Compounds for use the treatment of cancer, neurodegenerative diseases, psychiatric disorders, inflammation, epilepsy and seizures
New sulfonimidamide derivatives targeting NKCC1 overcome blood-brain barrier limitations and systemic side effects, offering effective treatment for brain cancers and neurological disorders by restoring inhibitory GABA actions.
Patent Information
- Application Number
- PCT/EP2025/059793
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-09
- Filing Date
- 2025-04-09
- Publication Date
- 2025-10-16
AI Technical Summary
Existing treatments for brain cancers and neurological disorders, such as glioblastoma and epilepsies, are limited by the impermeability of the blood-brain barrier and systemic side effects of current diuretics like bumetanide, which inhibit the NKCC1 transporter, leading to suboptimal bioavailability and efficacy.
Development of new compounds, including sulfonimidamide derivatives, that specifically inhibit the NKCC1 transporter to restore inhibitory GABA actions and treat conditions associated with high intracellular chloride levels, such as brain cancers and epilepsies, by formulating them into pharmaceutical compositions for oral or parenteral administration.
The new compounds effectively penetrate the blood-brain barrier, providing targeted treatment for brain cancers and neurological disorders by inhibiting NKCC1, thereby reducing intracellular chloride levels and mitigating disorder severity.
Smart Images

Figure EP2025059793_16102025_PF_FP_ABST
Abstract
Description
[0001] 1
[0002] NEW COMPOUNDS AND THEIR USE AS DRUGS FIELD OF THE INVENTION The invention relates to new compounds and their uses as drugs. PRIOR ART NKCC1 and KCC2, best known as chloride importer and extruder, respectively, play a crucial role in maintaining adequate [Cl-]i levels: low levels underlie the classical inhibitory actions of GABA in adult neurons and high levels are associated with a paradoxical excitatory action of GABA. Excitatory actions & high [Cl-]i levels are observed in pathological conditions, neurons failing to maintain low levels consequently to high activity of NKCC1 and reduced activity of KCC2 (reviewed in Ben-Ari, Y. et al.2007. Physiological Reviews 87(4):1215–68; Savardi, Annalisa et al. 2021. Trends in PharmacologicalSciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci. 40(9):536-554). Excitatory GABAactions have been reported in ASD, Rett, Fragile X, infantile epilepsies and neurodegenerative disorders such as Parkinson, Huntington, etc.; cerebro-vascular infarcts, traumatic injuries, post-traumatic disorder, chronic pain, spinal cord lesions, glioblastoma, severe brain tumors, but also peripheral onesincluding breast and lung cancers (Savardi, Annalisa et al. 2021. Trends in Pharmacological Scienc12):1009-1034; Ben-Ari Y.2017. Trends Neurosci.40(9):536-554). Restoring low [Cl-es42( ]ilevels and inhibitory actions of GABA by a NKCC1 antagonist (such as Bumetanide) attenuates the severity ofmany brain disorders (Savardi, Annalisa et al. 2021. Trends in Pharmacological Sciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci. 40(9):536-554). Pilot trials and larger phase 2 trials have reported an attenuation by bumetanide of the severity of disorders in Fragile X, Tuberous Sclerosis,Down syndrome, or Parkinson Disease (Savardi, Annalisa et al. 2021. Trends in PharmacologicalSciences 42(12):1009-1034; Ben-Ari Y. 2017. Trends Neurosci. 2540(9):536-554; Van Andel, DorindeM et al. 2020. Molecular Autism 11(1):1–14). Likewise, due to its essential role in cell migration,NKCC1 may serve as a specific therapeutic target to decrease cell invasion in patients with primarybrain cancer. NKCC1 inhibitor are able to block the K+ influx mechanism which hindered theestablishment of intracellular ion gradient in cultured glioma cells. In sum, the convergence of experimental and clinical data reflects the importance of the NKCC1 / KCC2 activity and GABA polarity,and particularly bumetanide and furosemide, as promising treatment of many pathologies, includingcancer and brain disorders.Loop diuretics such as bumetanide and furosemide, which are marketed as Bumex and Lasix, respectively, are cornerstones of clinical management of edema and hypertension, with more than 30 million prescriptions each year in the United States. Bumetanide (3-(butylamino)-4-phenoxy-5- sulfamoylbenzoic acid) was introduced in clinical medicine in 1972 as a drug with high diuretic potency(Ingram. 1964. Brit+ish M+edical j-ournal December:1640–41) mediated by an inhibition of NKCC2, acotransporter of Na , K , and Clexpressed in the renal thick of ascending loop of Henle. This site of action led to the classification of these drugs as “loop” diuretics, as opposed to thiazide diuretics, which work in more distal segments of the nephron. Loop diuretics are typically delivered orally or intravenously to treat congestive heart failure and brain edema. When taken orally, the diuretic is absorbed by the intestine, thereby delaying the time to peak effect to 60-90 min, compared to 10-30 min for intravenous administration. Once in the blood, >95% of the diuretic binds to serum albumin thereby reducing its systemic bioavailability. The second target of bumetanide -NKCC1-is widely expressed throughout the body, and in central and peripheral nervous systems. As most of bumetanide in plasma is albumin-bound, only a fraction will diffuse across biological membranes leading to brain levels that are 200-300-fold lower in the brain than the plasma. In addition,the blood brain barrier is quite impermeable to Bumetanide further limiting its central actions inparticular if it is also considered the diuretic side effects. Concerning furosemide, it has been associated 2 with worsening of kidney function in patients treated for volume overload admitted for acute heart failure.Therefore, new use of compounds to inhibit NKCC1 and KCC2 are requested.SUMMARY OF THE INVENTIONOne of the aims of the invention is to provide new use of compounds to provide drugs liable to treatbrain cancers such as glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma. Another aim of the invention is to provide drugs liable to treat neurological disorders includingepilepsies and infantile epilepsies.Another aim of the Invention is to provide new pharmaceutical compositions. Another aim of the Invention is to provide new compounds in order to respond to the technical problem as defined above. DETAILED DESCRIPTION The invention relates to a compound of formula (I): wherein ^Z represents :o wherein R6and R7represent independently : ^a hydrogen,or ^a (C1-C10)alkyl group,oo 3
[0003] ^ said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a halogen atom, a (C1-C3)alcoxy group, a heteroaryl such as imidazole, or a NR2R3group, wherein R2and R3are independently hydrogen, a (C1-C10)alkyl group, or a heteroaryl(C1- C10)alkyl, in particular a furanylmethyl, said above alkyl, aryl and heteroaryl being optionally substituted by one or more halogen atoms,^ R4 represents :o a O-aryl ring, such as group, or 4 oa heteroaryl ring, such as a oxadiazole ring, in particular aring, optionally substituted by one or more (C1-C10)alkyl group, in particular an (C1-C10)alkyloxadiazole,, in particular ring ooo ein m is integer equal to 0 or 1, X1 represents oxygen and X2represents OH, NH2or a (C1-C10)alcoxy , o group wherein R9 represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following pathologies: cancer, in particularglioblastoma, pancreas cancer, prostate cancer, lung cancer, kidney cancer, colon cancer, cerebraldisorders, neurodegenerative or psychiatric, in particular schizophrenia, autistic spectrum disorder, fragile X, Rett syndrome, Down syndrome, Parkinson disease, pathologies associated to an inflammatory state or epilepsies including temporal lobe, epilepsies, infantile epilepsies, partial or generalized seizures that have been shown to be associated with high (Cl-)i levels and failure ofinhibition – with a shift to excitation- by GABA.The invention relates to a compound of formula (I): 5 (I) wherein ^Z represents:o group wherein R5represents NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^ or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or o group wherein R8represents a NHZ1group, wherein Z1is chosen among : -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy group and / or a thiomethoxy group and / or a halogen atom, or 6 o group,^ R1 represents a hydrogen, a (C1-C10)acyl group, in particular group, a (C1-C10)carboxylic acid, a heteroaryl ring, in particular group, said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group,said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o 7 o group wherein R9 represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. It has been unexpectedly found that compounds of formula (I) are inhibitors of the NKCC1 transporters. The expression “NKCC1 transporters” means Na-K-Cl co-transporter isoform 1, and are active cotransporter that bring Na+, K+, and 2 Cl- into the cell and play an important role in intracellular Cl- accumulation. The expression “aryl” means 6 membered aromatic carbon cycles. The expression “heteroaryl” means 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. The expression “pyridine ring” means a 6 membered aromatic cycle containing one nitrogen atom. A The invention comprises compounds of formula (I), a pharmaceutically acceptable salt of said compound, its isomers, in particular under pure form, diastereomers, epimers and enantiomers or a mixture of said isomers, diastereomers, epimers and enantiomers. The expression “pharmaceutically acceptable salt” means all pharmaceutically or physiologicallyacceptable salt forms of the compounds of formula (I) which may be formed, by protonation of anitrogen of an amino group, in particular on the nitrogen of a sulfonamide function, with an inorganic or organic acid, or as a salt of an acid group (such as a carboxylic acid group) with a physiologically acceptable cation. It may also be formed with the carboxylic acid function when R4 or R1 is representing COOH, and the proton of this function is protonating an inorganic or organic base forming a salt. Exemplary base addition salts comprise,: alkali metal salts such as sodium or potassium salts; alkaline earth metal salts such as calcium or magnesium salts; zinc salts; ammonium salts; aliphatic amine salts such as trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, procaine salts, meglumine salts, ethylenediamine salts, or choline salts; aralkyl amine salts such as N,N-dibenzylethylenediamine salts, benzathine salts, benethamine salts; heterocyclic aromatic amine salts such as pyridine salts, picoline salts, quinoline salts or isoquinoline salts;quaternary ammonium salts such as tetramethylammonium salts, tetraethylammonium salts,benzyltrimethylammonium salts, benzyltriethylammonium salts, benzyltributylammonium salts, methyltrioctylammonium salts or tetrabutylammonium salts; and basic amino acid salts such as arginine salts, lysine salts, or histidine salts. Exemplary acid addition salts comprise, mineral acid salts such as hydrochloride, hydrobromide, hydroiodide, sulfate salts (such as, e.g., sulfate or hydrogensulfate salts), nitrate salts, phosphate salts (such as, e.g., phosphate, hydrogenphosphate, or dihydrogenphosphate salts), carbonate salts, hydrogencarbonate salts, perchlorate salts, borate salts, organic acid salts such as acetate, propionate, butyrate, pentanoate, hexanoate, heptanoate, octanoate, cyclopentanepropionate, decanoate, undecanoate, oleate, stearate, lactate, maleate, oxalate, fumarate, tartrate, malate, citrate, 8 succinate, adipate, gluconate, glycolate, nicotinate, benzoate, salicylate, ascorbate, pamoate (embonate), camphorate, glucoheptanoate, or pivalate salts; sulfonate salts such as methanesulfonate (mesylate), ethanesulfonate (esylate), 2-hydroxyethanesulfonate (isethionate), benzenesulfonate (besylate), p- toluenesulfonate (tosylate), 2-naphthalenesulfonate (napsylate), 3-phenylsulfonate, or camphorsulfonate salts; glycerophosphate salts; and acidic amino acid salts such as aspartate or glutamate salts. Preferred pharmaceutically / physiologically acceptable salts of the compounds of formula (I) include a hydrochloride salt, a hydrobromide salt, a mesylate salt, a sulfate salt, a tartrate salt, a fumarate salt, an acetate salt, a citrate salt, and a phosphate salt. The expression “enantiomers” means here two compounds of the same molecular formulae but having a different stereochemical configuration.The expression “isomers” means that the compounds could have several stereogenic centers and thecompounds could be epimers, enantiomers, diastereomers. The expression “isomer” means also positionisomers of substituents. The expression “diastereoisomers” means two compounds of the same formulae but being a non-mirror image and non-identical stereoisomers.The expression “epimers” means one of a pair of two diastereoisomers but having a difference of onlyone stereogenic center. In particular, when Z is representing , R8 is representing NHZ1 and Z1 is representing a (C1-C10-alkyl) group, the compound can be present in two tautomeric forms that are part of the invention. As a non-limiting example, when Z1 is an ethyl group, the compound can be present in two forms: . In particular, the (S) and (R) enantiomers of the sulfonimidamide function are part of the present invention. On the formula (I), the bond between Z and the phenyl moiety, as a substituent on a sp² carbon on the phenyl ring, is to be understood as being possibly on a ortho position to R1, or being possibly on a ortho position to R4. The formula (I) encompass compounds of formula (Ia) : wherein Z, R1, R4 and X have the meaning defined above 9 and compounds of formula (Ib) : wherein Z, R1, R4 and X have the meaning defined above that are part of the invention. A “(C1-C10)alkyl” group means an alkyl group having from 1 to 10 carbon atoms. A “(C1-C10)alcoxy” group means an alkyl group which is singularly bonded to oxygen 1 to 10 carbon atoms. It has the same meaning as alkyloxy. The compound according to the invention can comprise a sulfoximine, a sulfonamide or a sulfone function. The term “prevention” of a disorder or disease as used herein is also well known in the art. For example,a patient / subject suspected of being prone to suffer from a disorder or disease may particularly benefitfrom a prevention of the disorder or disease. The subject / patient may have a susceptibility or predisposition for a disorder or disease, including but not limited to hereditary predisposition. Such a predisposition can be determined by standard methods or assays, using, e.g., genetic markers or phenotypic indicators. It is to be understood that a disorder or disease to be prevented in accordance with the present invention has not been diagnosed or cannot be diagnosed in the patient / subject (for example, the patient / subject does not show any clinical or pathological symptoms). Thus, the term “prevention” comprises the use of a compound of the present invention before any clinical and / or pathological symptoms are diagnosed or determined or can be diagnosed or determined by the attending physician. It is to be understood that the present invention specifically relates to each and every combination of features described herein, including any combination of general and / or preferred features. In particular, the invention specifically relates to each combination of meanings (includinggeneral and / or preferred meanings) for the various groups and variables comprised in formula (I).The term “treatment” of a disorder or disease as used herein is well known in the art. “Treatment” of a disorder or disease implies that a disorder or disease is suspected or has been diagnosed in a patient / subject. A patient / subject suspected of suffering from a disorder or disease typically shows specific clinical and / or pathological symptoms which a skilled person can easily attribute to a specific pathological condition (i.e., diagnose a disorder or disease). The “treatment” of a disorder or disease may, for example, lead to a halt in the progression of the disorder or disease (e.g., no deterioration of symptoms) or a delay in the progression of the disorder or disease (in case the halt in progression is of a transient nature only). The “treatment” of a disorder or disease may also lead to a partial response (e.g., amelioration of symptoms) or complete response (e.g., disappearance of symptoms) of the subject / patient suffering from the disorder or disease. Accordingly, the “treatment” of a disorder or disease may also refer to an amelioration of the disorder or disease, which may, e.g., lead to a halt in the progression of the disorder or disease or a delay in the progression of the disorder or disease. Such a partial or complete response may be followed by a relapse. It is to be understood that a subject / patient may experience a broad range of responses to a treatment (such as the exemplary responses as described herein above). The treatment of a disorder or disease may, inter alia, comprise curative treatment (preferably leading to a complete response and eventually to healing of the disorder or disease) and palliative treatment (including symptomatic relief).According to another embodiment, the invention relates to a compound as defined above of the formula(I), provided that the compound comprises at least one sulfoximine function. 10 According to another embodiment, the invention relates to a compound as defined above of the formula (I), provided that the compound comprises at least one sulfonamide function. According to another embodiment, the invention relates to a compound as defined above of the formula (I), provided that the compound comprises at least one sulfone function. According to another embodiment, the invention relates to a compound as defined above of the formula (I), provided that: -Z represents group and R5 represents a NR6R7 group as defined above,and / or -R1 represents group. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: -Z represents group, R5 represents a NR6R7 group as defined above, and R6 and R7 represent a hydrogen. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: -Z represents group, R5 represents a NR6R7 group as defined above, and R6 and R7 represents independently a hydrogen and a phenyl ring. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: -Z represents group, R5represents a NR6R7group as defined above, and R6and R7 represents independently a hydrogen and a pyridine ring. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: 11 -Z represents group, R8 represents a NHZ1 group and Z1 represents a phenylring optionally substituted by a halogen atom.According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: -Z represents group, R8 represents a NHZ1 group and Z1 represents a pyridine ring optionally substituted a difluoromethoxy group and / or a methoxy group and / or athiomethoxy group. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein: -Z represents group, R8represents a NHZ1group and Z1represents a pyrazine ring. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group and provided that: -Z represents group and R5 represents a NR6R7 group as defined above,- According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: 12 -Z represents group, R5represents a NR6R7group as defined above, and R6and R7represent a hydrogen. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R5represents a NR6R7group as defined above, and R6and R7 represents independently a hydrogen and a phenyl ring. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3group wherein R2and R3are independently hydrogen and a n-butyl group wherein: -Z represents group, R5 represents a NR6R7 group as defined above, and R6 and R7 represents independently a hydrogen and a pyridine ring. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butylgroup wherein:- Z represents group, R8 represents a NHZ1 group and Z1 represents a phenyl ring optionally substituted by a halogen atom.According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R8represents a NHZ1group and Z1represents a pyridine ring optionally substituted a difluoromethoxy group and / or a methoxy group and / or athiomethoxy group. 13 According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R8represents a NHZ1group and Z1represents a pyrazine ring. According to another embodiment, the invention relates to a compound as defined above, of the formula (Ia): wherein Z, R1, R4 and X have the meaning defined above. According to another embodiment, the invention relates to a compound as defined above of the formula (Ib): wherein Z, R1, R4 and X have the meaning defined above. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein Z represents group and R5represents a NR6R7group. According to another embodiment, the invention relates to a compound as defined above, of formula (I): wherein ^Z represents: 14 o group wherein R5 represents NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen, o group wherein R8represents a NHZ1group, wherein Z1is chosen among: lgroup, -a phenyl ring, -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a halogen atom, o group, 15 said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, or o group wherein R9represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. According to another embodiment, the invention relates to a compound as defined above, of formula (I): 16 wherein ^Z represents:o group wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^ ^ R1 represents hydrogen, a (C1-C10)acyl group, in particular group, a heteroaryl ring, 17 said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in ^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents: for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. According to another embodiment, the invention relates to a compound as defined above, of formula (I): wherein ^Z represents: 18 o group wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently : ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or o group wherein R8 represents a NHZ1 group, wherein Z1 is chosen among: -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy and / or a thiomethoxy group and / or a halogen atom,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such as group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. 19According to another embodiment, the invention relates to a compound as defined above, of formula(I): wherein ^Z represents:o group wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or - group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such as group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. 20 According to another embodiment, the invention relates to a compound as defined above, of formula (I): wherein ^Z represents:o group wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,or ^a heteroaryl ring, in particular a pyridine ring,^ group, or group wherein R8represents a NHZ1group, wherein Z1is a pyridine bstituted by a methoxy and / or a thiomethoxy group, o up, 21^ R1 represents a hydrogen, a (C1-C10)acyl group, in particular group, a heteroaryl said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in ^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, or o group wherein R9represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. 22 According to another embodiment, the invention relates to a compound as defined above, having a formula chosen among the following
[0004] 23 NH2NH2O S OO S O O O H H N N H N H N O N NNO30 33 H3C H3C O H3CCH3O H N CH3O S OO H N O 32H3C H N OS NHO H N O 8H3C 24 for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies. The invention relates to a pharmaceutical composition, comprising as active substance a compound of formula (I): 25 wherein ^Z represents:o group wherein R5represents NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^ or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or o group wherein R8represents a NHZ1group, wherein Z1is chosen among : -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy group and / or a thiomethoxy group and / or a halogen atom, or 26 o group,^ R1 represents a hydrogen, a (C1-C10)acyl group, in particular group, a (C1- said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, or 27 o group wherein R9 represents a (C1-C10)alkyl group. According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), provided that : -- According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein:- Z represents group, R5represents a NR6R7group as defined above, and R6and R7 represent a hydrogen. According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein:- Z represents group, R5 represents a NR6R7 group as defined above, and R6 and R7 represents independently a hydrogen and a phenyl ring. According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein:- Z represents group, R5represents a NR6R7group as defined above, and R6and R7 represents independently a hydrogen and a pyridine ring. According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein: 28 -Z represents group, R8represents a NHZ1group and Z1represents a phenyl ring optionally substituted by a halogen atom.According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein:- Z represents group, R8 represents a NHZ1 group and Z1 represents a pyridine ring optionally substituted a difluoromethoxy group and / or a methoxy group and / or athiomethoxy group. According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I) wherein:- Z represents group, R8represents a NHZ1group and Z1represents a pyrazine ring.According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group.According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group and provided that: -Z represents group and R5 represents a NR6R7 group as defined above, According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3group wherein R2and R3are independently hydrogen and a n-butyl group wherein: 29 -Z represents group, R5represents a NR6R7group as defined above, and R6and R7represent a hydrogen. According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R5represents a NR6R7group as defined above, and R6and R7 represents independently a hydrogen and a phenyl ring. According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3group wherein R2and R3are independentlyhydrogen and a n-butyl group wherein:- Z represents group, R5 represents a NR6R7 group as defined above, and R6 and R7 represents independently a hydrogen and a pyridine ring. According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R8 represents a NHZ1 group and Z1 represents a phenyl ring optionally substituted by a halogen atom.According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: -Z represents group, R8 represents a NHZ1 group and Z1 represents a pyridine ring optionally substituted a difluoromethoxy group and / or a methoxy group and / or athiomethoxy group. According to another embodiment, the invention relates to a pharmaceutical composition as defined above of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group wherein: 30 -Z represents group, R8represents a NHZ1group and Z1represents a pyrazine ring. The pharmaceutical compositions can be formulated as dosage forms for oral or parenteral administration. According to another embodiment, the invention relates to a pharmaceutical composition as defined above, comprising as active substance a compound of formula (Ia) : wherein Z, R1, R4and X have the meaning defined above. According to another embodiment, the invention relates to a pharmaceutical composition as definedabove, comprising as active substance a compound of formula (Ib): wherein Z, R1, R4and X have the meaning defined above. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, of formula (I): wherein ^Z represents: 31 o group wherein R5 represents NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen, o group wherein R8represents a NHZ1group, wherein Z1is chosen among: lgroup, -a phenyl ring, -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a halogen atom, o group, 32 said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, or o group wherein R9represents a (C1-C10)alkyl group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, of formula (I): wherein ^Z represents: 33 o group wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,o ^ R1 represents hydrogen, a (C1-C10)acyl group, in particular group, a heteroaryl ring, said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup 34 said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, or o group wherein R9represents a (C1-C10)alkyl group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, of formula (I): wherein ^Z represents:o group wherein R5represents a NR6R7group, wherein R6and R7represent independently : ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or o group wherein R8 represents a NHZ1 group, wherein Z1 is chosen among: -a (C1-C10)alkyl group, 35 or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy and / or a thiomethoxy group and / or a halogen atom,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such as group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, of formula (I): wherein ^Z represents:o independently: ^a hydrogen, ^a phenyl ring, ^a heteroaryl ring, in particular a pyridine ring, 36 - group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such as group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, of formula (I): wherein ^Z represents:o group wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,or ^a heteroaryl ring, in particular a pyridine ring,^ group, or 37 - group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group, o group,^ R1 represents hydrogen, a (C1-C10)acyl group, in particular group, a heteroaryl ring, said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, 38 or o group wherein R9 represents a (C1-C10)alkyl group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, having a formula chosen among the following
[0005] 39 40 .According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I), wherein R1represents group. According to another embodiment, the invention relates to a compound as defined above of the formula (I), wherein X represents a NR2R3group wherein R2and R3are independently hydrogen and a n-butyl group. 41According to another embodiment, the invention relates to a pharmaceutical composition as definedabove of the formula (I), wherein X represents a NR2R3 group wherein R2 and R3 are independently hydrogen and a n-butyl group and wherein R1 represents group. According to another embodiment, the invention relates to the pharmaceutical composition as defined above, in a unitary form comprising from 0.033 mg to 200 mg of active substance (for a human being weighing 70 kg). According to another embodiment, the invention relates to the pharmaceutical composition as defined above, formulated for an administration of active substance at a range of 0.00047 mg / kg to 2.86 mg / kg of body weight. According to another embodiment, the invention relates to a method of treatment of a patient in need thereof comprising the administration of a pharmaceutical composition as defined above, so that the active substance is administrated at a dose of 0.1 mg / day to 200 mg / day, preferably from about 0.5 mg / day to about 100 mg / day. The invention relates to a compound of formula (I): wherein ^Z represents:o group wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,or ^a heteroaryl ring, in particular a pyridine ring,^ group, or 42 - group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group, o group,^ R1 represents hydrogen, a (C1-C10)acyl group, in particular group, a heteroaryl ring, said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particular ring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such as group, 43 or o group wherein R9 represents a (C1-C10)alkyl group. According to another embodiment, the invention relates to a compound as defined above, of formula (Ia) : wherein Z, R1, R4and X have the meaning defined above. According to another embodiment, the invention relates to a compound of formula (Ib): wherein Z, R1, R4and X have the meaning defined above. According to another embodiment, the invention relates to the compound as defined above, of formula (I): wherein ^Z represents:o group wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently: 44 ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring, ring optionally substituted by a methoxy and / or a thiomethoxy group,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such as group. According to another embodiment, the invention relates to the compound of formula (I): wherein ^Z represents:o group wherein R5represents NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^ group, or 45 ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or o group wherein R8 represents a NHZ1 group, wherein Z1 is chosen among : -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy group and / or a thiomethoxy group and / or a halogen atom, o group,^ 46 said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in ^ X represents NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group,said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents: According to another embodiment, the invention relates to the compound as defined above, having a formula chosen among the following 47 48 . The invention relates to a process of preparation of a compound of formula (II) as defined above: wherein ^R25 and R26 are independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group,(C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkylgroup, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1- C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- 49 C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro,fused, bridgehead or a combination of these forms, or ^R25 and R26 together with the nitrogen atom bearing them forming a C4-C10 memberedheterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfurand oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead, acombination of these forms or fused with an aryl ring, optionally containing one to four heteroatoms chosen among nitrogen, sulfur and oxygen, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1- C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, an aryl ring or (C1- C10)acyl group, ^R21 is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring, a heteroaryl ring, aryl(C1-C10)alkylgroup, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms,^ R22A and R22B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino,hydroxy or NR27R28, or R22Aand R22Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur andoxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination ofthese forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group,^ R24 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms,(C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28 or (C1-C10)acylamino group,^ R29 is representing: 50 O ^a group wherein R23 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3- C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ group wherein R32 and R33 represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkylgroup, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR27R28, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3- C10)cycloalkyl(C1-C10)alkylcarbonylamino group,^ R27 and R28 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, or R27and R28together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur andoxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination ofthese forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps: a) a silylation step of a compound of formula (XLVI): wherein R22A, R22B and R24 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O- heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- 51 C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group wherein R27and R28have the meaning defined above with a compound of formula (XLVII): wherein R34, R35and R36are representing independently a methyl group, an ethyl group, an isopropyl group, a butyl group, a tert-butyl group or an aromatic group, to obtain a compound of formula (XXXVIII): wherein GP1, R22A, R22B, R24, R34, R35and R36have the meaning defined above b) a substitution on said compound of formula (XXXVIII) to replace one of the oxygens on the radical in particular with dichlorotriphenylphosphorane or a mixture of PPh3and (CCl3)2and HNR25R26, wherein R25 and R26 have the meaning defined above, to obtain a compound of formula (XLIX): wherein GP1, R2A, R2B, R24, R25, R26, R34, R35and R36have the meaning defined above, c) a deprotection of the silyl function of said compound (XLIX), in particular with acidic acetonitrile, to obtain a compound of formula (L): 52 wherein GP1, R22A, R22B, R24, R25and R26have the meaning defined above said compound being of said formula (XXII) when and possibly, d) ^an addition of R21-B(OH)2 wherein R21 is representing an aryl ring or a heteroaryl ring, on saidcompound of formula (L), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, to obtain a compound of formula (LI): wherein GP1, R21, R22A, R22B, R24, R25and R26have the meaning defined above, said compound being of formula (XXII) when or^ an addition of formaldehyde on said compound of formula (L),to obtain a compound of formula (LI): 53 wherein GP1R22A, R22B, R24, R25and R26have the meaning defined above and R21is representing a methyl group, said compound being of formula (XXII) when or^ an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1-C10)alkyl-Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl- Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3- C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1-C10)alkyl-Br group, heteroaryl(C3-C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group on said compound of formula (XXX), in particular with K2CO3, KH or NaH said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, to obtain a compound of formula (LI): wherein GP1, R22A, R22B, R24, R25 and R26 have the meaning defined above and R1 is representing (C1-C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1- C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3- 54 C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkylgroup or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, on said compound of formula (XXX), in particular with K2CO3, KH or NaH said compound being of formula (II) when and possibly, e) a saponification of said compound of formula (L) or formula (LI), in particular with LiOH, NaOH or KOH, to obtain a compound of said formula (XXII) wherein , and possibly, O f) an amidation of one compound of said formula (XXII) wherein R29 is and R23 is OH with HNR32R33, wherein R32and R33have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uronium, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3- tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate, to obtain a compound of formula (XXII) wherein group, said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. This process described above is a process of preparation of compounds of formula (II) that are part of the sulfonimidamide class. The step d) is optional when R21 is representing a hydrogen The step e) is optional if the compound is part of the ester class. The compound obtained at the end of step f) is part of the amide class. This process comprising the 3 following steps : a), b) and c) is part of the invention. This process comprising the 4 following steps : a), b), c) and d) is part of the invention. This process comprising the 4 following steps : a), b), c) and e) is part of the invention. This process comprising the 5 following steps : a), b), c), d) and e) is part of the invention. This process comprising the 5 following steps : a), b), c), e) and f) is part of the invention. 55 This process comprising the 6 following steps : a), b), c), d), e) and f) is part of the invention. In this particular embodiment, the step a) is a silylation step of a compound of formula (XLVI) with a compound of formula (XLVII), for instance at a temperature from 0°C to 100 °C, preferably at 50°C during 18 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tert butyl methyl ether, tert- butyl ethyl ether, methyltetrahydrofuran, 1,4-dioxane or methoxycyclopentane, preferablytetrahydrofuran and a tertiary or aromatic amine as a base among triethylamine, diisopropylamine,pyridine or dimethylaminopyridine. In this particular embodiment, the step b) is a substitution step on the sulfur atom of a compound of formula (XLVIII) to synthesize the sulfonimidamide function; using for instance dichloro triphenyl phosphorane or triphenylphosphine and hexachloroethane in chloroform or dichloromethane or THF, preferably chloroform at a temperature from -50°C to 75°C, preferably 0°C. In this particular embodiment, the step c) is a deprotection step of the silyl function of a compound of formula (XLIX) using for instance acidic acetonitrile at a temperature from -20°C to 100°C, preferably at 20°C, or using a source of fluorine ion in particular tetrabutyl ammonium fluoride or potassium fluoride or cesium fluoride in THF at 20°C. In this particular embodiment, the step d) is an addition step of R21-B(OH)3on a compound of formula (L) for instance at a temperature from 20°C to 200°C, preferably 100°C during 16 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, The invention relates to a process of preparation of a compound of formula (XXIII) as defined above, wherein^ Xa is representing a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, said above groups optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group or nitro,^ R21 is representing hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, anaryl ring, a heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C1-C10)alcoxy group, aryl(C3- C10)cycloalkyl group, aryl(C3-C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group, said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, 56^ R22A and R22B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino,hydroxy or NR27R28, or R22Aand R22Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur andoxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination ofthese forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group,^ R24 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms,(C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28 or (C1-C10)acylamino group,^ R29 is representing:O ^a group wherein R23is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3- C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group ^ group wherein R22 and R23 represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3- C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkylgroup, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR27R28, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, or (C3- C10)cycloalkyl(C1-C10)alkylcarbonylamino group ^ ^R27 and R28 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or(C3-C10)cycloalkyl(C1-C10)alkyl group, 57 or R27 and R28 together with the nitrogen atom bearing them forming a C3-C12 membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur andoxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combinationof these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, comprising the following steps:a) a reduction, on a compound of formula (LII): wherein Y is representing a fluorine, a chlorine or a bromine, in particular with PPh3 or SnCl2 or zinc powder to obtain a compound of formula (LIII): wherein Y have the meaning defined aboveb) an addition of the Xa and GP1 groups, in particular the addition of^ Xa-Z and Gp1-Z in particular with Xa-Z and a base, in particular iodomethane and Cs2CO3or K2CO3 ^Xa-Z and Gp1-OH, in particular with Xa-Z and an aqueous base, in particular MeI andaqueous NaOH in a first step, then with a coupling reagent and Gp1-OH in particular with1- Ethyl-3-(3-dimethylaminopropyl)carbodiimide and 4-dimethylaminopyridine in Gp1-OH or with an alcohol and an acid in particular with Gp1-OH and sulfuric acid, ^Xa-Z and Gp1-OH, in particular with an alcohol and an acid, in particular with Gp1-OH andsulfuric acid, in particular with methanol and sulfuric acid in a first step, then with X-Z and a base, in particular MeI and Cs2CO3or K2CO3wherein Z is representing bromine or a iodine and and Xa have the meaning defined above 58 on said compound of formula (LIII), to obtain a compound of formula (LIV): wherein Y, GP1 and Xa have the meaning defined abovec) an aromatic nucleophilic substitution of said compound (LIV) with R24-OH, wherein R24 has themeaning defined above, in particular with K2CO3or Cs2CO3, NaOMe, triethylamine, N,N- diisopropylethylamine or 1,8-diazabicyclo[5.4.0]undec-7-ene to obtain a compound of formula wherein GP1, Xaand R24have the meaning defined aboved) an oxidation of said compound of formula (LV), in particular with (diacetoxyiodo)benzene and anammonium provider, such as ammonium carbamate, ammonium carbonate, ammonia or ammonium acetate, to obtain a compound of formula (LVI): wherein GP1, Xa and R24 have the meaning defined abovee) a reduction of said compound of formula (LVI) to obtain a compound of formula (LVII): 59 in particular with palladium and hydrogen, FeCl2, ZnCl2or SnCl2in aqueous ammonium chloride, wherein GP1, Xa and R24 have the meaning defined above f) ^a reductive amination of said compound of formula (LVII), by addition of a compound offormula (LVIII) or (LIX) and a reductive agent, in particular NaBH(OAc)3or NaBH3CN: T2A(LVIII) being O (LIX) being wherein T2Aand T2Brepresent independently hydrogen, (C1-C9)alkyl group, (C10-C11)alkyl group optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR27R28,^ an alkylation of said compound of formula (XXXVII), by addition of a compound offormula (LX) or (LXI) or of compounds of formulae (LX) and (LXI) and a base, in particular Cs2CO3or K2CO3, (LX) beingR2A Hal(LXI) being R2B Halwherein Hal is representing a chlorine or a bromine to obtain a compound of formula (LXII): wherein GP1, R24and Xahave the meaning defined above and R22A, R22Bare representing hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3- 60 C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3- C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino,hydroxy or NR27R28, or ^an arylation of said compound of formula (LVII), in particular a palladium or copper-catalysed, by addition of a compound of formula (LXIII) or (LXIV) or of compounds of formulae (LXIII) and (LXIV) and a catalyst, in particular chosen among copper (II) acetate, palladium diacetate, tris(dibenzylideneacetone)dipalladium (0) or palladium (II) [1,1'- bis(diphenylphosphanyl)ferrocene] dichloride (LXIII) beingR22A M(LXIV) beingR22B Mwherein R22Aand R22Bare representing independently an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1- C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino, hydroxy or NR27R28, wherein M is representing a chlorine or a bromine wherein Mx1 and Mx2 are representing independently a hydrogen or a (C1-C6) alkyl group, Mx1 and Mx2 being possibly linked by a covalent bond or ^a nucleophilic aromatic substitution of said compound of formula (LVII), by addition ofcompounds of formulae (LXV) and (LXVI) and a base, in particular triethylamine,(LXV) beingR22A F(LXVI) being R22B Fto obtain a compound of formula (LXII): wherein GP1, R24 and X have the meaning defined above and R22A, R22B are representing independently a hydrogen, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, 61 said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino,hydroxy or NR27R28, or ^a double alkylation of said compound of formula (LVII), by addition of a compound offormula (LXVIII) and a base, in particular Cs2CO3, K2CO3or triethylamine, wherein Hal is representing a chlorine or a bromine and n is a positive integer being from 4 to 10 to obtain a compound of formula (LXIX): wherein GP1, R24and Xahave the meaning defined above and R2Aand R2Btogether with the nitrogen atom bearing them forming a C4-C10 membered heterocycle, optionally containingone or more heteroatoms chosen among nitrogen, sulfur and oxygen, said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or acombination of these forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group, said compounds of formulae (LXII) or (LXIX) being of formula (XXIII) when = GP1and R21= H and possibly, g) ^an addition of R21-B(OH)2 wherein R21 is representing an aryl ring or a heteroaryl ring, on oneof compounds of formulae (LXII) or (LXIX), in particular with Cu(OAc)2, said aryl or heteroaryl ring optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3-C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3-C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, to obtain a compound of formula (LXX): 62 wherein GP1, R21, R22A, R22B, R24and Xahave the meaning defined above, said compound being of formula (XXIII) when or ^an addition of formaldehyde, on one of compounds of formulae (LXII) or (LXIX),to obtain a compound of formula (LXX): wherein GP1 R22A, R22B, R24 and Xa have the meaning defined and R21 is representing a methyl group, said compound being of formula (XXIII) when , or ^an addition of (C1-C10)alkyl-Br group, (C3-C10)cycloalkyl-Br group, a (C3-C10)cycloalkyl(C1-C10)alkyl-Br group, a (C3-C10)heterocycloalkyl-Br group, a (C3-C10)heterocycloalkyl(C1- C10)alkyl-Br group, an aryl(C1-C10)alkyl-Br group, an aryl(C1-C10)alcoxy-Br group, an aryl(C3- C10)cycloalkyl-Br group, an aryl(C3-C10)cycloalkyl(C1-C10)alkyl-Br group, heteroaryl(C1-C10)alkyl-Br group, heteroaryl(C3-C10)cycloalkyl-Br group or heteroaryl(C3-C10)cycloalkyl(C1- C10)alkyl-Br group on said compound of formula (XXX), in particular with K2CO3, KH or NaH said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group 63 said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, to obtain a compound of formula (LXX): wherein GP1, R22A, R22B, R24and Xahave the meaning defined above and R21is representing (C1-C10)alkyl group, (C3-C10)cycloalkyl group, a (C3-C10)cycloalkyl(C1-C10)alkyl group, a (C3- C10)heterocycloalkyl group, a (C3-C10)heterocycloalkyl(C1-C10)alkyl group, an aryl(C1- C10)alkyl group, an aryl(C1-C10)alcoxy group, an aryl(C3-C10)cycloalkyl group, an aryl(C3- C10)cycloalkyl(C1-C10)alkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkylgroup or heteroaryl(C3-C10)cycloalkyl(C1-C10)alkyl group said group optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acyl group, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group, said above cycloalkyl and heterocycloalkyl being possibly mono- or polycyclic, spiro, fused,bridgehead or a combination of these forms, said compound being of formula (XXIII) when , and possibly,h) a saponification of one of compound of formulae (LXII), (LXIX) or (LXX), in particular with LiOH,NaOH or KOH, to obtain a compound of said formula (XXIII) wherein is OH, and possibly, Oi) an amidation of a compound of said formula (XXIII) wherein R29 is and R23 is OH with HNR32R33, wherein R32 and R33 have the meaning defined above, in particular with N,N- diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1-ethyl-3- (3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido-1,1,3,3- tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium 64 hexafluorophosphate, to obtain a compound of formula (III) wherein R29is representing , or after step h),j) an amidation, followed by a dehydration, followed by a cyclization of a compound of said formulaO (XXIII) wherein R29 is and R23 is OH, in particular with 1,1'-carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), followed by sodium azide and ammonium chloride (cyclization), to obtain a compound of formula (XXIII) wherein R29 is representing ring,said above mentioned alkyl groups being linear or branched,said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms. This process described above is a process of preparation of compounds of formula (XXIII) that belong to the sulfoximine class. The step g) is optional when R21is representing a hydrogen The step h) is optional if the compound is part of the ester class. The compound obtained at the end of step i) is part of the amide class. The compound obtained at the end of step j) is part of the tetrazole class. This process comprising the 6 following steps : a), b), c), d), e) and f) is part of the invention. This process comprising the 7 following steps : a), b), c), d), e), f) and g) is part of the invention. This process comprising the 7 following steps : a), b), c), d), e), f) and h) is part of the invention. This process comprising the 8 following steps : a), b), c), d), e), f), g) and h) is part of the invention. This process comprising the 8 following steps : a), b), c), d), e), f), h) and i) is part of the invention. This process comprising the 9 following steps : a), b), c), d), e), f), g), h) and i) is part of the invention. This process comprising the 9 following steps : a), b), c), d), e), f), h), i) and j) is part of the invention.This process comprising the 10 following steps : a), b), c), d), e), f), g), h), i) and j) is part of theinvention. In this particular embodiment, the step a) is a reduction step of a compound of formula (LII) for example at a temperature from 0°C to 200°C, preferably 100°C for 16 hours. In this particular embodiment, the step b) is an addition step of X and / or GP1 group(s) on a compound of formula (LIII), for instance at a temperature at a temperature from -20°C to 100°C, in particular at 20°C in a polar solvent chosen among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular dimethylformamide. In this particular embodiment, the step c) is an aromatic nucleophilic substitution step of R24-OH on a compound of formula (LIV) for instance at a temperature from 20°C to 200°C, in particular 100°C in a polar solvent chosen among dimethylformamide, dimethylsulfoxide, butanone, 1-4 dioxane, hexamethylphosphoramide or dimethylacetamide, in particular dimethylformamide. 65 In this particular embodiment, the step d) is an oxidation step on a compound of formula (LV) to synthesize the sulfoximine function. The reaction is carried out for instance at a temperature from -75°C to 80 °C, in particular 20°C in a polar protic solvent chosen among methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol. In this particular embodiment, the step e) is a reduction step of a compound of formula (LVI), for instance at a temperature from -50°C to 100°C, preferably 20°C in a polar protic solvent chosen among methanol, ethanol, isopropanol, butanol, hexafluoroisopropanol, in particular methanol. In this particular embodiment, the step f) is an addition step on a compound of formula (LVII), for instance at a temperature from -50°C to 100°C, preferably 20°C in a solvent chosen among dichloromethane, chloroform, 1,2-dichloroethane, tetrachloroethane and tetrahydrofuran, in particular 1,2-dichloroethane. In this particular embodiment, the step g) is an addition step of a compound of formula R21-B(OH)2on a compound of formula (LXII) or (LXIX), for instance at a temperature from 20°C to 200°C, preferably 100°C during 16 hours in a cyclic ether as a solvent chosen among tetrahydrofuran, diethyl ether, dimethoxymethane, dimethoxyethane, diethoxymethane, tetrahydrofuran, tert-butyl-methyl ether, tert- butyl-ethyl ether, methyl-tetrahydrofuran, 1,4-dioxane or methoxycyclopentane, preferably 1,4- dioxane. In this particular embodiment, the step h) is a saponification step of one compound of formulae (LXII), (LXIX) or (LXX), for instance at a temperature from -50 °C to 75 °C, preferably at 20°C. The invention relates to a process of preparation of a compound of formula (XXIV) as defined above, wherein^ R30 and R31 are representing independently a hydrogen and an aryl or an aryl and a hydrogen,said aryl is optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group, arylcarbonylamino group, heteroarylcarbonylamino group, (C1-C10)alkylcarbamoyl group, (C3- C10)cycloalkylcarbamoyl group or (C3-C10)cycloalkyl(C1-C10)alkylcarbamoyl group^ R22A and R22B represent independently hydrogen, (C1-C10)alkyl group, (C11-C12)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3- C10)heterocycloalkyl(C1-C10)alkyl group, an aryl ring or heteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group or heteroaryl(C3-C10)cycloalkyl group, said above alkyl and aryl being optionally substituted by one or more deuterium, halogen atoms, (C3-C10)cycloalkyl group, (C1-C10)alcoxy group, (C3-C10)heterocycloalkyl group, nitro, amino,hydroxy or NR27R28, or R22Aand R22Btogether with the nitrogen atom bearing them forming a C4-C10membered heterocycle, optionally containing one or more heteroatoms chosen among nitrogen, sulfur andoxygen, 66 said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination ofthese forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C1-C10)alcoxy group or (C3-C10)heterocycloalkyl group,^ R24 is representing a phenyl ring, optionally substituted by one or more deuterium, halogen atoms,(C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1- C10)alcoxy group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, nitro, amino, hydroxy, NR27R28 or (C1-C10)acylamino group,^ R29 is representing:O oa group wherein R23 is representing OH, (C1-C10)alcoxy group, (C3- C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1-C10)alcoxy group, (C3-C10)heterocycloalkyl(C1- C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2- C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3-C10)cycloalkyl(C1- C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3-C10)cycloalcoxy group, orheteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group o group wherein R32and R33represent independently hydrogen, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C3-C10)heterocycloalkyl group, (C3-C10)heterocycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group, an aryl ring orheteroaryl ring, aryl(C1-C10)alkyl group, aryl(C3-C10)cycloalkyl group, heteroaryl(C1-C10)alkyl group, heteroaryl(C3-C10)cycloalkyl group, optionally substituted by one or more deuterium, halogen atoms, amino, hydroxy, (C1-C10)alcoxy group, NR27R28, (C1-C10)acylamino group, (C3- C10)cycloalkylcarbonylamino group, or (C3-C10)cycloalkyl(C1-C10)alkylcarbonylamino group oo ^ R27 and R28 are representing independently a (C1-C10)alkyl group, (C3-C10)cycloalkyl group or (C3-C10)cycloalkyl(C1-C10)alkyl group, or R27and R28together with the nitrogen atom bearing them forming a C3-C12membered heterocycle, optionally containing one to four heteroatoms chosen among nitrogen, sulfur andoxygen, 67 said heterocycles being possibly mono- or polycyclic, spiro, fused, bridgehead or a combination ofthese forms, optionally substituted by one or more deuterium, halogen atoms, (C1-C10)alkyl group, (C3-C10)cycloalkyl group, (C3-C10)cycloalkyl(C1-C10)alkyl group, (C1-C10)alcoxy group or (C3- C10)heterocycloalkyl group, comprising the following steps:a) an addition of an Ph-Hal group, in particular with CuI, N,N′-dimethylethylenediamine andpotassium carbonate, wherein Hal is representing a bromine or a iodine, on a compound of formula wherein R22A, R22B and R24 have the meaning defined above and GP1 is a protecting group, in particular representing (C1-C10)alcoxy group, (C3-C10)cycloalcoxy group, (C3-C10)cycloalkyl(C1- C10)alcoxy group, (C3-C10)heterocycloalkyl(C1-C10)alcoxy group, a (C2-C10)alkenyloxy group comprising 1 to 3 alkenyl function, a (C2-C10)alkynyloxy group comprising 1 to 3 alkynyl function, O-aryl ring, O-heteroaryl ring, aryl(C1-C10)alcoxy group, aryl(C3-C10)cycloalcoxy group, aryl(C3- C10)cycloalkyl(C1-C10)alcoxy group, heteroaryl(C1-C10)alcoxy group, heteroaryl(C3- C10)cycloalcoxy group, or heteroaryl(C3-C10)cycloalkyl(C1-C10)alcoxy group, to obtain a compound of formula (LXXIII): wherein GP1, R22A, R22B and R24 have the meaning defined above, said compound being of formula (XXIV) when , and possibly,b) a saponification of said compound of formula (LXXIII), in particular with LiOH, NaOH or KOH,to obtain a compound of said compound of formula (IV), wherein , 68 and possibly, oc) a step of amidation followed by a dehydration of said compound of formula(XXIV), wherein particular with 1,1'- carbonyldiimidazole and an ammonia solution (amidation) followed by pyridine and trifluoroacetic anhydride or thionyl chloride in dimethylformamide or phosphorus pentoxide in methanol, chloroform or toluene (dehydration), to obtain a compound of formula (LXXIV): wherein R22A, R22B and R24 have the meaning defined above, and, od) a cyclization of said compound of formula (LXXIV), in particular with sodiumazide and ammonium chloride, to obtain a compound of formula (XXIV) whereinR9 is representing or od’) a step of addition of HO-NH followed by a cyclization on said compound offormula (LXXIV), in particular with hydroxylammonium chloride and NaHCO3(addition of HO-NH) followed by 1,1'-carbonyldiimidazole and 1,8- diazabicyclo[5.4.0]undec-7-ene (cyclization), to obtain a compound of formula (XXIV) wherein R29 is representing ring, or after step b), Oe) an amidation of said compound of formula (XXIV) wherein R29 is representing and R23 is representing OH, with HNR32R33, wherein R32 and R33 have the meaning defined above, in particular with N,N-diisopropylethylamine and hexafluorophosphate azabenzotriazole tetramethyl uranium, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, hydroxybenzotriazole, (2-succinimido- 1,1,3,3-tetramethyluronium tetrafluoroborate) or 2-(1H-benzotriazol-1-yl)-1,1,3,3- 69 tetramethyluronium hexafluorophosphate, to obtain a compound of formula (XXIV) wherein R29 isa representing group,said above mentioned alkyl groups being linear or branched, said above mentioned aryl rings being 6 membered aromatic carbon cycles said above mentioned heteroaryl rings being 5 or 6 membered aromatic cycles containing at least one or more heteroatoms chosen among nitrogen, sulfur and oxygen atoms.This process described above is a process of preparation of compounds of formula (XXIV) that belongto the sulfonamide class. The step b) is optional if the compound is part of the ester class. The compound obtained at the end of step b) is part of the carboxylic acid class. One step chosen among d) or d’) is mandatory if step c) is implemented The compound obtained at the end of step d) is part of the tetrazole class. The compound obtained at the end of step d’) is part of the oxadiazolone class. The compound obtained at the end of step e) is part of the amide class. This process comprising the 1 following steps : a) is part of the invention. This process comprising the 2 following steps : a) and b) is part of the invention. This process comprising the 4 following steps : a), b), c) and d) is part of the invention. This process comprising the 4 following steps : a), b), c) and d’) is part of the invention. This process comprising the 3 following steps : a), b) and e) is part of the invention. LIST OF FIGURES Figure 1. Functional NKCC1 assay+s. A. Co+ntribution of NKCC1 to K influx in native HEK293 cells under isosmotic (basal) conditions.K influx was measured in untreated cells (Cntr), cells exposed to 100 µM ouabain (ouab), 20 µM bumetanide (bum), or both. B. Signal separation between native HEK293 cells with andwithout 20 µM bumetanide. Cells were tested in a hypertonic saline and in the presence of 100 µM ouabain. These con+ditions became our standard conditions for drug tes+ting. C. Absence ofbumetanide-sensitive K influx in Δ-NKCC1 HEK293 cells. Note that the K influx was reduced to basal levels. Figure 2. Diagram of a transwell assay. (A) Transwell insert(B) Upper compartment(C) Microporous membrane(D) Lower compartment(E) MigrationFigure 3. Cancer cell spheroid of U87MG cells at the beginning of a spheroid migration assay as seen with a brightfield microscope (Magnification 4x) Figure 4. Cancer cell spheroid of U87MG cells on a spheroid migration assay after 18 hours of being incubated with DMSO as seen with a brightfield microscope (Magnification 4x) Figure 5. Cancer cell spheroid of U87MG cells on a spheroid migration assay after 18 hours of being incubated with 11 (Magnification 4x) Pour les figures concernant le MTT, Figure 6. MTT assay of a cancer cell of U87MG (magnification X4) Figure 7. MTT assay of a cancer cell of U87MG (Magnification X4)Figure 8. MTT assay of a cancer cell of U87MG with 10 µM of 31 (Magnification X4)Figure 9. MTT assay of a cancer cell of U87MG with 10 µM of 31 (Magnification X4) 70Figure 10. MTT assay of a cancer cell of U87MG with 30 µM of 31 (magnification X4)Figure 11. MTT assay of a cancer cell of U87MG with 30 µM of 31 (Magnification X4)Figure 12. B50 suppresses GDP in hippocampal slices from P4-6 mice.A characteristic feature of the immature hippocampus is the occurrence of spontaneous network events that have been termed as giant depolarizing potentials (GDPs) (Ben-Ari et al., 1989). GDP activity is extremely sensitive to NKCC1 block by bumetanide (Silipä et al., 2005; Spoljaric et al., 2017)and therefore we used it for the estimation of pharmacodynamic effects of B50 and B64. B50potently blocked GDPs recorded by whole-cell patch-clamp (Vh=-70 mV) in CA3 pyramidal neurons in hippocampal slices from neonate (P4–6) mice (Figure 1A). B50 (1 µM) inhibited current density of GDPs to 0.27±0.04 of control (n=7, two-tailed, pared t-test, p=3*e-6), at concentration of 10 µM inhibition of GDPs activity was 0.04±0.01 of control (Figure 1B, n=6, two-tailed, pared t-test, p=3*e-8), with IC50of approximately 317 nM (Figure 1 C). Thus, B50 potently suppress the GABAAR-mediated depolarization in hippocampus of the neonatal mice. A characteristic feature of the immature hippocampus is the occurrence of spontaneous network events that have been termed as giant depolarizing potentials (GDPs) (Ben-Ari et al., 1989). GDP activity is extremely sensitive to NKCC1 block by bumetanide (Silipä et al., 2005; Spoljaric et al., 2017) andtherefore we used it for the estimation of pharmacodynamic effects of B50 and B64. B50 potentlyblocked GDPs recorded by whole-cell patch-clamp (Vh=-70 mV) in CA3 pyramidal neurons inhippocampal slices from neonate (P4–6) mice (Figure 1A). B50 (1 µM) inhibited current density of GDPs to 0.27±0.04 of control (n=7, two-tailed, pared t-test, p=3*e-6), at concentration of 10 µ f GDPs activity was 0.04±0.01 of control (Figure 1B, n=6, two-tailed, pared t-test, p=3*e-M inhibition o8), with IC50 of approximately 317 nM (Figure 1 C). Thus, B50 potently suppress the GABAAR-mediated depolarization in hippocampus of the neonatal mice. (INsert Hippocampal slcie with electrode positioning. Figure 13. B50 blocks seizure-like events (SLE) triggered by tetanus stimulation in CA1 area of hippocampal slices from p14-p15 miceUse of bumetanide to block the activation of NKCC1 can reduce the [Cl−]i, and thereby attenuate theexcitatory GABAAR responses during epilepsy. Therefore, we investigated anticonvulsant effects of B50 on modulating the GABA polarity in acute seizure models. The seizure-like events (SLEs) in CA1 pyramidal neurons were triggered by tetanic stimulation of stratum radiatum in hippocampus (Figure A). B50 (2 µM) significantly decrease post-tetanus spike frequency to 0.27±0.07 of control (n=5 ed, pared t-test, p=5*e- , two- tail4). Thus, B50 potently suppressed the GABAAR-mediated depolarizationduring SLEs (Figure B) and exhibited potent anticonvulsive activity. The left band of the diagramcorresponds to the control. The right band of the diagram corresponds to B50 (2 µM).Figure 14. B50 does not modify intrinsic properties of CA1 pyramidal neuronsTo study possible side-effects of B50 in CNS, we tested whether B50 affect basic neuronal intrinsic properties and excitability. Current-clamp whole-cell recordings were performed in CA1 pyramidal neurons in hippocampal slices from P14-15 mice. Spike amplitude, half-width AP duration, AP threshold, spike frequency in response to +100 pA current step and input resistance, were not changed in the presence of B50 (10 µM) (Figure 3, table 1). Table 1 71 The left band of the diagram corresponds to the control. The right band of the diagram corresponds toB50 (10 µM).Figure 15 B50 does not change evoked CA3-CA1 EPSC triggered by Schaffer collateralsextracellular stimulation in hippocampal slices from P14-15 mice We tested whether B50 affect AMPAR-mediated glutamatergic synaptic activity. Evoked postsynaptic currents (EPSC) were recorded in CA1 pyramidal neurons in response to Schaffer collaterals stimulation. B50 (10 µM) did not change the amplitude of EPSC (Figure ). A, Representative superimposed averaged traces (10 consecutive traces) of whole-cell AMPARs- mediated postsynaptic currents (EPSC) recorded at -70 mV in CA3-CA1 hippocampal connections in control conditions (black) and 30 min after application of 10 µM of B50 (red). B,Summary of the effect of B50 on EPSC amplitude (paired two-tailed t test: p=0.4, n=5 cells). The error bars represent SEM.The left band of the diagram corresponds to the control. The right band of the diagram corresponds toB50 (10 µM).Figure 16 B111 does not affect intrinsic properties of CA1 pyramidal neuronsTo study possible side-effects of B111 in CNS, we tested whether it affects basic neuronal intrinsic properties and excitability. Current-clamp whole-cell recordings were performed in CA1 pyramidal neurons in hippocampal slices from P14-15 mice. Spike amplitude, half-width AP duration, AP threshold, spike frequency in response to +100 pA current step and input resistance, were not changed in the presence of B111 (10 µM).The left band of the diagrams corresponds to the control. The right band of the diagrams corresponds toB111 (10 µM).Figure 17 B111 is more efficient than B135 or B83 to block seizuresComparing the efficacy of B111, B135 and B83 to block seizures generated by pre-incubation with 4 Amino-pyridine (100uM). Note the stronger efficacy of B111.From the left to the right, the three left bands of the diagram correspond to the control. The first rightband of the diagram corresponds to B111 (10 µM). The second right band of the diagram correspondsto B83 (10 µM). The third right band of the diagram corresponds to B135 (10 µM).Figure 18 Design of compartmentalized microfluidic deviceThe panel A represents the Chip, that consists of three channels separated by narrow microchannels that permit the passage of dendritic and axonal projections. In this example, the neurons were seeded in Channels 1 and 3 and projected their axons and dendrites into Channel 2, that are represented on panel (B). The fluorescent staining presented here on panel (C) was carried out in Channel 2, which is enriched with synapses and enables them to be specifically targeted: neurites labelled with MAP2 (red), and synapses labelled with PSD-95 (green puncta).Figure 19 Freshly removed tumours were sliced and recorded with various techniques includingwhole cell current or voltage clamp recording, and single channel GABA recordingsThe image on Panel A shows synaptic GABA mediated currents. (1) represents the peritumoral cortexand (2) represents the human pyramidal layer 5 neuron. Recorded in whole cell voltage clamp with GABA synaptic currents blocked by B111 (10 microMole)frames 1 to 4 are enlarged below to illustrate the effects of B111 (Panel B). 72 EXAMPLES CDI: carbonyldiimidazole CHCl3: chloroform CH3CN: acetonitrile CV: column volume d: doublet DBU: 1,8-Diazabicyclo[5.4.0]undec-7-ene DIPEA: N-Ethyl diisopropylamineDCM : dichloromethaneDMAP: 4-dimethylaminopyridine DMF: N,N-dimethylformamid DMSO: dimethylsulfoxide ESI+: positive electrospray ionisation Et2O: diethyl ether EtOAc: ethyl acetate GP: general procedure H2: hydrogen HATU: 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate HCl: hydrogen chloride HPLC / MS: high-pressure liquid chromatography / mass spectrometry K2CO3: potassium carbonate KNO3: potassium nitrate LiOH: lithium hydroxide m: multiplet MeI: methyl iodide MeOH: Methanol MS: mass spectrometry NaOH: sodium hydroxide Na2SO4: sodium sulfate nBu: n-butyl PIDA: (diacetoxyiodo)benzene Pyr.: pyridine s: singulet t: triplet TBDMSCl: tert-butyl dimethylsilyl chloride TFAA: trifluoroacetic anhydride THF: tetrahydrofuran TLC: thin layer chromatography UV: ultra-violet Analytical equipment1H NMR analyses (400 MHz),13C NMR (101 MHz) and19F NMR spectra (376 MHz) were recorded with a Bruker ULTRASHIELD 400 spectrometer. Processing and analyses of the spectra were performed with MestReNova. Data appear in the following order: chemical shifts in ppm which were referenced to the internal solvent signal, multiplicity, coupling constant J in Hertz and number of protons. Reversed-phase HPLC / MS analyses were carried out with a Waters Alliance 2795 HPLC equipped with an autosampler, an inline membrane degasser, a column oven (temperature set at 45°C), a UV detector, and a ZQ quadrupole mass detector working in ionization electrospray mode. Compounds (0.1 to 0.3 mg) were solubilized in a minimum amount of DMSO completed with acetonitrile (Total volume of 1 mL). Standard analytical parameters: flow rate of 1mL / min and volume of injection of 5 μL . 73- Acidic conditions: Waters XSelect CSH C18 column (3.5 μm, 2.1 x 50 mm). Gradient: (H2O + 0.04%v / v HCO2H (10 mM)) / ACN from 95 / 5 to 0 / 100 in 2.5 min.- Alkaline conditions: Waters Xbridge C18 column (3.5 μm, 2.1 x 50 mm). Gradient: (H2O + 0.06% v / vNH3(aq) (10 mM)) / ACN from 95 / 5 to 0 / 100 in 2.5 min.1 – General synthetic scheme for compounds 1-12 Step 1:methyl 3-(butylamino)-4-phenoxy-5-sulfamoyl-benzoate (Int01)Compound Int01 was obtained starting from Bumetanide (28395-03-1) following the proceduredescribed in Bioorganic Chemistry, 2020, 100, 103878. Step 2:methyl 3-(butylamino)-5-[[tert-butyl(dimethyl)silyl]sulfamoyl]-4-phenoxy-benzoate (Int02)To a stirred suspension of Int01 (1.16 g, 3.06 mmol) in dry THF (4 mL, 0.8 M) was added triethylamine(940 µL, 6.75 mmol, 2.2 equiv.) under argon atmosphere. The mixture was stirred for 10 minutes at 20°C and a solution of TBDMSCl (610 mg, 3.83 mmol, 1.25 equiv.) in toluene (1 mL) was added dropwise. The resulting mixture was stirred at 50°C for 18 hours. The solution was cooled down to 20°C and the resulting suspension was filtrated. The solid was washed with Et2O and the combined filtrates were concentrated under reduced pressure. The resulting crude was stirred for 5 minutes in a mixture of THF / Et2O (2 / 1, 12 mL), and the suspension was filtrated. The filtrate was concentrated under reducedpressure to afford Int02 (1.50 g, 2.90 mmol, 94%) as an orange oil.C24H36N2O5SiS; MS (ESI+) m / z: 493 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.95 (d, J =2.0 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.30 (dd, J = 8.7 Hz, J = 7.4 Hz, 2H), 7.14–7.04 (m, 1H), 6.93–6.89 (m, 2H), 4.45 (brs, 1H), 3.94 (s, 3H), 3.83 (t, J = 5.4 Hz, 1H), 3.11-3.09 (m, 2H), 1.45–1.38 (m,2H), 1.20-1.10 (m, 2H), 0.85 (s, 9H), 0.81 (t, J = 7.3 Hz, 3H), 0.12 (s, 6H). 74 General Procedure 1 (GP1): sulfonimidamide preparation: Step 3: Method A A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3(0.6 M) was stirred at 70°C for 3 hours. After cooling down to 20°C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred for 10 minutes at 20°C and was cooleddown to 0°C. A solution of Int02 (1 equiv.) in CHCl3 (0.6 M) was added and the resulting clear solutionwas stirred for 20 minutes at 0°C. Amine (3 equiv.) in CHCl3 (2 M) was added and the resulting solution was heated up to 20°C and stirred for 2 hours. The solvent was removed and the crude mixture was diluted in CH3CN (0.1 M). HCl 37% (0.5 v / v CH3CN) was added at 20°C and the resulting solution was stirred at 20°C for 45 minutes. The solution was basified until pH 10 using a saturated solution of NaHCO3and the aqueous layer was extracted with EtOAc. The combined organic layers were dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford the crude sulfonimidamide. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to provide pure Compound 1. Method B A solution of triphenylphosphine (1.1 equiv.) and hexachloroethane (1.1 equiv.) in CHCl3 (0.6 M) was stirred at 70°C for 3 hours. After cooling down to 20°C, triethylamine (1.5 equiv.) was added to the white suspension. The resulting yellow suspension was stirred for 10 minutes at 20°C and was cooled down to 0°C. A solution of Int02 (1 equiv.) in CHCl3(0.6 M) was added and the resulting clear solution was stirred for 20 minutes at 0°C. Amine (3 equiv.) in CHCl3(2 M) was added and the resulting solution was heated up to 20°C and stirred for 2 hours. The solvent was removed and the crude mixture was diluted in CH3CN (0.1 M). A solution of tetrabutylammonium fluoride (1M in THF, 1 equiv.) was added at 20°C and the resulting solution was stirred at 20°C for 5 hours. If necessary, a solution oftetrabutylammonium fluoride (1M in THF, 2 equiv.) was added at 20°C, and the resulting solution wasstirred at 20°C until full conversion was observed (conversion monitored by LCMS). Water was added to the reaction mixture that was extracted with a mixture of CHCl3: iPrOH (8:2). The combined organic layer was concentrated under reduced pressure. The crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) to provide pure Compound 2 to 4. General Procedure 2 (GP2): methyl ester saponification: Step 4: Method A To a solution of methyl ester (1 equiv.) diluted in a mixture of THF / H2O / MeOH 1 / 1 / 1 (0.1 M) was added LiOH (2 equiv.). The resulting mixture was stirred for 2 hours at 20°C or until full conversion was observed. THF was removed and the mixture was diluted in water (5 mL). The aqueous layer was washed with EtOAc and was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford the corresponding carboxylic acid. Method B In a sealed tube, potassium trimethylsilanolate (2.4 equiv.) was added to a solution of methyl ester (1 equiv.) diluted in dry tetrahydrofuran (0.2 M). The reaction was stirred at 20°C for 16 hours. Portions of potassium trimethylsilanolate (0.6 equiv.) could be added every 4 hours to complete conversion (conversion monitored by LCMS). Once the full conversion was reached, water was added to the reaction mixture. The aqueous layer was acidified upon the addition of an aqueous solution of HCl 1N to reach pH 2-3. The organic layer was extracted with DCM three times, and the combined organic layers were washed with brine once, dried over MgSO4, filtered, and concentrated under reduced pressure to afford the corresponding carboxylic acid. General Procedure 3 (GP3): peptide coupling reaction: Step 5:To a solution of carboxylic acid (1 equiv.) in N,N-dimethylformamide (0.1 M) were added DIPEA (1.5equiv.) and HATU (1.2 equiv.) at 20°C. The resulting mixture was stirred at 20°C up to complete conversion (conversion monitored by LCMS). The reaction was poured into a saturated aqueous solution 75 of NH4Cl and extracted twice with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude was purified by reverse phase LCMS. The pure fractions containing the target compounds were collected and concentrated under reduced pressure to provide pure Compound 9 to 12. 1.1 Compound 1 (B118) methyl 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoate (Compound 1)According to GP1 (step 3 – Method A) starting from Int02 and pyrazin-2-amine, Compound 1 wasisolated as a yellow oil (30 mg, 0.0667 mmol, 13%).C22H25N5O4S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.06 (d, J = 1.9Hz, 1H), 7.94 – 7.91 (m, 2H), 7.59 (d, J = 1.2 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.24 – 7.18 (m, 2H),7.09 – 7.04 (m, 1H), 6.75 – 6.71 (m, 2H), 5.80 (s, 1H), 3.94 (s, 3H), 3.87 (t, J = 5.3 Hz, 1H), 3.15 – 3.06(m, 2H), 1.47 – 1.37 (m, 2H), 1.22 – 1.11 (m, 2H), 0.82 (t, J = 7.3 Hz, 3H).1.2 Compound 2 (B96) methyl 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoate (Compound 2)According to GP1 (step 3 – Method B) starting from Int02 and 3-chloroaniline, Compound 2 wasisolated as an off-white foam (224 mg, 0.4590 mmol, 91%).C24H26ClN3O4S; MS (ESI+) m / z: 488 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J =2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.17 – 7.11 (m, 1H), 7.02 – 6.96 (m, 1H),6.91 – 6.83 (m, 3H), 6.69 – 6.64 (m, 1H), 6.56 (t, J = 2.1 Hz, 1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H),1.48 – 1.39 (m, 2H), 1.23 – 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).1.3 Compound 3 (B127) 76 methyl 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoate (Compound 3)According to GP1 (step 3 – Method B) starting from Int02 and 2-thiazol-2-ylethylamine, Compound3 was isolated as a white solid (111 mg, 0.2272 mmol, 61%).C23H28N4O4S2; MS (ESI+) m / z: 489 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.04 (d, J = 2.0Hz, 1H), 7.70 (d, J = 3.4 Hz, 1H), 7.54 (d, J = 2.0 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.23 (d, J = 3.3 Hz,1H), 7.10 – 7.03 (m, 1H), 6.89 – 6.85 (m, 2H), 3.93 (s, 3H), 3.83 (s, 1H), 3.49 – 3.42 (m, 1H), 3.39 –3.30 (m, 1H), 3.15 – 3.06 (m, 4H), 1.46 – 1.38 (m, 2H), 1.22 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz, 3H).1.4 Compound 4 (B107) methyl 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 4)According to GP1 (step 3 – Method B) starting from Int02 and 3-(difluoromethoxy)aniline, Compound4 was isolated as a white solid (209 mg, 0.4023 mmol, 87%).C25H27F2N3O5S; MS (ESI+) m / z: 520 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J =2.0 Hz, 1H), 7.59 (d, J = 2.0 Hz, 1H), 7.31 (dd, J = 8.5, 7.2 Hz, 2H), 7.17 – 7.09 (m, 1H), 7.05 (t, J =8.1 Hz, 1H), 6.92 – 6.85 (m, 2H), 6.71 – 6.61 (m, 2H), 6.43 (d, J = 74.4 Hz, 1H), 6.31 (t, J = 2.3 Hz,1H), 3.95 (s, 3H), 3.12 (t, J = 7.0 Hz, 2H), 1.49 – 1.37 (m, 2H), 1.24 – 1.12 (m, 2H), 0.83 (t, J = 7.3 Hz,3H). 1.5 Compound 5 (B104) 77 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]benzoic acid (Compound 5)According to GP2 (step 4 – Method A), starting from Compound 1, Compound 5 was isolated as abrown foam (20 mg, 0.0453 mmol, 10%).C21H23N5O4S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.19 (s, 1H), 7.87(d, J = 2.0 Hz, 1H), 7.83 – 7.81 (m, 1H), 7.75 (d, J = 2.7 Hz, 1H), 7.43 – 7.40 (m, 2H), 7.11 (d, J = 1.5Hz, 1H), 7.08 – 7.02 (m, 2H), 6.88 (t, J = 7.3 Hz, 1H), 6.62 – 6.58 (m, 2H), 5.06 (t, J = 6.0 Hz, 1H),3.05 (q, J = 6.3 Hz, 2H), 1.40 – 1.30 (m, 2H), 1.16 – 1.06 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ 167, 156 (2C), 155, 142, 141, 139, 135, 134, 129 (2C), 122, 118,116 (2C), 115 (2C), 42.4, 30.4, 19.7, 14.0. 1.6 Compound 6 (B100) 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 6)According to GP2 (step 4 – Method A), starting from Compound 2, Compound 6 was isolated as anoff-white foam (221 mg, 0.4476 mmol, 98%).C23H24ClN3O4S; MS (ESI+) m / z: 474 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.14 (s, 1H),7.83 (d, J = 1.9 Hz, 1H), 7.44 (d, J = 2.0 Hz, 1H), 7.23 (dd, J = 8.6, 7.3 Hz, 2H), 7.01 (q, J = 7.8 Hz,2H), 6.83 – 6.79 (m, 2H), 6.76 (dd, J = 7.8, 2.1 Hz, 1H), 6.47 (d, J = 8.1 Hz, 1H), 6.37 (s, 1H), 5.13 (t,J = 5.7 Hz, 1H), 3.08 (q, J = 6.4 Hz, 2H), 1.42 – 1.33 (m, 2H), 1.19 – 1.08 (m, 2H), 0.78 (t, J = 7.4 Hz,3H).13C NMR (101 MHz, DMSO-d6): δ 167, 157 (2C), 143, 140, 138, 133, 130, 129 (2C), 128, 122 (2C),121, 120, 116 (3C), 115, 42.4, 30.5, 19.7, 14.0. 1.7 Compound 7 (B135) 78 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]benzoic acid (Compound 7)According to GP2 (step 4 – Method A), starting from Compound 3, Compound 7 was isolated as awhite solid (28 mg, 0.0594 mmol, 99%).C22H26N4O4S2; MS (ESI+) m / z: 475 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.79 (d, J = 2.0 Hz,1H), 7.62 (dd, J = 49.1, 3.3 Hz, 2H), 7.39 (d, J = 2.0 Hz, 1H), 7.31 – 7.23 (m, 2H), 7.04 – 6.97 (m, 1H),6.87 – 6.81 (m, 2H), 4.89 (t, J = 5.7 Hz, 1H), 3.19 – 3.13 (m, 2H), 3.09 – 2.96 (m, 4H), 1.42 – 1.30 (m,2H), 1.17 – 1.05 (m, 2H), 0.77 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ 167.10, 166.69, 156.12, 142.31, 142.09, 139.57, 136.87, 129.13(2C), 128.17, 122.16, 119.49, 116.67, 115.46 (2C), 114.44, 42.83, 42.07, 33.36, 30.17, 19.28, 13.57. 1.8 Compound 8 (B111) 3-(butylamino)-5-[[3-()anilino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 8)According to GP2 (step 4 – Method B), starting from Compound 4, Compound 8 was isolated as awhite solid (25 mg, 0.0472 mmol, 52%).C24H25F2N3O5S; MS (ESI+) m / z: 506 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.15 (s, 1H),7.84 (d, J = 2.0 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 7.26 – 7.19 (m, 3H), 7.04 – 6.99 (m, 2H), 6.83 – 6.80(m, 2H), 6.54 (dd, J = 8.2, 2.4 Hz, 1H), 6.44 (d, J = 8.0 Hz, 1H), 6.21 (s, 1H), 5.09 (t, J = 5.8 Hz, 1H),3.07 (q, J = 6.5 Hz, 2H), 1.42 – 1.33 (m, 2H), 1.19 – 1.07 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ 166.5 (2C), 156.0 (2C), 142.6 (2C), 139.5, 129.3, 128.9 (2C), 122.0(2C), 121.8, 117.9, 116.3, 115.6 (2C), 114.7, 113.3, 110.3, 42.0, 30.1, 19.3, 13.6. 1.9 Compound 9 (B180) 79 3-(butylamino)-4-phenoxy-5-[(pyrazin-2-ylamino)sulfonimidoyl]-N-(2,2,2-trifluoroethyl)benzamide (Compound 9)According to GP3 (step 5) starting from Compound 5 and 2,2,2-trifluoroethylamine, Compound 9 wasisolated as a yellow oil (320 mg, 0.612 mmol, 82%).C23H25F3N6O3S; MS (ESI+) m / z: 523 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.90 (d, J =2.8 Hz, 1H), 7.87 – 7.84 (m, 1H), 7.72 (d, J = 2.0 Hz, 1H), 7.50 – 7.45 (m, 2H), 7.23 – 7.12 (m, 3H),7.04 (t, J = 7.3 Hz, 1H), 6.66 (d, J = 8.0 Hz, 2H), 4.18 – 4.02 (m, 3H), 3.96 – 3.80 (m, 1H), 3.08 (t, J =7.1 Hz, 2H), 1.46 – 1.33 (m, 2H), 1.21 – 1.07 (m, 2H), 0.79 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, Chloroform-d): δ 166.6, 155.4, 153.9, 143.0, 140.7, 140.7, 138.7, 136.2, 135.7, 131.4, 130 (3C), 123.8, 115.7, 114.9 (2C), 114.0, 43.1, 41.2, 31.1, 19.9, 13.7. 1.10 Compound 10 (B181) 3-(butylamino)-5-[(3-chloroanilino)sulfonimidoyl]-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 10)According to GP3 (step 5) starting from Compound 6 and 2,2,2-trifluoroethylamine, Compound 10was isolated as a yellow oil (19.5 mg, 0.035 mmol, 18%).C25H26ClF3N4O3S; MS (ESI+) m / z: 555 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 7.69 (d, J= 2.0 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.31 (dd, J = 8.4, 7.2 Hz, 2H), 7.17 – 7.11 (m, 1H), 6.98 (dd, J= 8.5, 7.6 Hz, 1H), 6.90 – 6.83 (m, 3H), 6.75 (t, J = 6.6 Hz, 1H), 6.64 – 6.58 (m, 1H), 6.55 (t, J = 2.0Hz, 1H), 4.20 – 4.07 (m, 2H), 3.12 (t, J = 7.0 Hz, 2H), 1.49 – 1.36 (m, 2H), 1.24 – 1.10 (m, 2H), 0.82 (t,J = 7.3 Hz, 3H). 13C NMR (101 MHz, Chloroform-d): δ 166.4, 155.5, 143.1, 138.9, 135.7, 134.3, 131.2, 130.2 (2C), 129.7, 125.6, 123.9, 123.6, 122.9, 121.4, 115.7, 115.3 (2C), 113.1, 43.2, 41.6, 41.2, 31.1, 19.9, 13.8. 1.11 Compound 11 (B183) 80 3-(butylamino)-4-phenoxy-5-[(2-thiazol-2-ylethylamino)sulfonimidoyl]-N-(2,2,2- trifluoroethyl)benzamide (Compound 11)According to GP3 (step 5) starting from Compound 7, Compound 11 was isolated as a yellow oil (25mg, 0.045 mmol, 65%).C24H28F3N5O3S2; MS (ESI+) m / z: 556 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.72 – 7.63(m, 2H), 7.48 (d, J = 2.1 Hz, 1H), 7.35 – 7.17 (m, 4H), 7.10 – 7.03 (m, 1H), 6.90 – 6.79 (m, 2H), 4.16 –4.00 (m, 2H), 3.87 (s, 1H), 3.38 (ddt, J = 37.4, 13.0, 6.4 Hz, 2H), 3.12 – 3.04 (m, 4H), 1.46 – 1.34 (m,2H), 1.22 – 1.08 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, 101 MHz, Chloroform-d) δ 167.5, 166.6, 155.9, 143, 142.4, 139.3, 135, 131.1,130.1 (2C), 123.6, 119.0, 115.4, 115.2 (2C), 114, 43.1, 43.0, 41.4, 41.1, 33.1, 31.1, 19.9, 13.8.1.12 Compound 12 (B182) 3-(butylamino)-5-[[3-(difluoromethoxy)anilino]sulfonimidoyl]-N-(2-methoxyethyl)-4-phenoxy- benzamide (Compound 12)According to GP3 (step 5) starting from Compound 8, Compound 12 was isolated as a white solid (36mg, 0.0582 mmol, 42%). C27H32F2N4O5S; MS (ESI+) m / z: 563 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.67 (d, J =2.0 Hz, 1H), 7.45 (d, J = 2.1 Hz, 1H), 7.33 – 7.24 (m, 2H), 7.14 – 7.07 (m, 1H), 7.01 (t, J = 8.1 Hz, 1H),6.89 (t, J = 5.3 Hz, 1H), 6.88 – 6.81 (m, 2H), 6.64 – 6.57 (m, 2H), 6.41 (t, J = 74.3 Hz, 1H), 6.24 (t, J =2.3 Hz, 1H), 3.87 (s, 1H), 3.70 – 3.52 (m, 4H), 3.38 (s, 3H), 3.10 (t, J = 7.0 Hz, 2H), 1.46 – 1.36 (m,2H), 1.22 – 1.09 (m, 2H), 0.81 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, Chloroform-d) δ 166.36, 155.60, 151.95 (t, J = 2.8 Hz), 144.45, 142.80, 138.19, 135.88, 132.44, 130.02 (2C), 129.71, 123.61, 119.93, 116.19, 115.44, 115.27 (2C), 114.02, 113.20, 112.92, 71.16, 58.93, 43.14, 40.14, 31.14, 19.94, 13.75. 1.13 Compound 51 81 methyl 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoate (Compound 51)According to GP1 (step 3 – Method A) starting from Int02 and Methylamine 2M in THF, Compound51 was isolated as a white solid (44 mg, 0.11 mmol, 14%).C19H25N3O4S; MS (ESI+) m / z: 392 [M+H]+; 1H NMR (400 MHz, CDCl3): δ 8.04 (d, J = 2.0 Hz, 1H), 7.56 (d, J = 2.0 Hz, 1H), 7.34-7.28 (m, 2H), 7.12-7.05 (m, 1H), 6.93-6.87 (m, 2H), 3.94 (s, 3H),3.89 (t, J = 5.4 Hz, 1H), 3.15-3.07 (m, 2H), 2.53 (s, 3H), 1.48-1.38 (m, 2H), 1.22-1.11 (m, 2H), 0.83 (t,J = 7.3 Hz, 3H). 1.13 Compound 52 methyl 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoate (Compound 52)According to GP1 (step 3 – Method A) starting from Int02 and 2-aminopyridine, Compound 52 wasisolated as a white solid (228 mg, 0.4514 mmol, 74%).C23H26N4O4S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.03 (d, J = 1.9Hz, 1H), 7.98 (ddd, J = 5.3, 2.0, 0.8 Hz, 1H), 7.53 (d, J = 1.9 Hz, 1H), 7.51 – 7.43 (m, 1H), 7.26 – 7.20(m, 2H), 7.07 – 7.01 (m, 1H), 6.87 – 6.80 (m, 2H), 6.80 – 6.74 (m, 1H), 6.65 (d, J = 8.3 Hz, 1H), 3.91(s, 3H), 3.85 (t, J = 5.4 Hz, 1H), 3.08 (td, J = 6.9, 5.3 Hz, 2H), 1.39 (q, J = 7.2 Hz, 2H), 1.21 – 1.09 (m,2H), 0.81 (t, J = 7.3 Hz, 3H). 1.14 Compound 53 methyl 3-(butylamino)-5-[[(2-methylsulfanyl-4-pyridyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 53) 82According to GP1 (step 3 – Method A) starting from Int02 and 2-(Methylthio)pyridin-4-amine,Compound 53 was isolated as a white solid (45 mg, 0.0899 mmol, 18%).C24H28N4O4S2; MS (ESI+) m / z: 501 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J = 2.0Hz, 1H), 8.02 (d, J = 5.6 Hz, 1H), 7.61 (d, J = 2.0 Hz, 1H), 7.35 – 7.29 (m, 2H), 7.19 – 7.04 (m, 1H),6.84 (d, J = 8.1 Hz, 2H), 6.37 (dd, J = 5.6, 2.0 Hz, 1H), 6.32 (d, J = 2.0 Hz, 1H), 3.98 (s, 3H), 3.92 (t, J= 5.5 Hz, 1H), 3.14 (q, J = 6.6 Hz, 2H), 2.44 (s, 3H), 1.52-1.42 (m, 2H), 1.27-1.14 (m, 2H), 0.85 (t, J =7.3 Hz, 3H). 1.15 Compound 54 methyl 3-(butylamino)-5-[[(2-methoxy-4-pyridyl)amino]sulfonimidoyl]-4-phenoxy-benzoate (Compound 54)According to GP1 (step 3 – Method A) starting from Int02 and 2-methoxypyridin-4-amine, Compound54 was isolated as a white solid (31 mg, 0.064 mmol, 13%).C24H28N4O5S; MS (ESI+) m / z: 485 [M+H]+; 1H NMR (400 MHz, Chloroform-d): δ 8.09 (d, J = 1.9Hz, 1H), 7.78 (d, J = 5.7 Hz, 1H), 7.61 (d, J = 1.9 Hz, 1H), 7.35 – 7.28 (m, 2H), 7.14 (t, J = 7.4 Hz, 1H),6.86 (d, J = 8.0 Hz, 2H), 6.23 (dd, J = 5.7, 1.8 Hz, 1H), 6.04 (d, J = 1.8 Hz, 1H), 4.01 – 3.94 (m, 3H),3.91 (t, J = 5.5 Hz, 1H), 3.83 (s, 3H), 3.14 (q, J = 6.5 Hz, 2H), 1.51-1.40 (m, 2H), 1.26-1.15 (m, 2H), 0.85 (t, J = 7.3 Hz, 3H).1.16 Compound 55 (B50) 3-(butylamino)-5-(methylaminosulfonimidoyl)-4-phenoxy-benzoic acid (Compound 55)According to GP2 (step 4 – Method A), starting from Compound 51, Compound 55 was isolated as awhite solid (32 mg, 0.0831 mmol, 74%).C18H23N3O4S; MS (ESI+) m / z: 378 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.75 (d, J = 2.0 Hz,1H), 7.38 (d, J = 2.0 Hz, 1H), 7.29-7.24 (m, 2H), 7.04-6.98 (m, 1H), 6.87- 6.82 (m, 2H), 4.91 (t, J = 5.7Hz, 1H), 3.05-3.03 (m, 2H), 2.42 (s, 3H), 1.42-1.30 (m, 2H), 1.14-1.04 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ 166.7, 156.2, 142.3, 139.7, 136.1, 129.1 (2C), 127.9, 122.2, 116.9,115.5 (2C), 114.3, 42.1, 30.2, 29.4, 19.3, 13.6. 1.17 Compound 56 (B191) 83 3-(butylamino)-4-phenoxy-5-[(2-pyridylamino)sulfonimidoyl]benzoic acid (Compound 56)According to GP2 (step 4 – Method A), starting from Compound 52, Compound 56 was isolated as awhite solid (104 mg, 0.2361 mmol, 92%).C22H24N4O4S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.93 – 7.82 (m, 2H),7.39 (d, J = 2.0 Hz, 1H), 7.26 (td, J = 7.8, 2.0 Hz, 1H), 7.10 (t, J = 7.8 Hz, 2H), 6.92 (t, J = 7.3 Hz, 1H), 6.65 (dd, J = 12.9, 6.5 Hz, 3H), 6.05 (d, J = 8.2 Hz, 1H), 4.94 (t, J = 5.7 Hz, 1H), 3.04 (q, J = 6.6 Hz,2H), 1.39-1.32 (m, 2H), 1.15-1.08 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO) δ 167.17, 158.45, 156.35, 147.17, 142.81, 139.89, 138.53, 137.62, 129.27 (2C), 128.20, 122.42, 117.96, 116.48, 115.80 (2C), 115.61, 114.83, 42.51, 30.63, 19.76, 14.03. 1.18 Compound 57 (B192) 3-(butylamino)-5-[[(2-methylsulfanyl-4-pyridyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid(Compound 57)According to GP2 (step 4 – Method A), starting from Compound 53, Compound 57 was isolated as awhite solid (38 mg, 0.0781 mmol, 87%).C23H26N4O4S2; MS (ESI+) m / z: 487 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.93 (d, J = 5.8 Hz,1H), 7.83 (d, J = 1.9 Hz, 1H), 7.68 (s, 2H), 7.47 (d, J = 1.9 Hz, 1H), 7.22 (t, J = 7.8 Hz, 2H), 7.01 (t, J =7.3 Hz, 1H), 6.77 (d, J = 8.1 Hz, 2H), 6.34 – 6.20 (m, 1H), 6.14 (s, 1H), 5.22 (s, 1H), 3.09 (q, J = 6.5Hz, 2H), 2.36 (s, 3H), 1.42-1.36 (m, 2H), 1.18-1.09 (m, 2H), 0.79 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 166.90, 158.45, 156.48, 154.21, 147.90, 143.37, 139.87, 137.08, 129.35(2C), 128.58, 122.61, 116.16, 115.99 (2C), 115.68, 113.99, 113.42, 42.47, 30.61, 19.81, 14.06, 13.35.1.19 Compound 58 (B193) 84 3-(butylamino)-5-[[(2-methoxy-4-pyridyl)amino]sulfonimidoyl]-4-phenoxy-benzoic acid (Compound 58)According to GP2 (step 4 – Method A), starting from Compound 54, Compound 58 was isolated as awhite solid (24 mg, 0.0510 mmol, 80%).C23H26N4O5S; MS (ESI+) m / z: 471 [M+H]+; 1H NMR (400 MHz, DMSO-d6): 3.13 (s, 1H), 7.83 (d,J = 1.9 Hz, 1H), 7.65 (d, J = 5.7 Hz, 1H), 7.45 (d, J = 2.0 Hz, 3H), 7.25 – 7.17 (m, 2H), 7.01 (t, J = 7.3Hz, 1H), 6.79 (d, J = 8.0 Hz, 2H), 6.05 (d, J = 5.6 Hz, 1H), 5.82 (s, 1H), 5.12 (t, J = 5.8 Hz, 1H), 3.69 (s, 3H), 3.08 (q, J = 6.6 Hz, 2H), 1.42-1.35 (m, 2H), 1.16-1.08 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 166.98, 164.81, 156.49, 155.02, 146.52, 143.24, 139.99, 137.53, 129.35 (2C), 122.58, 116.26, 116.04 (2C), 115.45, 112.92, 101.75, 53.16, 42.49, 30.62, 19.79, 14.06.2 – General synthetic scheme for compounds 13-18 General Procedure 1 (GP1): sulfonamide arylation: Step 1:To a stirred solution of Int01 (1 equiv.) in dry acetonitrile (0.2 M) were added potassium carbonate (2.5equiv.), copper(I) iodide (0.1 equiv.), N,N'-dimethylethylenediamine (0.5 equiv.). The solution was degassed under Argon and sonication, and then ArylBromide (1.20 equiv.) was added at 20°C. The reaction vessel was flushed with Argon, sealed, and stirred at 80°C for 16 hours. The reaction was cooled down to 20°C and filtered over a pad of celite to give a crude that was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 100 / 0 to 0 / 100 over 10 CV) or with DCM / MeOH(gradient from 100 / 0 to 80 / 20 over 10 CV) to afford the corresponding aryl substitited sulfonamide. General Procedure 2 (GP2): methyl ester saponification: Step 2: 85 To a solution of methyl ester (1 equiv.) diluted in a mixture of THF / H2O / MeOH 1 / 1 / 1 (0.1 M) was added LiOH (2 equiv.). The resulting mixture was stirred for 2 hours at 20°C or until full conversion was observed. THF was removed and the mixture was diluted in water (5 mL). The aqueous layer was washed with EtOAc and was acidified with HCl 1N until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford the corresponding carboxylic acid. General Procedure 3 (GP3): peptide coupling reaction: Step 3:To a solution of carboxylic acid (1 equiv.) in N,N-dimethylformamide (0.1 M) were added DIPEA (1.5equiv.) and HATU (1.2 equiv.) at 20°C. The resulting mixture was stirred at 20°C up to complete conversion (conversion monitored by LCMS). The reaction was poured into a saturated aqueous solution of NH4Cl and extracted twice with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude was purified by reverse phase LCMS. The pure fractions containing the target compounds were collected and concentrated under reduced pressure to provide pure amide compound.2.1 Compound 13 (B75) methyl 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoate (Compound 13)According to GP1 (step 1) starting from Int01 and benzylbromide, Compound 1 was isolated as a whitesolid (1.45 g, 3.2 mmol, 97%).C24H26N2O5S; MS (ESI+) m / z: 455 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 10.24 (s, 1H), 7.69(d, J = 2.0 Hz, 1H), 7.39 (d, J = 2.0 Hz, 1H), 7.32 – 7.16 (m, 4H), 7.08 – 6.97 (m, 4H), 6.82 – 6.77 (m,2H), 5.10 (t, J = 5.6 Hz, 1H), 3.86 (s, 3H), 3.00 (q, J = 6.5 Hz, 2H), 1.36 – 1.24 (m, 2H), 1.09 – 0.98 (m,2H), 0.73 (t, J = 7.3 Hz, 3H). 2.2 Compound 59 methyl 3-(butylamino)-4-phenoxy-5-(2-pyridylsulfamoyl)benzoate (Compound 59)According to GP1 (step 1) starting from Int01 and 2-bromopyridine, Compound 59 was isolated as awhite solid (142 mg, 0.3117 mmol, 59%).C23H25N3O5S; MS (ESI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.83 (d, J = 2.0 Hz,1H), 7.77 (s, 1H), 7.46 (s, 1H), 7.30 (s, 1H), 7.14 (t, J = 7.8 Hz, 2H), 6.92 (t, J = 7.3 Hz, 1H), 6.81 (s,1H), 6.67 (d, J = 8.0 Hz, 2H), 6.59 (s, 1H), 4.81 (s, 1H), 3.87 (s, 3H), 3.00 (q, J = 6.4 Hz, 2H), 1.36-1.32 (m, 2H), 1.08-1.03 (m, 2H), 0.74 (t, J = 7.3 Hz, 3H). 862.3 Compound 604-phenoxy-5-(4-pyridylsulfamoyl)benzoate (Compound 60)1) starting from Int01 and 4-bromopyridine, Compound 60 was isolated as a512 mmol, 66%). SI+) m / z: 456 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.57 (s, 1H), 787-), 7.15 (d, J = 7.9 Hz, 2H), 6.94 (s, 1H), 6.61 (s, 4H), 4.94 (s, 1H), 3.89 (s, 3H), ,1.37-1.28 (m, 2H), 1.11-1.06 (m, 2H), 0.75 (t, J = 7.4 Hz, 3H) 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)benzoic acid (Compound 14)According to GP2 (step 2) starting from Compound 13, Compound 14 was isolated as a white solid(1.3 g, 2.95 mmol, 92%). C23H24N2O5S; MS (ESI+) m / z: 441 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 13.21 (s, 1H), 10.21(s, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.0 Hz, 1H), 7.28 – 7.18 (m, 4H), 7.08 – 6.97 (m, 4H),6.82 – 6.78 (m, 2H), 5.03 (t, J = 5.7 Hz, 1H), 3.00 (q, J = 6.5 Hz, 2H), 1.37 – 1.26 (m, 2H), 1.09 – 0.98(m, 2H), 0.73 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6): δ 166.8, 156.5, 142.9, 140.5, 138.1, 134.1, 129.6 (2C), 129.5 (2C), 128.8, 124.0, 122.9, 119.7 (2C), 117.2, 116.2, 116.2 (2C), 42.4, 30.5, 19.7, 14.0. 2.5 Compound 61 (B189) 3-(butylamino)-4-phenoxy-5-(2-pyridylsulfamoyl)benzoic acid (Compound 61) 87According to GP2 (step 2) starting from Compound 59, Compound 61 was isolated as a white solid(128 mg, 0.2899 mmol, 93%). C22H23N3O5S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.70 (s, 1H), 7.82 (s, 1H), 7.76 (s, 1H), 7.66 (t, J = 8.0 Hz, 1H), 7.38 (s, 1H), 7.14 (t, J = 7.7 Hz, 2H), 7.03 (d, J = 8.9 Hz,1H), 6.93 (t, J = 7.4 Hz, 1H), 6.81 – 6.70 (m, 1H), 6.63 (d, J = 8.0 Hz, 2H), 4.91 (s, 1H), 3.10 – 2.87 (m,2H), 1.34-1.32 (m, 2H), 1.11-1.03 (m, 2H), 0.74 (t, J = 7.4 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 167.07, 156.58, 156.49, 154.47, 142.78, 141.57, 140.37, 137.30, 129.44 (2C), 128.45, 122.42, 117.03, 115.72 (3C), 115.11, 113.98, 42.49, 30.58, 19.72, 14.03. 2.6 Compound 62 (B190) 3-(butylamino)-4-phenoxy-5-(4-pyridylsulfamoyl)benzoic acid (Compound 62)According to GP2 (step 2) starting from Compound 60, Compound 62 was isolated as a white solid(140 mg, 0.3171 mmol, 90%).C22H23N3O5S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.70 (s, 1H), 7.83 (d, J = 32.3 Hz, 3H), 7.36 (s, 1H), 7.16 (t, J = 7.7 Hz, 2H), 6.94 (t, J = 7.3 Hz, 1H), 6.65 (d, J = 7.7 Hz,4H), 5.03 – 4.72 (m, 1H), 3.01 (q, J = 6.5 Hz, 2H), 1.37-1.32 (m, 2H), 1.11-1.06 (m, 2H), 0.75 (t, J =7.3 Hz, 3H). 13C NMR (101 MHz, DMSO) δ 167.29, 165.63, 156.79, 142.80, 140.29, 129.34 (2C), 128.81, 122.27, 116.86, 115.88 (2C), 114.76 (2C), 42.56, 30.67, 19.75, 14.03.2.7 Compound 15 (B184) 3-(butylamino)-N-methyl-4-phenoxy-5-(phenylsulfamoyl)benzamide (Compound 15)According to GP1 (step 3) starting from Compound 14, Compound 15 was isolated as a white solid(143 mg, 0.299 mmol, 88%). C24H27N3O4S; MS (ESI+) m / z: 454 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 10.14 (s, 1H), 8.56(q, J = 4.4 Hz, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.35 (d, J = 2.0 Hz, 1H), 7.31 – 7.13 (m, 4H), 7.09 – 6.93(m, 4H), 6.85 – 6.76 (m, 2H), 4.86 (t, J = 5.7 Hz, 1H), 3.01 (q, J = 6.5 Hz, 2H), 2.78 (d, J = 4.5 Hz, 3H),1.37 – 1.26 (m, 2H), 1.11 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6) δ 165.4, 156.2, 142.1, 138.6, 137.7, 133.3, 131.9, 129.0 (2C), 128.9 (2C), 123.3, 122.3, 118.9 (2C), 115.7 (2C), 115.0, 114.0, 41.9, 30.2, 26.3, 19.2, 13.5.2.8 Compound 16 (B177) 88 3-(butylamino)-N,N-dimethyl-4-phenoxy-5-(phenylsulfamoyl)benzamide (Compound 16)According to GP1 (step 3) starting from Compound 14, Compound 16 was isolated as a white solid(135 mg, 0.279 mmol, 82%). C25H29N3O4S; MS (ESI+) m / z: 468 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 10.15 (s, 1H), 7.23(dtd, J = 24.3, 7.3, 1.9 Hz, 4H), 7.09 – 6.96 (m, 5H), 6.89 (d, J = 1.9 Hz, 1H), 6.85 – 6.79 (m, 2H), 4.97(t, J = 5.8 Hz, 1H), 3.06 – 2.74 (m, 8H), 1.34 – 1.23 (m, 2H), 1.12 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz,3H). 13C NMR (101 MHz, DMSO-d6) 168.9, 156.4, 142.4, 137.7, 137.1, 133.9, 132.9, 129.0 (2C), 128.9 (2C), 123.5, 122.2, 119.2 (2C), 115.6 (2C), 113.9, 113.8, 41.9, 38.8, 34.7, 30.1, 19.2, 13.6.2.9 Compound 17 (B178) 3-(butylamino)-4-phenoxy-5-(phenylsulfamoyl)-N-(2,2,2-trifluoroethyl)benzamide (Compound 17)According to GP1 (step 3) starting from Compound 14, Compound 17 was isolated as a white solid(162 mg, 0.281 mmol, 83%).C25H26F3N3O4S; MS (ESI+) m / z: 522 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 10.18 (s, 1H),9.23 (t, J = 6.2 Hz, 1H), 7.71 (d, J = 2.0 Hz, 1H), 7.40 (d, J = 2.1 Hz, 1H), 7.30 – 7.14 (m, 4H), 7.12 –6.92 (m, 4H), 6.86 – 6.77 (m, 2H), 4.94 (t, J = 5.6 Hz, 1H), 4.16 – 4.06 (m, 2H), 3.02 (q, J = 6.5 Hz,2H), 1.37 – 1.26 (m, 2H), 1.11 – 0.95 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6) δ 170.29, 165.70, 156.08, 142.29, 139.17, 137.64, 133.47, 130.54, 129.02 (2C), 128.93 (2C), 123.40, 122.37, 119.05 (2C), 115.72 (2C), 115.24, 114.30, 41.93, 40.44, 30.11, 19.19, 13.53.2.10 Compound 18 (B179) 89 3-(butylamino)-N-(2-methoxyethyl)-4-phenoxy-5-(phenylsulfamoyl)benzamide (Compound 18) According to GP1 (step 3) starting from Compound 14, Compound 18 was isolated as a white solid(134 mg, 0.244 mmol, 72%). C26H31N3O5S; MS (ESI+) m / z: 498 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 10.12 (s, 1H), 8.70 (t, J = 5.4 Hz, 1H), 7.66 (d, J = 2.0 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.30 – 7.14 (m, 4H), 7.10 – 6.92(m, 4H), 6.87 – 6.74 (m, 2H), 4.85 (t, J = 5.6 Hz, 1H), 3.51 – 3.38 (m, 4H), 3.28 (s, 3H), 3.01 (q, J = 6.5Hz, 2H), 1.37 – 1.26 (m, 2H), 1.10 – 0.98 (m, 2H), 0.73 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, DMSO-d6) δ 165.03, 156.17, 142.11, 138.65, 137.71, 133.26, 131.79, 129.01 (2C), 128.92 (2C), 123.32, 122.30, 118.99 (2C), 115.71 (2C), 115.09, 114.21, 70.44, 57.92, 41.96, 38.60, 30.18, 19.20, 13.55. 3– General synthetic scheme for compounds 19-25 Step 1: 4-chloro-3-chlorosulfonyl-5-nitro-benzoic acid (Int01)To a solution of 4-chloro-3-chlorosulfonyl-benzoic acid (CAS 2494-79-3) (1.4 g, 5.49 mmol, 1 equiv.)diluted in concentrated sulfuric acid (4.4 mL, 82.33 mmol, 15 equiv.) was added KNO3 (555 mg, 5.79 90mmol, 1 equiv.) at 0°C, the resulting yellow suspension was stirred at 100°C for 16 hours. During thetemperature ramping up, suspension dissolved. The reaction mixture was poured in 20 mL ice / water and extracted with EtOAc, the combined organic layers were dried over Na2SO4, filtrated, and concentrated under reduced pressure to afford Int01 (793 mg, 2.64 mmol, 48%) as a white solid.C7H3Cl2NO6S; 1H NMR (400 MHz, DMSO-d6): δ 8.63 (d, J = 2.1 Hz, 1H), 8.37 (d, J = 2.1 Hz, 1H).Step 2: 4-chloro-3-nitro-5-sulfanyl-benzoic acid (Int02)To a solution of Int01 (2 g, 6.66 mmol, 1 equiv.) diluted in toluene (66.6 mL, 0.1 M) was addedtriphenylphosphine (5.25 g, 20 mmol, 3 equiv.) at 20°C, the resulting yellow suspension was stirred at 20°C for 1 hour. Water was added and stirring was continued for 1 hour. Addition of 1M NaOH and phase separation. The organic layer was washed twice with NaOH 1M. The aqueous layer was acidified to pH 3 with HCl 2M filtration of the suspension, solid washed once with water, and air dried to afford Int02 (400 mg, 1.54 mmol, 23%) as a white solid.C7H4ClNO4S; MS (ESI+) m / z: 232 [M-1]-; 1H NMR (400 MHz, DMSO-d6): δ 8.55 (d, J = 1.7 Hz,1H), 8.45 (s, 2H), 8.33 (d, J = 1.7 Hz, 1H).Step 3: methyl 4-chloro-3-methylsulfanyl-5-nitro-benzoate (Int03)To a solution of Int02 (400 mg, 1.71 mmol, 1 equiv.) diluted in DMF (11 mL, 0.15 M) were addedK2CO3 (710 mg, 5.14 mmol, 3 equiv.) and methyl iodide (234 µL, 3.77 mmol, 2.2 equiv.) at 20°C, theresulting yellow suspension was stirred at 20°C for 16 hours. The reaction mixture was poured into water and extracted with EtOAc, the combined organic layers were dried over Na2SO4, filtrated, andconcentrated under reduced pressure to afford Int03 (220 mg, 0.80 mmol, 47%) as a yellow solid.C9H8ClNO4S; MS (ESI+) m / z: 262, 264 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.26 (d, J = 1.8Hz, 1H), 7.95 (d, J = 1.8 Hz, 1H), 3.93 (s, 3H), 2.67 (s, 3H).Step 4: methyl 3-methylsulfanyl-5-nitro-4-phenoxy-benzoate (Int04)To a solution of Int03 (90 mg, 0.34 mmol, 1 equiv.) diluted in DMF (3 mL, 0.1 M) were added phenol(35.6 mg, 0.38 mmol, 1.1 equiv.) and K2CO3 (95 mg, 0.70 mmol, 2 equiv.) at 20°C, the resulting yellowsuspension was stirred at 100°C for 4 hours. The reaction mixture was poured into water and extractedwith EtOAc, the combined organic layers were dried over Na2SO4, filtrated, and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography withCyclohexane / EtOAc (gradient from 100 / 0 to 1 / 1 over 10 CV) to afford Int04 (64 mg, 0.2 mmol, 60%)as a yellow solid.C15H13NO5S; MS (ESI+) m / z: 320 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.32 (d, J = 2.0 Hz,1H), 8.10 (d, J = 2.0 Hz, 1H), 7.38-7.31 (m, 2H), 6.91-6.87 (m, 2H), 6.80 – 6.71 (m, 1H), 3.95 (s, 3H),2.54 (s, 3H). Step 5: methyl 3-(methylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int05) To a solution of Int04 (270 mg, 0.85 mmol, 1.00 equiv.) diluted in MeOH (8 mL, 0.1 M) and CH2Cl2 (2 mL) were added ammonium carbamate (264 mg, 3.38 mmol, 4 equiv.) and (diacetoxyiodo)benzene (817 mg, 2.54 mmol, 3 equiv.) at 20°C, the resulting yellow suspension was stirred at 20°C for 2 hours. The reaction mixture was concentrated under reduced pressure and then purified by automated flashchromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 9 CV) to afford Int05 (276mg, 0.75 mmol, 89%) as a yellow solid.C15H14N2O6S; MS (ESI+) m / z: 351 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.82 (d, J = 2.2 Hz,1H), 8.70 (d, J = 2.2 Hz, 1H), 7.37-7.31 (m, 2H), 7.19–7.08 (m, 1H), 7.01–6.91 (m, 2H), 4.92 (d, J =1.4 Hz, 1H), 3.97 (s, 3H), 3.28 (d, J = 1.4 Hz, 3H).Step 6: methyl 3-(N,S-dimethylsulfonimidoyl)-5-nitro-4-phenoxy-benzoate (Int06) Int05 (550 mg, 1.491 mmol, 1.00 equiv.) was diluted in formic acid (5.6 mL, 149.14 mmol, 100 equiv.) and heated with paraformaldehyde (224 mg, 7.46 mmol, 5 equiv.) at 120°C during 4 hours with a microwave oven. The reaction mixture was concentrated under reduced pressure and then purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 10 CV) toafford Int06 (481 mg, 1.188 mmol, 80%) as a yellow oil. 91C16H16N2O6S; MS (ESI+) m / z: 365 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.75 – 8.69 (m, 2H),7.38 – 7.29 (m, 2H), 7.12 (td, J = 7.3, 1.1 Hz, 1H), 7.00 – 6.92 (m, 2H), 3.97 (s, 3H), 3.34 (s, 3H), 2.35(s, 3H). Step 7:methyl 3-amino-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 19 ; B173)To a solution of Int06 (481 mg, 1.19 mmol, 1.00 equiv.) diluted in ethanol (8.3 mL, 0.1 M) and water (4.2 mL, 0.1 M) was added ammonium chloride (636 mg, 11.9 mmol, 10.0 equiv.). The suspension wasstirred at 85°C for 10 min. Then, iron (0.93 g, 16.6 mmol, 14.0 equiv.) was added at once. The reactionwas stirred at 85 °C for 2 hours. The mixture was cooled down to 20°C. Water was added and the organic layer was extracted with EtOAc (3 times). The combined organic layers were dried over Na2SO4,filtered, and concentrated under reduced pressure to afford Compound 19 (404 mg, 1.01 mmol, 85%)as a brown oil.C16H18N2O4S; MS (ESI+) m / z: 335 [M+1]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 – 7.62 (m, 2H),7.29 (t, J = 7.8 Hz, 2H), 7.03 (t, J = 7.4 Hz, 1H), 6.80 (d, J = 8.0 Hz, 2H), 5.46 (s, 2H), 3.87 (s, 3H), 3.16 (s, 3H), 2.19 (s, 3H). Step 8:methyl 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoate (Compound 20 ; B174)To a solution of Compound 19 (278 mg, 0.765 mmol, 1.00 equiv.) diluted in 1,2-dichloroethane (5.1 mL, 0.15 M) was added butyraldehyde (207 µL, 2.29 mmol, 3.00 equiv.) then sodium triacetoxyborohydride (324 mg, 1.53 mmol, 2.00 equiv.) at 20°C. The resulting solution was stirred at20°C for 7 hours. After the addition of water, the aqueous layer was extracted 3 times with DCM Thecombined organic layers were dried over Na2SO4, filtered, and concentrated under reduced pressure to give a crude. The crude was purified by automated flash chromatography with Cyclohexane / EtOAc(gradient from 1 / 0 to 0 / 1 over 10 CV) to afford Compound 20 (203 mg, 0.468 mmol, 61%) as a yellowoil.C20H26N2O4S; MS (ESI+) m / z: 391 [M+1]+; 1H NMR (400 MHz, DMSO-d6): δ 7.70 (d, J = 2.0 Hz,1H), 7.48 (d, J = 2.1 Hz, 1H), 7.32 – 7.26 (m, 2H), 7.07 – 7.00 (m, 1H), 6.82 – 6.77 (m, 2H), 5.31 (t, J= 5.7 Hz, 1H), 3.89 (s, 3H), 3.16 (s, 3H), 3.09 (q, J = 6.6 Hz, 2H), 2.17 (s, 3H), 1.46 – 1.34 (m, 2H),1.16 (dt, J = 12.1, 7.2 Hz, 2H), 0.80 (t, J = 7.3 Hz, 3H). Step 9:3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-benzoic acid (Compound 21 ; B175)According to GP2 (Method A), starting from Compound 20, Compound 21 was isolated as a yellowsolid (258 mg, 0.6444 mmol, 99%).C19H24N2O4S; MS (ESI+) m / z: 377 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.78 – 7.70 (m, 1H),7.55 (s, 1H), 7.33 – 7.24 (m, 2H), 7.02 (t, J = 7.3 Hz, 1H), 6.79 (d, J = 8.0 Hz, 2H), 4.96 – 4.82 (m, 1H),3.13 (s, 3H), 3.11 – 3.04 (m, 2H), 2.19 (s, 3H), 1.46 – 1.36 (m, 2H), 1.20 – 1.12 (m, 2H), 0.80 (t, J = 7.3Hz, 3H). 13C NMR (101 MHz, DMSO) δ 162.3, 156.6 (2C), 142.6, 132.5, 129.7 (2C), 122.6, 118.7, 118.5, 116.6, 115.5 (2C), 43.6, 42.7, 30.9, 29.7, 19.9, 14.1. General Procedure 1 (GP1): peptide coupling reaction: Step 10:To a solution of carboxylic acid (1 equiv.) in N,N-dimethylformamide (0.1 M) were added DIPEA (1.5equiv.) and HATU (1.2 equiv.) at 20°C. The resulting mixture was stirred at 20°C up to complete conversion (conversion monitored by LCMS). The reaction was poured into a saturated aqueous solution of NH4Cl and extracted twice with DCM. The combined organic layers were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude was purified by reverse phase LCMS. The pure fractions containing the target compounds were collected and concentrated underreduced pressure to provide pure Compounds 22 to 25.3.1 Compound 22 (B186) 92 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-N-methyl-4-phenoxy-benzamide (Compound 22)According to GP1 (step 10) starting from Compound 21, Compound 22 was isolated as a yellow oil(23 mg, 0.055 mmol, 21%). C20H27N3O3S; MS (ESI+) m / z: 390 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.55 (dd, J =12.2, 2.0 Hz, 2H), 7.34 – 7.27 (m, 2H), 7.10 – 7.04 (m, 1H), 6.87 – 6.81 (m, 2H), 6.43 – 6.34 (m, 1H),3.99 (t, J = 5.5 Hz, 1H), 3.24 (s, 3H), 3.19 – 3.12 (m, 2H), 3.04 (d, J = 4.7 Hz, 3H), 2.43 (s, 3H), 1.52 –1.41 (m, 2H), 1.25 – 1.14 (m, 2H), 0.84 (t, J = 7.4 Hz, 3H).13C NMR (101 MHz, Chloroform-d) δ 166.9, 155.9, 143.5, 139.4, 132.9, 131.8, 130.0 (2C), 123.4, 115.9, 115.1, 115.0 (2C), 43.9, 43.2, 31.2, 29.6, 27.1, 20.3, 13.8. 3.2 Compound 23 (B187) 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-N,N-dimethyl-4-phenoxy-benzamide (Compound 23)According to GP1 (step 10) starting from Compound 21, Compound 23 was isolated as a yellow oil(72 mg, 0.169 mmol, 4%). C21H29N3O3S; MS (ESI+) m / z: 404 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.33 (d, J = 1.9Hz, 1H), 7.32 – 7.27 (m, 2H), 7.09 – 7.02 (m, 2H), 6.89 – 6.83 (m, 2H), 3.98 (t, J = 5.5 Hz, 1H), 3.22(s, 3H), 3.17 – 3.02 (m, 8H), 2.43 (s, 3H), 1.51 – 1.40 (m, 2H), 1.25 – 1.13 (m, 2H), 0.83 (t, J = 7.3 Hz,3H). 13C NMR (101 MHz, Chloroform-d) δ 170.5, 156.1, 143.4, 138.0, 134.5, 129.9 (3C), 123.3, 116.4, 115.1 (3C), 115.0, 44.0, 43.2, 39.7, 35.6, 31.2, 29.6, 20.0, 13.8. 3.3 Compound 24 (B185) 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-4-phenoxy-N-(2,2,2-trifluoroethyl)benzamide (Compound 24)According to GP1 (step 10) starting from Compound 21, Compound 24 was isolated as a yellow oil(162 mg, 0.281 mmol, 83%). 93 C21H26F3N3O3S; MS (ESI+) m / z: 458 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.63 (d, J =2.2 Hz, 1H), 7.57 (d, J = 2.1 Hz, 1H), 7.33 – 7.27 (m, 2H), 7.11 – 7.03 (m, 1H), 6.87 – 6.81 (m, 2H),6.78 (t, J = 6.6 Hz, 1H), 4.21 – 4.08 (m, 2H), 4.01 (t, J = 5.4 Hz, 1H), 3.21 (s, 3H), 3.19 – 3.11 (m, 2H),2.40 (s, 3H), 1.53 – 1.41 (m, 2H), 1.27 – 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, Chloroform-d) δ 166.5, 155.8, 143.5, 140.1, 132.7, 131.2, 130.0 (2C), 123.4, 115.8, 115.4, 115.0 (2C), 43.9, 43.2, 41.5, 41.1, 31.1, 29.8, 20.0, 13.8. 3.4 Compound 25 (B188) 3-(butylamino)-5-(N,S-dimethylsulfonimidoyl)-N-(2-methoxyethyl)-4-phenoxy-benzamide (Compound 25)According to GP1 (step 10) starting from Compound 21, Compound 25 was isolated as a yellow oil(89 mg, 0.195 mmol, 73%). C22H31N3O4S; MS (ESI+) m / z: 434 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 7.63 (d, J = 2.1 Hz, 1H), 7.57 (d, J = 2.0 Hz, 1H), 7.30 (t, J = 7.9 Hz, 2H), 7.08 (t, J = 7.4 Hz, 1H), 6.85 (d, J = 8.1 Hz,2H), 6.74 (t, J = 5.9 Hz, 1H), 4.00 (t, J = 5.5 Hz, 1H), 3.72 – 3.55 (m, 4H), 3.41 (s, 3H), 3.31 (s, 3H),3.20 – 3.11 (m, 2H), 2.47 (s, 3H), 1.46 (p, J = 7.2 Hz, 2H), 1.29 – 1.14 (m, 2H), 0.84 (t, J = 7.3 Hz, 3H).13C NMR (101 MHz, Chloroform-d) δ 202.3, 166.3, 143.5, 130.1 (3C), 123.5, 115.3, 115.1 (3C), 112.4, 107.6, 98.8, 71.1, 59.0, 43.8, 43.2, 40.2, 31.2, 20.0, 13.8.4 – General synthetic scheme for compounds 26 and 27 4.1 Compound 26 (B01) 94 3-(butylamino)-5-(3-methyl-1,2,4-oxadiazol-5-yl)-2-phenoxy-benzenesulfonamide (Compound 26)To a stirred solution of Bumetanide (100 mg, 0.274 mmol, 1 equiv.) in acetonitrile (2.7 mL, 0.1 M) wasadded carbonyl diimidazole (49 mg, 0.301 mmol, 1.1 equiv.), the solution was stirred at 50°C for 1 hour then N-hydroxyacetamidine (23 mg, 0.315 mmol, 1.15 equiv.) was added and the reaction mixture was sirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and the crude oil was taken up in pyridine (2 mL) and stirred at 110°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and purified by automated flashchromatography with DCM / MeOH (gradient from 1 / 0 to 95 / 5 over 10 CV) to afford Compound 26 (30mg, 0.071 mmol, 26%) as a white solid.C19H24N4O5S; MS (ESI+) m / z: 403 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 7.78 (d, J = 2.0 Hz,1H), 7.55 – 7.42 (m, 3H), 7.28 (dd, J = 8.7, 7.3 Hz, 2H), 7.09 – 6.98 (m, 1H), 6.93 – 6.84 (m, 2H), 5.30(t, J = 5.7 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 2.45 (s, 3H), 1.49 – 1.33 (m, 2H), 1.21 – 1.05 (m, 2H), 0.79(t, J = 7.3 Hz, 3H). 4 3-(butylamino)-5-(1,3,4-oxadiazol-2-yl)-2-phenoxy-benzenesulfonamide (Compound 27)To a stirred solution of Bumetanide (200 mg, 0.548 mmol, 1 equiv.) in 1,2-dichloroethane (5.5 mL, 0.1M) was added (N-Isocyanoimino)triphenylphosphorane (199 mg, 0.658 mmol, 1.2 equiv.), the solution was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure and triturated in EtOAc to affordCompound 27 (18 mg, 0.046 mmol, 8%) as a white solid.C18H20N4O4S; MS (ESI+) m / z: 389 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 9.38 (s, 1H), 7.72(d, J = 2.0 Hz, 1H), 7.51 – 7.41 (m, 3H), 7.28 (dd, J = 8.7, 7.3 Hz, 2H), 7.08 – 7.00 (m, 1H), 6.94 – 6.83(m, 2H), 5.28 (t, J = 5.8 Hz, 1H), 3.12 (q, J = 6.6 Hz, 2H), 1.47 – 1.36 (m, 2H), 1.20 – 1.09 (m, 2H),0.79 (t, J = 7.3 Hz, 3H).5 – General synthetic scheme for compounds 28 and 29 95 Step 1: methyl 3-(butylamino)-4-phenoxy-5-sulfamoyl-benzoate (Int01)Compound Int01 was obtained starting from Bumetanide (28395-03-1) following the proceduredescribed in Bioorganic Chemistry, 2020, 100, 103878. Step 2: 3-(butylamino)-5-(hydrazinecarbonyl)-2-phenoxy-benzenesulfonamide (Int02) Astirred solution of Int01 (200 mg, 0.528 mmol, 1 equiv.) in hydrazine 1M in THF (2 mL, 2.11 mmol,4 equiv.) was added at 70°C for 5 days. The reaction mixture was concentrated under reduced pressure and the crude oil was taken up in pyridine (2 mL) and stirred at 110°C for 16 hours. The reaction mixture was concentrated under reduced pressure and triturated in DCM / MeOH 9 / 1 to afford Int02 (100 mg, 0.264 mmol, 50%) as a white solid.C17H22N4O4S; MS (ESI+) m / z: 379 [M+H]+ 3-(butylamino)-5-(2-oxo-3H-1,3,4-oxadiazol-5-yl)-2-phenoxy-benzenesulfonamide (Compound 28) To a stirred solution of Int02 (25 mg, 0.066 mmol, 1 equiv.) in DMF (1 mL, 0.05 M) was addedtriethylamine (14 µL, 0.099 mmol, 1.5 equiv.), and carbonyl diimidazole (12 mg, 0.072 mmol, 1.1 equiv.), the solution was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and the crude oil was purified by preparative thin layer chromatography with DCM / MeOH 95 / 5 to afford Compound 28 (15 mg, 0.037mmol, 56%) as a white solid. C18H20N4O5S; MS (ESI+) m / z: 405 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 12.65 (s, 1H), 7.49(d, J = 2.0 Hz, 1H), 7.40 (s, 2H), 7.34 – 7.23 (m, 2H), 7.20 (d, J = 2.1 Hz, 1H), 7.02 (t, J = 7.3 Hz, 1H),6.90 – 6.81 (m, 2H), 5.20 (t, J = 5.8 Hz, 1H), 3.09 (q, J = 6.6 Hz, 2H), 1.43 – 1.32 (m, 2H), 1.20 – 1.08(m, 2H), 0.78 (t, J = 7.3 Hz, 3H). 96 3-(butylamino)-5-(4-ethyl-5-oxo-1H-1,2,4-triazol-3-yl)-2-phenoxy-benzenesulfonamide (Compound 29)To a stirred solution of Int02 (50 mg, 0.132 mmol, 1 equiv.) in THF (2 mL, 0.05 M) was added ethylisocyanate (12 µL, 0.152 mmol, 1.15 equiv.), the solution was stirred at 20°C for 1 hour. 5 mL Et2O were added to make precipitate a solid that was recovered by filtration, and air-dried. The solid taken up in NaOH 1M and the orange suspension was stirred at 90°C for 16 hours. The reaction mixture was extracted twice with CHCl3 / iPrOH 9 / 1, the organic layer was dried overMgSO4, filtered, and concentrated to dryness to afford Compound 29 (15 mg, 0.035 mmol, 26%) as ayellow solid.C20H25N5O4S; MS (ESI+) m / z: 432 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 11.94 (s, 1H), 7.36(s, 1H), 7.32 – 7.23 (m, 3H), 7.11 (d, J = 2.0 Hz, 1H), 7.06 – 6.97 (m, 1H), 6.92 – 6.83 (m, 2H), 5.15 (t,J = 5.9 Hz, 1H), 3.75 (q, J = 7.2 Hz, 2H), 3.08 (q, J = 6.6 Hz, 2H), 1.43 – 1.30 (m, 2H), 1.22 – 1.09 (m,6H), 0.78 (t, J = 7.4 Hz, 3H).6 – General synthetic scheme for compound 30 to 33
[0006] 97 Step 1: 3-(butylamino)-4-phenoxy-5-sulfamoyl-benzamide (Int01)To a stirred solution of Bumetanide (100 mg, 0.274 mmol, 1 equiv.) in acetonitrile (2.7 mL, 0.1 M) was added carbonyl diimidazole (49 mg, 0.301 mmol, 1.1 equiv.), the solution was stirred at 50°C for 1 hour then a 28% aqueous solution of ammoniac (42 µL, 0.302 mmol, 1.1 equiv.) was added and the reaction mixture was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure and the crude oil was triturated in acetonitrile to afford Int01 (80 mg, 0.220 mmol, 80%) as a white solid.C17H21N3O4S; MS (ESI+) m / z: 364 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.09 (s, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.42 (d, J = 2.1 Hz, 2H), 7.32 – 7.05 (m, 4H), 7.05 – 6.97 (m, 1H), 6.88 – 6.81 (m,2H), 4.85 (t, J = 5.8 Hz, 1H), 3.08 (q, J = 6.6 Hz, 2H), 1.44 – 1.29 (m, 2H), 1.21 – 1.04 (m, 2H), 0.78 (t,J = 7.3 Hz, 3H). 98 Step 2: tert-butyl N-[3-(butylamino)-5-[methoxy(methyl)carbamoyl]-2-phenoxy-phenyl]sulfonylcarbamate (Int02) To a stirred solution of Bumetanide (1 g, 2.740 mmol, 1 equiv.) in THF (10 mL, 0.5 M) was added carbonyl diimidazole (489 mg, 3.02 mmol, 1.1 equiv.), the solution was stirred at 50°C for 1 hour then N, O-dimethyl hydroxylamine hydrochloride (294 mg, 3.02 mmol, 1.1 equiv.) was added and the reaction mixture was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure and the crude oil was taken up in acetonitrile (20 mL), and treated with triethylamine (572 µL, 4.11 mmol, 1.5 equiv.), DMAP (21 mg, 0.172 mmol, 0.06 equiv.), and (549 mg, 3.288 mmol, 1.2 equiv.). The resulting mixture was stirred at 20°C for 4 hours. The reaction mixture was concentrated under reduced pressure and purified by automated flashchromatography with DCM / MeOH (gradient from 1 / 0 to 95 / 5 over 10 CV) to afford Int02 (1.12 g, 2.74mmol, quantitative) as a white solid.C24H33N3O7S; MS (ESI+) m / z: 508 [M+H]+. 1H NMR (400 MHz, DMSO-d6): δ 11.53 (s, 1H), 7.35(d, J = 2.0 Hz, 1H), 7.28 (dd, J = 8.7, 7.3 Hz, 2H), 7.22 (d, J = 2.0 Hz, 1H), 7.03 (t, J = 7.3 Hz, 1H), 6.87– 6.78 (m, 2H), 5.08 (s, 1H), 3.62 (s, 3H), 3.29 (s, 3H), 3.04 (q, J = 6.6 Hz, 2H), 1.39 – 1.30 (m, 2H),1.26 (s, 9H), 1.15 – 1.03 (m, 2H), 0.76 (t, J = 7.4 Hz, 3H).Step 3:3-(butylamino)-5-cyano-2-phenoxy-benzenesulfonamide (Int03)To a stirred solution of Int01 (180 mg, 0.495 mmol, 1 equiv.) in dry dioxane (2.5 mL, 0.2 M) was addeddry pyridine (120 µL, 1.49 mmol, 3 equiv.), and trifluoroacetic anhydride (105 µL, 0.742 mmol, 1.5 equiv.), the solution was stirred at 20°C for 1 hour. The reaction mixture was concentrated under reduced pressure, and the crude oil was purified by automated flash chromatography with DCM / MeOH (gradientfrom 1 / 0 to 9 / 1 over 10 CV) to afford Int03 (99 mg, 0.495 mmol, 58%) as a white solid.C17H19N3O3S; MS (ESI+) m / z: 346 [M+H]+.1H NMR (500 MHz, DMSO-d6) δ 7.47 (s, 2H), 7.38 (t,J = 2.1 Hz, 2H), 7.33 – 7.23 (m, 2H), 7.07 – 6.98 (m, 1H), 6.88 – 6.80 (m, 2H), 5.42 (t, J = 5.9 Hz, 1H),3.07 (q, J = 6.6 Hz, 2H), 1.43 – 1.28 (m, 2H), 1.16 – 1.02 (m, 2H), 0.77 (t, J = 7.4 Hz, 3H).6.1 Compound 30 (B27) 3-(butylamino)-2-phenoxy-5-(4H-1,2,4-triazol-3-yl)benzenesulfonamide (Compound 30)A stirred solution of Int01 (150 mg, 0.413 mmol, 1 equiv.) in DMF-DMA (1 mL, 0.4 M) was stirred at120°C for 2 hours. The reaction mixture was concentrated under reduced pressure and the crude oil was taken up in acetic acid ( 1 mL, 0.4 M), and treated with hydrazine hydrate ( 28 µL, 0.454 mmol, 1.1 equiv.). The resulting mixture was stirred at 90°C for 2 hours. The reaction mixture was concentrated under reduced pressure, taken up in EtOAc, and poured into a saturated solution of NaHCO3in water to reach a basic pH. The aqueous layer was extracted with EtOAc, and the organic layer was dried with Na2SO4, filtered, and concentrated under reduced pressure. The crude oil was purified by automated flash purification with DCM / MeOH (gradient from 1 / 0 to 9 / 1 in 4 CV). The resulting intermediate was diluted in MeOH (1 mL) and THF (2 mL) and stirred at 20°C with solid NaOH (30 mg, 0.746 mmol) for 3 days. The reaction mixture was poured in water; and extracted twice with CHCl3 / iPrOH 8 / 2. The combined organic layers were dried with MgSO4, filtered, and concentrated under reduced pressure. The crude oil was triturated once in acetonitrile and once with methyl tert-butylether to afford Compound30 (30 mg, 0.248 mmol, 31%) as a white solid.C18H21N5O3S; MS (ESI+) m / z: 388 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 14.18 (s, 1H), 8.63(s, 1H), 7.81 (d, J = 1.9 Hz, 1H), 7.56 (d, J = 1.9 Hz, 1H), 7.34 – 7.17 (m, 4H), 7.01 (t, J = 7.3 Hz, 1H), 996.88 (d, J = 8.1 Hz, 2H), 4.94 (s, 1H), 3.15 – 3.02 (m, 2H), 1.48 – 1.35 (m, 2H), 1.22 – 1.12 (m, 2H),0.79 (t, J = 7.3 Hz, 3H). 6.2 Compound 31 (B26) 3-(butylamino)-N-methylsulfonyl-4-phenoxy-5-sulfamoyl-benzamide (Compound 31) To a stirred solution of Bumetanide (200 mg, 0.548 mmol, 1 equiv.) in acetonitrile (5 mL, 0.1 M) was added carbonyl diimidazole (99 mg, 0.603 mmol, 1.1 equiv.), the solution was stirred at 50°C for 1 hour then methane sulfonamide (156 mg, 1.65 mmol, 3 equiv.), and DBU (82 µL, 0.548 mmol, 1 equiv.) were added at 20°C, and the reaction mixture was stirred at 20°C for 3 days. The reaction mixture was concentrated under reduced pressure, and the crude oil was purified by automated flash chromatographywith DCM / MeOH (gradient from 1 / 0 to 9 / 1 over 10 CV) to afford Compound 31 (30 mg, 0.068 mmol,13%) as a white solid.C18H23N3O6S; MS (ESI+) m / z: 442 [M+H]+; 1H NMR (400 MHz, DMSO-d6): δ 8.29 (s, 1H), 7.74(d, J = 1.9 Hz, 1H), 7.50 (d, J = 2.0 Hz, 1H), 7.32 (d, J = 1.1 Hz, 2H), 7.30 – 7.24 (m, 1H), 7.21 (s, 1H),7.00 (t, J = 7.3 Hz, 1H), 6.84 (d, J = 8.1 Hz, 2H), 4.78 (t, J = 5.7 Hz, 1H), 3.07 (d, J = 11.0 Hz, 5H), 1.48– 1.32 (m, 2H), 1.21 – 1.03 (m, 2H), 0.78 (t, J = 7.3 Hz, 3H). tert-butyl N-[5-acetyl-3-(butylamino)-2-phenoxy-phenyl]sulfonylcarbamate (Compound 32)To a stirred solution of Int02 (850 mg, 1.67 mmol, 1 equiv.) in THF (15 mL, 0.1 M) was added dropwiseat 0°C a 3M solution of methyl magnesium bromide in THF (1.67 mL, 5.02 mmol, 3 equiv.), the solution was stirred at 20°C for 2 hours. The reaction mixture was poured into a 1M aqueous solution of hydrogenchloride. The aqueous solution was extracted with EtOAc, and the organic layer was dried in Na2SO4,filtered, and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography with Cyclohexane / EtOAc (gradient from 1 / 0 to 0 / 1 over 12 CV) to afford Compound32 (550 mg, 1.67 mmol, 71%) as a yellow solid.C23H30N2O6S; MS (ESI+) m / z: 463 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 11.60 (s, 1H), 7.69(d, J = 2.0 Hz, 1H), 7.50 (d, J = 2.0 Hz, 1H), 7.33 – 7.23 (m, 2H), 7.11 – 6.99 (m, 1H), 6.86 – 6.78 (m,2H), 5.17 – 5.07 (m, 1H), 3.10 (q, J = 6.6 Hz, 2H), 2.62 (s, 3H), 1.43 – 1.33 (m, 2H), 1.25 (s, 9H), 1.14– 1.02 (m, 2H), 0.76 (t, J = 7.3 Hz, 3H). 100 6.4 Compound 33 (B06) 3-(butylamino)-5-(5-oxo-4H-1,2,4-oxadiazol-3-yl)-2-phenoxy-benzenesulfonamide (Compound 33)To a stirred solution of Int03 (90 mg, 0.260 mmol, 1 equiv.) in ethanol (2.5 mL, 0.1 M) was added a 1.2M aqueous solution of sodium bicarbonate (650 µL, 0.781 mmol, 3 equiv.) and hydroxylamine hydrochloride (36 mg, 0.521 mmol, 2 equiv.) at 20°C. The resulting mixture was stirred at 80°C for 4 hours. The reaction mixture was poured into water, the aqueous layer was extracted with EtOAc, and the organic layer was dried with Na2SO4, filtered, and concentrated under reduced pressure.The resulting crude white solid was diluted in dioxane (2.5 mL, 0.1 M), and treated with DBU (38.5 µL,253 mmol, 1.1 equiv.), and carbonyl diimidazole (56 mg, 0.344 mmol, 1.5 equiv.) at 20°C. The reaction mixture was stirred at 100°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and the crude oil was purified bypreparative thin layer chromatography with DCM / MeOH 95 / 5 to afford Compound 33 (15 mg, 0.037mmol, 16%) as a yellow solid.C18H20N4O5S; MS (ESI+) m / z: 405 [M+H]+; 1H NMR (400 MHz, Acetonitrile-d3) δ 7.72 – 7.58 (m,2H), 7.42 (s, 1H), 7.34 (t, J = 7.7 Hz, 2H), 7.06 (s, 2H), 6.94 (d, J = 8.0 Hz, 2H), 4.47 – 4.35 (m, 1H),3.15 – 3.03 (m, 2H), 1.47 – 1.35 (m, 2H), 1.23 – 1.07 (m, 2H), 0.81 (t, J = 7.4 Hz, 3H).7 – General synthetic scheme for compounds 34 to 36
[0007] 101 Step 3: 2-chloro-5-cyano-4-fluoro-benzenesulfonamide (Int01)A solution of 4-Chloro-2-fluoro-5-sulfamoylbenzoic acid (300 mg, 1.18 mmol, 1 equiv.) in thionylchloride (2.14 mL, 29.57 mmol, 25 equiv.) was stirred at 75°C for 2 hours. The reaction mixture was concentrated under reduced pressure. The crude oil was taken up at 0°C in a 28% aqueous solution of ammonia (2 mL, 14.19 mmol, 12 equiv.) and the resulting solution was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure. The crude oil was taken up in phosphorus oxychloride (1 mL), stirred at 110°C for 1 hour, then concentrated under reduced pressure to affordInt01 (200 mg, 0.852 mmol, 72%) as a yellow solid.C7H4ClFN2O2S; MS (ESI+) m / z: 235 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.44 (d, J = 6.8 Hz, 1H), 8.10 (d, J = 9.1 Hz, 1H), 7.92 (s, 2H). Step 4: 2-chloro-5-cyano-4-(2-furylmethylamino)benzenesulfonamide (Int02)To a solution of Int01 (100 mg, 0.426 mmol, 1 equiv.) in DMF (2 mL, 0.2 M) were added triethylamine(89 µL, 0.639 mmol, 1.5 equiv.) and furfurylamine (56 µL, 0.639 mmol, 1.5 equiv.). The resulting mixture was stirred at 50°C for 16 hours. The reaction mixture was concentrated under reduced pressure. The crude solid was suspended up in DCM (3 mL) and MeOH (0.5 mL), filtered, and air-dried to affordInt02 (100 mg, 0.321 mmol, 75%) as a white solid.C10H10ClN3O3S; MS (ESI+) m / z: 312 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 7.95 (s, 1H), 7.70– 7.56 (m, 2H), 7.44 (s, 2H), 7.07 (s, 1H), 6.38 (dd, J = 19.9, 2.7 Hz, 2H), 4.52 (d, J = 5.8 Hz, 2H). 102 7.1 Compound 34 (F01) 4-(2-furylmethylamino)-2-hydroxy-5-(3-methyl-1,2,4-oxadiazol-5-yl)benzenesulfonamide (Compound 34)To a stirred solution of Furosemide (100 mg, 0.302 mmol, 1 equiv.) in acetonitrile (3 mL, 0.1 M) wasadded carbonyl diimidazole (54 mg, 0.332 mmol, 1.1 equiv.), the solution was stirred at 50°C for 1 hour then N-hydroxyacetamidine (26 mg, 0.347 mmol, 1.15 equiv.) was added. The reaction mixture was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and thecrude oil was taken up in pyridine (2 mL) and stirred at 110°C for 16 hours.The reaction mixture was concentrated under reduced pressure, and purified by automated flashchromatography with DCM / MeOH (gradient from 1 / 0 to 95 / 5 over 10 CV) to afford Compound 34 (50mg, 0.129 mmol, 43%) as a white solid.C14H15ClN4O5S; MS (ESI+) m / z: 387 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.43 (s, 2H), 7.64(t, J = 1.3 Hz, 1H), 7.48 (s, 2H), 7.26 (s, 1H), 6.48 – 6.37 (m, 2H), 4.73 (d, J = 5.9 Hz, 2H), 2.46 (s, 3H).7.2 Compound 35 (F13) 4-(2-furylmethylamino)-2-hydroxy-5-(3-methyl-1,2,4-oxadiazol-5-yl)benzenesulfonamide (Compound 35)To a stirred solution of Furosemide (200 mg, 0.605 mmol, 1 equiv.) in DCE (6 mL, 0.1 M) was added(N-isocyanoimino)triphenylphosphorane (219 mg, 0.725 mmol, 1.2 equiv.), the solution was stirred at 20°C for 18 hours. The reaction mixture was concentrated under reduced pressure, and purified by preparated thin layerchromatography with CyHex / AcOEt 1 / 1 to afford Compound 35 (87 mg, 0.245 mmol, 40%) as a whitesolid. C13H11ClN4O4S; MS (ESI+) m / z: 355 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 9.40 (s, 1H), 8.33(s, 2H), 7.64 (dd, J = 1.8, 1.0 Hz, 1H), 7.45 (s, 2H), 7.25 (s, 1H), 6.50 – 6.38 (m, 2H), 4.73 (d, J = 5.8Hz, 2H). 103 2-chloro-4-(2-furylmethylamino)-5-(5-oxo-4H-1,2,4-oxadiazol-3-yl)benzenesulfonamide (Compound 36) To a stirred solution of Int02 (45 mg, 0.144 mmol, 1 equiv.) in ethanol (1.5 mL, 0.1 M) was added a 1.2M aqueous solution of sodium bicarbonate (360 µL, 0.433 mmol, 3 equiv.) and hydroxylamine hydrochloride (20 mg, 0.0.289 mmol, 2 equiv.) at 20°C. The resulting mixture was stirred at 80°C for 2 hours. The reaction mixture was poured into water, the aqueous layer was extracted with EtOAc, and the organic layer was dried with Na2SO4, filtered, and concentrated under reduced pressure. The resulting crude white solid was diluted in dioxane (1.5 mL, 0.1 M) and treated with DBU (14 µL, 0.144 mmol, 1.1 equiv.) and carbonyl diimidazole (21 mg, 0.216 mmol, 1.5 equiv.) at 20°C. The reactionmixture was stirred at 100°C for 16 hours. The reaction mixture was concentrated under reduced pressure. The crude oil was purified by preparative thin layer chromatography with DCM / MeOH 97 / 3 to afford Compound 36 (6 mg, 0.017mmol, 18%) as a white solid. C13H11ClN4O5S; MS (ESI+) m / z: 371 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.31 (s, 1H), 8.29 –8.15 (m, 2H), 7.62 (d, J = 1.7 Hz, 1H), 7.28 (d, J = 13.9 Hz, 2H), 6.99 (s, 1H), 6.51 – 6.29 (m, 2H),4.56 (d, J = 5.5 Hz, 2H). 8– General synthetic scheme for compounds 37 - 38 Step 1: 4-chloro-2-fluoro-5-methylsulfonyl-benzoic acid (Int01) Asolution of 4-Chloro-2-fluoro-5-sulfamoylbenzoic acid (1 g, 3.66 mmol, 1 equiv.) in THF (3.7 mL,1 M) was stirred at 20°C to a solution of sodium sulfite (646 mg, 5.13 mmol, 1.4 equiv.) and sodium hydrogen carbonate (461 mg, 5.49 mmol, 1.5 equiv.). The resulting white suspension was stirred at 75°C for 2 hours. At 30°C methyl iodide (1.14 mL, 18.31 mmol, 5 equiv.) was added, and the resulting yellow solution was stirred at 50°C for 24 hours. The reaction mixture was poured into water, and washed with EtOAc then the aqueous layer was acidified to pH 4 and extracted with EtOAc. The organic layer was concentrated under reduced pressure to afford Int01 (634 mg, 2.51 mmol, 68%) as a yellow solid.C8H6ClFO4S; 1H NMR (400 MHz, DMSO-d6) δ 8.49 (d, J = 7.6 Hz, 1H), 7.96 (d, J = 10.2 Hz, 1H), 3.41 (s, 3H). 104 Step 2: 4-chloro-2-fluoro-5-methylsulfonyl-benzamide (Int02)Int01 (200 mg, 0.792 mmol, 1 equiv.) was diluted in thionyl chloride (1.44 mL, 19.79 mmol, 25 equiv.)was stirred at 75°C for 2 hours. The reaction mixture was concentrated under reduced pressure. The resulting mixture was taken up in a 28% aqueous solution of ammonia at 0°C and stirred at 20°C for 16hours. The reaction mixture was concentrated under reduced pressure to afford Int02 (200 mg, 0.792mmol, quantitative) as a white solid. C8H7ClFNO3S; 1H NMR (400 MHz, DMSO-d6) δ 8.29 (d, J = 7.4 Hz, 1H), 7.94 (d, J = 9.9 Hz, 1H), 7.14 (s, 2H), 3.40 (s, 3H). Step 3: 4-chloro-2-(2-furylmethylamino)-5-methylsulfonyl-benzonitrile (Int03)Int02 (200 mg, 0.792 mmol, 1 equiv.) was dissolved in phosphoryl trichloride (1.5 mL, 0.5 M) andheated at 110°C for 1 hour in a sealed vial. The reaction mixture was concentrated under reduced pressure. The crude oil was purified by automated flash chromatography with CyHex / EtOAc 1 / 0 to 0 / 1 in 10 CV to afford a white solid 4-chloro-2-fluoro-5-methylsulfonyl-benzonitrile (127 mg, 0.544 mmol, 1.00 equiv.) that was taken up in DMF (5.4 mL, 0.1 M) with triethylamine (91 µL, 0.652 mmol, 1.20 equiv.) and furfurylamine (58 µL, 0.652 mmol, 1.20 equiv.) at 20°C, the resulting yellow solution was stirred at 50°C for 2 hours. The reaction mixture was concentrated under reduced pressure to affordInt03 (170 mg, 0.520 mmol, 96%) as a white solid.C13H11ClN2O3S; 1H NMR (400 MHz, DMSO-d6) δ 7.99 (s, 1H), 7.90 (t, J = 6.0 Hz, 1H), 7.62 (dd, J = 1.9, 0.9 Hz, 1H), 7.16 (s, 1H), 6.40 (dd, J = 9.2, 1.4 Hz, 2H), 4.56 (d, J = 6.0 Hz, 2H), 3.27 (s, 3H). 3-[4-chloro-2-(2-furylmethylamino)-5-methylsulfonyl-phenyl]-4H-1,2,4-oxadiazol-5-one (Compound 37)To a stirred solution of Int03 (143 mg, 0.461 mmol, 1 equiv.) in ethanol (2.3 mL, 0.2 M) was added a1.2 M solution of sodium bicarbonate in water (1.2 mL, 1.38 mmol, 3 equiv.), the resulting yellow suspension was stirred at 80°C for 2 hours. After cooling to 20°C, water was added and the aqueous layer was extracted with EtOAc, the organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure. The resulting yellow solid was taken up in 1,4-Dioxane (4.6 mL, 0.1 M) and treated with 1,8-diazabicyclo[5,4,0]undec-7-ene (70µL, 0.461 mmol, 1 equiv.) and carbonyl diimidazole (102 mg, 0.628 mmol, 1 equiv.). The resulting yellow suspension was stirred at 100°C for 16 hours. The reaction mixture was concentrated under reduced pressure, and purified by automated flash chromatography with DCM / MeOH (gradient from 1 / 0 to 95 / 5 over 10 CV) to afford Compound 37 (100 mg, 0.257 mmol, 61%) as a white solid. C14H12ClN3O5S; MS (ESI+) m / z: 370 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 8.21(s, 1H), 7.63 (dd, J = 1.9, 0.9 Hz, 1H), 7.50 (d, J = 1.2 Hz, 1H), 7.14 (s, 1H), 6.46 – 6.36 (m, 2H), 4.63(d, J = 5.8 Hz, 2H), 3.26 (s, 3H). 8.2 Compound 38 (F38) 105 4-chloro-2-imidazol-1-yl-5-methylsulfonyl-benzamide (Compound 38) To a stirred solution of Int01 (100 mg, 0.397 mmol, 1 equiv.) diluted in acetonitrile (4 mL, 0.1 M) wasadded carbonyl diimidazole (64 mg, 0.397 mmol, 1 equiv.) at 20°C, the resulting yellow suspension wasstirred at 50°C for 1 hour. Then a 28% aqueous solution of ammonium hydroxide (1 mL) was added and the reaction mixture was stirred at 20°C for 16 hours. The reaction mixture was concentrated under reduced pressure and triturated in acetonitrile to afford Compound 38 (100 mg, 0.334 mmol, 84%) asa white solid. C11H10ClN3O3S; MS (ESI+) m / z: 300 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.10 (s, 2H), 8.02 (s, 1H), 7.96 (s, 1H), 7.82 (s, 1H), 7.48 (s, 1H), 7.11 (s, 1H), 3.45 (s, 3H). 9– General synthetic scheme for compounds 39 - 42 Step 1: methyl 2,4-dichloro-5-methylsulfanyl-benzoate (Int01) To a solution of 2,4-dichloro-5-chlorosulfonyl-benzoic acid (1 g, 3.45 mmol, 1 equiv.) diluted intoluene (34 mL, 1 M) was stirred at 20°C triphenylphosphine (2.72 g, 10.36 mmol, 3 equiv.). The resulting solution was stirred at 20°C for 20 minutes. Water (3 mL) was added to the reaction mixture and the white suspension was filtered, the filtrate was concentrated under reduced pressure, taken up in EtOAc, treated with a 2M aqueous solution of NaOH, layers were separated, and the organic layer was washed once with NaOH 2M. Aqueous layers were acidifed to pH 3, and extracted with EtOAc. Organic layers were dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford as a 106 white solid that was taken up in DMF (10 mL) treated with potassium carbonate (550 mg, 3.98 mmol)and methyl iodide (182 µL, 2.92 mmol). The resulting yellow solution was stirred at 20°C for 2 hours.The reaction mixture was poured into water, and extracted with EtOAc. The organic layer was driedover sodium sulfate, filtered, and concentrated under reduced pressure to afford Int01 (336 mg, 1.34mmol, 38%) as a yellow solid. C7H4Cl2O2S; 1H NMR (400 MHz, DMSO-d6) δ 7.78 (s, 1H), 7.62 (s, 2H), 3.88 (s, 3H), 2.55 (s, 3H). Step 2: methyl 4-chloro-2-fluoro-5-methylsulfanyl-benzoate (Int02)To a solution of 4-Chloro-5-(chlorosulfonyl)-2-fluorobenzoic acid (500 mg, 1.83 mmol, 1 equiv.)diluted in toluene (18 mL, 1 M) was stirred at 20°C triphenylphosphine (1.44 g, 5.49 mmol, 3 equiv.). The resulting solution was stirred at 20°C for 20 minutes. Water (3 mL) was added to the reaction mixture and the white suspension was filtered, the filtrate was concentrated under reduced pressure, taken up in EtOAc, treated with a 2M aqueous solution of NaOH, layers were separated and the organic layer was washed once with NaOH 2M. Aqueous layers were acidifed to pH 3 and extracted with EtOAc. Organic layers were dried over sodium sulfate, filtered, and concentrated under reduced pressure to afford a colorless oil that was taken up in DMF (4.5 mL) treated with cesium carbonate (914 mg, 2.90 mmol) and methyl iodide (150 µL, 2.42 mmol). The resulting yellow solution was stirred at 20°C for 16 hours. The reaction mixture was poured into water, and extracted with EtOAc. The organic layer wasdried over sodium sulfate, filtered, and concentrated under reduced pressure to afford Int02 (250 mg,1.07 mmol, 58%) as a yellow solid.C9H8ClFO2S; 1H NMR (400 MHz, DMSO-d6) δ 7.72 – 7.65 (m, 2H), 3.88 (s, 3H), 2.55 (s, 3H).Step 3: methyl 4-chloro-2-fluoro-5-(methylsulfonimidoyl)benzoate (Int03)To a solution of Int02 (230 mg, 0.980 mmol, 1 equiv.) diluted in methanol (10 mL, 0.4 M) were addedammonium carbamate (307 mg, 3.98 mmol, 4 equiv.) and iodosobenzene I,I-diacetate (947 mg, 2.94mmol, 3 equiv.) at 20°C, the resulting yellow solution was stirred at 20°C for 2 hours. The reactionmixture was concentrated under reduced pressure, and purified by automated flash chromatography withDCM / MeOH from 1 / 0 to 95 / 5 over 10 CV to afford Int03 (102 mg, 0.384 mmol, 39%) as a white solid.C9H9ClFNO3S; MS (ESI+) m / z: 266 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.59 (d, J = 7.7 Hz, 1H), 7.91 (d, J = 10.4 Hz, 1H), 4.83 (s, 1H), 3.91 (s, 3H), 3.24 (d, J = 1.2 Hz, 3H). 9.1 methyl 2,4-dichloro-5-(methylsulfonimidoyl)benzoate (Compound 39)To a stirred solution of Int01 (100 mg, 0.398 mmol, 1 equiv.) diluted in methanol (1 mL, 0.4 M) wereadded ammonium carbamate (124 mg, 1.59 mmol, 4 equiv.) and iodosobenzene I,I-diacetate (385 mg,1.19 mmol, 3 equiv.) at 20°C, the resulting yellow solution was stirred at 20°C for 2 hours. The reactionmixture was concentrated under reduced pressure, and purified by thin-layer chromatography withDCM / MeOH 95 / 5 to afford Compound 39 (53 mg, 0.187 mmol, 47%) as a white solid.C9H9Cl2NO3S; MS (ESI+) m / z: 282 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.49 (s, 1H), 8.06 (s, 1H), 4.84 (s, 1H), 3.91 (s, 3H), 3.25 (d, J = 1.3 Hz, 3H). 9.2 Compound 40 (F30) 107 2,4-dichloro-5-(methylsulfonimidoyl)benzoic acid (Compound 40)To a stirred solution of Compound 39 (300 mg, 1.06 mmol, 1 equiv.) diluted in methanol / dioxane 1 / 1(5 mL, 0.2 M) was added a 2 M aqueous solution of sodium hydroxide (1.6 mL, 3.19 mmol, 3 equiv.)at 20°C, the resulting colorless solution was stirred at 20°C for 16 hours. The reaction mixture waspoured into water, the aqueous layer was washed once with EtOAc. The aqueous layer was acidified to pH 3 with a 2 M aqueous solution of HCl, then extracted with an 8 / 2 mixture of chloroform / isopropanol. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure.The resulting white solid was triturated with methyl tert-butyl ether to afford Compound 40 (100 mg,0.373 mmol, 35%) as a white solid. C8H7Cl2NO3S; MS (ESI+) m / z: 268 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 8.44 (s, 1H), 7.97 (s, 1H), 4.82 (s, 1H), 3.24 (s, 3H). 9.3 Compound 41 (F09) 4-chloro-2-(2-furylmethylamino)-5-(methylsulfonimidoyl)benzoic acid (Compound 41)To a solution of Compound 40 (50 mg, 0.186 mmol, 1 equiv.) in THF (0.5 mL, 0.4 M) were addedtriethylamine (36 µL, 0.261 mmol, 1.4 equiv.) and furfurylamine (49 µL, 0.559 mmol, 3 equiv.). Theresulting mixture was stirred at 80°C for 3 days. The reaction mixture was concentrated under reducedpressure. The crude solid was purified by reverse phase HPLC-MS with a water / Acetonitrile to affordCompound 41 (9 mg, 0.027 mmol, 15%) as a brown oil.C13H13ClN2O4S; MS (ESI+) m / z: 329 [M+H]+; 1H NMR (400 MHz, Acetonitrile-d3) δ 9.00 (s, 1H),8.60 (s, 1H), 7.48 (s, 1H), 6.97 (s, 1H), 6.51 – 6.25 (m, 3H), 4.51 (s, 2H), 3.16 (s, 3H).9.4 Compound 42 (F39) 4-chloro-2-methoxy-5-(methylsulfonimidoyl)benzoic acid (Compound 42)To a solution of Int03 (102 mg, 0.384 mmol, 1 equiv.) diluted in methanol / dioxane 1 / 1 (4 mL, 0.2 M)was added a 2 M aqueous solution of sodium hydroxide (576 µL, 1.15 mmol, 3 equiv.) at 20°C, the resulting colorless solution was stirred at 20°C for 16 hours. The reaction mixture was poured into water, the aqueous layer was washed once with EtOAc. The aqueous layer was acidified to pH 3 with a 2 M aqueous solution of HCl, then extracted with an 8 / 2 mixture of chloroform / isopropanol. The organic layer was dried with magnesium sulfate, filtered, and concentrated under reduced pressure. The resultingwhite solid was triturated with methyl tert-butyl ether to afford Compound 42 (49 mg, 0.185 mmol,48%) as a white solid. C9H10ClNO4S; MS (ESI+) m / z: 264 [M+H]+; 1H NMR (400 MHz, DMSO-d6) δ 13.15 (s, 1H), 8.37 (s, 1H), 7.43 (s, 1H), 4.59 (s, 1H), 3.94 (s, 3H), 3.20 (s, 3H).10 – Compounds 43 - 4510.1 Compound 43 (F14) 108 2-chloro-4-(2-furylmethylamino)-5-(hydroxymethyl)benzenesulfonamide (Compound 43)Compound 43 was isolated following reported procedures disclosed in Chemische Berichte, 1966, vol.99, p.328 by Karl Sturm, Walter Siedel, Rudi Weyer and Heinrich Ruschig. 10.2 Compound 44 (F10) 4-chloro-2-(2-furylmethylamino)-5-(methylsulfamoyl)benzoic acid (Compound 44)Compound 44 was isolated following reported procedures disclosed in European Journal ofMedicinal Chemistry, 2021, vol. 222, p 113565 by Wang Zhiyu, Wang Yanfei, Pasangulapati Jagadeesh Prasad, Stover Kurt R., Liu Xiaojing, Schier Stephanie Wohnig, Weaver Donald F.. 10.3 Compound 45 (F11) 4-chloro-2-(2-furylmethylamino)-5-methylsulfonyl-benzoic acid (Compound 45)Compound 45 was isolated following reported procedures disclosed in US3953476, 1976, by MERCK.10.4 Compound 46 (F50) 4-chloro-2-fluoro-5-sulfamoyl-benzamide (Compound 46)Compound 46 was isolated following reported procedures disclosed in US2022 / 71935, by NeuroTherapeutics Inc.. 10.5 Compound 47 (F52) 109 2,4-dichloro-5-methylsulfonyl-benzoic acid (Compound 47) Compound 47 – CAS 51521-75-6 was purchased.10.6 Compound 48 (F53) 4-chloro-5-(dimethylsulfamoyl)-2-(2-furylmethylamino)benzoic acid (Compound 48) Compound 48 was isolated following reported procedures disclosed in European Journal of MedicinalChemistry, 2021, vol.222, p 113565 by Wang Zhiyu, Wang Yanfei, Pasangulapati Jagadeesh Prasad, Stover Kurt R., Liu Xiaojing, Schier Stephanie Wohnig, Weaver Donald F... 10.7 Compound 49 (F54) 3-(dimethylsulfamoyl)-4-fluoro-benzoic acid (Compound 49) Compound 49 - – CAS 381229-72-7 was purchased.11 – Synthetic scheme for Compounds 50 Step 1: methyl 4-fluoro-3-(methylsulfonimidoyl)benzoate (Int01) To a stirred solution of Methyl 4-fluoro-3-(methylthio)benzoate (125 mg, 0.62 mmol, 1 equiv.) inMeOH were added ammonium carbamate (195 mg, 2.50 mmol, 3 equiv.) and PIDA (600 mg, 1.87 mmol, 4 equiv.). The mixture was stirred 2 hours at 20°C. Solvent was removed under reduced pressure 110 and the crude residue was purified by automated flash chromatography with Cyclohexane / EtOAc(gradient from 95 / 5 to 0 / 100 over 12 CV) to afford Int01 as a colorless oil (129 mg, 0.552 mmol, 88%).C9H10FNO3S; MS (ESI+) m / z: 232 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.63 (dd, J = 7.0Hz, J = 2.2 Hz, 1H), 8.29 (ddd, J = 8.6 Hz, J = 4.7 Hz, J = 2.3 Hz, 1H), 7.31 (dd, J = 9.3 Hz, J = 8.6 Hz,1H), 3.95 (s, 3H), 3.29 (s, 3H), 3.09 (br s, 1H).19F NMR (400 MHz, Chloroform-d): δ -102.3 Step 2: methyl 3-(methylsulfonimidoyl)-4-(8,8,8-trifluorooctylamino)benzoate (Int02) To a stirred solution of 2-(8,8,8-trifluorooctyl)isoindoline-1,3-dione1(262 mg, 0.83 mmol, 1.5 equiv.) in dry EtOH (10 mL) was added hydrazine monohydrate (277 µL, 5.58 mmol, 10 equiv.). The solution was stirred 1 hour at 80°C and the mixture was cooled down to 20°C. The suspension was filtrated, the solid was washed with DCM and the filtrate was concentrated under reduced pressure. The residue wastaken up in dioxane (5 mL) and was added to Int01 (129 mg, 0.56 mmol). The solution was stirred 16hours at 110°C. After cooling down, the mixture was partitioned between an aqueous saturated solution of ammonium chloride and EtOAc. Aqueous layer was extracted with EtOAc twice and combined organic layers were washed with brine, filtrated over sodium sulphate and concentrated under reduced pressure. The crude oil was purified by automated flash chromatography with Cyclohexane / EtOAc(gradient from 100 / 0 to 30 / 70 over 10 CV) to afford Int02 as a sticky solid (145 mg, 0.37 mmol, 66%).C17H25F3N2O3S; MS (ESI+) m / z: 395 [M+H]+; 1H NMR (400 MHz, Chloroform-d) δ 8.50 (d, J = 2.1 Hz, 1H), 8.05 (dd, J = 8.8 Hz, J = 2.1 Hz, 1H), 7.46 (t, J = 4.8 Hz, 1H), 6.71 (d, J = 8.8 Hz, 1H), 3.87 (s, 3H), 3.26-3.18 (m, 2H), 3.08 (d, J = 1.2 Hz, 3H), 2.85 (s, 1H), 2.13–1.99 (m, 2H), 1.75-1.66 (m, 2H),11.61-1.51 (m, 2H), 1.48-1.35 (m, 6H). 19F NMR (376 MHz, Chloroform-d) δ -66.4.: 2-(8,8,8-trifluorooctyl)isoindoline-1,3-dione was prepared following the procedure described in Chem, 2020, vol. 6, p 2073 by Savardi Annalisa, Borgogno Marco, Narducci Roberto, La Sala Giuseppina, Ortega Jose Antonio, Summa Maria, Armirotti Andrea, Bertorelli Rosalia, Contestabile Andrea, De Vivo Marco, Cancedda Laura. 11.1 Compound 50 (I03) 3-(methylsulfonimidoyl)-4-(8,8,8-trifluorooctylamino)benzoic acid (Compound 50)To a solution of Int02 (145 mg, 0.36 mmol, 1 equiv.) in a mixture THF / H2O / MeOH 1 / 1 / 1 (6 mL) wasadded LiOH (20 mg, 0.72 mmol, 2 equiv.). The resulting mixture was stirred 16 hours at 20°C. THF was removed under reduced pressure and the mixture was diluted in water (5 mL). Aqueous layer was washed with EtOAc and was acidified with a 1 M aqueous solution of HCl until pH = 2-3. The aqueous layer was extracted with EtOAc and the resulting organic layer was dried over sodium sulphate, filtratedand concnetrated under reduced pressure to afford Compound 50 (94 mg, 0.25 mmol, 68%) as a whitesolid. C16H23F3N2O3S ; MS (ESI+) m / z: 381 [M+H]+; 1H NMR (400 MHz, DMSO-d6) : δ 8.26 (d, J = 2.1 Hz, 1H), 7.92 (dd, J = 8.7 Hz, J = 2.1 Hz, 1H), 7.63 (t, J = 5.3 Hz, 1H), 6.85 (d, J = 8.8 Hz, 1H), 4.63 (s, 1H), 3.31 (s, 1H), 3.27–3.18 (m, 2H), 3.02 (s, 3H), 2.33–2.14 (m, 2H), 1.67-1.55 (m, 2H), 1.53–1.42(m, 2H), 1.41-1.28 (m, 6H). 19F NMR (376 MHz, DMSO-d6): δ -64.7.13C NMR (101 MHz, DMSO-d6): δ 166.6, 149.6, 135.3, 131.9, 129.1, 122.5, 111.3, 43.8, 42.2, 32.5 (q, J = 27 Hz), 28.2, 28.1, 27.8, 26.2, 21.3 (q, J = 3 Hz). (CF3 is missing: signal in the background).12 – Analytical data tableTable 2. Analytical data table. 111 112 113 114 115 116 117 118 119 120 13 – Biological ProtocolsThe use of the compounds of the invention have been tested for evaluating their potency in inhibiting the NKCC1 channel. The test used is a cellular assay expressing the NKCC1 channel: HEK293 cells are human cells derived from embryonic kidney. The inhibitory activity of the compounds has been evaluated in measuring the modification of the potassium flux at 2 concentrations, as described hereafter in the biological protocol. 13.1 Native HEK293 cellsHEK293 cells are human cells derived from embryonic kidney. These cells express at their plasmamembranes, proteins that transport potassium (K+). Among+these proteins is the Na-K-2Cl cotransporte+ror NKCC1. This transporter contributes to 40-50% of K influx into the cells. The remaining of K transport is mediated by the Na+ / K+-ATPase (also known as Na+pump or Na+ / K+pump), which also contributes some 40-50% of the influx basal flux of 5-10%, which is mainly due to K+channels (Figure 1A). Thus, the HEK293 cell in culture is an ideal model to study the function of NKCC1 and test compounds that inhibits its transport. The assay to measure NKCC1 function was optimized to obtain the next signal to noise ratio: a. A slightly hypertonic saline was used to stimulate NKCC1 function. The culture medium, wherethe cells were grown and passaged, had a measured osmolarity of 330 mOsM. The saline used for the K+influx measurements had an osmolarity of 370-380 mOsM. By consistent use of this simple manipulation, the NKCC1 + si +gnal was enhanced. b. Ouabain, an inhibitor of the Na / K pump, was used at 100 µM. The use of ouabain greatlyreduced the flux not mediated by the cotransporter. This manipulation significantly increased signal / noise ratio. c. A radioactive isotope was used to trace the inward movement of K+ into the cell (influx). Thisallowed for highly precise measurements of K+influx. Because radioactive isotopes of K+had very short half-lives, radioactive isotop++es of Rb were used. Rubidium was a monovalent c +ation which was readily transporter at the K binding site by many transporters and channels. Rb was a congener of K+, being transported undistinguishably from K+.83Rb (half-life of 83 days) was 121 used since 86Rb (half-life of 19.6 days) is no longer commercially available. The 83Rb isotopewas used as a tracer, i.e. at a very low amounts to trace the movement of K+.As indicated in Figure 1B, the assay was validated with 2 reference compounds: Ref 1 is bumetanide, Ref 2 is furosemide. K+influx measured in native HEK293 was in the range of 7000-9000 pmole++s Kper mg protein per min. In the presence of 20 µM Ref 1, the flux was reduced to 600-900 pmoles K permg protein per min. Thus, there was a very solid dynamic range. In each experiment, the flux without Ref 1 was set at 1000 (equivalent to 100.0%) and the flux with 20 µM bumetanide was set at 0 (equivalent to 0%). 13.2 NKCC1-KO HEK293 cellsNKCC1 expression was eliminated from HEK293 cells using CRISPR / cas9. Cells were transfected with a vector expressing a cas9-EGFP fusion protein and a guide RNA specific to a NKCC1 sequence (CCGCTTCCGCGTGAACTTCG; SEQ ID NO: 1) located within exon 1. Two days post transfection, cells were FACS sorted and cells expressing EGFP and cas9 (green cells) were plated at 1 cell per well in 96 well plates. Cells were grown to confluence, duplicated, and tested for NKCC1 function usi++ng Tl (another congener of K ) and a thallium sensitive fluorescent dye in the presence or absence ofbumetanide. As seen in Figure 1C, K+ influx measured using the 83Rb uptake assay was re+duced tobaseline levels in NKCC1-KO HEK293 cells. In these cells, bumetanide no longer affected K influx.13.3 Detailed Flux Protocol For the flux experiments, 35-mm culture dishes were coated with 0.1 mg / mL poly-L-lysine and placed in large 20 x 20 [square] dishes. For convenience, the poly-L-lysine was placed in the dishes the day before the experiment. Before plating the cells, the poly-L-lysine was aspirated, and each dish washed twice with 1 mL sterile water. Cells from 3 confluent 10-cm dishes were detached with trypsin and resuspended into 49 mL complete medium. Cells (2 mL / 35-mm dish) were plated in 24 dishes and allowed to attach for at least 2 hours prior to the flux. This setup allowed the measurement of 8 conditions in triplicates. For the flux, culture medium was aspirated and replaced with 1 mL saline for a preincubation period of 8315 min. The saline was aspirated and replaced with 1 mL identical saline containing 0.25 µCi / mL Rb for 15 min. Following the uptake period, the radioactive solution was aspirated, and the cells washed 3 times with ice-cold saline. Cells were then lyzed with 500 µl 0.25N NaOH for 1 hour, neutralized with 250 µL glacial acetic acid and 300 µL and 30 µL aliquots were used for µ-scintillation counting and protein assays, resp +ectively. Two 5 µL of each flux solution was + used to determine cpm and relate those cpm to nmoles K . Potassium influx was expressed in nmoles K per mg protein per min. Note that within an experiment, groups of 3 dishes were separated 2 min apart for easy handling. Also note that since all dishes were plated with a homogeneous cell suspension, and all dishes were identical, the protein content was measured from a subset of dishes. 13.4 Approach Each compound was initially tested on NKCC1 at concentrations of 2 µM and 20 µM in an experiment that always included no drug (flux = 1000) and 20 µM bumetanide (flux = 0). Many experiments also included bumetanide at 2 µM and for this condition, the flux was highly consistent (171 ± 21, n = 6). Table 4. Inhibition of drugs on NKCC1 at 2 and 20 µM. 122 123 124 Compounds according to the Invention are numbered in two distinct ways. Each compound according to the Invention has a compound number, which is an integer (corresponding to the second column of Table 4). Each compound according to the Invention has a compound code, which consists in a combination of a letter and an integer (corresponding to the first column of Table 4). As an example, 4- 125 (2-furylmethylamino)-2-hydroxy-5-(3-methyl-1,2,4-oxadiazol-5-yl)benzenesulfonamide correspondsto compound 35 (F13).“statistically significant” means that the result is different compared to the same experiment with bumetanide instead of a compound according to the Invention. The compounds are active in inhibiting NKCC1. % NKCC1 mediated flux inhibition: % NKCC1 mediated flux inhibition ≥ 75%: ++++ 75% > NKCC1 mediated flux inhibition ≥ 50%: +++ 50% > NKCC1 mediated flux inhibition ≥ 30%: ++ 30% > NKCC1 mediated flux inhibition ≥ 10%: + Among the compounds of the invention there is a set of molecules of particular interest with % of inhibition equal or superior to 30%, called group 1, among this set of class 1 there is a subset of molecules of particular interest with a % in inhibition equal or superior to 50%, called group 2, among this set of class 2 there is a subset of molecules of particular interest with a % in inhibition equal or superior to 75%, called group 3. 13.3 Transwell assays Most of previous drug development against cancer has mainly focused on assays that screen their efficiency that led to inhibition of cell proliferation or promoting apoptosis. More attention is now focusing toward targeted therapies with development of inhibitors of migration to slow down processes such as invasion and metastasis. Transwell assay represent one of the common laboratory technique used in cancer biology field. It allows to evaluate cell migration and invasion which are characteristics of cancer cells during tumor development and metastasis. We used this assay to evaluate the effectiveness of our compounds to prevent these cellular processes in cancer cells such as U87-MG and U251-MG.The principle relies on the use of Transwell inserts that are permeable porous membranes which separatetwo compartment. Cells are plated on the top face of the membrane in serum free media, while the bottom chamber is filled with media that contains serum which serve as a chemoattractant molecule. The membrane contains small pores that, over the time, allows cells to migrate from the top toward the bottom part. In this study, a cell migration assay was conducted using a Transwell system. The required equipment and materials included Falcon™ 353097 Cell Culture Inserts 24-well plates with 8µm pore size, Falcon™ 35350424-Well Permeable Racks and FluoroBlok™ Companion Plates, 10% neutral buffered formalin, Sigma-Aldrich F6057-20ML Fluoroshield™ with 4′,6-diamidino-2-phenylindole (DAPI), Epredia™ J1820AMNZ SuperFrost Plus™ Adhesive Slides, carbon steel scalpel blades, and U87MG and U251MG cells. All molecule were dissolved in dimethyl sulfoxide (DMSO) to a stock of molecule concentration of 10mM. The protocol commenced with seeding 100µL of cells at a concentration of 1*105cells / mL in serum- free medium onto the Transwell inserts, cells were allowed to adhere on membrane before testing molecule was added. Subsequently, 100µL of 2x concentration of the target molecule concentration 126were placed to each Transwell insert compartment , the final concentration ranging from 100µM – 3µM. Equivalent dilutions of DMSO, serving as a control, were also placed with the cells in separatedtranswell insert in order to be used as a normalizer for analysis. Test concentrations were preparedaccording to Table 5, accounting for final volumes and concentrations. Table 5. Test concentration Following drug treatment, 760µL of molecule final testing concentration with 10% fetal bovine serum (FBS) medium was added to the bottom wells, and the plates were returned to the cell culture incubator for a 48-hour incubation period. After incubation, Transwell inserts were washed with 1X phosphate- buffered solution (PBS, pH 7.4). Subsequently, the inserts were fixed with 10% neutral buffered formalin for 5 minutes and washed twice with 1X PBS. Cotton swabs were used to clean the inner sides of the Transwell inserts to remove non migrate cells, and membranes were carefully removed using scalpel blades. The membranes were then placed onto adhesive slides and mounted with Fluoroshield™ containing DAPI for nuclear staining. Finally, images were captured at five areas from each membrane for further analysis. Example of 5 fields were taken under the 10X magnification microscope. Protocol: 1. Seed 100uL per transwells with concentration of 1*105 cells / mL in serum free medium.2. Add 100uL of 2x concentration prepared test drugs.The same DMSO serious dilution concentration as a control. 5, 6 or 14 / DMSO starting concentration (1mM) from stock concentration 10mM.100µL stock / DMSO into 900µL of medium (1:10) 3. Add 760µL of 10% FBS medium at the bottom wells.4. Return plate to cell culture incubate for 48h.5. Wash transwell with phosphate buffer solution (PBS)6. Fix transwell with 10% neutral buffered formalin for 5min7. Wash transwell 2 times with PBS8. Use cotton swabs to clean the inner side of the transwell9. Remove membrane out from transwell with scalpel blades10. Place membrane on adhesive slides11. Mount with Fluoroshield™ with DAPI (4′,6-diamidino-2-phenylindole)12. Images were recorded at 5 areas of from each membrane as represented below 127 Cells that cross the microporous barrier are counted and statistical analysis is performed. Figure 2 showshow the transwell assay is performed. Table 6. Migration of U87MG cells and U251MG cells on transwell assay. N.S means no significant effet at all concentrations tested (from 3 to 100μM) Values expressed in μM represent the lowest concentration tested giving significant effect in comparison to the control reference. Example : 10 μM means a significant effect at 10, 30 and 100 μM compared to control reference.For analysis, the average of each membrane was calculated and normalized by each deserved DMSOconcentration. Data were then further processed with GraphPad Prism statistic analysis software byusing two-way ANOVA Dunnett's multiple comparisons test, adjusted p-value data was then used toevaluate the significant difference when compared to Bumetanide (p-value < 0.05, significant different).13.4 Spheroid migration assayWhile Transwell assay allows to study cell migration in two-dimentional (2D) system, Spheroidmigration assay offers the opportunity to study this biological process in a three-dimensional (3D)culture system. Cancer cells are cultured in a way to allow cell-cell interactions in a spacial relevant manner that mimic tumors conditions in vivo. 128 Briefly, when cancer cells are cultivated in non-adherent round bottom plates, they establish interactions and grow in aggregate to form spherical 3D structure. Once transferred into adherent cell culture plate, cancer cells spread and migrate all around the spheroid. The area can be measure and quantified as a result of migration process. For spheroid formation, 100 μl of cells, 1x104cells / mL for U87MG were pipetted into the non-adheredU-sharp 96-well plates (Cat#7007), followed by an incubation period of at least 3-4 days to allow theformation of tight tumor spheroids. Spheroid migration was assessed using varying concentrations 100 µM, 30 µM,10 µM, and 3 µM. For the migration assay, 100 μl of the 2x concentration of target final concentration was added to the non-adhered U-sharp 96-well plate and mixed well. Subsequently, 100μl of cell culture medium containing tumor spheroids were transferred to a cell culture treated U-sharp96-well plate (Cat#3977). The plate was then centrifuged at room temperature at 500g for 3 minutes.The same amount of DMSO contained in each test concentrations was used as a non-treatment controland normalized value. Images of each spheroid were captured at Day 0 using a 4x brightfieldmicroscope, and additional images were taken after >18 hours of migration to evaluate the cell migration area out from the spheroids. A spheroid migration assay is illustrated. Figure 3 shows a cancer cell spheroid of U87MG cells at thebeginning of the assay. Figure 4 shows a cancer cell spheroid of U87MG cells after 18h of incubationwith DMSO. Figure 5 shows a cancer cell spheroid of U87 cells after 18h of incubation with compound11 13.5 MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assays It is well known that one of the hallmarks of cancer cells is their capability to acquire sustained proliferation rate and resistance to cell death. The MTT assay is widely used to estimate cell proliferation and cytotoxicity with respect to cellular metabolism. Therefore, we used this method to evaluate the proliferation and cytotoxicity of the compounds of the Invention in two well established cancer cell lines U87-MG and U-251-MG.The aim of this assay consists on a colorimetric measurement resulting from a reaction based on thecleavage of the tetrazolium ring of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5- 129diphenyltetrazolium bromide) by mitochondrial dehydrogenase enzyme. MTT, a yellow tetrazole isthen converted to a purple formazan only in living cells. The insoluble purple formazan can be dissolved with isopropanol solution and quantified by measuring the absorbance at 570 nm using a spectrophotometer. The obtained value is proportional to the number of living cells. Initially, 100 μL of cells at a concentration of 0.5 × 105cells / mL for both U87MG and U251MG were seeded into each well of the 96-well plate (Corning™ 3595). Subsequently, 100 μL of 2x concentrationof the test molecule concentration, were added the following day, with varying final concentrations of100 µM, 30 µM, 10 µM, and 3 µM. The same amount of DMSO contained in each test concentrationwas used as a non-treatment control and normalized value. After a 24-hour incubation period, 20 μL ofMTT (Cat# M6494) stock reagent (5 mg / mL) were added to each well, and the plate was returned to theincubator for 2 hours. Following incubation, the medium mixture was removed, and 100 μL ofisopropanol were added to each well, followed by incubation in the dark at room temperature for 20minutes. The plate was then shaken for 60 seconds, and the absorbance at 570 nm with reference at 630nm was measured to determine cell viability, providing valuable insights into the effects of the testmolecule on cellular proliferation and viability. Table 8. MTT assays after 24h and 48h on U87-MG and U251-MG N.S means no significant effect at all tested concentrations (from 3 to 100μM) 130 Values expressed in μM represent the lowest tested concentration giving significant effect in comparison to the control reference. Example: 10 μM means a significant effect at 10, 30 and 100 μM compared to control reference.MTT assay with compound 31 is illustrated. Figure 6 and Figure 7 shows the normal development ofU87MG cells without compound 31. Figure 8 and Figure 9 shows the appearance of cell death ofU87MG cells with 10 µM of compound 31. Figure 10 and Figure 11 shows the change in morphologyof U87MG cells with 30 µM of 31. Altogether these results show efficiency the tested compounds to significantly impede cancerprocesses such as proliferation, survival and migration. 13.6 electrical recordings of hippocampal neurons in mouse slices maintained in artificial conditions Slice preparation. P4–P15 mice were anaesthetized and killed by decapitation. The brain was rapidly removed and placed in an oxygenated ice-cold saline buffer. Sagittal 300–350 µm-thick slices were cut with a vibratome in ice-cold choline solution containing (in mM): 118 choline chloride, 2.5 KCl, 0.7 CaCl2, 7 MgCl2, 1.2 NaH2PO4, 26 NaHCO3, and 8 glucose oxygenated with 95% O2and 5% CO2. Before recordings, slices were incubated in artificial cerebrospinal fluid (ACSF) solution containing (in mM): 125 NaCl, 3.5 KCl, 0.5 CaCl2, 3 MgCl2, 1.25 NaH2PO4, 26 NaHCO3, and 10 glucose, 300 mOsm, equilibrated at pH 7.3 with 95% O2and 5% CO2at 22–25 °C for at least 2 h to allow recovery. For the recordings, an ACSF of the same composition was used but containing 2 mM CaCl2 and 1 mM MgCl2. Patch-clamp recordings. Slices were transferred to the recording chamber and perfused with oxygenated recording ACSF at 3 ml min–1 at RT. Neurons were visualized using infrared differential interference contrast microscopy.Patch pipettes had resistances of 7–9 MΩ when filled with the “low” chloride intracellular solution (inmM): 130 K-gluconate, 10 Na-gluconate, 7 NaCl, 4 MgATP, 4 phosphocreatine, 10 HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), and 0.3 GTP (pH 7.3 with KOH, 280 mOsm). Cells with leakage current more than 40 pA were discarded.To determine cell excitability, voltage responses were recorded (current-clamp mode) to 1 s current stepsof − 50 to + 150 pA (10 pA increment, 3 s interval between each step and voltage determined in mV.Current–voltage (I–V) relationships were established to calculate input resistance of cells. Actionpotential duration (half-width) was measured at half of the maximal amplitude. seizures generated by Extracellular tetanus stimulation or incubation with 4 amino-pyridine To induce seizure-like events (SLE) in CA1 pyramidal neurons, a bipolar Ni–Cr electrode was positioned on the surface of hippocampal slices close to the recorded cell. Trains (20 stimuli, 100 Hz) of current pulses (25–50 μA, 100 µs) were delivered every 60 s through the constant current bipolar stimulus isolator A365 (World Precision Instruments). Seizures were also induced using 4 amino-pyridine a classical convulsive agent.Using techniques which are mastered, the aims here were multifoldi) determine the effects of molecules on ongoing neuronal activity- does the agent impact intrinsicexcitability (mediated by Voltage gated currents) ii) determine if an agent impacts ongoing synaptic responses using both patch clamp recordings and field recordings that sum up many synaptic connections. 131iii) determine if the agent alters transmitter gated currents and most notably Glutamate - the most abundantexcitatory transmitter- and GABA -the most abundant inhibitory transmitteriv) determine if the agents also exert an antiepileptic action. This is of paramount importance considering the epilepsies associated with GBM that necessitate often chronic antiepileptic treatments. v) In addition, by regulating (Cl⁻)i levels, it enhances the efficacy of GABAergic inhibition. This has been amply demonstrated, notably by our teams, as a good signature of these effects. The abolition of classical network activities, present in all immature animal species including humans and non-human primates, known as GDPs (Ben-Ari et al., 1989), is an example of this. see figures 13.7 Epilepsy study Rodent Hippocampal Slice preparation P4–P15 mice are anaesthetized and killed by decapitation. The brain is rapidly removed and placed inan oxygenated ice-cold saline buffer and the hippocampus dissected. Sagittal 300–350 µm-thick slices are cut with a vibratome in ice-cold choline solution containing (in mM): 118 choline chloride, 2.5 KCl,0.7 CaCl2, 7 MgCl2, 1.2 NaH2PO4, 26 NaHCO3, and 8 glucose oxygenated with 95% O2and 5% CO2. Before recordings, slices are incubated in artificial cerebrospinal fluid (ACSF-1) solution containing (inmM): 125 NaCl, 3.5 KCl, 0.5 CaCl2, 3 MgCl2, 1.25 NaH2PO4, 26 NaHCO3, and 10 glucose, 300 mOsm, equilibrated at pH 7.3 with 95% O2and 5% CO2at room temperature (RT) (22–25 °C) for at least 2 h to allow recovery. For the recordings, a solution ACSF-2 is used of the same composition as ACSF-1 butcontaining 2 mM CaCl2 and 1 mM MgCl2. Human GBM acute slice preparation After surgical resection, the brain tissue is placed within 30 s in ice-cold oxygenated protecting solutionthat contained in (mM): 110 choline chloride, 26 NaHCO3, 10 D-glucose, 11.6 sodium ascorbate, 7 MgCl2, 3.1 sodium pyruvate, 2.5 KCl, 1.25 NaH2PO4 and 0.5 CaCl2, 300 mOsm and transported to the neurophysiology laboratory, within <10 min. Brain slices (300–400 μm) are prepared in the samesolution, and are then transferred to the holding chamber in which they were stored at room temperature(20–22 °C) in ACSF-1. Recordings are performed in ACSF-2.Patch-clamp recordings in rodent and human brain slices Brain slices are transferred to the recording chamber and perfused with oxygenated recording ACSF at3 ml / min–1 at RT. Neurons are visualized using infrared differential interference contrast microscopy.Patch pipettes have resistances of 7–9 MΩ when filled with the “low” chloride intracellular solution (inmM): 130 K-gluconate, 10 Na-gluconate, 7 NaCl, 4 MgATP, 4 phosphocreatine, 10 HEPES, and 0.3 GTP (pH 7.3 with KOH, 280 mOsm). Biocytin (final concentration 0.3–0.5%) is added to the pipettesolution to label the neurons in human GBM slices from which recordings are obtained. Cells withleakage current more than 40 pA are discarded.To determine cell excitability, voltage responses (current-clamp mode) are recorded to 1 s current steps of − 50 to + 150 pA (10 pA increment, 3 s interval between each step). Current–voltage (I–V) relationships are established to calculate input resistance of cells. Action potential duration (half-width)is measured at half of the maximal amplitude. Spontaneous excitatory postsynaptic currents (EPSCs)are recorded for 10 min at −70 mV and spontaneous GABAergic postsynaptic currents (GPSCs) at 0 mV(the reversal potential for glutamatergic currents). The results are shown on Figure 19. Epilepsy models in rodent and human acute slices 1. Epileptiform activity in rodent slices induced by 4-AP (4-aminopyridine)Epileptiform activity manifested as interictal discharges and seizure-like events (SLE, duration more than 5 s)) in CA1 pyramidal neurons in hippocampal slices (P5-7) are triggered by 4-AP (100 μM,2 hours -long slices preincubation) 132 2. Epileptiform activity in rodent slices induced by extracellular tetanus stimulation To induce seizure-like events (SLE) in CA1 pyramidal neurons in mouse brain slices, a bipolar Ni–Crelectrode is positioned on the surface of hippocampal slices close to the recorded cell. Trains (20 stimuli,100 Hz) of current pulses (25–50 μA, 100 µs) are delivered every 60 s through the constant currentbipolar stimulus isolator A365 (World Precision Instruments). 3. Epileptiform activity in human acute slices from GBM and epilepsy patientsSpontaneous activity in epileptic slices are recorded in voltage-, current- and cell-attached patch-clampmodes in ACSF. Single-channel recordings from GBM cells in human brain slices Patch pipette solution for recordings of single GABAAchannels contained (in mM): NaCl 120, KCl 5, TEA-Cl 20, 4-aminopyridine 5, CaCl2 0.1, MgCl210, glucose 10, Hepes 10 buffered to pH 7.2–7.3. Pipettes had a resistance in the range of 7–10 MΩ. Conventional cell-attached recordings are performed under visual control. With 5 μM GABA in the pipette solution, after gigaseal formation ( > 3 GΩ)currents through GABAA channels of 1 pA are immediately visible at the potential + 50 mV. Currentsthrough GABAA channels are recorded from − 50 mV to + 50 mV with 10 mV increments for 1–2 minutes for each holding potential, depending on the ongoing frequency of GABAA channelsopenings. Analysis of single channel currents and I–V relationships are performed using Clampfit 10.6(Axon Instruments, Union City, CA). 13.8 Study of tumour-cell invasion and migration in a neuronal environment ETAP-Lab is an independent French corporation which has been specialized for many years inpreclinical in vivo testing and rodent behavioural analysis and in vitro analyses particularly cell culture,for neurodegenerative diseases and neurological disorders. ETAP-Lab is developing and validatingcellular models that mimic the neuronal environment using human induced Pluripotent Stem Cells (hiPSC((Induced pluripotent stem cells))-derived neurons and microfluidic technology. The neuronalenvironment is reproduced in microfluidic system composed of three compartments separated bymicrochannels. Each channel is fluidly isolated thanks to the architecture of the microchannels, allowing neurites and axons to project into them. These systems make it possible to specifically target a compartment or a cell type or region. Using these compartmentalized cell models, owned by ETAP-Lab, the Inventors are able to study the migration of human brain tumour cells from patient biopsies ina neuronal environment and assess the anti-metastatic and anti-invasion effects of compounds. For this application, neurons are seeded in one compartment (Channel 1) and project their axons through the second compartment (Channel 2) and into the third compartment (Channel 3) where tumourcells are seeded. The migration of these cells is followed through the different compartments andmicrochannels by immunofluorescence, see Figure 18. 13.9 Study of Glioblastoma-Brain co-cultureSeveral studies have demonstrated the critical contribution of tumour microenvironment (TME) andcell-cell interactions in cancer development and progression. Therefore, co-culture represents a useful method to investigate the contribution and the complex dynamics of different cell type in cancer biology processes. In addition, it is shown that cancer cells and neurons establish direct and indirect communication that led to neuronal activity modification as well as promoting proliferation and migration of cancer cells.For this purpose, the BlastomaBrain technology is used to test the compounds of the present Inventionand their efficiency against brain tumours. This approach allows to study glioblastoma development inpresence of healthy human neural tissue derived from human iPSC 133 Procedure: Co-cultures are made up of patient-derived glioblastomas that grow and invade engineered iPSC-derivedneural tissue in a 3D culture. Glioblastoma and neural tissue can be distinguished by the expression ofmcherry / fluc reporter (Firefly luciferase) and gfp (green fluorescent protein), respectively. Using thismethod, both anticancer efficacy and potential neurotoxicity is evaluated.Patient's derived glioblastoma are transduced with UBI-fLUC-PGK-mCherry lentiv 5mcherry / firus and selected bymcherry expression. GE83 luc were plated at 4x103 cells / well in a 96 well plate (U-bottom cellrepellent, Grenier) for two days to allow gliomasphere formation.Neural organoids (or neurospheres) are differentiated from human iPSCs (RCRP005N,Reprocell). IPSCs are cultured in StemFlex medium (A3349401, Thermofisher) in T25 flask coatedwith laminin imatrix 511 (T304, Takara), transduced with UBI-GFP lentivirus and selected by GFP expression. 3-D neural differentiation is performed using 3D-AIRLIWELL technology(https: / / elharanesanae.wixsite.com / 3d-airliwell). The iPSCs are transferred onto AIRLIWELL inDMEM-F12 medium enriched with N2-supplement (17502048, Thermofisher), LDN-193189(Selleckchem), SB431542 (S1067, LuBioscience). 1 week after the formation of neurospheres, theculture medium is replaced by DMEM-F12 plus N2, B27-plus (A35828, Gibco) and FGF-2 (100-41,Peprotech) for the neural differentiation process. From day 22 of differentiation, neurospheres arecultured in suspension on a 6-well plate in Neurobasal plus B27 supplement.Following day 31 of neural different3iation, the bulk of the neurosphere is dissociated with Accutase(A1110501, Thermofisher) and 5x10 neural cells are plated in 96 well plates (U-botr) to allow formation of one neurosphere per well (hereafter neuroGftom cell repellent,Greniep), in Neurobasal plus B27medium enriched of GDNF (Glial cell line-derived neurotrophic factor) (GFH2, Cell guidance) andBDNF (Brain-derived neurotrophic factor) (GFH1, Cell guidance). Culture of neurospheres in 96 wellplates is performed for one week and for the duration of the coculture with glioblastoma.One gliomasphere is plated within one neurosphere (neuroGfp gliomcherry / fLuc culture) in mixed medium(1:1, glioblastoma medium: neurosphere medium). Upon assembling the culture and establishing theinvasion of the tumour into the neural tissue, different treatments of compounds of the present Inventionare applied for different hoursAfter treatment of the co-culture with different compounds, cell death, migration and tumor growth isevaluated. Compounds evaluation on cell death and apoptosis using Draq7 staining and Caspase-3 activity After treatment, enzymatic dissociation of the neuroGfpgliomcherry / fLucco-culture is performedwith Papain / Dnase (07466 and 07900 Stemcell Technologies).The samples are then stained with Draq7 dye (D15106 ThermoFisher), a membrane-impermeable dye that rapidly stain double-stranded DNA (dsDNA) in dead cells and processed with CytoFlex (BeckmanCoulter). Therefore, both gfp / draq7 positive and mcherry / draq7 positive cells are evaluated within theco-culture to identify dead cells in each population. Caspase-3 is a key protease that is activated during apoptosis. Th within the neuroGfp gliomcherry / ferefore, Caspase-3 activity isdetermined Luc co-cultures. The Caspase-3 Assay Kit (Colorimetric; ab39401) is used according to manufactured instructions.In addition, fLuciferase (which is expressed only on glioblastoma cells) expression by tumor cells isdetermined to extrapolate specific apoptotic process.Measurement of the Glioblastoma area and cell invasionTo evaluaGtfep the gmrchoewrryt / fh of the tumor cells and their propensity to migrate and disseminate, pictures ofthe neuro glio Luc co-cultures are taken using the channels of brightfield, mcherry, and gfp. 134 The tumor area is measured within the co-culture using ImageJ software, taking advantage of the fluorescence of glioblastoma cells able to record and track their migration and invasion into theneurosphere. 13.10 Compounds cytotoxicity and cell morphology using Tumoroid-on-chip Tumoroid preparation and culture The tumoroid-on-chip model captures cellular interactions within a realistic tumour microenvironment, where cell-cell interactions and matrix components impact drug efficacy. Glioblastoma and / or Meningioma tumoroids are generated from patient-derived tissue samples obtainedthrough biopsy. Each tumor samples are collected under ethically approved protocols with informedpatient consent. Tumoroids are cultured using a tumoroid on chip to better recapitulate the tumourmicroenvironment and maintain the three-dimensional architecture necessary for accurate compoundsscreening. Therefore they are also embedded in Vivoink matrix (CellInk), a commercially availablebioink designed to mimic the extracellular matrix (ECM). The Telo-6 (CellInk), a fibrous matrixoptimized for glioma and metastatic brain tumor models, is tried enabling tumor growth in conditionsthat mimic brain metastasis. Those matrixes provide structural support to the tumoroids while allowingfor interactions between tumour cells and ECM components, which are critical for maintaining thephysiological properties of the tumour microenvironment.Tumoroids are maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10%foetal bovine serum (FBS), 1% penicillin-streptomycin, and maintained in a humidified incubatorat 37°C with 5% CO2.Analysis are performed at several time points (24h, 48h and 72h) after treatment with the compounds ofthe present Invention. The control conditions correspond to DMSO at the same concentration as theones used in the tre2ated groups. The sizes of each tumoroid are standardized to minimize variability,with a size of 5mm . For each experimental condition, data from three independent chips (triplicates)are averaged.3.2 Quantification of viability using the live and dead assay To assess the viability of tumour cells within the tumoroids, a Live / Dead assay (Thermo FisherScientific) is performed. This assay uses two fluorogenic markers to distinguish live from dead cells:^ Calcein AM: permeates live cells, where it is converted to fluorescent calcein, indicating viable cellsthrough green fluorescence.^ Propidium Iodide (PI): penetrates only cells with compromised membranes, binding to DNA andemitting red fluorescence, indicating dead or dying cells. After treatment, tumoroids are incubated with Calcein AM and Propidium Iodide for 30minutes at 37°C. Post-staining, the tumoroids are carefully washed with PBS to remove excess ofCalcein AM and Propidium Iodide, and live and dead cells are visualized using a confocal laser scanningmicroscope (Zeiss LSM 880) with excitation / emission wavelengths of 488 nm for calcein and 561 nmfor PI. For each condition, the number of live cells (stained green by calcein) and dead cells (stained red by PI)are manually counted across several regions of each tumoroid to ensure accurate representation of the entire tumoroid. The ratio of dead cells to total cells is calculated.Cell morphology analysis following compounds treatment In addition to the Live / Dead assay, qualitative morphological changes is observed under phase-contrast microscopy. For example, eventual changes such as cell shrinkage, cytoskeletal 135disorganization, and condensation of cell bodies are observed. These features give furtherinformation’s related to cytotoxic effects and changes of cell structure occurring during processes like migration and / or invasion. 13.11 Co-culture of neuronal derived stem cells with human primary glioblastoma As mentioned previously, tumour microenvironment and cell-cell interactions play a major role in tumour growth and invasion. In particular, several studies revealed the relationship between cancer cells and neurons in the progression of the tumour. Cancer cells and neurons can establish direct and indirect communication leading to modification of neuronal activity and cancer cells proliferation and invasion.To evaluate the present compounds of the Invention implication in these processes, the co-culture gliomaand neuronal cells is aimed.Procedure :Neural stem cells (NSCs) are previously isolated from E16 BALB / c mouse embryos and cultured inNSC medium containing Neurobasal medium supplemented with 1X N2, 1X B27, 1X penicillin- streptomycin, and 1X gentamicin (all obtained from Gibco, Thermo Fisher Scientific), along with 2 μg / mL heparin (STEMCELL Technologies) and 20 ng / mL each of human b-FGF and EGF (PeproTech®). After two weeks of culture, NSCs are plated at a density of 1x10⁵ cells / mL onto coverslips coated with a 1:5 dilution of Geltrex™ (Gibco, Thermo Fisher Scientific) in NSC medium without growth factors and cultured for an additional week.Primary human glioblastoma (GBM) cells are cultured and labelled with CellTracker™ (Invitrogen™,Thermo Fisher Scientific). A total of 100 GBM cells are added to a 12-well plate containing the neuron-coated coverslips. The co-culture of glioblastoma cells with neurons is incubated for at least three daysbefore being used for electrophysiological experiments.In addition to electrophysiological recording to test the compounds of the Invention on neuronal activity,a dose response of the compounds of the Invention are also tested on cell proliferation (Eduincorporation assay) and migration (as previously described). Brain organotypic model This ex-vivo approach recapitulate the majority of the tumour microenvironment both at cellular and extracellular level. This investigation allows to study the tumour development and invasion into the brain slices in conditions of cross-talk with other cell types and extracellular matrix.To establish organotypic cultures, healthy mice brains are surgically harvested and sectioned into 300μm thick slices using a vibratome as described for electrophysiology studies. A 4-day spheroid formedfrom GFP-expressing GL261 cells is grafted onto each brain slice. Then, these organotypic co-cultureare placed on cell culture inserts with 0.4 μm pore size membranes and cultured in 50% MEM mediasupplemented with 25% horse serum, 25% Hanks’ Balanced Salt Solution, 10 mM HEPES buffer, 28mM Glucose, 1% Glutamax and 1% penicillin-streptomycin.Each co-culture is treated or not with the compounds of the Invention at different concentrations.Tumour growth of GFP-expressing GL261 cells within the brain slices are followed and analysed overtime using fluorescent microscopy. Area of each generated tumour, as well as peritumoral cell migrationare measured.In addition, electrophysiological recording is assessed to study electrical modifications upon cancer cellgrafting in presence or not of the compounds of the Invention.
Claims
136 CLAIMS1. A compound of formula (I):wherein ^Z represents:ogroup wherein R5 represents NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,^or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or ogroup wherein R8 represents a NHZ1 group, wherein Z1 is chosen among : -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,137 said rings being optionally substituted by a difluoromethoxy group and / or a methoxy group and / or a thiomethoxy group and / or a halogen atom, ogroup,^ R1 represents a hydrogen, a (C1-C10)acyl group, in particulargroup, a (C1-said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group,said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup,138 or ogroup wherein R9 represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
2. The compound according to claim 1, of formula (I):wherein ^Z represents:ogroup wherein R5represents NR6R7group, wherein R6and R7represent independently: ^a hydrogen,ogroup wherein R8represents a NHZ1group, wherein Z1is chosen among: -a (C1-C10)alkyl group,or139 -a phenyl ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a halogen atom, or ogroup,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,140^ R4 represents:oogroup wherein R9represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, orin the prevention or the treatment of epilepsies or infantile epilepsies.
3. The compound according to any one of claim 1 to 2, of formula (I):wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^group, or141 ogroup,^ R1 represents hydrogen, a (C1-C10)acyl group, in particulargroup, a heteroaryl ring,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup, or ogroup wherein R9 represents a (C1-C10)alkyl group,142 for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
4. The compound according to any one of claims 1 or 2, of formula (I):wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently : ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or ogroup wherein R8represents a NHZ1group, wherein Z1is chosen among: -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy and / or a thiomethoxy group and / or a halogen atom,143^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such asgroup, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
5. The compound according to any one of claims 1, 2 or 4, of formula (I):wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or -group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group,144^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such asgroup, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
6. The compound according to claim 1, of formula (I):wherein ^Z represents:oindependently: ^a hydrogen,^a heteroaryl ring, in particular a pyridine ring,145 group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine bstituted by a methoxy and / or a thiomethoxy group, oup,^ R1 represents a hydrogen, a (C1-C10)acyl group, in particulargroup, a heteroarylsaid above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup,146 or ogroup wherein R9 represents a (C1-C10)alkyl group, for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
7. The compound according to any one of claims 1 to 6, having a formula chosen among thefollowing147 O H3CCH3NH2O H N CH3O S OO S OO O H N CH3H N O H N NOO 33 32 H3C H3C O H C O 3 S OH H N NH F3C ( )7 H N OSO H N 8 H3C148for its use in the prevention or the treatment of one of the following brain cancers chosen among: glioblastoma, astrocytoma, oligodendroglioma, medulloblastoma, ependymoma, meningioma, pineoblastoma, or in the prevention or the treatment of epilepsies or infantile epilepsies.
8. A pharmaceutical composition, comprising as active substance a compound of formula (I):149wherein ^Z represents:ogroup wherein R5represents NR6R7group, wherein R6and R7represent independently: ^a hydrogen,^or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or ogroup wherein R8represents a NHZ1group, wherein Z1is chosen among : -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy group and / or a thiomethoxy group and / or a halogen atom, or150 ogroup,^ R1 represents a hydrogen, a (C1-C10)acyl group, in particulargroup, a (C1-said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup, or151 ogroup wherein R9 represents a (C1-C10)alkyl group.
9. The pharmaceutical composition according to of claim 8, of formula (I):wherein ^Z represents:ogroup wherein R5 represents NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,or ^group, or ^a phenyl ring,or os a NHZ1group, wherein Z1is chosen among: -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a halogen atom,152 or ogroup,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in particularring^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen or a (C1-C10)alkylgroup, said above (C1-C10)alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o153 ogroup wherein R9 represents a (C1-C10)alkyl group.
10. The pharmaceutical composition according to any one of claim 8 or 9, of formula (I):wherein ^Z represents:ogroup wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,o,154^ R1 represents hydrogen, a (C1-C10)acyl group, in particulargroup, a heteroaryl ring,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup, or ogroup wherein R9represents a (C1-C10)alkyl group.
11. The pharmaceutical composition according to any one of claims 8 or 9, of formula (I):155wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently : ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or ogroup wherein R8 represents a NHZ1 group, wherein Z1 is chosen among: -a (C1-C10)alkyl group,or -a phenyl ring,or -a pyridine ring,or -a pyrazine ring,said rings being optionally substituted by a difluoromethoxy group and / or a methoxy and / or a thiomethoxy group and / or a halogen atom,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such asgroup.15612. The pharmaceutical composition according to any one of claims 8, 9 or 11, of formula (I):wherein ^Z represents:ogroup wherein R5 represents a NR6R7 group, wherein R6 and R7 representindependently: ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or -group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such asgroup.
13. The pharmaceutical composition, according to claim 8, of formula (I):157 (I) wherein ^Z represents:ogroup wherein R5 represents a NR6R7 group, wherein R6 and R7 represent independently: ^a hydrogen,or ^a heteroaryl ring, in particular a pyridine ring,^group, or group wherein R8represents a NHZ1group, wherein Z1is a pyridine bstituted by a methoxy and / or a thiomethoxy group, oup,158^ R1 represents hydrogen, a (C1-C10)acyl group, in particulargroup, a heteroaryl ring,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:oogroup wherein R9represents a (C1-C10)alkyl group.
14. The pharmaceutical composition according to any one of claims 8 to 13, having a formula chosenamong the following159160 N H16115. The compound of formula (I):wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,or ^a heteroaryl ring, in particular a pyridine ring,^group, or group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine bstituted by a methoxy and / or a thiomethoxy group, oup,162^ R1 represents hydrogen, a (C1-C10)acyl group, in particulargroup, a heteroaryl ring,said above heteroaryl ring being optionally substituted by one or more (C1-C10)alkyl group, in^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkylgroup said above alkyl group being optionally substituted by one or more halogen atoms,^ R4 represents:o a O-aryl ring, such asgroup, or ogroup wherein R9represents a (C1-C10)alkyl group.
16. Compound according to claim 15, of formula (I):163wherein ^Z represents:ogroup wherein R5represents a NR6R7group, wherein R6and R7represent independently: ^a hydrogen,or ^a phenyl ring,or ^a heteroaryl ring, in particular a pyridine ring,or -group wherein R8 represents a NHZ1 group, wherein Z1 is a pyridine ring optionally substituted by a methoxy and / or a thiomethoxy group,^ R1 represents a (C1-C10)carboxylic acid,^ X represents a NR2R3 group, wherein R2 and R3 are independently hydrogen, a (C1-C10)alkyl group^ R4 represents:o a O-aryl ring, such asgroup.
17. The compound according to any one of claim 15 or 16, having a formula chosen among thefollowing164 NH2O S O O N H N CH3O 26NH C165.
Citation Information
Patent Citations
jewett
US1976A
Bumetanide analogs, compositions and methods of use
US20220071935A1
ortho-substituted benzoic acid derivatives
DE4430212A1
Antiviral compositions and a method for treating virus diseases
EP0068408A1
3-Amino-5-sulfonylbenzoic acids
US3953476A