NO: 3), the sequence of Barcode1 being 5'-Phos GCGNNNNNNNNNNCCT (SEQ ID NO: 4), and the sequence of Barcode2-Universal sequence being 5'-Phos TCCNNNNNNNNNNCGATGCTACATGCCGAACAAACAAG (SEQ ID NO: 5), wherein N represents any one of the four bases A, T, C, and G.

[0075] Microsphere 2 encoding, the steps are as follows:

[0076] 1) Select a suitable hydrogel material to prepare microsphere 2, such as gelatin, acrylamide, sodium alginate, etc.

[0077] 2) Taking acrylamide as an example, mix the acrylamide-modified PCR handle, acrylamide solution, acrylamide / bis-acrylamide solution, catalyst, and initiator, and prepare droplets with a size of about 40 um through a microfluidic chip. After thermal curing or photocuring, the oil phase is washed away, and the hydrogel ball is inflated to about 50 um.

[0078] 3) Using the split and pool method, Barcode1, Barcode2, and universal sequence are respectively connected to the hydrogel ball.

[0079] 4) Use the universal sequence probe modified with a fluorescent group to target microsphere 2, simulate the capture of microsphere 2 after the information release of microsphere 1. As shown in Figure 5, it can be proved that the capture sequence is modified on microsphere 2 and can normally capture nucleic acid fragments.

[0080] Example 3

[0081] Reagent source used in Example 3: N3-peg-NHS was purchased from Thermo, Cat# 26130; DBCO modified nucleic acid was synthesized from GenScript, sequence was 5’ ATGGCTACGATCCGACTATAGGGATATGGCTCTACACGACGCTCTTCCGATCTGGCTTGTTTGTTCGGCATGTAG (SEQ ID NO: 6);

[0082] Detection of antibody coding, steps as follows:

[0083] 1) Antibody and nucleic acid coupling, direct or indirect method can be selected. Direct method such as using 2-mercaptoethylamine hydrochloride to reduce the sulfhydryl group on the antibody, and then reacting with maleimide modified nucleic acid sequence; indirect method such as using N3-peg-NHS bifunctional crosslinking agent to couple amino group on the antibody and DBCO modified on the nucleic acid sequence respectively.

[0084] 2) Take the indirect method as an example: dilute the antibody with PBS solution at pH = 7.4, mix according to the molar ratio of antibody: crosslinking agent = 1:20, and ensure the final concentration of antibody is 1 mg / mL. Incubate at 37°C for 2 hours with shaking, then use 50kD ultrafiltration tube to remove unreacted crosslinking agent.

[0085] 3) Mix according to the molar ratio of antibody: nucleic acid = 1:4, and the final concentration of antibody is 1 mg / mL. Incubate at 37°C for 5 hours with shaking or at 4°C overnight, and use 50kD ultrafiltration tube to remove free nucleic acid.

[0086] 4) As shown in Figure 6, after antibody-nucleic acid coupling, the absorption peak shifts from 280 nm to 260 nm. And the non-denaturing SDS-PAGE gel can see that the antibody band after coupling is shifted upward.

Claims

1. A method for co-analyzing a single-cell transcriptome and proteome, comprising: Separating first particles containing capture reagents, single cells from a sample, and labeled protein detection reagents into a single compartment, wherein the capture reagents include nucleic acid capture reagents capable of directly or indirectly capturing nucleic acids from the single cells and protein capture reagents from the single cells, Nucleic acids and proteins from a single cell are contacted with a first particle and a protein detection reagent, such that the first particle captures the protein information via the protein capture reagent and the protein detection reagent, and captures the nucleic acid information via the nucleic acid capture reagent.

2. The method of claim 1, further comprising: The first particle that captures protein information and nucleic acid information is separated from the second particle in a single compartment, wherein the second particle contains a universal sequence, and a nucleic acid amplification reaction is performed through the universal sequence, so that the second particle captures the nucleic acid and protein information from the single cell.

3. The method of claim 1 or 2, wherein 1) the particle comprises a microsphere, 2) the compartment comprises a droplet, 3) the nucleic acid comprises mRNA, 4) the nucleic acid capture reagent comprises a universal sequence and poly T, and optionally a unique molecular identifier (UMI), 5) the protein capture reagent and / or the protein detection reagent comprises an antibody, and / or 6) the tag comprises an oligonucleotide tag, wherein the oligonucleotide comprises a PCR handle, a barcode capable of identifying antibodies from a single cell, a universal sequence, and optionally a unique molecular identifier (UMI).

4. The method of claim 2, wherein the second particle comprises a universal sequence, a PCR handle sequence, and a barcode.

5. The method according to any one of claims 1 to 4, wherein the protein is a cell secretory protein, the method comprising: After capturing the secreted protein, cell lysate is added to the compartment to allow the first particles to capture protein and nucleic acid information.

6. The method according to any one of claims 1 to 4, comprising: The cell lysate, the first particles and the protein detection reagent are partitioned into individual compartments, and nucleic acids and proteins from individual cells are contacted with the first particles and the protein detection reagent by lysing the cells, optionally further comprising an incubation step after lysing the cells.

7. The method according to any one of claims 1 to 6, comprising: The reverse transcription reagent is partitioned with the first particle and the protein detection reagent in a single compartment, and cDNA is obtained by reverse transcription.

8. The method according to any one of claims 2 to 7, comprising: Random primers are separated from the first and second particles in a single compartment, and nucleic acid fragments with universal sequences and optional UMI information are extended by the random primers.

9. The method of any one of claims 2 to 8, comprising the step of releasing nucleic acid messages from the protein capture reagent and the protein detection reagent by reagents or photocleavage.

10. The method of any one of claims 2 to 9, further comprising associating the nucleic acid and protein information from the single cell captured by the second particle to the same cell.

11. The method according to any one of claims 1 to 10, further comprising the steps of constructing a library and sequencing analysis.

12. A kit for single cell analysis, comprising the particle defined in any one of claims 1 to 11 and a labeled protein detection reagent, and optionally comprising additional components defined in any one of claims 1 to 11.

Citation Information

Patent Citations

  • Method for high-throughput analysis of single cell inclusions by using paired micro-fluidic chip

    CN107012220A

  • High-throughput single-cell proteome analysis and transcriptome combined analysis method

    CN113588963A

  • Microporous chip and single cell analysis method

    CN117019248A

  • Single-cell multi-omics analysis method based on magnetic microsphere separation and application of single-cell multi-omics analysis method

    CN117344001A

  • Single cell map analysis based on nucleic acid aptamer sequencing

    CN117552114A