Optogenetic modulation for vision restoration
A fusion polypeptide using opsins sensitive to different light wavelengths, delivered via rAAV, addresses the limitations of existing IRD therapies by restoring vision in retinal cells, enhancing light sensitivity and visual function.
Patent Information
- Application Number
- PCT/CN2025/088044
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2025-04-09
- Publication Date
- 2026-01-02
AI Technical Summary
Inherited retinal degenerations (IRDs) cause blindness due to the degeneration of photoreceptor cells, and existing gene therapies are limited by the low prevalence of specific mutations, making it unfeasible to develop targeted treatments for all forms of IRDs.
A fusion polypeptide comprising opsins sensitive to different visible light wavelengths, expressed in retinal cells using a recombinant adeno-associated virus (rAAV), converting light into electro-chemical signals to restore vision.
The fusion polypeptide effectively restores light sensitivity and vision by modulating membrane potential in retinal cells, demonstrating improved visual function in animal models of IRDs.
Smart Images

Figure PCTCN2025088044-FTAPPB-I100001 
Figure PCTCN2025088044-FTAPPB-I100002 
Figure PCTCN2025088044-FTAPPB-I100003
Abstract
Description
Optogenetic Modulation for Vision RestorationTechnical Field
[0001] The present disclosure relates to molecular biology. In particular, the present disclosure relates to the gene therapy for treating inherited retinal degenerations (IRD) by expressing a fusion of opsins in retinal cells.Background
[0002] Inherited retinal degenerations (IRDs) are the leading cause of blindness, affecting 1 in 4,000 people worldwide (~1.75M in total) . Along with the progression of IRDs, the photoreceptors (e.g., rods and cones) that are responsible for conversion of light into electro-chemical signals, are degenerated. This prevents the generation of photo-induced signals in retina, breaking the vision-sensory related cascade of events within the visual system. Loss of photoreceptor cells and / or loss of photoreceptor cell function are the primary causes of reduced light sensitivity and blindness.
[0003] Numerous clinical trials have been initiated in recent years, providing AAV vector gene supplementation strategies for forms of IRD, leading to the first FDA-approved gene therapy product, Luxturna for the deficiency of RPE65 gene, which has been very well studied in the phototransduction pathway, and is the therapeutic agent for the Leber Congenital Amaurosis (LCA) patients.
[0004] However, IRDs can result from different mutations in more than 300 genes and many identified forms have very low prevalence, which makes it unfeasible to develop gene specific treatments for all forms of IRDs.
[0005] It was reported that the expression of an opsin in retinal cells, such as retinal ganglion cells (RGCs) can enable the conversion of light into electro-chemical signals, thereby restoring the loss of vision caused by an IRD or other retinal degenerative diseases, in which the loss of photoreceptor cells and / or loss of photoreceptor cell function occur.
[0006] There is a need of a new therapy for restoring vision, such as a gene therapy for delivering the coding sequence of an opsin or a fusion of opsins, and expressing the same in retina.Summary of the Invention
[0007] In a first aspect, the present disclosure provides A fusion polypeptide comprising a first opsin, a second opsin and a fluorescent protein, wherein the first opsin and the second opsins are sensitive to visible lights of different wavelengths.
[0008] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm, and the second opsin is sensitive to a visible light of 550-650nm.
[0009] In some embodiments, the fluorescent protein comprises red fluorescent protein (RFP) and / or green fluorescent protein (GFP) .
[0010] In some embodiments, the first opsin is ChIEF opsin or opsin5. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43 or 93. In some embodiments, the second opsin is ReaChR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45.
[0011] In some embodiments, the fluorescent protein comprises PlamGFP and / or dTomato. In some embodiments, the fluorescent protein comprises an amino acid sequence of SEQ ID NO: 25 and / or SEQ ID NO: 39.
[0012] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the fluorescent protein, and the second opsin.
[0013] In some embodiments, the fusion polypeptide further comprises a first linker between the first opsin and the fluorescent protein, and a second linker between the fluorescent protein and the second opsin. In some embodiments, the first and second linkers comprise an amino acid sequence of SEQ ID NO: 19 or 21.
[0014] In some embodiments, the first linker comprises an amino acid sequence of SEQ ID NO: 19. In some embodiments, the second linker comprises an amino acid sequence of SEQ ID NO: 21.
[0015] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 51, 95, 97, 99 or 101.
[0016] In a second aspect, the present disclosure provides a polynucleotide comprising a nucleotide sequence encoding the fusion polypeptide of the present disclosure.
[0017] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 62, 94, 96, 98 or 100.
[0018] The present disclosure also provides an expression cassette comprising the polynucleotide of the present disclosure.
[0019] In some embodiments, the expression cassette further comprises a promoter comprising a nucleotide sequence of SEQ ID NO: 1. In some embodiments, the expression cassette further comprises an intron of SEQ ID NO: 14 or 17 between the promoter and the polynucleotide. In some embodiments, the expression cassette further comprises an enhancer of SEQ ID NO: 15 upstream of the promoter. In some embodiments, the expression cassette further comprises a polyadenylation signal sequence of SEQ ID NO: 16.
[0020] The present disclosure also provides a vector comprising the polynucleotide or the expression cassette of the present disclosure.
[0021] In a third aspect, the present disclosure provides a recombinant adeno-associate virus (rAAV) comprising a genome comprising the expression cassette of the present disclosure.
[0022] In some embodiments, the genome further comprises a 5’-ITR of SEQ ID NO: 12 and a 3’-ITR of SEQ ID NO: 13. In some embodiments, the rAAV comprises a modified AAV2 capsid encoded by SEQ ID NO: 75.
[0023] The present disclosure also provides a pharmaceutical composition comprising the rAAV of the present disclosure.
[0024] In a fourth aspect, the present disclosure provides a method of treating inherited retinal degenerations (IRD) in a subject, comprising administering the rAAV or the pharmaceutical composition of the present disclosure to an eye of the subject.
[0025] In some embodiments, the rAAV or the pharmaceutical composition is administered by intravitreal injection.
[0026] The present disclosure also provides use of the rAAV or the pharmaceutical composition of the present disclosure to in the preparation of a medicament for treating IRD in a subject.
[0027] The present disclosure also provides the rAAV of or the pharmaceutical composition of the present disclosure, for use in treating IRD in a subject.Brief Description of the Drawings
[0028] Fig. 1 shows the maps of the helper plasmid (Fig. 1A) , the packaging plasmid (Fig. 1B) and an exemplified transgene plasmid (Fig. 1C) .
[0029] Fig. 2 shows the expressions of GFP in retina, which were driven by various promoters.
[0030] Fig. 3 shows the intracellular fluorescent intensity of the cells expressing GFPs (Fig. 3A) or RFPs (Fig. 3B) , in which the data were normalized to EGFP and mCherry, respectively.
[0031] Fig. 4 shows the constructs (expression cassettes) for expressing the fusions of opsins.
[0032] Fig. 5 shows the ERG detection in rd1 mice injected with rAAVs on Day 14 (Fig. 5A) and Day 42 (Fig. 5B) post-injection.
[0033] Fig. 6 shows the light-dark test in rd1 mice injected with rAAVs, in which Fig. 6A is the illustration of the test, Fig. 6B shows the time in light (%) of the mice, and Fig. 6C shows the time for 1st to the dark (in seconds) .
[0034] Fig. 7 shows the construct for screening the codon optimization of coding sequence.
[0035] Fig. 8 shows the ERG detection in rd1 mice injected with rAAVs comprising codon optimized coding sequences on Day 14 (Fig. 8A) and Day 21 (Fig. 8B) post-injection.
[0036] Fig. 9 shows the opto-electrophysiology of cells transfected with the transgene plasmid and cells infected with the rAAVs, both of which comprise codon optimized coding sequences.
[0037] Fig. 10 shows the ERG detection in rd1 mice injected with rAAVs comprising codon optimized coding sequences.
[0038] Fig. 11 shows the ERG detection in the proof of concept study.
[0039] Fig. 12 shows the light-dark box test in the proof of concept study.
[0040] Fig. 13 shows the visually driven optomotor behavior test in the proof of concept study.
[0041] Fig. 14 shows the constructs (expression cassettes) for expressing the fusions of opsins.
[0042] Fig. 15 shows the patch clamp test of cells infected with rAAVs.
[0043] Fig. 16 shows the Fluorescein angiography (FA) at D14 in WT mice injected with rAAVs, in which the images are designated with the rAAVs injected to the mice, and the image WT represents a mouse injected with PBS.
[0044] Fig. 17 shows the light-dark test in the rd1 mice injected with rAAVs, in which WT and rd1 represent WT and rd1 mice injected with PBS, respectively.
[0045] Fig. 18 shows the visually driven optomotor behavior test in the rd1 mice injected with rAAVs, in which WT and rd1 represent WT and rd1 mice injected with PBS, respectively.
[0046] Fig. 19 shows the general ophthalmic observation at D14 in the rd1 mice injected with rAAV SKG1108.
[0047] Fig. 20 shows the ERG detection in the rd1 mice injected with rAAV SKG1108, in which PBS WT and PBS represent WT and rd1 mice injected with PBS, respectively.
[0048] Fig. 21 shows the visually driven optomotor behavior test in the rd1 mice injected with rAAV SKG1108 in which PBS WT and PBS represent WT and rd1 mice injected with PBS, respectively.Detailed Description of the Invention
[0049] 1. Definition
[0050] Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill in the art.
[0051] As used herein, the term “optogenetic modulation” refers to a technology that combines optics and genetics, based on a principle that photosensitive proteins (e.g., opsins) , which serve as the channels for cations or anions such as Cl-, Na+, H+, K+ through cellular membrane, are stimulated by light of specific wavelengths, resulting in changes in the membrane potential of the cell, thereby selectively exciting or inhibiting the cell. Optogenetic modulation has a very high accuracy that it can achieve a modulation a single cell in the time at a sub-millisecond level. Optogenetic modulation generally involves the construction of opsins, the expression of opsins, and the delivery of light. Due to the translucency of the eye structures, the delivery of light will not be a problem optogenetic modulation in eyes.
[0052] “Opsin” is a membrane protein with a molecular weight of approximately 30-50 kDa, which generally comprises one extracellular amino terminal, seven transmembrane regions, and one intracellular carboxyl terminal. Opsins are members of G protein coupled receptor (GPCR) superfamily. Opsins can be found in animals and microorganisms. Non-animal opsins, such as those from archaea, bacteria, and fungi, have similar tertiary structures to animal opsins, but they are significantly different in amino acid sequences. In addition to native opsins, opsins include modified and artificial ones. Examples for opsins include but not limited to those listed in Table 1.
[0053] Table 1. Exemplified opsins
[0054] Adeno-associated virus (AAV) is a member of Parvoviridae family. It is a simple single-stranded DNA virus, and requires a helper virus (such as adenovirus) for replication. The genome of a wildtype AAV contains approximately 4.7 kilobases (kb) , comprising the cap and rep genes between two inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can fold into hairpin structures that function as primers during initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of AAV. AAV can infect a variety of cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep product.
[0055] As used herein, the term “inverted terminal repeats” or “ITRs” as used herein refers to AAV viral cis-elements named due to their symmetry. These elements are essential for efficient multiplication of an AAV genome. In the present disclosure, the term “ITR” refers to ITRs of known natural AAV serotypes, to chimeric ITRs formed by the fusion of ITR elements derived from different serotypes, and to functional variant thereof.
[0056] The production of a recombinant AAV particle may involve three plasmids, a transgene plasmid comprising an expression construct for expressing an exogenous polynucleotide, a packaging plasmid encoding the REP and / or CAP proteins, and a helper plasmid.
[0057] As used herein, the term “expression construct” refers to a single-stranded or double-stranded polynucleotide, which is isolated from a naturally occurring gene or modified to contain a nucleic acid segment that does not naturally occur. The expression construct may contain the control sequences required to express the coding sequence of the present disclosure.
[0058] As used herein, the term “polynucleotide” usually refers to generally a nucleic acid molecule (e.g., 100 bases and up to 30 kilobases in length) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or non-transcribed.
[0059] The term “exogenous polynucleotide” as used herein refers to a nucleotide sequence that does not originate from the host in which it is placed. It may be identical to the host’s DNA or heterologous. An example is a sequence of interest inserted into a vector. Such exogenous DNA sequences may be derived from a variety of sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences that encode antisense oligonucleotides.
[0060] As used herein, the term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0061] A “control sequence” includes all elements necessary or beneficial for the expression of the polynucleotide encoding the polypeptide of the present disclosure. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to, leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for the termination of transcription and translation.
[0062] For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by the host cell to express the polynucleotide encoding the polypeptide of the present disclosure. The promoter sequence contains a transcription control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, for example, lac operon of E. coli. The promoters also include mutant, modified and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, which are homologous or heterologous to the host cell.
[0063] In some cases, an intron can be included in the construct to improve the expression of the coding sequence. The intron can be a native intron from a gene. Alternatively, the intron can be an artificial one, such as a chimeric intron comprising a native intron and an exon, e.g., an exon from another gene.
[0064] As used herein, the term “operably linked” herein refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence, whereby the control sequence directs the expression of the polypeptide coding sequence.
[0065] The polynucleotide encoding the fusion polypeptide can be subjected to various manipulations to improve the expression of the polypeptide. Before the insertion thereof into a vector, manipulation of the polynucleotide according to the expression vector or the host, such as codon optimization, is desirable or necessary.
[0066] The term “recombinant” as used herein refers to nucleic acids, vectors, polypeptides, or proteins that have been generated using DNA recombination (cloning) methods and are distinguishable from native or wild-type nucleic acids, vectors, polypeptides, or proteins.
[0067] The terms “polypeptide” and “protein” are used interchangeably herein and refer to a polymer of amino acids and includes full-length proteins and fragments thereof.
[0068] As used herein, the term “host cell” refers to, for example microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of rAAV vectors. The term includes the progeny of the original cell which has been transduced. Thus, a “host cell” as used herein generally refers to a cell which has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original parent, due to natural, accidental, or deliberate mutation.
[0069] The term “pharmaceutically acceptable” as used herein refers to molecular entities and compositions that are physiologically tolerable and do not typically produce toxicity or an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
[0070] The term “subject” as used herein includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0071] 2. Fusion polypeptides
[0072] The present disclosure provides a fusion polypeptide comprising one or more opsin (such as exciting opsins) moieties, wherein upon expression on the cell membrane of retinal cells such RGCs, the fusion polypeptide can be stimulated by visible lights, enabling the transfer of ions through the membrane, modulating membrane potential, thereby converting the light into electro-chemical signals. Subsequently, the signals can be transferred to the optic nerve.
[0073] In some embodiments, the fusion polypeptide comprises a first opsin, a second opsin and a fluorescent protein, wherein the first opsin and the second opsins are sensitive to visible lights of different wavelength.
[0074] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm. For example, the first opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the first opsin is ChIEF opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the first opsin is M-opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the first opsin is opsin5. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof.
[0075] In some embodiments, the second opsin is sensitive to a visible light of 550-650nm. For example, the second opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the second opsin is ReachR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the second opsin is Melanopsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof.
[0076] In some embodiments, the first opsin is ChIEF opsin, and the second opsin is ReaChR opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45.
[0077] In some embodiments, the first opsin is opsin5, and the second opsin is ReaChR opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45.
[0078] In some embodiments, the fluorescent protein comprises a red fluorescent protein (RFP) and / or green fluorescent protein (GFP) . In some embodiments, the fluorescent protein comprises an RFP. In some embodiments, the fluorescent protein comprises a GFP. Examples of RFP include, but are not limited to, mCherry, TdTomato, dTomato and DsRed, such as SEQ ID NOs: 23, 25, 27, 29, 31 and 33, respectively; and examples of GFP include, but are not limited to, eGFP, PlamGFP, hrGFR, Ypet, mCitrine, and mVenus, such as SEQ ID NOs: 35, 37, 39 and 41, respectively.
[0079] In some embodiments, the fluorescent protein comprises PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) and / or dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) . In some embodiments, the fluorescent protein comprises PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0080] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the fluorescent protein, and the second opsin. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the fluorescent protein, and the first opsin.
[0081] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0082] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0083] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0084] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0085] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0086] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0087] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0088] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0089] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0090] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0091] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0092] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0093] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0094] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0095] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0096] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0097] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0098] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0099] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0100] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0101] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0102] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0103] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0104] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0105] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0106] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0107] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0108] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0109] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0110] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0111] In some embodiments, the fusion polypeptide further comprises a first linker between the first opsin and the fluorescent protein, and a second linker between the fluorescent protein and the second opsin. In some embodiments, the first and second linkers comprise an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21. In some embodiments, the first linker comprises an amino acid sequence of SEQ ID NO: 19. In some embodiments, the second linker comprises an amino acid sequence of SEQ ID NO: 21. In some embodiments, the first linker comprises an amino acid sequence of SEQ ID NO: 21. In some embodiments, the second linker comprises an amino acid sequence of SEQ ID NO: 19.
[0112] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0113] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0114] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0115] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0116] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0117] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0118] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0119] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0120] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0121] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0122] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO:51.
[0123] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the second opsin, and the fluorescent protein. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the first opsin, and the fluorescent protein. In some embodiments, the fusion polypeptide further comprises an ER sequence such as SEQ ID NO: 87 at the C-terminal.
[0124] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0125] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0126] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0127] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0128] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0129] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0130] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0131] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, and
[0132] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0133] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0134] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, and
[0135] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0136] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 47.
[0137] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0138] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0139] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0140] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0141] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0142] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0143] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0144] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, and
[0145] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0146] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0147] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, and
[0148] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0149] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the second opsin, a linker and the fluorescent protein. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the first opsin, a linker (such as SEQ ID NO: 19 or 21, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21) and the fluorescent protein. In some embodiments, the fusion polypeptide further comprises an ER sequence such as SEQ ID NO: 87 at the C-terminal.
[0150] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0151] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0152] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0153] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0154] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0155] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0156] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0157] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0158] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0159] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0160] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0161] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0162] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0163] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0164] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0165] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0166] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0167] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0168] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0169] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0170] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0171] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0172] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0173] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0174] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0175] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0176] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0177] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0178] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0179] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0180] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0181] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0182] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 101. In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 99.
[0183] The present disclosure also provides a fusion polypeptide comprising, e.g., from N to C terminus, an opsin and a fluorescent protein, wherein the fluorescent protein emits a fluorescence having a wavelength that stimulates the opsin.
[0184] In some embodiments, the opsin is sensitive to a visible light of 400-500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400-500nm. For example, the opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the opsin is ChIEF opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the opsin is M-opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the opsin is opsin5. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises an RFP, such as TdTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37) .
[0185] In some embodiments, the opsin is sensitive to a visible light of 550-650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550-650nm. For example, the opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the opsin is ReaChR opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the opsin is Melanopsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0186] In some embodiments, the fusion polypeptide comprises opsin5 and an RFP. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, and the fluorescent protein comprises an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37.
[0187] In some embodiments, the fusion polypeptide further comprises a linker (such as an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21) between the opsin and the fluorescent protein.
[0188] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21, and an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37.
[0189] In some embodiments, the fusion polypeptide comprises an ER sequence at the C terminus.
[0190] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 97. In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 95.
[0191] The present disclosure also provides a combination of fusion polypeptides comprising a first and a second fusion polypeptides, wherein the first fusion polypeptide comprises a first opsin and a first fluorescent protein, and the second fusion polypeptide comprises a second opsin and a second fluorescent protein; and wherein the first fluorescent protein emits a fluorescence having a first wavelength that stimulates the first opsin, and the second fluorescent protein emits a fluorescence having a second wavelength that stimulates the second opsin.
[0192] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm, and the first wavelength is 400-500nm. For example, the first opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the first opsin is ChIEF opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the first opsin is M-opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the first fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) .
[0193] In some embodiments, the second opsin is sensitive to a visible light of 550-650nm, and the second fluorescent protein emits a fluorescence having a second wavelength of 550-650nm. For example, the second opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the second wavelength is 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the second opsin is ReaChR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the second opsin is Melanopsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the second fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0194] 3. Polynucleotide and expression cassette / vector
[0195] In order to express the fusion polypeptide of the present disclosure, provided is a polynucleotide comprising a nucleotide sequence encoding the fusion polypeptide of the present disclosure. Preferably, the nucleotide sequence is codon optimized to improve the expression of the fusion polypeptide in mammal cells, e.g., human cells.
[0196] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0197] a nucleotide sequence encoding the first opsin,
[0198] a nucleotide sequence encoding a fluorescent protein, and
[0199] a nucleotide sequence encoding the second opsin.
[0200] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0201] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0202] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0203] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0204] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 24 and 71, respectively.
[0205] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0206] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0207] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0208] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0209] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 67 and 71, respectively.
[0210] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0211] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0212] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0213] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0214] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0215] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0216] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 63, 24, 71, 18 and 20, respectively.
[0217] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0218] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0219] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0220] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0221] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0222] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0223] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 63, 67, 71, 18 and 20, respectively.
[0224] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 62.
[0225] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0226] a nucleotide sequence encoding the second opsin,
[0227] a nucleotide sequence encoding a fluorescent protein, and
[0228] a nucleotide sequence encoding the first opsin.
[0229] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0230] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0231] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0232] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0233] In some embodiments, the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 24 and 63, respectively.
[0234] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0235] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0236] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0237] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0238] In some embodiments, the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 67 and 63, respectively.
[0239] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0240] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0241] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0242] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0243] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0244] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0245] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 71, 24, 63, 18 and 20, respectively.
[0246] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0247] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0248] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0249] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0250] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0251] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0252] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 71, 67, 63, 18 and 20, respectively.
[0253] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0254] a nucleotide sequence encoding the first opsin,
[0255] a nucleotide sequence encoding the second opsin, and
[0256] a nucleotide sequence encoding a fluorescent protein.
[0257] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0258] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0259] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0260] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0261] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 71 and 24, respectively.
[0262] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0263] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0264] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0265] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0266] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 71 and 67, respectively.
[0267] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 58.
[0268] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0269] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0270] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0271] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0272] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71 and 24, respectively.
[0273] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0274] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0275] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0276] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0277] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71 and 67, respectively.
[0278] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0279] a nucleotide sequence encoding the first opsin,
[0280] a nucleotide sequence encoding the second opsin,
[0281] a nucleotide sequence encoding a linker,
[0282] a nucleotide sequence encoding a fluorescent protein, and
[0283] optionally, a nucleotide sequence encoding an ER sequence of SEQ ID NO: 87.
[0284] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0285] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0286] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0287] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0288] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0289] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0290] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 18 and 24, respectively.
[0291] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0292] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0293] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0294] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0295] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0296] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0297] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 18 and 67, respectively.
[0298] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0299] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0300] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0301] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0302] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0303] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0304] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 20 and 24, respectively.
[0305] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0306] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0307] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0308] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0309] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0310] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0311] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 20 and 67, respectively.
[0312] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0313] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0314] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 95,
[0315] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0316] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0317] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0318] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 18 and 24, respectively.
[0319] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0320] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0321] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0322] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0323] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0324] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0325] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 18 and 67, respectively.
[0326] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0327] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0328] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93
[0329] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0330] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0331] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0332] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 20 and 24, respectively.
[0333] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0334] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0335] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 94,
[0336] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0337] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0338] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0339] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 20 and 67, respectively.
[0340] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 100.
[0341] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 98.
[0342] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0343] a first nucleotide sequence encoding an opsin, and
[0344] a second nucleotide sequence encoding a fluorescent protein,
[0345] wherein the fluorescent protein emits a fluorescence having a wavelength that stimulates the opsin.
[0346] In some embodiments, the opsin is sensitive to a visible light of 400-500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400-500nm. For example, the opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the opsin is M-opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the opsin is opsin5. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises an RFP, such as TdTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37) .
[0347] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0348] a first nucleotide sequence comprising SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66, and
[0349] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0350] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0351] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92, and
[0352] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0353] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0354] a first nucleotide sequence comprising SEQ ID NO: 82, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 82, and
[0355] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0356] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0357] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92, and
[0358] a second nucleotide sequence comprising SEQ ID NO: 36, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 36.
[0359] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0360] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92,
[0361] a nucleotide sequence comprising SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21,
[0362] a second nucleotide sequence comprising SEQ ID NO: 36, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 36, and
[0363] optionally a nucleotide sequence comprising SEQ ID NO: 87.
[0364] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 96.
[0365] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 94.
[0366] In some embodiments, the opsin is sensitive to a visible light of 550-650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550-650nm. For example, the opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the opsin is ReaChR opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the opsin is Melanopsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0367] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0368] a first nucleotide sequence comprising SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74, and
[0369] a second nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0370] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0371] a first nucleotide sequence comprising SEQ ID NO: 84, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 82, and
[0372] a second nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0373] The present disclosure also provides a combination of polynucleotides encoding a combination of fusion polypeptides comprising a first and a second fusion polypeptides, wherein the first fusion polypeptide comprises a first opsin and a first fluorescent protein, and the second fusion polypeptide comprises a second opsin and a second fluorescent protein; and wherein the first fluorescent protein emits a fluorescence having a first wavelength that stimulates the first opsin, and the second fluorescent protein emits a fluorescence having a second wavelength that stimulates the second opsin. For example, the first and second wavelengths are different from each other.
[0374] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm, and the first wavelength is 400-500nm. For example, the first opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the first opsin is ChIEF opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the first opsin is M-opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the first fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) .
[0375] In some embodiments, the second opsin is sensitive to a visible light of 550-650nm, and the second wavelength is 550-650nm. For example, the second opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the second wavelength of 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the second opsin is ReaChR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the second opsin is Melanopsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the second fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0376] In some embodiments, the combination of polynucleotides comprises a first polynucleotide encoding the first fusion polypeptide, and a second polynucleotide encoding the second fusion polypeptide. In some embodiments, the first and second polynucleotides are expressed in a single expression cassette. In some embodiments, the first and second polynucleotides are expressed in separated expression cassettes. The means for expressing two polynucleotides (translating into separated polypeptides) is conventional in the art, including but not limited to, the insertion of a nucleotide sequence encoding cleavable peptide linkers (such as 2A peptides, e.g., a 2A peptide encoded by SEQ ID NO: 79) , an RBS or an IRES between the two polynucleotides.
[0377] In some embodiments, the first polynucleotide comprises, from 5’ to 3’ end,
[0378] a nucleotide sequence comprising SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74, and
[0379] a nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0380] In some embodiments, the second polynucleotide comprises, from 5’ to 3’ end,
[0381] a nucleotide sequence comprising SEQ ID NO: 84, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 82, and
[0382] a nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0383] The present disclosure further provides an expression cassette comprising the polynucleotide of the present disclosure operably linked to a promoter. Preferably, the promoter drives the expression of the fusion polypeptide in retinal cells such as RGCs. In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 1 or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 1.
[0384] In some embodiments, the expression cassette further comprises an intron (such as SEQ ID NO: 14 or 17 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 14 or 17) between the promoter and the polynucleotide. In some embodiments, the expression cassette further comprises an enhancer (such as SEQ ID NO: 15 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 15) upstream of the promoter. In some embodiments, the expression cassette further comprises a polyadenylation signal sequence, such as SEQ ID NO: 16 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 16.
[0385] Provided are a vector comprising the polynucleotide or the expression cassette of the present disclosure, and a host cell comprising the polynucleotide, expression cassette or the vector of the present disclosure.
[0386] For example, the vector can be a transgene plasmid for preparing an rAAV. Therefore, in some embodiment, the vector comprises the expression cassette and AAV ITRs flanking the expression cassette. In some embodiments, the vector comprises AAV2 ITRs. In some embodiments, the 5’ ITR comprises a nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 12. In some embodiments, the 3’ ITR comprises a nucleotide sequence of SEQ ID NO: 13, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 13.
[0387] 4. Recombinant adeno-associate virus (rAAV)
[0388] The present disclosure provides an rAAV for delivering and expressing the polynucleotide encoding a fusion polypeptide or a combination of fusion polyptides in retinal cells, such as RGCs, thereby restoring the loss of vision due to the degeneration of photoreceptors such as rods and cones.
[0389] In some embodiments, the rAAV comprises a genome comprising an expression cassette, which comprises a polynucleotide encoding the fusion polypeptide. In some embodiments, the fusion polypeptide comprises a first opsin, a second opsin and a fluorescent protein, wherein the first opsin and the second opsins are sensitive to visible lights of different wavelength.
[0390] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm. For example, the first opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the first opsin is ChIEF opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the first opsin is M-opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the first opsin is opsin5. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof.
[0391] In some embodiments, the second opsin is sensitive to a visible light of 550-650nm. For example, the second opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the second opsin is ReaChR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the second opsin is Melanopsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof.
[0392] In some embodiments, the first opsin is ChIEF opsin, and the second opsin is ReaChR opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45.
[0393] In some embodiments, the first opsin is opsin5, and the second opsin is ReaChR opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 93, and the second opsin comprises an amino acid sequence of SEQ ID NO: 45.
[0394] In some embodiments, the fluorescent protein comprises a red fluorescent protein (RFP) and / or green fluorescent protein (GFP) . In some embodiments, the fluorescent protein comprises an RFP. In some embodiments, the fluorescent protein comprises a GFP. Examples of RFP include, but are not limited to, mCherry, TdTomato, dTomato and DsRed, such as SEQ ID NOs: 23, 25, 27, 29, 31 and 33, respectively; and examples of GFP include, but are not limited to, eGFP, PlamGFP, hrGFR, Ypet, mCitrine, and mVenus, such as SEQ ID NOs: 35, 37, 39 and 41, respectively.
[0395] In some embodiments, the fluorescent protein comprises PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) and / or dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) . In some embodiments, the fluorescent protein comprises PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0396] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the fluorescent protein, and the second opsin. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the fluorescent protein, and the first opsin.
[0397] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0398] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0399] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0400] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0401] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0402] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0403] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0404] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0405] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0406] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0407] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0408] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0409] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0410] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0411] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0412] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0413] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0414] an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0415] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0416] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0417] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0418] an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0419] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0420] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0421] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0422] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0423] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0424] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0425] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0426] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0427] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0428] an amino acid sequence of SEQ ID NO: 85, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85.
[0429] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0430] an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0431] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0432] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0433] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0434] an amino acid sequence of SEQ ID NO: 83, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83,
[0435] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0436] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0437] In some embodiments, the fusion polypeptide further comprises a first linker between the first opsin and the fluorescent protein, and a second linker between the fluorescent protein and the second opsin. In some embodiments, the first and second linkers comprise an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21. In some embodiments, the first linker comprises an amino acid sequence of SEQ ID NO: 19. In some embodiments, the second linker comprises an amino acid sequence of SEQ ID NO: 21. In some embodiments, the first linker comprises an amino acid sequence of SEQ ID NO: 21. In some embodiments, the second linker comprises an amino acid sequence of SEQ ID NO: 19.
[0438] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0439] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0440] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0441] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0442] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0443] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0444] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0445] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0446] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0447] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0448] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0449] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0450] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 51.
[0451] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the second opsin, and the fluorescent protein. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the first opsin, and the fluorescent protein. In some embodiments, the fusion polypeptide further comprises an ER sequence such as SEQ ID NO: 87 at the C-terminal.
[0452] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0453] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0454] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0455] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0456] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0457] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0458] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0459] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0460] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0461] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0462] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, and
[0463] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0464] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0465] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0466] an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, and
[0467] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0468] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 47.
[0469] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0470] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0471] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0472] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0473] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0474] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0475] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0476] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0477] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0478] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0479] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, and
[0480] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0481] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0482] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0483] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, and
[0484] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0485] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the first opsin, the second opsin, a linker and the fluorescent protein. In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, the second opsin, the first opsin, a linker (such as SEQ ID NO: 19 or 21, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21) and the fluorescent protein. In some embodiments, the fusion polypeptide further comprises an ER sequence such as SEQ ID NO: 87 at the C-terminal.
[0486] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0487] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0488] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0489] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0490] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0491] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0492] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0493] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0494] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0495] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0496] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0497] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0498] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0499] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0500] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0501] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0502] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0503] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0504] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0505] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0506] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0507] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0508] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0509] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0510] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0511] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0512] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0513] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0514] an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19, and
[0515] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0516] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0517] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0518] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0519] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0520] an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0521] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus,
[0522] an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0523] an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0524] an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0525] an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0526] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 101. In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 99.
[0527] In some embodiments, the fusion polypeptide comprising, e.g., from N to C terminus, an opsin and a fluorescent protein, wherein the fluorescent protein emits a fluorescence having a wavelength that stimulates the opsin.
[0528] In some embodiments, the opsin is sensitive to a visible light of 400-500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400-500nm. For example, the opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the opsin is ChIEF opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the opsin is M-opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the opsin is opsin5. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises an RFP, such as TdTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37) .
[0529] In some embodiments, the opsin is sensitive to a visible light of 550-650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550-650nm. For example, the opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the fluorescent protein emits a fluorescence having a wavelength of 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the opsin is ReaChR opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the opsin is Melanopsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0530] In some embodiments, the fusion polypeptide comprises opsin5 and an RFP. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, and the fluorescent protein comprises an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37.
[0531] In some embodiments, the fusion polypeptide further comprises a linker (such as an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21) between the opsin and the fluorescent protein.
[0532] In some embodiments, the fusion polypeptide comprises, from N terminus to C terminus, an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof, an amino acid sequence of SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21, and an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37.
[0533] In some embodiments, the fusion polypeptide comprises an ER sequence at the C terminus.
[0534] In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 97. In some embodiments, the fusion polypeptide comprises an amino acid sequence of SEQ ID NO: 95.
[0535] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0536] a nucleotide sequence encoding the first opsin,
[0537] a nucleotide sequence encoding a fluorescent protein, and
[0538] a nucleotide sequence encoding the second opsin.
[0539] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0540] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0541] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0542] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0543] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 24 and 71, respectively.
[0544] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0545] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0546] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0547] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0548] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 67 and 71, respectively.
[0549] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0550] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0551] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0552] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0553] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0554] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0555] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 63, 24, 71, 18 and 20, respectively.
[0556] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0557] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0558] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0559] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0560] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0561] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45.
[0562] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 63, 67, 71, 18 and 20, respectively.
[0563] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 62.
[0564] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0565] a nucleotide sequence encoding the second opsin,
[0566] a nucleotide sequence encoding a fluorescent protein, and
[0567] a nucleotide sequence encoding the first opsin.
[0568] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0569] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0570] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0571] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0572] In some embodiments, the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 24 and 63, respectively.
[0573] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0574] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0575] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0576] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0577] In some embodiments, the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 67 and 63, respectively.
[0578] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0579] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0580] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0581] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25,
[0582] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0583] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0584] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 71, 24, 63, 18 and 20, respectively.
[0585] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0586] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0587] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0588] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39,
[0589] a fifth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21, and
[0590] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43.
[0591] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the fifth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second, third, fourth and fifth nucleotide sequences comprise SEQ ID NOs: 71, 67, 63, 18 and 20, respectively.
[0592] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0593] a nucleotide sequence encoding the first opsin,
[0594] a nucleotide sequence encoding the second opsin, and
[0595] a nucleotide sequence encoding a fluorescent protein.
[0596] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0597] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0598] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0599] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0600] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 71 and 24, respectively.
[0601] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0602] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 43, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43,
[0603] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0604] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0605] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 63, 71 and 67, respectively.
[0606] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 58.
[0607] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0608] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0609] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0610] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25.
[0611] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71 and 24, respectively.
[0612] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0613] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0614] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, and
[0615] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39.
[0616] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71 and 67, respectively.
[0617] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0618] a nucleotide sequence encoding the first opsin,
[0619] a nucleotide sequence encoding the second opsin,
[0620] a nucleotide sequence encoding a linker,
[0621] a nucleotide sequence encoding a fluorescent protein, and
[0622] optionally, a nucleotide sequence encoding an ER sequence of SEQ ID NO: 87.
[0623] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0624] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0625] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0626] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0627] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0628] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0629] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 18 and 24, respectively.
[0630] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0631] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0632] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0633] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0634] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0635] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0636] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 18 and 67, respectively.
[0637] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0638] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0639] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0640] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0641] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0642] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0643] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 20 and 24, respectively.
[0644] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0645] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0646] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0647] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0648] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0649] optionally, a nucleotide sequence encoding of SEQ ID NO: 86.
[0650] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 92, 71, 20 and 67, respectively.
[0651] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0652] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0653] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 95,
[0654] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0655] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0656] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0657] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 18 and 24, respectively.
[0658] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0659] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0660] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93,
[0661] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 19, or at least 70%, 80%, 85%, 90%, or 95%identical to SEQ ID NO: 19,
[0662] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0663] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0664] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 18, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 18. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 18 and 67, respectively.
[0665] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0666] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0667] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93
[0668] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0669] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25, and
[0670] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0671] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 24, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 20 and 24, respectively.
[0672] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0673] a first nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 45, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45,
[0674] a second nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 93, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 94,
[0675] a fourth nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 21, or at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 21,
[0676] a third nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39, and
[0677] optionally, a nucleotide sequence encoding SEQ ID NO: 87, such as SEQ ID NO: 86.
[0678] In some embodiments the first nucleotide sequence comprises SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74. In some embodiments, the second nucleotide sequence comprises SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92. In some embodiments the third nucleotide sequence comprises SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70. In some embodiments, the fourth nucleotide sequence comprises SEQ ID NO: 20, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 20. In some embodiments, the first, second and third nucleotide sequences comprise SEQ ID NOs: 71, 92, 20 and 67, respectively.
[0679] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 100.
[0680] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 98.
[0681] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0682] a first nucleotide sequence encoding an opsin, and
[0683] a second nucleotide sequence encoding a fluorescent protein,
[0684] wherein the fluorescent protein emits a fluorescence having a wavelength that stimulates the opsin.
[0685] In some embodiments, the opsin is sensitive to a visible light of 400-500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400-500nm. For example, the opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the fluorescent protein emits a fluorescence having a wavelength of 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the opsin is M-opsin. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the opsin is opsin5. In some embodiments, the opsin comprises an amino acid sequence of SEQ ID NO: 93, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 93, or a functional fragment thereof. In some embodiments, the fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) . In some embodiments, the fluorescent protein comprises an RFP, such as TdTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 37, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 37) .
[0686] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0687] a first nucleotide sequence comprising SEQ ID NO: 42, 63, 64, 65 or 66, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 42, 63, 64, 65 or 66, and
[0688] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0689] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0690] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92, and
[0691] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0692] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0693] a first nucleotide sequence comprising SEQ ID NO: 82, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 82, and
[0694] a second nucleotide sequence comprising SEQ ID NO: 24, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 24.
[0695] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0696] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92, and
[0697] a second nucleotide sequence comprising SEQ ID NO: 36, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 36.
[0698] In some embodiments, the polynucleotide comprises, from 5’ to 3’ end,
[0699] a first nucleotide sequence comprising SEQ ID NO: 92, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 92,
[0700] a nucleotide sequence comprising SEQ ID NO: 19 or 21 or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 19 or 21,
[0701] a second nucleotide sequence comprising SEQ ID NO: 36, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 36, and
[0702] optionally a nucleotide sequence comprising SEQ ID NO: 87.
[0703] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 96.
[0704] In some embodiments, the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 94.
[0705] In some embodiments, the rAAV comprises a genome comprising an expression cassette encoding a combination of fusion polypeptides.
[0706] In some embodiments, the combination of fusion polypeptides comprises a first and a second fusion polypeptides, wherein the first fusion polypeptide comprises a first opsin and a first fluorescent protein, and the second fusion polypeptide comprises a second opsin and a second fluorescent protein; and wherein the first fluorescent protein emits a fluorescence having a first wavelength that stimulates the first opsin, and the second fluorescent protein emits a fluorescence having a second wavelength that stimulates the second opsin. For example, the first and second wavelengths are different from each other.
[0707] In some embodiments, the first opsin is sensitive to a visible light of 400-500nm, and the first first wavelength of 400-500nm. For example, the first opsin has a peak activation with a wavelength in the range of 400-500nm, such as 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm, and the first wavelength is 400nm, 405nm, 410nm, 415nm, 420nm, 425nm, 430nm, 435nm, 440nm, 445nm, 450nm, 455nm, 460nm, 465nm, 470nm, 475nm, 480nm, 485nm, 490nm, 495nm or 500nm. In some embodiments, the first opsin is ChIEF opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 43, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 43, or a functional fragment thereof. In some embodiments, the first opsin is M-opsin. In some embodiments, the first opsin comprises an amino acid sequence of SEQ ID NO: 83, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 83, or a functional fragment thereof. In some embodiments, the first fluorescent protein comprises a GFP, such as PlamGFP (e.g., comprising an amino acid sequence of SEQ ID NO: 25, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 25) .
[0708] In some embodiments, the second opsin is sensitive to a visible light of 550-650nm, and the second wavelength is 550-650nm. For example, the second opsin has a peak activation with a wavelength in the range of 550-650nm, such as 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm, and the second wavelength is 550nm, 555nm, 560nm, 565nm, 570nm, 575nm, 580nm, 585nm, 590nm, 595nm, 600nm, 605nm, 610nm, 615nm, 620nm, 625nm, 630nm, 635nm, 640nm, 645nm or 650nm. In some embodiments, the second opsin is ReaChR opsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 45, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 45, or a functional fragment thereof. In some embodiments, the second opsin is Melanopsin. In some embodiments, the second opsin comprises an amino acid sequence of SEQ ID NO: 85, a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 85, or a functional fragment thereof. In some embodiments, the second fluorescent protein comprises an RFP such as dTomato (e.g., comprising an amino acid sequence of SEQ ID NO: 39, or a functional variant thereof which is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 39) .
[0709] In some embodiments, the expression cassette comprises a first polynucleotide encoding the first fusion polypeptide, and a second polynucleotide encoding the second fusion polypeptide. The means for expressing two polynucleotides (translating into separated polypeptides) is conventional in the art, including but not limited to, the insertion of a nucleotide sequence encoding cleavable peptide linkers (such as 2A peptides, e.g., a 2A peptide encoded by SEQ ID NO: 79) , an RBS or an IRES between the two polynucleotides.
[0710] In some embodiments, the first polynucleotide comprises, from 5’ to 3’ end,
[0711] a nucleotide sequence comprising SEQ ID NO: 44, 71, 72, 73 or 74, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 44, 71, 72, 73 or 74, and
[0712] a nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0713] In some embodiments, the second polynucleotide comprises, from 5’ to 3’ end,
[0714] a nucleotide sequence comprising SEQ ID NO: 84, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 82, and
[0715] a nucleotide sequence comprising SEQ ID NO: 38, 67, 68, 69 or 70, or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 38, 67, 68, 69 or 70.
[0716] The present disclosure further provides an expression cassette comprising the polynucleotide of the present disclosure operably linked to a promoter. Preferably, the promoter drives the expression of the fusion polypeptide in retinal cells such as RGCs. In some embodiments, the promoter comprises a nucleotide sequence of SEQ ID NO: 1 or is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 1.
[0717] In some embodiments, the expression cassette further comprises an intron (such as SEQ ID NO: 14 or 17 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 14 or 17) between the promoter and the polynucleotide. In some embodiments, the expression cassette further comprises an enhancer (such as SEQ ID NO: 15 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 15) upstream of the promoter. In some embodiments, the expression cassette further comprises a polyadenylation signal sequence, such as SEQ ID NO: 16 or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 16.
[0718] In some embodiment, the genome comprises the expression cassette and AAV ITRs flanking the expression cassette. In some embodiments, the genome comprises AAV2 ITRs. In some embodiments, the 5’ ITR comprises a nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 12. In some embodiments, the 3’ ITR comprises a nucleotide sequence of SEQ ID NO: 13, or a nucleotide sequence at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more identical to SEQ ID NO: 13.
[0719] In some embodiments, the rAAV of the present disclosure can be selected from human serotype 1 AAV (hAAV1) , hAAV2, hAAV3, hAAV4, hAAV5, hAAV6, hAAV7, hAAV8, hAAV9, hAAV10, and hAAV11.26. In some embodiments, the rAAV is hAAV2. A number of modified AAV capsids derived from hAAV2 have been reported, which improve gene therapy for ocular diseases. In some embodiments, the rAAV comprises a modified AAV2 capsid, such as those described in WO2012145601, WO2016134375, WO2018022905 and WO2023155828, preferably a capsid encoded by SEQ ID NO: 75.
[0720] It is known in the art to package rAAV with a system comprising three plasmids, including i) a transgene plasmid comprising the genome of the rAAV encoding a desired gene product, ii) a packaging plasmid encoding the REP and / or CAP proteins, and iii) a helper plasmid in a host cell (see, e.g., Crosson SM et al., Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Mol Ther Methods Clin Dev. 2018; 10: 1-7) . A method of producing rAAV is also described in, for example, U.S. Patent Publication No. 2005 / 0053922 and U.S. Patent Publication No. 2009 / 0202490.
[0721] The polynucleotide or the vector of the present disclosure can be introduced into the host cell stably or transiently using defined techniques including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like. For stable transformation, the subject nucleic acid will typically be operably linked to a selectable marker, such as neomycin resistance gene and the like.
[0722] The host cell is a variety of cells, such as mammalian cells, including, for example, murine cells and primate cells (e.g., human cells) . Suitable mammalian cells include, but are not limited to, primary cells and cell lines, wherein suitable cell lines include, but are not limited to, 293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, etc. Non-limiting examples of suitable host cells include, for example, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2) , CHO cells (e.g., ATCC No. CRL9618, CCL61, CRL9096) , 293 cells (e.g., ATCC No. CRL-1573) , Vero cells, NIH3T3 cells (eg, ATCC No. CRL-1658) , Huh-7 cells, BHK cells (e.g., ATCC No. CCL10) , PC12 cells (ATCC No. CRL1721) COS cells, COS-7 cells (ATCC No. CRL1651) , RAT1 cells, mouse L cells (ATCC No. CCLI. 3) , human embryonic kidney (HEK) cells (ATCC No. CRL1573) , HLHepG2 cells, and the like. Bacterial cells, such as Sf9 cells, which produce AAV, can also be used to prepare the host cell of the present disclosure (see, for example, U.S. Patent No. 7,271,002; U.S. Patent Publication No. 12 / 297,958) .
[0723] 5. Pharmaceutical Composition and Medical Use
[0724] The present disclosure provides a pharmaceutical composition comprising: a) the rAAV of the present disclosure; and b) a pharmaceutically acceptable carrier, diluent, excipient or buffer. In some embodiments, a pharmaceutically acceptable carrier, diluent, excipient or buffer is suitable for use in humans.
[0725] Such excipients, carriers, diluents, and buffers include any agent that can be administered without abnormal toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. Included therein may be pharmaceutically acceptable salts such as mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and salts of organic acids such as acetates, propionates, malonates, Benzoate and the like. In addition, auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like may be present in such vehicles. A wide variety of pharmaceutically acceptable excipients are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been described in detail in various publications including, for example, A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy, ” 20th Edition, Lippincott, Williams, &Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) Editing by HC Ansel et al, 7th edition, Lippincott, Williams, &Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., 3rd edition, Amer. Pharmaceutical Assoc.
[0726] The present disclosure provides a method of treating an ocular disease with loss of photoreceptor, the method comprising administering to a subject in need thereof an effective amount of the rAAV or the pharmaceutical composition of the present disclosure. In some embodiments, the rAAV or the pharmaceutical composition is administered by intraocular injection or by intravitreal injection. The rAAV or the pharmaceutical composition is administered by a single-dose or a multiple-dose (e.g., 2, 3, 4 or more doses) scheme. For the multiple-dose scheme, the rAAV or the pharmaceutical composition can be administered at different intervals, such as daily, weekly, monthly, yearly, to achieve a desired level of gene expression.
[0727] Provided is also the rAAV or the pharmaceutical composition of the present disclosure, for use in the treatment of an ocular disease with loss of photoreceptor. In some embodiments, the rAAV or the pharmaceutical composition is administered by intraocular injection or by intravitreal injection. The rAAV or the pharmaceutical composition is administered by a single-dose or a multiple-dose (e.g., 2, 3, 4 or more doses) scheme. For the multiple-dose scheme, the rAAV or the pharmaceutical composition can be administered at different intervals, such as daily, weekly, monthly, yearly, to achieve a desired level of gene expression.
[0728] The present disclosure provides use of the rAAV or the pharmaceutical composition of the present disclosure in the preparation of a medicament for treating an ocular disease with loss of photoreceptor in a subject in need thereof.
[0729] The rAAV or the pharmaceutical composition of the present disclosure can be used to treat vision loss due to any degenerative retinal disease, which includes, but is not limited to, inherited retinal degenerations (IRDs) , such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis (LCA) , Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies.
[0730] Examples
[0731] The following Examples are provided for illustration only, rather than for any limitation to the present application.
[0732] Example 1. Screening of promoters for driving the expression in RGC
[0733] This Example was carried out to screen a promoter driving an desired expression of the gene of interest.
[0734] rAAVs comprising a genome encoding GFP driven by various promoters were prepared with a method similar to that described in Crosson SM et al. 2018. Briefly, 3E6 cells / ml 293VPC cells (Thermo, Catalog A35347) in serum free virus production medium OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) were triple transfected, using polyethylenimine, with the helper plasmid, the packaging plasmid encoding rep / cap, and the transgene plasmid below:
[0735] - helper plasmid ( “pHelper” containing the Ad E2A, E4, and VA RNA helper genes as described in Crosson Sm et al., the map thereof is shown in Fig. 1A) ;
[0736] - packaging plasmid, the map thereof is shown in Fig. 1B, in which “AAV2 Cap” is the nucleotide sequence encoding a modified AAV2 capsid polypeptide (SEQ ID NO: 75) , and “AAV2 Rep” is the nucleotide sequence encoding an AAV2 Rep polypeptide (SEQ ID NO: 76) ;
[0737] - transgene plasmid, comprising the rAAV genome comprising the nucleotide sequence encoding eGFP (SEQ ID NO: 21) driven by a promoter selected from CBA, hSyn, hGRM6, hGNAT1, hSAG, hNRL, hPKC-alpha, hGRK1, hCULU1, L7-6 and Mini-camK2 (SEQ ID NOs: 1-11, respectively) , in which the elements were assembled using Gibson assembly methodology (NEBuilder HiFi DNA Assembly Master Mix, NEB, Catalog E2621) . The transgene plasmid comprising CBA promoter is shown in Fig. 1C as an example.
[0738] Following 72 h incubation at 37℃, cells were harvested, and viral particles were purified through an iodixanol gradient (see Crosson SM et al. ) .
[0739] The rAAVs were tested for titers by ddPCR, which were all at the level of 1013 viral genomes (vg) / mL. In particular, the ddPCR was carried out with Bio-Rad’s QXDx AutoDG ddPCR System and QXDx Universal Kit for AutoDG ddPCR System according to the manufacturer’s instructions. The primers and probe for the ddPCR are as follows:
[0740] GFP-F ACTACAACAGCCACAACGTCTATATCA
[0741] GFP-R GGCGGATCTTGAAGTTCACC
[0742] GFP-P 5′-6-FAM-CCGACAAGC-ZEN-AGAAGAACGGCATCA-Iowa Black FQ-3′
[0743] The prepared rAAVs were administered to C57BL / 6 mice (2-3-month-old, from Shanghai Model Organisms Center Inc. ) by an intravitreal (IVT) injection at a dose of 7.5E9 vg / eye (6 eyes / group) . The mice were sacrificed 21 days after the injection, and the eyes were imaged by IHC staining.
[0744] In particular, mice were perfused with ice-cold phosphate-buffered saline (PBS) . Then, the tissues were dissected and post-fixed in 4%PFA for 24h at 4℃ followed by processing for paraffin embedding and 5μm thickness sectioning (CM1950, Lecia) . Antigen retrieval was performed using Leica Bond Rx with ER1 or ER2 buffer according to the manufacturer’s instructions.
[0745] The IHC staining was performed on the Leica BOND RX according to the manufacturer’s instructions. In brief, all histology consumables were transferred to barcoded reagent containers. Staining protocols that list the order and durations of reagent incubations and washes were created on the BOND controller software. Slides were assigned unique barcode labels coupled to staining protocols and placed onto temperature-controlled pads on the instrument. Flow-through chambers were assembled across the whole slides using plastic cover plates.During staining, a liquid volume of 150μl was dispensed to each slide on every step using automated liquid handler. Reagents were flushed at least once before the main incubations to ensure uniform coverage of the slide. Between reagent incubations, multiple short washes were performed. All incubations were performed at room temperature. Signal was detected with DAB Substrate (Leica) , and counterstaining was performed with hematoxylin II and bluing reagent (Leica) before slides were dehydrated and mounted using Coverslip system (Leica CV5030) .
[0746] Frozen tissue samples were sectioned at a thickness of 30 μm using a cryostat (CM1950, Lecia) , and the sections were mounted onto gelatin-coated glass slides. Slides were then subjected to a brief fixation in cold acetone to preserve cellular antigens. Following fixation, sections were permeabilized with 0.1-0.5%Triton X-100 in phosphate-buffered saline (PBS) for 10 minutes at room temperature. Non-specific binding sites were blocked with a solution containing 5%normal goat serum in PBS for 1 hour. Primary antibodies, specific for the protein of interest, were applied at optimal dilutions and incubated overnight at 4℃ in a humidified chamber. After extensive washing with PBS containing 0.1%Tween-20 (PBST) , sections were incubated with species-specific secondary antibodies for 1-2 hours at room temperature in the dark. Images were acquired with Leica DM6 B THUNDER imaging system.
[0747] As shown in Fig. 2, the CBA promoter (SEQ ID NO: 1) drove a broad and even expression of GFP in RGCs (Fig. 2B) , while the GRM6 promoter drove an expression of GFP in bipolar cells (the promoters that drove a poor expression were not shown) .
[0748] Example 2. Screening of fluorescent protein for enhancing the opsins
[0749] It was reported that fusion with a fluorescent protein might enhance the function of the opsin by improving the brightness in cell or tissue. This Example was carried out to screen a fluorescent protein providing desired improvement in brightness.
[0750] The plasmids for expressing various green fluorescent proteins (GFPs, including eGFP, PlamGFP, hrGFR, Ypet, mCitrine, and mVenus, SEQ ID NOs: 23, 25, 27, 29, 31 and 33, repectively) and red fluorescent proteins (RFPs, including mCherry, TdTomato, dTomato and DsRed, SEQ ID NOs: 35, 37, 39 and 41, respectively) were constructed by replacing the EGFP sequence in Fig. 1C.
[0751] 293 cells were transfected with the constructed plamsids by FuGENE (Promega) according to the manufacturer’s instructions.
[0752] The transfected cells were observed and analyzed with Leica DM6B THUNDER imaging system. As shown in Fig. 3, the PlamGFP showed the highest intensity among the GFPs, while TdTomato and dTomato showed higher intensity than mCherry and DsRed. Considering the large size of TdTomato, PlamGFP and dTomato were selected for further studies.
[0753] Example 3. Screening of fusion of opsins for an optimal optogenetic modulation
[0754] This Example was carried out to screen an optimized fusion of opsins that can provide a desired optogenetic modulation for vision restoration.
[0755] rAAVs were prepared as described in Example 1 with varied transgene plasmids comprising constructs (expression cassettes) as shown in Fig. 4, and were designated as the constructs. The elements in addition to the expression cassette were identical to those shown in Fig. 1C. The Nanoscope construct was designed as a benchmark according to WO 2018 / 106369. The elements in Fig. 4 are detailed as follows:
[0756] CBA: CBA promoter of SEQ ID NO: 1;
[0757] MCO1: nucleotide sequence encoding MCO1, SEQ ID NO: 48;
[0758] ChIEF: nucleotide sequence encoding ChIEF opsin, SEQ ID NO: 42;
[0759] ReaChR: nucleotide sequence encoding ReaChR opsin, SEQ ID NO: 44;
[0760] dTomato: nucleotide sequence encoding dTomato, SEQ ID NO: 38;
[0761] LR: nucleotide sequence encoding LR tag, SEQ ID NO: 77;
[0762] mGluR6: hGRM6 promoter of SEQ ID NO: 3;
[0763] PlamGFP: nucleotide sequence encoding PlamGFP, SEQ ID NO: 24;
[0764] T2A: nucleotide sequence encoding T2A peptide, SEQ ID NO: 79;
[0765] ts: nucleotide sequence encoding TS linker, SEQ ID NO: 18;
[0766] hk: nucleotide sequence encoding HK-beta linker, SEQ ID NO: 20;
[0767] Melanopsin: nucleotide sequence encoding Melanopsin, SEQ ID NO: 84; and
[0768] M-opsin: nucleotide sequence encoding M-opsin, SEQ ID NO: 83.
[0769] The rAAVs were dministered to rd1 mice (Jackson Laboratory, 004766, 6-8 week-old) by an intravitreal (IVT) injection at a dose of 7.5E9 vg / eye (20 eyes / group with wildtype mice as control) .
[0770] Electroretinogram (ERG) detection was conducted 14 and 42 days after the injection. In particular, mice were anesthetized and pupils were dilated with 1%Tropicamide and 1%Atropine. ERGs (RetiMINER-C, IRC) were recorded from the corneal surface using a pair of platinum loop electrodes, along with a ground electrode placed in the tail and a reference electrode in the anterior scalp between the eyes. A drop of Genteal Gel (Alcon) was placed on the cornea to keep it moistened. For scotopic ERG, mice were dark-adapted overnight and stimulated with flashes of steadily increasing light intensity (0.1, 1, 3, and 10 log cds / m2) . The data were analyzed via RetiMINER4.0.
[0771] As shown in Fig. 5, the mice injected with rAAV CBA-3210 showed a significant increase in the response to light at all of the light intensities both 14 days post-injection (Fig. 5A) and 42 days post-injection (Fig. 5B) detection, as compared to the mice injected with rAAV Nanoscope.
[0772] Behavior (light / dark box) test was conducted 28 days after the injection. In particular, the light / dark box is composed of two boxes of the same dimensions (18cm (l) × 20 cm (b) × 18 cm (h) ) , with a hole (7 cm (b) × 5 cm (h) ) in the middle. The light compartment was fitted with white light source at 200 Lux, all mice were age-matched, and their ages ranged 6-8 weeks at time of testing. Wild-type, AAV treated rd1 mice, and rd1 mice were subjected to 2 minutes trials during the light / dark box at light intensity of 200 lux. The mice were dark adaptation for 2 hours before the experiment. Data were collected on the track, distance and average speed of the mice when they first found the hole in the light box and entered the dark box. These data were then analyzed and plotted in Prism 7 (GraphPad Software, La Jolla, CA) . The significance was assessed using a one-way ANOVA, and an α-level of P < 0.05 was considered to be significant.
[0773] As shown in Fig. 6, the mice injected with rAAV CBA-3210 showed the lowest time in the light and lowest time for 1st to the dark, which were comparable to the WT mice, indicating that the vision of the treated rd1 mice was restored to a level comparable to the WT mice.
[0774] Example 4. Codon optimization of the coding sequences
[0775] This Example was carried out to obtain a codon-optimized coding sequence for achieving a desired expression level and therapeutic effect.
[0776] rAAVs were prepared as described in Example 3 with a transgene plasmid comprising a construct (expression cassette) as shown in Fig. 7. The parent nucleotide sequence (SEQ ID NO:46) encoding the fusion polypeptide (SEQ ID NO: 47) was codon optimized as 2838 Co1, 2838 Co2, 2838 Co3 and 2838 Co4 (SEQ ID NOs: 58, 59, 60 and 61, respectively) . The resulted rAAVs were designated as CBA 2838-WT, CBA 2838-Co1, CBA 2838-Co2, CBA 2838-Co3, and CBA 2838-Co4.
[0777] As described in Example 4, the rAAVs were administered to rd1 mice and ERG detection was conducted 14 days (D14) and 21 days (D21) after the injection.
[0778] As shown in Fig. 8, at D14, the mice injected with rAAV CBA 2838-WT showed a significant increase in the response to light as compared to the mice injected with the benchmark, while the mice injected with rAAV CBA-2838-Co1 showed a significant increase in the response to light as compared to the mice injected with the rAAV CBA 2838-WT (Fig. 8A) ; and at D21, the mice injected with rAAV CBA-2838-Co1 also showed a significant increase in the response to light as compared to the mice injected with the rAAV CBA 2838-WT (Fig. 8B) .
[0779] Example 5. rAAVs comprising codon optimized coding sequence
[0780] This Example was carried out to demonstrate the effect of the codon optimized coding sequence for the preferred construct (the fusion polypeptide of SEQ ID NO: 51) .
[0781] The coding sequences for ChIEF, dTomato and ReaChR in the expression cassette CBA-3210 were replaced by those in CBA-2838-Co1 (SEQ ID NOs: 63, 67 and 71, respectively) , and thus, a codon optimized CBA-3210 (referred to as CBA-Cbin-3210GS) , and rAAVs were prepared as described above. The rAAVs and transgene plasmid were designated as the expression cassette.
[0782] 5.1. HEK 293 cells were infected with the rAAVs at an MOI of 3E5 or transfected with the transgene plasmids as described in Example 2 for light induced whole cell patch clamp assay.
[0783] The opto-electrophysiology set up consists of an Olympus upright fluorescence microscope platform with an amplifier system (Axon Multiclamp 700B, Molecular Devices Inc. ) . Parameters of the pipette puller were optimized in order to obtain desired borosilicate micropipettes of resistance from 3 to 5MO for whole-cell patch-clamp electrophysiology. The micropipette was filled with a solution containing 130 mM K-Gluoconate, 7 mM KCl, 2 mM NaCl, 1 mM MgCl2, 0.4 mM EGTA, 10 mM HEPES, 2 mM ATP-Mg, 0.3 mM GTP-Tris and 20 mM sucrose. The electrode was mounted on an XYZ motorized micromanipulator. The standard extracellular solution contained 150 mM NaCl, 10 mM Glucose, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, buffered with 10 mM HEPES (pH 7.3) . The output from the amplifier was digitized using Digidata (Molecular devices) . For electrophysiological recording, the hardware was interfaced with patch-clamp software (pClamp, Molecular Devices) . For the activation of white-opsin-expressing cells, the stimulation beam was delivered by an optical fiber. For generating and controlling pulses of light, the electro-mechanical shutter in the light path was interfaced with a computer. Transistor-transistor logic (TTL) pulses of desired frequency were generated using a Digidata card in order to produce the required pulses of light for activation. Voltage clamp recordings were done in the dark using randomized fluorescent cells derived from three independent experiments. Open-source software (PM MicroManager) and ImageJ (NIH) were used for the acquisition and analysis of fluorescence images, respectively.
[0784] In case of light stimulation using same wavelength, 100 ms pulse stimulation and ~1 s resting time was given between each sweep of electrophysiological recording in cells. For different color stimulations (white light) , 1 min recovery periods were allowed between each patch-clamp recording. pClamp 10 (Molecular Devices) software was used for all patch-clamp data analyses. Two-tailed Student’s t-test and Bonferroni analyses were used to determine any statistically significant differences in fluorescence and patch-clamp recordings.
[0785] As shown in Fig. 9, cells transfected with the plasmid CBA-Cbin-3210GS / infected with the rAAV CBA-Cbin-3210GS showed a higher white light current than CBA-2838-Co1 (Cbin-2838GS in Fig. 9) , indicating a superior light-sensing activity.
[0786] 5.2. As described above, rAAVs were administered to rd1 mice and the ERG detection was conducted 14 days after injection.
[0787] As shown in Fig. 10, the mice injected with rAAV CBA-Cbin-3210GS showed a significant increase in the response to light as compared to the mice injected with the rAAV CBA-2838-Co1 or the benchmark.
[0788] Example 6. Proof of concept study
[0789] This Example was carried out to demonstrate the therapeutic effect of the rAAV expressing the fusion of the present disclosure.
[0790] rAAV CBA-Cbin-3210GS was administered by IVT injection to rd1 mice (n=8) at a dose of 1E10 vg / eye, rAAV CBA-MCO1 was administered as benchmark. The rd1 (negative) and WT (positive) mice administered with PBS were employed as controls. ERG detection and light-dark box test were conducted as described in Example 3.
[0791] As shown in Fig. 11, the mice injected with rAAV CBA-Cbin-3210GS showed a significant increase in the response to light as compared to the benchmark (2.5-3.6 times greater B-wave amplitude) in ERG detection.
[0792] In the light-dark box test, the mice injected with rAAV CBA-Cbin-3210GS showed lower time in light and 1st to the dark, which were both comparable to the WT mice, indicating an superior vision restoration (Fig. 12) .
[0793] A visually driven optomotor behavior test was further conducted to determine the vision restoration. The optomotor reflex was assessed by an automated headtracking system modified from a version previously published (Kretschmer et al., (2015) A system to measure the optokinetic and optomotor response in mice. J Neurosci Methods 256: 91–105. ) . Mice (n=4) were placed and freely moving on a central, elevated platform and presented with vertical sinusoidal grating stimuli rotating (12° / s) horizontally in either a clockwise or counterclockwise direction randomly generated by a virtual cylinder projected onto the four surrounding LCD monitors. The visual stimuli were presented either at maximum contrast (100%) with six different spatial frequencies (0.05, 0.1, 0.15, 0.2, 0.3 cycles / °, see Fig. 13 A) , and a light intensity of 200Lux. Stimulus at each spatial frequency or contrast level lasted 60 s and presented in a randomized order and direction. Each mouse was tested for at least 4 trials and the performances were averaged for analysis.
[0794] As shown in Fig. 13B, the rd1 mice injected with rAAV CBA-Cbin-3210GS showed light-response that was comparable to the WT mice, which is significantly advantageous as compared to the negative control (having an OMR index lower than the cut-off value of 1.1, indicating a loss of response) and benchmark.
[0795] Example 7. Screening of fusion of opsins for an optimal optogenetic modulation
[0796] This Example was carried out to screen an optimized fusion of opsins that can provide a desired optogenetic modulation for vision restoration.
[0797] rAAVs were prepared as described in Example 1 with varied transgene plasmids comprising constructs (expression cassettes) as shown in Fig. 14, and were designated as the constructs.
[0798] The elements in addition to the expression cassette were identical to those shown in Fig. 1C.
[0799] The elements in Fig. 14 are detailed as follows:
[0800] CBA: CBA promoter of SEQ ID NO: 1;
[0801] Cbin: chimeric intron, SEQ ID NO: 17;
[0802] hGHpA: human growth hormone (hGH) polyA signal, SEQ ID NO: 16;
[0803] CHIEF: nucleotide sequence encoding ChIEF opsin, SEQ ID NO: 42;
[0804] ReaChR: nucleotide sequence encoding ReaChR opsin, SEQ ID NO: 44;
[0805] dTomato: nucleotide sequence encoding dTomato, SEQ ID NO: 38;
[0806] tdTomato: nucleotide sequence encoding tdTomato, SEQ ID NO: 36;
[0807] ts: nucleotide sequence encoding TS linker, SEQ ID NO: 18;
[0808] ER: nucleotide sequence encoding a signal peptide of ER export, SEQ ID NO: 86; and PKOPN5: nucleotide sequence encoding Pipistrellus kuhlii opsin5, SEQ ID NO: 92.
[0809] 7.1 Patch Clamp Test
[0810] HEK 293 cells were infected with the rAAVs, and then, subjected to patch clamp test as described in Example 1 with a shorter time period for the stimulation in light. An rAAV expressing ChR2 (see Zhang et al., 2007, Multimodal fast optical interrogation of neural circuitry, Nature, volume 446, pages 633–639) was employed as a reference.
[0811] As shown in Fig. 15, the cells infected with rAAVs 2574TS and 2574TS-ER showed a higher current in response to the light stimulation than the rAAVs 2898TS, 2898TS-ER, and SKG1101 (CBA-Cbin-3210GS) .
[0812] 7.2 Slit lamp recording
[0813] Mice (WT) were injected with the rAAVs as described in Example 1, and detected by Fluorescein angiography (FA) . WT mice injected with PBS were employed as a control.
[0814] In particular, FA was performed on anesthetized mice with dilated pupils to visualize retinal vasculature (Micron IV, Phoenix) . FA images were acquired using a fundus camera with blue light excitation and a barrier filter to detect fluorescence.
[0815] As shown in Fig. 16, mice injected with the rAAVs 2574TS and 2574TS-ER showed a high expression of fluorescent protein, those injected with the rAAVs 2898TS 2898, TS-ER and ChR2 showed a moderate expression of fluorescent protein, those injected with the rAAV 2922TS was weakly expressed, and those injected with the rAAVs 2922TS-ER, SKG1101 and PBS did not show a detectable fluorescent signal over the same threshold.
[0816] 7.3 Restoration of Visual loss
[0817] The rd1 mice were injected with the rAAVs, and WT and rd1 mice injected with PBS were employed as controls. The light-dark box test were conducted as described in Example 3 except a light intensity of 30Lux.
[0818] As shown in Fig. 17, the mice injected with the rAAVs 2898TS, 2898TS-ER, 2574TS and 2574TS-ER, 2922TS, 2922TS-ER and SKG1101 showed comparable time in the light compartment with the WT mice.
[0819] The mice were further subjected to a visually driven optomotor behavior test as described in Example 6 except a light intensity of 20Lux, and spatial frequencies of 0.2 and 0.3 cycles / °.
[0820] The mice injected with rAAVs 2898TS, 2898TS-ER, 2574TS and 2574TS-ER showed an OMR index higher than the cut-off value of 1.1 at 0.2 cycle / degree, which is comparable to the WT mice; while the mice injected with rAAVs 2898TS and 2898TS-ER showed an OMR index higher than the cut-off value of 1.1 at 0.3 cycle / degree.
[0821] Example 8. Dose-dependent therapeutic effect
[0822] This Example was carried out to demonstrate the therapeutic effect of the rAAV, and identify an effective dose.
[0823] rAAV 2898TS-ER (designated as SKG1108) was administered by IVT injection to rd1 mice (n=14 eyes) with doses of 3.2e7 (G5) , 1.6e8 (G4) , 8e8 (G3) , 4e9 (G2) and 2e10 (G1) vg in 2 μL PBS / eye; and the rd1 (negative, G6) and WT (positive, G7) mice administered with PBS were employed as controls.
[0824] The mice were subjected to FA test as described in Example 7, and to ERG detection and light-dark box test as described in Example 3.
[0825] As shown in Figs. 19 and 20, the SKG1108 showed a dose-dependent therapeutic effect. The rd1 mice injected with SKG1108 at higher doses (4e9 and 2e10 vg / eye) showed a time in light compartment comparable to the WT mice (Fig. 21) . The above results were consistent with those shown in Example 7.
Claims
1.A fusion polypeptide comprising a first opsin, a second opsin and a fluorescent protein, wherein the first opsin and the second opsins are sensitive to visible lights of different wavelengths.2.The fusion polypeptide of claim 1, wherein the first opsin is sensitive to a visible light of 400-500nm, and the second opsin is sensitive to a visible light of 550-650nm.3.The fusion polypeptide of claim 1 or 2, wherein the fluorescent protein comprises red fluorescent protein (RFP) and / or green fluorescent protein (GFP) .4.The fusion polypeptide of any one of claims 1-3, wherein the first opsin is ChIEF opsin, or opsin 5.5.The fusion polypeptide of claim 4, wherein the first opsin comprises an amino acid sequence of SEQ ID NO: 43 or 93.6.The fusion polypeptide of any one of claims 1-5, wherein the second opsin is ReaChR opsin.7.The fusion polypeptide of claim 6, wherein the second opsin comprises an amino acid sequence of SEQ ID NO: 45.8.The fusion polypeptide of any one of claims 1-7, wherein the fluorescent protein comprises PlamGFP and / or dTomato.9.The fusion polypeptide of any one of claims 1-8, wherein the fluorescent protein comprises an amino acid sequence of SEQ ID NO: 25 and / or SEQ ID NO: 39.10.The fusion polypeptide of any one of claims 1-9, comprising, from N terminus to C terminus, the first opsin, the fluorescent protein, and the second opsin.11.The fusion polypeptide of claim 10, further comprising a first linker between the first opsin and the fluorescent protein, and a second linker between the fluorescent protein and the second opsin.12.The fusion polypeptide of claim 11, wherein the first and second linkers comprise an amino acid sequence of SEQ ID NO: 19 or 21.13.The fusion polypeptide of claim 11 or 12, wherein the first linker comprises an amino acid sequence of SEQ ID NO: 19.14.The fusion polypeptide of claim 11 or 12, wherein the second linker comprises an amino acid sequence of SEQ ID NO: 21.15.The fusion polypeptide of any one of claims 1-14, comprising an amino acid sequence of SEQ ID NO: 51, 95, 97, 99 or 101.16.A polynucleotide comprising a nucleotide sequence encoding the fusion polypeptide of any one of claims 1-15.17.The polynucleotide of claim 16, comprising a nucleotide sequence of SEQ ID NO: 62, 94, 96, 98 or 100.18.An expression cassette comprising the polynucleotide of claim 16 or 17.19.The expression cassette of claim 18, further comprising a promoter comprising a nucleotide sequence of SEQ ID NO: 1.20.The expression cassette of claim 18 or 19, further comprising an intron of SEQ ID NO: 14 or 17 between the promoter and the polynucleotide.21.The expression cassette of any one of claims 18-20, further comprising an enhancer of SEQ ID NO: 15 upstream of the promoter.22.The expression cassette of any one of claims 18-21, further comprising a polyadenylation signal sequence of SEQ ID NO: 16.23.A vector comprising the polynucleotide of claim 16 or 17 the expression cassette of any one of claims 18-22.24.A recombinant adeno-associate virus (rAAV) comprising a genome comprising the expression cassette of any one of claims 18-22.25.The rAAV of claim 24, wherein the genome further comprises a 5’-ITR of SEQ ID NO: 12 and a 3’-ITR of SEQ ID NO: 13.26.The rAAV of claim 24 or 25, comprising a modified AAV2 capsid encoded by SEQ ID NO: 75.27.A pharmaceutical composition comprising the rAAV of any one of claims 24-26.28.A method of treating vision loss caused by inherited retinal degenerations (IRD) , such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject, comprising administering the rAAV of any one of claims 24-26 or the pharmaceutical composition of claim 27 to an eye of the subject.29.The method of claim 28, wherein the rAAV or the pharmaceutical composition is administered by intravitreal injection.30.Use of the rAAV of any one of claims 24-26 or the pharmaceutical composition of claim 27 in the preparation of a medicament for treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.31.The rAAV of any one of claims 24-26 or the pharmaceutical composition of claim 27, for use in treating vision loss caused by IRD, such as Stargardt’s Disease, Cone Rod Dystrophy, Retinitis Pigmentosa, Leber Congenital Amaurosis, Retinitis Pigmentosa (RP) , Best Juvenile Dystrophy, and Rod-Cone Dystrophies in a subject.