Efficient heterologous expression of nicotinamide ribokinase mutant in escherichia coli and use thereof

By mutating amino acids and optimizing recombinant plasmids, the enzyme activity of nicotinamide ribokinase in Escherichia coli was improved, solving the problem of low heterologous expression of nicotinamide ribokinase and realizing the efficient biosynthesis and industrial application of β-nicotinamide mononucleotide.

WO2025213622A1PCT designated stage Publication Date: 2025-10-16SERAGON BIOSCIENCES INC +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107280
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-07
Filing Date
2024-07-24
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

In the prior art, the heterologous expression of nicotinamide ribokinase in Escherichia coli has low enzyme activity, which makes it difficult to meet the requirements for efficient biosynthesis of β-nicotinamide mononucleotide.

Method used

By mutating amino acids and optimizing the design of recombinant plasmids for nicotinamide ribokinase, ribosome binding sites and specific promoter sequences were introduced to improve the expression efficiency and activity of the enzyme.

Benefits of technology

It significantly enhanced the enzyme activity of nicotinamide ribokinase, reaching a maximum of 208.3 U/mL, supporting the efficient biosynthesis and industrial production of β-nicotinamide mononucleotide.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024107280_16102025_PF_FP_ABST
    Figure CN2024107280_16102025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are efficient heterologous expression of a nicotinamide ribokinase mutant in Escherichia coli and a use thereof. Provided are nicotinamide ribokinase capable of being heterologously expressed in Escherichia coli and a mutant thereof. The activity of the nicotinamide ribokinase of the mutant is significantly improved as compared with that of a parent. On the basis of the nicotinamide ribokinase and the mutant thereof, further provided is a method for the efficient heterologous expression of the nicotinamide ribokinase, that is, during the construction of a recombinant plasmid, by introducing a ribosome binding site into the plasmid, inserting a specific promoter sequence, etc., the enzyme activity of the expressed nicotinamide ribokinase is made higher than that of a control. In addition, further provided is a method for culturing a recombinant bacterium expressing the nicotinamide ribokinase, such that the highest enzyme activity of the expressed nicotinamide ribokinase is 208.3 U / mL. The present invention is conducive to efficient biosynthesis of β-nicotinamide mononucleotide and is suitable for industrial production and use.
Need to check novelty before this filing date? Find Prior Art

Description

High-efficiency heterologous expression of a nicotinamide riboside kinase mutant in escherichia coli and application thereof TECHNICAL FIELD

[0001] The present application belongs to the technical field of enzyme engineering. More specifically, it relates to high-efficiency heterologous expression of a nicotinamide riboside kinase mutant in Escherichia coli and application thereof. BACKGROUND

[0002] β-nicotinamide mononucleotide (β-NMN) is a bioactive nucleotide widely present in humans and animals. As a direct precursor of nicotinamide adenine dinucleotide (NAD + ), β-NMN has a significant effect on increasing the level of NAD + in the body, and has important applications in preventing and improving symptoms related to aging and chronic diseases, and can be developed as a dietary supplement or skin care product, etc. However, the current production of β-NMN cannot meet the growing demand.

[0003] Before 2010, β-NMN was mainly produced in large quantities by chemical synthesis using adenosine monophosphate (AMP), tetraacetyl ribose (TAR) and nicotinamide (NAM) as raw materials. However, due to the increase in the use of organic solvents, environmental pollution and purification problems, this method was eventually discontinued. Combining biological catalysis and microbial metabolic engineering to biosynthesize β-NMN has the advantages of being green and environmentally friendly. With the analysis of the metabolic pathway of β-NMN and the development of metabolic and enzyme engineering technology, biological catalysis has become the main method for large-scale production of β-NMN.

[0004] The synthesis of NMN by metabolic engineering of Escherichia coli is usually carried out using nicotinamide (NAM) and the intermediate of the pentose phosphate pathway, ribose phosphate pyrophosphate (PRPP), as substrates, which are catalyzed by phosphoribosyltransferase (Nampt, EC 2.4.2.12) to generate NMN. However, it is difficult to achieve high-level accumulation of PRPP in cells using glucose and xylose as raw materials, which ultimately leads to unsatisfactory NMN production. Another method for biosynthesis of NMN is to use nicotinamide ribose (NR) and ATP as substrates, which are catalyzed by nicotinamide riboside kinase (Nrk) to generate β-NMN. However, the existing Nrk has generally low enzyme activity after heterologous expression in host bacteria such as Escherichia coli, and the nicotinamide riboside kinase enzyme activity in the fermentation broth obtained by high-density fermentation process is only about 100 U / mL, which still cannot meet the needs of efficient enzymatic synthesis of β-NMN.

[0005] SUMMARY

[0006] The present application aims at the problems existing in the prior art, and provides a nicotinamide riboside kinase capable of being expressed in Escherichia coli, and also provides a mutant of the nicotinamide riboside kinase with relatively improved enzyme activity compared with the parent, and a method and application for efficiently heterologously expressing the nicotinamide riboside kinase, which are beneficial to the efficient biosynthesis of beta-nicotinamide mononucleotide.

[0007] A first object of the present application is to provide a nicotinamide riboside kinase.

[0008] A second object of the present application is to provide a gene encoding the nicotinamide riboside kinase.

[0009] A third object of the present application is to provide a mutant of the nicotinamide riboside kinase.

[0010] A fourth object of the present application is to provide a gene encoding the mutant.

[0011] A fifth object of the present application is to provide a recombinant plasmid for expressing the nicotinamide riboside kinase.

[0012] A sixth object of the present application is to provide a recombinant bacterium containing the recombinant plasmid.

[0013] A seventh object of the present application is to provide a method for improving the enzyme activity of the nicotinamide riboside kinase.

[0014] An eighth object of the present application is to provide a method for efficiently heterologously expressing the nicotinamide riboside kinase.

[0015] A ninth object of the present application is to provide the use of the nicotinamide riboside kinase, the gene, the mutant, the recombinant plasmid or the recombinant bacterium in the biosynthesis of beta-nicotinamide mononucleotide or in the preparation of a product for biosynthesizing beta-nicotinamide mononucleotide.

[0016] A tenth object of the present application is to provide a method for biosynthesizing beta-nicotinamide mononucleotide.

[0017] The above objects of the present application are achieved by the following technical solutions.

[0018] The present application provides a nicotinamide riboside kinase, which can be expressed in Escherichia coli, and the amino acid sequence of the nicotinamide riboside kinase is shown in SEQ ID NO. 2.

[0019] The present application also provides a gene encoding the nicotinamide riboside kinase.

[0020] As one of the optional embodiments, the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0021] The present application also provides a recombinant plasmid for expressing the nicotinamide riboside kinase, wherein the vector used for constructing the recombinant plasmid is pET-28a, pET-32a, pRSFDuet-1 or pET-3b.

[0022] Preferably, the vector used for constructing the recombinant plasmid is pRSFDuet-1, and the recombinant plasmid constructed by using the vector has relatively higher enzyme activity of the nicotinamide riboside kinase expressed by the host bacteria after being transformed by the recombinant plasmid.

[0023] The present application also provides a mutant of the nicotinamide riboside kinase, wherein the mutant is obtained by mutating any one or several of the amino acids at positions 45, 88 or 189 of the nicotinamide riboside kinase shown in SEQ ID NO. 2.

[0024] Specifically, the mutation is:

[0025] the aspartic acid (D) at position 45 is mutated into any one of glycine (G), alanine (A), valine (V), proline (P), phenylalanine (F), tyrosine (Y), serine (S), threonine (T), cysteine (C), methionine (M), asparagine (N), glutamine (Q), glutamic acid (E), lysine (K) or arginine (R);

[0026] the isoleucine (I) at position 88 is mutated into any one of glycine (G), alanine (A), valine (V), isoleucine (I), serine (S), threonine (T), cysteine (C), methionine (M), asparagine (N), glutamine (Q), arginine (R) or histidine (H);

[0027] the glutamic acid (E) at position 189 is mutated into any one of glycine (G), alanine (A) or glutamine (Q);

[0028] or the amino acids at positions 45, 88 and 189 are mutated into threonine (T), arginine (R) and alanine (A), respectively.

[0029] As above, the specific amino acid sequences of the mutants are not listed.

[0030] The gene sequence encoding the mutants is also not listed. Based on the known amino acid sequence and the known gene sequence encoding the parent nicotinamide riboside kinase, the gene sequence encoding the mutant can be determined according to the known correspondence between amino acids and codons. In addition to mutating the parent, the corresponding mutant can also be obtained by artificial synthesis and the like according to the sequence of the mutant. Therefore, the present application claims the gene encoding the mutant of the nicotinamide riboside kinase. By using the gene, the corresponding mutant can be obtained by recombinant expression.

[0031] The application further provides a recombinant plasmid for expressing nicotinamide riboside kinase.

[0032] Specifically, the recombinant plasmid contains a gene encoding the nicotinamide riboside kinase or the mutant thereof; or, on the basis of the gene encoding the mutant, a ribosome binding site sequence and / or another promoter sequence are further contained between the original promoter sequence of the recombinant plasmid and the gene; the ribosome binding site sequence is shown in SEQ ID NO. 12 or SEQ ID NO. 13, and the other promoter sequence is shown in SEQ ID NO. 17 or SEQ ID NO. 21.

[0033] Alternatively, the vector used for constructing the recombinant plasmid is pET-28a, pET-32a, pRSFDuet-1 or pET-3b.

[0034] Preferably, the vector used for constructing the recombinant plasmid is pRSFDuet-1.

[0035] The application further provides a recombinant bacterium containing the recombinant plasmid.

[0036] Alternatively, the recombinant bacterium is an Escherichia coli, Bacillus subtilis, Bacillus cereus, Bacillus cereus, Bacillus licheniformis, Bacillus megaterium, Bacillus fragilis, Bacillus clausii, Bacillus alcalophilus, Bacillus thuringiensis, Saccharomyces cerevisiae, Pichia pastoris or Kluyveromyces lactis.

[0037] In a specific embodiment of the application, the Escherichia coli is used as the starting strain.

[0038] The application further provides a method for improving the enzyme activity of nicotinamide riboside kinase, which comprises mutating any one or several of the 45th, 88th or 189th amino acids of the nicotinamide riboside kinase.

[0039] or replacing the gene sequence encoding the nicotinamide riboside kinase with a gene sequence encoding the mutant of the nicotinamide riboside kinase.

[0040] The application also provides a method for efficiently heterologously expressing nicotinamide riboside kinase, which is: when constructing a recombinant plasmid for expressing the nicotinamide riboside kinase or the mutant of the nicotinamide riboside kinase, the recombinant plasmid is modified by inserting a ribosome binding site sequence and / or another promoter sequence between the original promoter sequence and the gene sequence of the recombinant plasmid, wherein the ribosome binding site sequence is shown in SEQ ID NO. 12 or SEQ ID NO. 13, and the other promoter sequence is shown in SEQ ID NO. 17 or SEQ ID NO. 21.

[0041] The application of the ribosome binding site sequence shown in SEQ ID NO. 12 or SEQ ID NO. 13 and / or the promoter sequence shown in SEQ ID NO. 17 or SEQ ID NO. 21 in improving the enzyme activity (or heterologous expression) of the nicotinamide riboside kinase of the application should also be within the protection scope of the application.

[0042] The application also claims the application of the nicotinamide riboside kinase, the gene encoding the nicotinamide riboside kinase, the mutant of the nicotinamide riboside kinase, the gene encoding the mutant of the nicotinamide riboside kinase, the recombinant plasmid or the recombinant bacteria in biosynthesizing β-nicotinamide mononucleotide or in preparing a product for biosynthesizing β-nicotinamide mononucleotide.

[0043] The application also provides a method for biosynthesizing β-nicotinamide mononucleotide, which is: replacing the nicotinamide riboside kinase used for biosynthesizing β-nicotinamide mononucleotide with the mutant of the nicotinamide riboside kinase of the application or replacing the recombinant bacteria expressing the nicotinamide riboside kinase with the recombinant bacteria of the application.

[0044] Specifically, the method is: using the mutant of the nicotinamide riboside kinase or the recombinant bacteria of the application to catalyze the synthesis of β-nicotinamide mononucleotide with nicotinamide ribose (NR) and ATP as substrates.

[0045] As one specific embodiment, the method is: activating the recombinant bacteria of the application to obtain a seed liquid; inoculating the obtained seed liquid into a fermenter, culturing at 35-37℃ until OD 600 When reaching 28-32, the temperature is lowered to 24-26℃, and IPTG is added to a final concentration of 0.4-0.6mM to induce expression for 10-12h, and then fed-batch fermentation is performed; during the fed-batch fermentation, the pH of the culture system is controlled at 6.5-7.5, and the rotation speed of the fermenter is controlled at 350-450rpm; as the bacteria grow continuously, glucose is gradually consumed, and when its concentration is lower than 2g / L, flow feeding is performed to use it to catalyze the substrates to generate β-nicotinamide mononucleotide.

[0046] Specifically, the method is as follows: activating the recombinant bacteria of the application to obtain a seed liquid; inoculating the obtained seed liquid into a fermentation tank medium at a 7.5% (v / v) inoculation amount, and culturing at 37℃ until the OD 600 When the glucose concentration is lower than 2 g / L, flow feeding is performed, and the recombinant bacteria are used to catalyze the substrate to generate β-nicotinamide mononucleotide.

[0047] In addition, when the first batch of substrate is detected to be depleted, a second batch of substrate is added, and so on; when a third batch of substrate is added, the yield of β-nicotinamide mononucleotide is the highest.

[0048] The application has the following beneficial effects:

[0049] The application provides a nicotinamide riboside kinase capable of being heterologously expressed in Escherichia coli, and also provides a mutant of the nicotinamide riboside kinase, and the nicotinamide riboside kinase activity of the mutant is obviously improved compared with the parent. On the basis of the nicotinamide riboside kinase and the mutant thereof, the application also provides a method for efficiently heterologously expressing nicotinamide riboside kinase, that is, when a recombinant plasmid is constructed, a ribosome binding site is introduced into the plasmid, and a specific promoter sequence is inserted, so that the enzyme activity of the expressed nicotinamide riboside kinase is higher than that of a control. In addition, the application also provides a method for expanding culture of the recombinant bacteria expressing the nicotinamide riboside kinase, so that the enzyme activity of the expressed nicotinamide riboside kinase is further improved, and the highest enzyme activity is 208.3 U / mL.

[0050] The application is beneficial to efficient biosynthesis of β-nicotinamide mononucleotide, and is suitable for industrial production and application. BRIEF DESCRIPTION OF DRAWINGS

[0051] Fig. 1 is a result of determination of the enzyme activity of the nicotinamide riboside kinase expressed by different recombinant bacteria constructed in Example 1.

[0052] Fig. 2 is a result of SDS-PAGE analysis of the nicotinamide riboside kinase expressed by different recombinant bacteria constructed in Example 1.

[0053] Fig. 3 is a result of determination of the enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria containing different RBS sequences; the control is the enzyme activity of the nicotinamide riboside kinase expressed by the control bacteria E. coli BL21 (DE3) / pRSFDuet-Nrk.

[0054] Figure 4 is the determination result of the enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria containing different double promoter sequences; the control is the enzyme activity of the nicotinamide riboside kinase expressed by the control bacteria E. coli BL21(DE3) / pRSFDuet-35000-Nrk; P1-P6 are the enzyme activities of the nicotinamide riboside kinase expressed by the recombinant bacteria constructed using the dnaKJ, alsR, ssrA, skp, gapA and aceE promoters, respectively.

[0055] Figure 5 is the determination result of the relative enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of different mutants.

[0056] Figure 6 is the determination result of the relative enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of each mutant obtained by performing saturation mutation on the D at the 45th position of the nicotinamide riboside kinase according to the present application.

[0057] Figure 7 is the determination result of the relative enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of each mutant obtained by performing saturation mutation on the I at the 88th position of the nicotinamide riboside kinase according to the present application.

[0058] Figure 8 is the determination result of the relative enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of each mutant obtained by performing saturation mutation on the E at the 189th position of the nicotinamide riboside kinase according to the present application.

[0059] Figure 9 is the determination result of the specific enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of the combined mutant NRK-TRA.

[0060] Figure 10 is the change of OD 600 during the scale-up culture of the recombinant bacteria of the combined mutant NRK-TRA.

[0061] Figure 11 is the change of the enzyme activity of the nicotinamide riboside kinase during the scale-up culture of the recombinant bacteria of the combined mutant NRK-TRA.

[0062] Figure 12 is the optimum temperature of the nicotinamide riboside kinase mutant NRK-TRA.

[0063] Figure 13 is the optimum pH of the nicotinamide riboside kinase mutant NRK-TRA. DETAILED DESCRIPTION

[0064] The present application will be further described below in conjunction with the drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices employed in the present application are the conventional reagents, methods and devices in the technical field.

[0065] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0066] Example 1 Recombinant expression of nicotinamide riboside kinase

[0067] The present application takes the gene encoding nicotinamide riboside kinase (Nrk) from Kluyveromyces lactis as the parent, and obtains a nicotinamide riboside kinase capable of being expressed in Escherichia coli through optimization design. The gene sequence of the nicotinamide riboside kinase obtained through optimization design is shown as follows (SEQ ID NO. 1):

[0068] The amino acid sequence of the protein encoded by the nicotinamide riboside kinase gene obtained through optimization design is shown as follows (SEQ ID NO. 2):

[0069] The gene sequence shown in SEQ ID NO. 1 is artificially synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd. and is respectively connected to pET-28a, pET-32a, pRSFDuet-1 and pET-3b vectors. After transformation, screening and verification, etc., the recombinant plasmids verified by sequencing are saved. The saved recombinant plasmids are respectively transformed into Escherichia coli BL21 (DE3) and verified, and four kinds of recombinant bacteria expressing the gene sequence shown in SEQ ID NO. 1 are obtained and saved.

[0070] The single colonies of the above-mentioned saved recombinant bacteria are respectively inoculated in 10 mL LB medium containing 50 μg / mL kanamycin and cultured for 10 h for activation. The activated bacterial liquid is inoculated in 30 mL LB medium at an inoculation amount of 1% (v / v), and is cultured at 37°C, 220 rpm until the OD 600 is 0.6-0.8, and then 0.5 mM IPTG is added for fermentation and culture for 12 h. After the fermentation and culture is finished, the obtained bacterial liquid is centrifuged at 4°C, the precipitate is fully shaken with 10 mL PBS solution and then resuspended, and the process is repeated twice to obtain a cell liquid. The enzyme activity of nicotinamide riboside kinase (or simply enzyme activity) in the cell liquid is determined, and SDS-PAGE analysis of nicotinamide riboside kinase is performed.

[0071] The method for detecting the activity of nicotinamide riboside kinase is as follows:

[0072] (1) First, 50 μL of 1.2 mol / L nicotinamide riboside (NR), 1.2 mol / L ATP and 0.6 mol / L MgCl2 are prepared, 800 μL of ddH2O and 50 μL of cell liquid are added to prepare a whole cell catalytic system (1 mL); 37°C, 1500 rpm shaking reaction for 10 min, after the reaction is finished, 100 μL of 25% HCl is added to terminate the reaction;

[0073] (2) HPLC detection was performed using a C18 column (5 μm, 250 x 4.6 mm); the mobile phase mainly included two parts, the mobile phase A was prepared by mixing methanol, water, glacial acetic acid and tetrabutylammonium hydroxide in a volume ratio of 3:97:1:0.60, and the mobile phase B was 100% methanol; the elution program was as follows: 0 min, 100% A; 5 min, 100% A; 25 min, 40% A; 30 min, 20% A; 45 min, 100% A; each group of experiments was measured 3 times to take the average value;

[0074] The enzyme activity was calculated by the amount of product β-NMN. The enzyme activity of nicotinamide riboside kinase was defined: under the above reaction conditions, 1 unit (U) of enzyme activity was defined as the amount of enzyme protein required to produce 1 μmol of β-NMN per minute.

[0075] The results of determination of the enzyme activity of nicotinamide riboside kinase expressed by different recombinant bacteria constructed in Example 1 of the present application are shown in Figure 1. As can be seen from Figure 1, the expression of nicotinamide riboside kinase using different vectors has a certain influence on the enzyme activity of the nicotinamide riboside kinase expressed thereby. The recombinant bacteria E. coli BL21 (DE3) / pRSFDuet-Nrk constructed using the pRSFDuet-1 vector has the highest enzyme activity of the nicotinamide riboside kinase expressed thereby, which is 2.14 U / mL.

[0076] The results of SDS-PAGE analysis of the nicotinamide riboside kinase expressed by different recombinant bacteria constructed in Example 1 of the present application are shown in Figure 2. In Figure 2, 1-4 correspond to the recombinant bacteria constructed using the pET-32a(+), pET-28a(+), pRSFDuet-1 and pET-3b vectors, respectively. As can be seen from Figure 2, the supernatant of each of the different recombinant bacteria has a specific protein band at 27.3 kDa, indicating that the nicotinamide riboside kinase gene shown in SEQ ID NO. 1 is successfully expressed in the E. coli BL21 (DE3). Among them, the band in the supernatant of the recombinant bacteria E. coli BL21 (DE3) / pRSFDuet-Nrk is thicker, indicating that the solubility expression level of the nicotinamide riboside kinase in the recombinant bacteria E. coli BL21 (DE3) / pRSFDuet-Nrk is higher.

[0077] Example 2: Scheme for improving the enzyme activity of nicotinamide riboside kinase

[0078] In order to further improve the enzyme activity of the nicotinamide riboside kinase expressed in E. coli, the following different methods were used in the present application.

[0079] 1. Improving the enzyme activity of nicotinamide riboside kinase using ribosome binding sites (RBS)

[0080] The present application designs 13 different RBS sequences with translation initiation rates of 5000, 7500, 10000, 12500, 15000, 17500, 20000, 25000, 30000, 35000, 40000, 80000, 100000 a.u., respectively, which are named R1-R13 in turn, and the sequences (SEQ ID NO. 3-15) are shown in Table 1. The primers used for amplifying the linearized plasmids carrying different RBS (R1-R13) by reverse polymerase chain reaction are provided, as shown in Table 2.

[0081] Table 1 RBS sequences with different translation initiation rates

[0082] Table 2 Primers used for amplifying the linearized plasmids carrying different RBS by reverse polymerase chain reaction Note: The capital letters in the primers are different RBS sequences, and the lowercase letters are homologous arms.

[0083] The present application uses the recombinant plasmid pRSFDuet-Nrk constructed in Example 1 as the DNA template, and uses the primers shown in Table 2 to obtain 13 linearized plasmids carrying different RBS by reverse polymerase chain reaction, and constructs the corresponding recombinant bacteria. The recombinant bacteria containing different RBS sequences are induced for expression by the method described in Example 1, and the enzyme activity of the expressed nicotinamide riboside kinase is determined.

[0084] The reverse polymerase chain reaction is carried out in a 50 μL reaction system, and 20 μL of ddH2O, 1 μL of template, 25 μL of 2×Phanta Max Master Mix, and 2 μL of upstream and downstream primers are added. The reaction conditions are as follows: pre-denaturation at 95℃ for 3 min, followed by 34 cycles of denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, and extension at 72℃ for 2.5 min, and final extension at 72℃ for 5 min. Then the methylated template plasmid pRSFDuet-Nrk is digested with Dpn I restriction enzyme, transformed into E. coli BL21(DE3), and the obtained transformants are sequenced to verify the successful construction of positive transformants, and the recombinant bacteria containing different RBS sequences for expressing the nicotinamide riboside kinase are obtained. The obtained recombinant bacteria are induced for expression by the method described in Example 1, and the enzyme activity of the expressed nicotinamide riboside kinase is determined.

[0085] The results of the determination of the enzyme activity of the nicotinamide riboside kinases expressed by the recombinant bacteria containing different RBS sequences are shown in Figure 3; wherein, the control is the enzyme activity of the nicotinamide riboside kinase expressed by the control bacteria E. coli BL21(DE3) / pRSFDuet-Nrk; and R1-R13 in the figure are the enzyme activities of the nicotinamide riboside kinases expressed by the R1-R13 recombinant bacteria. As shown in Figure 3, compared with the control bacteria, the enzyme activities of the nicotinamide riboside kinases expressed by the R10 recombinant bacteria (E. coli BL21(DE3) / pRSFDuet-35000-Nrk) and the R11 recombinant bacteria (E. coli BL21(DE3) / pRSFDuet-40000-Nrk) are significantly improved, and in particular, the enzyme activity of the recombinant bacteria of the R10 modification reaches 4.28 U / mL, which is increased by 50% compared with the control bacteria.

[0086] 2. Improving the enzyme activity of nicotinamide riboside kinase by using a promoter sequence

[0087] The effective expression of a protein is closely related to the transcription efficiency thereof, and a promoter is an important regulatory element for promoting high-level gene expression and recombinant protein production. It is found in the present application that, on the basis of the constructed pRSFDuet-35000-Nrk recombinant plasmid (the recombinant plasmid contained in the R10 recombinant bacteria), the enzyme activity of the expressed nicotinamide riboside kinase can be changed by inserting different promoter sequences in the recombinant plasmid in series with the original T7 promoter sequence, that is, the enzyme activity of the nicotinamide riboside kinase described in the present application can be improved by introducing a specific promoter sequence.

[0088] The specific promoter sequence introduced in the present application is as follows:

[0089] The above promoter sequence is inserted into the constructed pRSFDuet-35000-Nrk recombinant plasmid by the method of enzyme digestion and ligation.

[0090] For all the above promoters, the above promoter fragments (as shown in Table 3) are obtained by specific primer amplification with the E. coli genome as the DNA template, and all the promoter fragments are recovered after the amplification. The plasmid pRSFDuet-35000-Nrk is used as the template, and the reverse polymerase chain reaction is used to obtain a linearized plasmid fragment (linearization primer F: taatacgactcactataggggaattgtgagcg; linearization primer R: atttcctaatgcaggagtcgcataagggaga).

[0091] The reverse polymerase chain reaction is carried out in a 50 μL reaction system, and 20 μL of ddH2O, 1 μL of template, 25 μL of 2×Phanta Max Master Mix and 2 μL of upstream and downstream primers are added. The reaction conditions are as follows: after pre-denaturation at 95°C for 3 min, start the cycle: denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 2.5 min, a total of 34 cycles; and final extension at 72°C for 5 min. The methylated template plasmid pRSFDuet-35000-Nrk is digested with Dpn I restriction enzyme, transformed into E. coli BL21(DE3), and the obtained transformant is sequenced and verified to screen the successfully constructed positive transformant, thereby constructing the recombinant bacteria containing different double promoters. The obtained recombinant bacteria are induced and expressed by the method described in Example 1, and the enzyme activity of the obtained nicotinamide riboside kinase is determined.

[0092] Table 3 Specific primers for amplifying promoter sequences and required primers for linearizing templates Note: The capital letters in the primers are the promoter sequence part, and the lowercase letters are the homologous arm.

[0093] The enzyme activity determination results of the nicotinamide riboside kinase expressed by the recombinant bacteria containing different double promoter sequences are shown in FIG. 4; wherein, control is the enzyme activity of the nicotinamide riboside kinase expressed by the control bacteria E. coli BL21(DE3) / pRSFDuet-35000-Nrk; P1 is the enzyme activity of the nicotinamide riboside kinase expressed by the dnaKJ promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P dnaKJ -Nrk; P2 is the enzyme activity of the nicotinamide riboside kinase expressed by the alsR promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P alsR -Nrk; P3 is the enzyme activity of the nicotinamide riboside kinase expressed by the ssrA promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P ssrA -Nrk; P4 is the enzyme activity of the nicotinamide riboside kinase expressed by the skp promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P skp -Nrk; P5 is the enzyme activity of the nicotinamide riboside kinase expressed by the gapA promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P gapA -Nrk; P6 is the enzyme activity of the nicotinamide riboside kinase expressed by the aceE promoter recombinant bacteria E. coli BL21(DE3) / pRSFDuet-35000-P aceE -Nrk.

[0094] As can be seen from Figure 4, the enzyme activities of the nicotinamide riboside kinases obtained by using different double promoters to express the same nicotinamide riboside kinase gene are different. Among the promoters used in the present application, the enzyme activity of the nicotinamide riboside kinase of the recombinant bacteria expressed by the tandem of the alsR promoter (shown in SEQ ID NO. 17) or the aceE promoter (shown in SEQ ID NO. 21) and the T7 promoter is the highest; wherein the enzyme activity of the nicotinamide riboside kinase of the recombinant bacteria expressed by the tandem of the alsR promoter and the T7 promoter is the highest, which is 5.56 U / mL, increased by 30% compared with the control bacteria, indicating that the introduction of the alsR promoter and the tandem of the T7 promoter can significantly improve the enzyme activity of the expressed nicotinamide riboside kinase.

[0095] 3. Improving the enzyme activity of the nicotinamide riboside kinase by mutating the nicotinamide riboside kinase shown in SEQ ID NO. 2

[0096] The present application uses the recombinant plasmid pRSFDuet-35000-P alsR -Nrk as the DNA template, a series of mutants are obtained by using a site-directed mutation primer (as shown in Table 4) containing a mutation site through reverse polymerase chain reaction.

[0097] Table 4 Site-directed mutation primer Note: The numbers in the brackets represent the mutated amino acid sites.

[0098] Among them, the reverse polymerase chain reaction is carried out in a 50 μL reaction system, 20 μL of ddH2O, 1 μL of template, 25 μL of 2×Phanta Max Master Mix and 2 μL of upstream and downstream primers are added. The reaction conditions are as follows: after pre-denaturation at 95℃ for 3 min, start the cycle: denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 2.5 min, a total of 34 cycles; final extension at 72℃ for 5 min. Then the methylated template plasmid pRSFDuet-35000-P alsR -Nrk is transformed into E. coli BL21 (DE3), the obtained transformants are sequenced and verified, and the positive transformants with successful construction are screened to obtain different nicotinamide riboside kinase mutant strains.

[0099] The plasmid containing the gene sequence of the mutant D45P, I88Q and E189G of nicotinamide riboside kinase shown in SEQ ID NO. 2 is obtained by reverse polymerase chain reaction; wherein the mutant D45P is that the D at the 45th position of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is mutated to P, and the other mutants are mutated in the same way. Meanwhile, the recombinant bacteria (or mutant strains) expressing the mutants are constructed by transforming the plasmid containing the gene sequence of the mutants into E. coli BL21 (DE3). The mutant recombinant bacteria are induced for expression and the enzyme activity of nicotinamide riboside kinase is determined by using the method described in Example 1. In order to more intuitively observe the change of the enzyme activity of the obtained mutant strains compared with the starting strain, all the mutant strains are expressed in E. coli BL21 (DE3) / pRSFDuet-35000-P alsR -Nrk is the control, and the relative enzyme activity is calculated. The determination results of the relative enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of different mutants are shown in Figure 5. As shown in Figure 5, compared with the control bacteria, the enzyme activity of the nicotinamide riboside kinase expressed by the recombinant bacteria of the mutants D45P, I88Q and E189G is improved.

[0100] On the basis of the above results, the mutants D45P, I88Q and E189G are taken as DNA templates, and saturation mutation is performed on each of them. Specifically, the D at the 45th position of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is mutated to G / A / V / L / H / P / F / Y / W / S / T / C / M / N / Q / D / E / K / R; the I at the 88th position of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is mutated to G / A / V / L / H / P / F / Y / W / S / T / C / M / N / Q / D / E / K / R; and the E at the 189th position of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is mutated to G / A / V / L / H / P / F / Y / W / S / T / C / M / N / Q / D / I / K / R.

[0101] The application obtains plasmids containing gene sequences of the above different site saturation mutations by reverse polymerase chain reaction, and constructs recombinant bacteria expressing the mutants by transforming the plasmids containing the mutant gene sequences into E. coli BL21 (DE3). The reverse polymerase chain reaction is performed in a 50 μL reaction system, 20 μL of ddH2O, 1 μL of template, 25 μL of 2×Phanta Max Master Mix, and 2 μL of upstream and downstream primers are added. The reaction conditions are as follows: pre-denaturation at 95°C for 3 min, then start the cycle: denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 2.5 min, a total of 34 cycles; final extension at 72°C for 5 min. Then the methylated template plasmid D45P, I88Q or E189G is digested with Dpn I restriction enzyme and transformed into E. coli BL21 (DE3), and the obtained transformants are sequenced and verified, and the positive transformants with successful construction are screened to obtain different mutant strains of nicotinamide riboside kinase. The mutant recombinant bacteria are induced for expression by the method described in Example 1, and the enzyme activity of nicotinamide riboside kinase is determined, and the relative enzyme activity of E. coli BL21 (DE3) / pRSFDuet-35000-P alsR -Nrk is the relative enzyme activity calculated by control.

[0102] The relative enzyme activity of nicotinamide riboside kinase expressed by each recombinant bacteria obtained by saturation mutation of the 45th D of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is shown in FIG. 6. As shown in FIG. 6, when the 45th aspartic acid (D) is mutated into glycine (G), alanine (A), valine (V), proline (P), phenylalanine (F), tyrosine (Y), serine (S), threonine (T), cysteine (C), methionine (M), asparagine (N), glutamine (Q), glutamic acid (E), lysine (K) or arginine (R), the enzyme activity of the nicotinamide riboside kinase of the mutant strain is improved compared with the control.

[0103] The relative enzyme activity of nicotinamide riboside kinase expressed by each recombinant bacteria obtained by saturation mutation of the 88th I of the nicotinamide riboside kinase shown in SEQ ID NO. 2 is shown in FIG. 7. As shown in FIG. 7, when the 88th isoleucine (I) is mutated into glycine (G), alanine (A), valine (V), isoleucine (I), serine (S), threonine (T), cysteine (C), methionine (M), asparagine (N), glutamine (Q), arginine (R) or histidine (H), the enzyme activity of the nicotinamide riboside kinase of the mutant strain is improved compared with the control.

[0104] The results of the determination of the relative enzyme activity of the nicotinamide riboside kinase obtained by the expression of each of the recombinant bacteria in which the glutamic acid at position 189 of the nicotinamide riboside kinase shown in SEQ ID NO. 2 was subjected to saturation mutation are shown in FIG. 8. As shown in FIG. 8, when the glutamic acid at position 189 is mutated to glycine (G), alanine (A) or glutamine (Q), the enzyme activity of the nicotinamide riboside kinase of the mutant strain is increased compared with the control.

[0105] Based on the mutants D45T, I88R and E189A, the nicotinamide riboside kinase shown in SEQ ID NO. 2 was subjected to combined mutation, and a mutant strain capable of expressing the combined mutant NRK-TRA (D45T-I88R-E189A) was obtained. The relative enzyme activity of the nicotinamide riboside kinase mutant obtained by purifying the nicotinamide riboside kinase mutant expressed by the mutant strain through the method of nickel column affinity chromatography was determined.

[0106] The results of the determination of the specific enzyme activity of the nicotinamide riboside kinase (NRK-TRA) obtained by the expression of the recombinant bacteria of the combined mutant NRK-TRA are shown in FIG. 9. As shown in FIG. 9, the relative enzyme activity of the nicotinamide riboside kinase obtained by the expression of the recombinant bacteria of the combined mutant NRK-TRA is 22.95 U / mg, which is 2.9 times that of the control bacteria.

[0107] Example 3 Scale-up culture of nicotinamide riboside kinase recombinant bacteria in a 5L fermenter

[0108] In order to further evaluate the enzyme production capacity of the nicotinamide riboside kinase mutant, based on the constant feeding strategy, the recombinant bacteria of the combined mutant NRK-TRA were subjected to batch fermentation in a 5L fermenter to further improve the enzyme activity of NRK-TRA.

[0109] Specifically, the recombinant bacteria strain was activated to obtain seed liquid; the seed liquid was inoculated into the fermentation medium in the fermenter at an inoculation amount of 7.5% (v / v), and cultured at 37°C until the OD 600 When the OD reached 30, the temperature was lowered to 25°C, and IPTG was added at a final concentration of 0.5 mM to induce expression for 12 h; during the fed-batch fermentation, the pH of the culture system was controlled at 7.0, and the rotation speed of the fermenter was controlled at 400 rpm.

[0110] During the scale-up culture of the recombinant bacteria of the combined mutant NRK-TRA, the OD 600 The changes of the OD and the nicotinamide riboside kinase enzyme activity are shown in FIGS. 10 and 11, respectively. As shown in FIGS. 10 and 11, as the bacteria grew continuously, the glucose was gradually consumed, and when the concentration of glucose was lower than 2 g / L, the feeding was performed. After the fed-batch fermentation, the OD 600The highest enzyme activity reached 119 at 19h of culture, and the enzyme activity also reached the highest value of 208.3 U / mL. At this time, the recombinant bacteria had also accumulated biomass, and the enzyme production rate was maintained at a relatively stable level. After 19h of feeding, the OD 600 of the strain began to decrease, and the enzyme activity also decreased.

[0111] Example 4 Characterization of the enzymatic properties of nicotinamide riboside kinase

[0112] To explore the effects of temperature and pH on the enzyme activity of nicotinamide riboside kinase, the relative enzyme activity of nicotinamide riboside kinase at different temperatures and pH was determined by using whole-cell catalysis.

[0113] The activity of the recombinant nicotinamide riboside kinase mutant NRK-TRA was determined at 30-75℃, and the relative enzyme activity at different reaction temperatures was calculated by using the enzyme activity of the enzyme at 55℃ as a control. The results are shown in Figure 12. As shown in Figure 12, as the temperature increases, the molecular motion becomes more intense, and the substrate and enzyme are more likely to bind and react, so the enzyme activity gradually increases and reaches the highest enzyme activity at 55℃. At too high a temperature, the enzyme structure and activity are often destroyed, and the reaction products are more likely to be degraded. Therefore, the optimum reaction temperature of the enzyme is 55℃.

[0114] The activity of the recombinant nicotinamide riboside kinase mutant NRK-TRA was determined in different pH buffers (pH 6-11), and the relative enzyme activity of the enzyme at different pH was calculated by using the enzyme activity of the enzyme at pH 7.2 as a control. The results are shown in Figure 13. As shown in Figure 13, the nicotinamide riboside kinase mutant exhibits the highest enzyme activity at pH 7.2, and can better maintain the enzyme activity under neutral conditions.

[0115] Example 5 Optimization of the whole-cell catalysis system

[0116] To explore the optimal substrate concentration for the biotransformation experiment, the recombinant bacteria of the mutant NRK-TRA combined with the whole-cell catalyst were used as the experimental object to explore the batch conversion conditions under the optimal reaction temperature and pH conditions obtained in Example 4.

[0117] The bacterial solution obtained by high-density fermentation was centrifuged at 4℃ and 8000 rpm for 10 min, and the supernatant was discarded. 30 mL of PBS buffer was added to resuspend the bacterial body, which was then centrifuged at 4℃ and 8000 rpm for 10 min, and the supernatant was discarded. The washing of the bacterial body (cells) was repeated twice. 15 mL of PBS buffer was added to the bacterial body precipitate, and the bacterial body was resuspended and then ice-bathed for 10 min to obtain the whole-cell catalyst.

[0118] Formulate 0.4 mol / L NR, 0.5 mol / L ATP, 0.2 mol / L MgCl2, each take 50 μL, add ddH2O 800 μL and whole cell catalyst 50 μL, 37℃, 1500 rpm oscillation, reaction 10 min. After the reaction, add 100 μL 25% HCl to terminate the reaction, 4℃, 8000 rpm centrifugal 1 min, separate the reaction solution and cells.

[0119] The results show that the first batch of substrate is added, HPLC is used to detect the substrate depletion, the second batch of substrate is added for continuous reaction, and so on, when the third batch of substrate is added to the reaction system, the yield of β-NMN reaches the highest, which is 15.16 g / L.

[0120] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.

Claims

1. A nicotinamide ribokinase, characterized in that The amino acid sequence of the nicotinamide ribokinase is shown in SEQ ID NO.

2.

2. A gene encoding the nicotinamide ribokinase according to claim 1.

3. The mutant of nicotinamide ribokinase according to claim 1, characterized in that The mutant is obtained by mutating any one or more of the amino acids at positions 45, 88 or 189 of the nicotinamide ribokinase shown in SEQ ID NO.

2.

4. A gene encoding the mutant according to claim 3.

5. A recombinant plasmid expressing nicotinamide ribokinase, characterized in that: The recombinant plasmid contains the gene according to claim 2 or 4; Or the recombinant plasmid contains the gene according to claim 2 or 4, and a ribosome binding site sequence and / or other promoter sequence is contained between the original promoter sequence of the recombinant plasmid and the gene; the ribosome binding site sequence is shown as SEQ ID NO.12 or SEQ ID NO.13, and the other promoter sequence is shown as SEQ ID NO.17 or SEQ ID NO.

21. A recombinant bacterium containing the recombinant plasmid according to claim 5 .

7. A method for increasing the activity of nicotinamide ribokinase, characterized in that: The method comprises: mutating any one or more of amino acids 45, 88 or 189 of the nicotinamide ribokinase according to claim 1; Or the gene sequence encoding the nicotinamide ribokinase according to claim 1 is replaced with the gene sequence encoding the nicotinamide ribokinase mutant according to claim 3.

8. A method for efficiently heterologously expressing nicotinamide ribokinase, characterized in that: When constructing a recombinant plasmid for expressing the nicotinamide ribokinase according to claim 1 or the mutant according to claim 3, the recombinant plasmid is modified as follows: a ribosome binding site sequence and / or other promoter sequence is inserted between the original promoter sequence and the gene sequence of the recombinant plasmid; the ribosome binding site sequence is shown in SEQ ID NO.12 or SEQ ID NO.13, and the other promoter sequence is shown in SEQ ID NO.17 or SEQ ID NO.

21.

9. Use of the nicotinamide ribokinase according to claim 1, the gene according to claim 2, the mutant according to claim 3, the gene according to claim 4, the recombinant plasmid according to claim 5, or the recombinant bacterium according to claim 6 in the biosynthesis of β-nicotinamide mononucleotide or in the preparation of a product for the biosynthesis of β-nicotinamide mononucleotide.

10. A method for biosynthesizing β-nicotinamide mononucleotide, characterized in that: The mutant of the nicotinamide ribokinase according to claim 3 or the recombinant bacterium according to claim 6 is used as the nicotinamide ribokinase or recombinant bacterium required for the biosynthesis of β-nicotinamide mononucleotide.

Citation Information

Patent Citations

  • Nicotinamide ribokinase mutant and application thereof

    CN110373398A

  • Enzymatic synthesis method of beta-nicotinamide mononucleotide

    CN112795606A

  • Method for secretory expression of pichia pastoris endogenous nicotinamide ribokinase and application thereof

    CN113980929A

  • Nicotinamide riboside kinase as well as coding gene and application thereof

    CN115948365A

  • Nicotinamide ribokinase mutant with improved activity and application of nicotinamide ribokinase mutant in synthesis of NMN

    CN116064469A