Methods and compositions for identifying, treating, ameliorating, and / or preventing bacterial infection

Phage-displayed VHH libraries enable the identification and therapeutic use of VHHs to target Pseudomonas aeruginosa antigens, addressing the challenge of multi-drug resistance and chronic infections by enhancing treatment and prevention strategies.

WO2025217317A1PCT designated stage Publication Date: 2025-10-16YALE UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/023929
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-09
Filing Date
2025-04-09
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Current clinical care is hindered by the development of multi-drug resistance in Pseudomonas aeruginosa, particularly in patients with structural lung damage, where chronic infections are difficult to eradicate due to bacterial mutations affecting cell-surface structures and biofilm formation, making it challenging to identify, treat, and prevent infections effectively.

Method used

A method involving phage-displayed VHH libraries is used to generate and enrich for VHHs that bind to Pseudomonas aeruginosa antigens, followed by high-throughput sequencing to identify specific VHHs, which can then be administered therapeutically to treat, ameliorate, or prevent infections.

Benefits of technology

This approach allows for the identification and development of VHHs that specifically target Pseudomonas aeruginosa antigens, providing diagnostic and therapeutic tools to manage chronic infections by enhancing treatment efficacy and prevention strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025023929_16102025_PF_FP_ABST
    Figure US2025023929_16102025_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are methods and compositions for identifying, treating, ameliorating, and / or preventing P. aeruginosa infection. The compositions and methods include generating, panning, enriching, and sequencing a VHH that binds to an antigen of P. aeruginosa.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.047162-7503WO1 (02594) TITLE Methods and Compositions for Identifying, Treating, Ameliorating, and / or Preventing Bacterial Infection CROSS-REFERENCE TO RELATED APPLICATION The present application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No.63 / 631,663, filed April 9, 2024, which application is incorporated herein by reference in its entirety. SEQUENCE LISTING The XML filed named “047162-7503WO1.xml” created on April 8, 2025, comprising 325,209 bytes, is hereby incorporated by reference in its entirety. BACKGROUND Clinical care relies on effective antimicrobial therapy. This is threatened by the remarkable capacity of bacteria to develop multi-drug resistance (MDR). Among MDR organisms, Pseudomonas aeruginosa presents particular challenges. Patients with structural lung damage (e.g. cystic fibrosis, bronchiectasis, chronic obstructive pulmonary disease) frequently develop chronic P. aeruginosa infections that are impossible to eradicate. Many selective pressures act on “naïve” environmentally-acquired bacteria during years of chronic infection: host metabolites, the immune system, antibiotics. In response, P. aeruginosa acquires many mutations, evolving towards common phenotypes that increase in-host fitness and treatment resistance. Often, this involves the modification or change in expression of a cell-surface structure that mediates compound uptake / efflux, within-host virulence, surface attachment, or biofilm formation. Although genomic and transcriptomic studies have identified numerous bacterial mutations and gene expression changes occurring during chronic infection, each change can have many phenotypic effects which are difficult to predict. There remains a need to identify, treat, ameliorate, and / or prevent P. aeruginosa infection in a patient in need thereof. The present disclosure addresses these needs. BRIEF SUMMARY In one aspect described herein is a method of identifying at least one member of a 1 55382181.3 Attorney Docket No.047162-7503WO1 (02594) display library that binds to an antigen of interest associated with a bacterium, the method comprising: a) generating the display library, b) panning the display library against an antigen of interest associated with the bacterium, c) enriching for at least one member of the library that bind the antigen of interest, and d) high-throughput sequencing the gene encoding the at least one member of the display library; thus identifying at least one member of the display library that binds to the antigen of interest. In another aspect described herein is a phage- displayed VHH library comprising a plurality of VHHs generated from P. aeruginosa. In another aspect described herein is a VHH comprising one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125-200 (CDR2 sequences), and SEQ ID NOs: 276-354 (CDR3 sequences), optionally wherein the VHH comprises at least one of SEQ ID NOs: 2-64 (CDR1 sequences), at least one of SEQ ID NOs: 125-200 (CDR2 sequences), and at least one of SEQ ID NOs: 276-354 (CDR3 sequences). In another aspect described herein is a method of treating, ameliorating, and / or preventing a disease arising from Pseudomonas aeruginosa infection in a patient, the method comprising: administering to the patient a therapeutically effective amount of an agent selected from the display library of any of the embodiments described herein and the VHHs of the embodiments described herein. In another aspect described herein is a method of diagnosing a Pseudomonas aeruginosa infection in a patient, the method comprising contacting a biological sample from the patient with an agent selected from the display library of any of the embodiments described herein and the VHH of the embodiments described herein, and identifying binding between at least one antigen in the biological sample with the agent. BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description of illustrative embodiments of the disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosure, exemplary embodiments are shown in the drawings. It should be understood, however, that the disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. FIGs.1A-1E examine selecting antibody VH domains (VHHs) against purified P. aeruginosa proteins. FIG.1A. Schematic of experiment. Flagellin and pilin were purified from P. aeruginosa using standard methods. In each case, a mock purification was carried out on isogenic mutants lacking the antigen of interest; this “antigen–” sample was handled and diluted similarly to the “antigen+” sample. Wells of a 96-well plate were coated with purified antigen and phage display panning was performed for 4 rounds. Phage were first applied to 2 55382181.3 Attorney Docket No.047162-7503WO1 (02594) the antigen- (counter-selection) wells, then transferred to the antigen+(selection) wells. FIG. 1B. Clonal enzyme-linked immunosorbent assays (ELISAs). After the final round of selection, eluted phage from the antigen+wells were plated and 15 clones were picked and amplified; phage-displayed VHHs were tested for binding to the antigen of interest (light circles) or the mock, antigen– prep (dark circles) by ELISA. “Ab YU573” and “Ab YU586” are positive controls using polyclonal rabbit antiserum raised against the indicated antigen. “No 1°” is a negative control where buffer replaces the primary antibody. FIG.1C. Cell- based ELISA using phage-displayed camelid antibody VH domains (VHHs): P. aeruginosa cells were fixed to a plate with methanol and dried. These cells were stained with the phage- displayed VHHs and horseradish peroxidase (HRP)-conjugated secondary antibody, then HRP binding activity measured with TMB. FIG.1D. Bacterial dot blot using recombinant VHHs (rVHHs): VHHs were cloned into a mammalian expression vector, expressed, and purified. P. aeruginosa cells were serially diluted and spotted onto dry nitrocellulose membranes. Total protein was estimated by Ponceau S staining (right column). Blots were then blocked, probed with rVHH or polyclonal antisera, appropriate secondary antibody, and developed with enhanced chemiluminescence (left column). FIG.1E. Flow cytometry of P. aeruginosa cells fixed with methanol, then stained with rVHHs or polyclonal antiserum and phycoerythrin (PE)-conjugated secondary antibody. Light races show antigen-positive cells and dark traces show antigen-negative cells. FIGs.2A-2E shows VHH phage display panning against intact P. aeruginosa cells. FIG.2A shows the schematic of experiment. For each antigen, a pair of P. aeruginosa strains were chosen to serve as “selection” (e.g. wild type) and “counter-selection” (e.g. isogenic mutant lacking the antigen of interest) strains. Phage display panning was performed by applying the phage library to the counter-selection cells, collecting un-bound phage (supernatant), applying those phage to the selection cells, washing, and eluting bound phage with acid and base. Eluted phage were amplified in E. coli and the process repeated for 4 rounds. After each round, titers were measured and VHH populations were determined by Illumina sequencing. FIGs.2B–2C show rank-abundance (Whittaker) plots of VHH pools at each round of selection. FIG.2B shows selections against purified proteins (as displayed in FIG.6A-6F). FIG.2C shows elections against intact bacterial cells. Traces in the top-right corner represent samples with higher diversity, while less diverse samples appear as traces in the bottom-left. Progression of traces down and to the left over the course of rounds of selection suggests populations of VHHs are becoming less diverse. FIGs.2D–2E show bar plots showing relative abundance of VHH complementarity-determining region 3 (CDR3) 3 55382181.3 Attorney Docket No.047162-7503WO1 (02594) clonotypes, for each round of selection. Each colored bar represents one of the 40 most abundant CDR3 clonotypes in that selection. Each CDR3 clonotype was identified by MD5 hash of its sequence, and the first six hexadecimal digits of this identifier (e.g. e06677) are used to identify and color that clonotype in figure marks. Colors and labels are comparable, with the same color identifying the same CDR3 clonotype in different panels and figures. Each plot shows a different selection. FIG.2D shows selections against purified proteins. FIG.2E shows selections against intact bacterial cells with corresponding antigens. FIGs.3A-3F demonstrates massively parallel phage display panning against P. aeruginosa cells. FIG.3A shows the schematic. Panning procedure against whole cells shown in FIGs.2A-2E was adapted to a 96-well format and panning performed on ~180 distinct pairs of bacterial genotypes, summarized in panel C. Eleven selections from this experiment were continued in triplicate for three further rounds. FIG.3B shows antigen matrix for a subset of conditions. Each pair of genotypes was chosen to enrich for one or more antigens. In each case, if the antigen was present on the selection cells but absent on the counter-selection cells, that selection condition was considered positive for that antigen (light circles). If that antigen was absent from the selection cells, the selection condition was negative for that antigen (dark circles). The selections labeled in bold and marked with a bullet were continued for three rounds of extended panning. Full set of conditions described in Table 6, and full antigen matrix shown in FIG.14. FIG.3C shows ordination showing selections at each round of high-throughout and extended panning. Abundances were normalized to library size using scran package. PCA (via TSVD, first 100 components) was performed and first three components are plotted. Each point represents the input phage for a single selection at a single round. Round 1 input corresponds to the raw library (FIG.6A-6F). FIGs.3D–3E show VHH population structure across rounds of panning. Left, Bar plots showing relative abundance of VHH CDR3 clonotypes, as in FIG.2D. Right, Rank- abundance (Whittaker) plots of VHH pools, as in FIG.2C. FIG.3E, first four rounds of panning, for three replicate selections targeting the flagellar hook-basal body. FIG.3F, three rounds of extended panning against the same antigen, continued from FIG.3E. Each plot in the bottom row represents the extended panning for the same selection shown in the top row. FIG.3F shows distribution of VHH enrichment values, for each selection condition. Enrichment for a given VHH was defined as (relative abundance at final round) ÷ (relative abundance at initial round). Each point on the X axis represents a distinct selection. Selections are grouped according to the type of predominant antigen expected to differ between the selection and counter-selection cells. Each point represents a distinct CDR3 4 55382181.3 Attorney Docket No.047162-7503WO1 (02594) which was significantly enriched in that selection, colored as in FIGs.3D–3E. CPA, common polysaccharide antigen; EPS, Exopolysaccharide; LPS, lipopolysaccharide; OSA, O-specific antigen; QS, quorum sensing FIGs.4A-4J shows picking and testing recombinant VHHs for diagnostics and therapeutics. FIGs.4A–4D shows a method of selecting VHHs for resynthesis. Plots show all VHHs identified in selections containing the antigen OprM; each colored point is a distinct CDR3 clonotype. Points in the shaded regions of each plot indicate VHHs that likely recognize the antigen of interest. Opaque points represent VHHs chosen for resynthesis. FIG. 4A shows binary enrichment probability. For a VHH significantly enriched in N antigen+selections, indicates the probability of observing this VHH to be significantly enriched in N antigen– selections; see methods. FIG.4B shows percentile sum for antigen+and antigen– selections; see methods. FIG.4C shows geometric mean of the enrichment for antigen+and antigen– selections; see methods. FIG.4D shows geometric mean of the starting abundance and ending abundance within antigen+selections. FIG.4E shows behavior of each VHH candidate was examined across all selections; this inset shows CDR3 #7a08ae, which was tested in FIG.3H. FIG.4E Left: trace of CDR3 abundance at each round of selection; each trace represents a different selection. Traces are colored according to whether the selection was OprM+ (dark grey), OprM– (gray) or OprM status was unknown (light gray). Right: Ending abundance vs. enrichment plot; each point is a distinct selection, colored using the same scheme as the left panel. FIG.4F shows 84 VHHs were selected, targeting 5 distinct antigens (the flagellar filament “FliC”, the flagellar hook-basal body “FlgEHKL”, and the efflux pump-associated outer membrane porins OprM, OprN, and OprJ) for resynthesis. Of these, 69 were successfully expressed as fusions to human IgG1-Fc and tested for staining of P. aeruginosa by flow cytometry. Of these, 28 were validated by flow cytometry to have the predicted specificity. FIG.4G–4J show flow cytometry of P. aeruginosa stained with selected rVHHs, anti-Human IgG1-PE secondary antibody (0.5 µg / well), and the nuclear stain SYTO9. Events were gated by FSC / SSC (FIGs.24A-24E) and SYTO9+ events were interpreted as bacterial cells. Each rVHH was used to stain antigen+cells (right) and antigen- cells (left). The rVHH+ gate was drawn for fluorescence above the 99th percentile of the antigen- cells; the percent of rVHH+ antigen+cells is shown in the corner of each plot. The rightmost panel(s) shows the same scheme for cells stained with free IgG1-Fc. FIG.4G shows rVHHs targeting the flagellar hook-basal body apparatus. PAK ΔflhA does not produce any part of the flagellar apparatus. PAK ΔfliC ΔfleN produces multiple flagellar hook-basal bodies but no flagellar filament. rVHH per well: D2, 0.073 µg; E1, 0.226 µg; E2, 5 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 0.271 µg; F1, 0.201 µg. FIG.4H–4J shows rVHHs targeting efflux-associated outer membrane porins OprM (FIG.4H), OprJ (FIG.4I), or multiple efflux porins (FIG.4J). PAO1 “Δefflux” lacks all RND-type multidrug efflux systems. The antigen-positive strains (“+mexAB +oprM”, etc.) are Δefflux but express the indicated efflux pump in trans from plasmid mpMQ72. All cells were induced overnight with 1% arabinose. FIG.4H shows rVHHs targeting OprM. rVHH per well: A6, 9.7 µg; H5, 9.2 µg; C6, 3.4 µg. FIG.4I shows rVHHs targeting OprJ. rVHH per well: D9, 24.0 µg; E9, 16.7 µg; F9, 5.2 µg. FIG.4J shows rVHHs targeting multiple efflux-associated porins. rVHHs per well: 10 µg. FIGs.5A-5G shows the mapping of the P. aeruginosa cell surface with Phage-seq. FIG.5A–5B show first 3 principal components (truncated single value decomposition [TSVD]) of VHH relative abundance matrix at final round of selection. Each point represents a distinct selection or biological replicate, or a sample of the non-panned input library. FIG. 5A shows selections (or library) colored according to growth condition. FIG.5B shows selections (or library) colored according to the category of antigen targeted by the selection. FIG.5C shows canonical correspondence analysis (CCA) of selections and a subset of the antigen matrix. CCA projects samples (selections) and features (antigens) into the same lower-dimensional space. Antigens are depicted as vectors from the origin, and selections are shown as points. Each plot depicts the same 3D space with a different antigen vector and cells positive for that antigen highlighted in separate panels. Left, flagellar hook-basal body; center, OprM; right, type III secretion system (T3SS). FIGs.5D–5G show for each antigen shown in FIG.3C with >10 example selections, a classifier was trained to predict whether that antigen was present or absent in the relevant selection. Repeated stratified 5-fold cross- validation was performed and area under the receiver-operator characteristic curve (AUROC) was calculated for each antigen. As a control, classifiers were fit against the same selections with the labels randomly permuted. Trained classifiers were used to predict whether each antigen was present or absent for all samples in the selection. p-values, Wilcoxon rank-sum test. EPS, Exopolysaccharide; LPS, lipopolysaccharide; QS, quorum sensing. FIGs.6A-6F depict developing a VHH phage display library against P. aeruginosa. FIG.6A shows an alpaca received four immunizations with a cocktail of cytoplasmic and membrane proteins from several strains of P. aeruginosa grown under various conditions. Peripheral blood lymphocytes were collected and the VHH region from heavy-chain IgG cDNA were cloned into a phagemid vector for phage display. FIG.6B shows ELISAs performed on test bleeds during immunization show alpaca immune response to P. aeruginosa antigens. Western blot of these test bleeds against the immunogen shown in FIGs. 6 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 7A-7C. FIG.6C shows Rank-abundance (Whitaker) plot showing clone frequency distribution in the phagemid library. FIG.6D examines distribution of lengths for each complementarity-determining region (CDR). FIG.6E shows the amino acid sequence logo of VHH library. Framework regions (FR1, FR2, FR3) are relatively conserved portions bordering the variable CDRs. Consensus sequence from HTS analysis of library is shown below (SEQ ID NO: 370). The first four residues of FR1 were not sequenced by HTS, and the FR4 consensus sequence was low confidence. The corresponding consensus sequences determined by Sanger sequencing are shown in gray boxes adjacent and below. FIG.6F shows the maximum likelihood phylogeny constructed from multiple-sequence alignment of alpaca library. FIGs.7A-7C examine western blot of alpaca sera from test bleeds against P. aeruginosa antigens. “Liquid growth” refers to P. aeruginosa grown in broth; “plate growth” refers to P. aeruginosa grown on agar plates. In each case, bacteria were lysed with a French press (see methods), then centrifuged. This supernatant contained the “soluble proteins”. The pellet was resuspended and separated by a 60% / 25% sucrose step gradient. The interface of this gradient contained the “membrane extract.” Proteins were separated on 12% SDS-PAGE gels, transferred to nitrocellulose membrane, and stained with alpaca serum at 1 / 5000x dilution. Anti-llama HRP-conjugated secondary was used at 1 / 5000x dilution. FIG.7A shows pre-immunization serum. FIG.7B shows serum collected after second immunization. FIG.7C shows serum collected after third immunization. FIG.8 shows SDS-PAGE of flagella and type IV pili preparations from P. aeruginosa. Flagella or pili were prepared from P. aeruginosa, diluted in dye containing SDS and β-mercaptoethanol, boiled, and loaded onto a 12–20% polyacrylamide gradient gel, then stained with 0.25% Coomassie brilliant blue R. Concentration of the product of interest was estimated by comparison to a BSA standard. FliC, the major monomer forming the flagellar filament, is 49 kDa. PilA, the major pilin comprising the type IV pilus, is 15 kDa. SDS, sodium dodecyl sulfate. BSA, bovine serum albumin. FIGs.9A-9B examines ordination showing selections at each round. High-throughput panning experiments in FIG.3. Abundances were normalized to library size using scran package. TSVD (first 100 components) was performed and first three components are plotted. Each point represents the input phage for a single selection at a single round. Round 1 input corresponds to the raw library (FIGs.6A-6F). FIG.9A shows selections from the first four rounds of selection. FIG.9B shows selections from the first four rounds of selection, plus three rounds of extended selection. 7 55382181.3 Attorney Docket No.047162-7503WO1 (02594) FIGs.10A-10E shows phagemid titers from phage display selection campaigns. Phagemid titers of eluted phage from input phage pool (top graph), phage eluted from antigen+wells / cells (light line), and phage eluted from antigen–wells / cells (dark line). Y axis shows the number of carbenicillin-resistant (e.g. phagemid carrying) E. coli recovered after infection with the indicated phage population. FIG.10A shows phagemid titers from solid- phase pannings (FIG.1). FIG.10B shows phagemid titers from small-scale cell-based pannings (FIG.2). FIGs.10C–10E shows distribution of titers for each round of high- throughput and extended pannings (FIG.3), Tukey’s boxplots. FIG.10C shows the first four rounds of high-throughput panning. FIG.10D shows three rounds of extended panning. FIG. 10E shows selections where the input phage were diluted 1 / 100x before applying to cells. FIGs.11A-11B show ELISAs using bacterially-produced recombinant VHHs identified by solid-phase panning. Selected nanobodies identified by phage display panning against immobilized antigens. FIG.1A were cloned into a pET-based expression vector, expressed in E. coli, and purified to create bacterially-produced recombinant VHHs (brVHHs). FIG.11A shows standard ELISA using brVHHs. Purified recombinant nanobodies displayed similar selectivity to phage-displayed nanobodies against immobilized purified antigens, as in FIG.1B. FIG.11B shows cell-based ELISA repeated as in FIG.1C, but using brVHHs instead of phage-displayed VHHs. FIGs.12A-12B shows live cell ELISA and flow cytometry using rVHHs identified by solid-phase panning. FIG.12A shows live cell ELISA; live P. aeruginosa cells were probed with brVHHs identified by solid-phase panning. Rows show the results for different antigens. Columns show different dilutions of cells. Different primary antibodies or brVHHs are shown in the x-axis. Antiserum refers to YU586 (anti-FliC) or YU586 (anti-PilA) at a 1 / 100x dilution. brVHHs are used at 40 µg / mL final concentration. FIG.12B shows flow cytometry for rVHHs (produced in mammalian cells) probed against live P. aeruginosa cells. Top row: rVHHs / antibodies targeting flagella. Bottom row: rVHHs / antibodies targeting T4P. Left two columns: cells stained with rVHHs. Right two columns: cells stained with free IgG1-Fc (isotype control) or antiserum (positive control) at 1 / 100x dilution. FIGs.13A-13B shows live cell dot blot using rVHHs identified by solid-phase panning. Live cells in liquid phase were probed with rVHHs from FIG.1 and the SYTO9 nuclear stain, then spotted to a nitrocellulose membrane, washed, blocked, probed with secondary antibody, and developed via +ECL. FIG.13A shows fluorescent image of membrane in SYTO9 channel. FIG.13B shows chemiluminescence exposure of membrane (10 min). Antigen matrix below indicates the expected presence (light circles) or absence 8 55382181.3 Attorney Docket No.047162-7503WO1 (02594) (dark circles) of each antigen on the different cell types tested. FIG.14 shows the full antigen matrix for high-throughput panning experiment. Expanded version of FIG.3B; full list of genotypes and conditions given in Table 6. FIGs.15A-15C examine the diversity of high-throughput cell-based pannings using alpaca library. Each panel shows a rank-abundance (Whittaker) plot for one selection in the high-throughput panning experiment described in FIGs.3A-3F. The (log10) relative abundance of each clone in a given selection round is plotted on the Y axis, with clones ordered by decreasing abundance. Each trace represents a different round of selection. Length of the trace indicates the total number of clones (richness) in a sample, while the angle of the trace reflects the difference in abundance between VHHs (evenness). FIGs.16A-16C shows the barplots of high-throughput cell-based pannings using alpaca library. Each panel shows a barplot for one selection in the high-throughput panning experiment described in FIG.3. Each stack represents a different round of selection. Plots show the abundance of the 40 VHHs that are most abundant at the final round of selection. FIG.17A-17E examines simulations to assign enrichment statistics. FIG.17A demonstrates to characterize inherent noise in the experiment, the input library from FIGs. 6A-6F was re-precipitated, passaged, and sequenced repeatedly alongside samples from FIG.3. FIG.17B shows random pairs were chosen of input library samples, and enrichment was calculated between these two samples for each VHH. The distribution of these enrichments was approximately log-normal, centered around 1. FIG.17C shows the cumulative distribution function (CDF) of panel B. Lines show values of the inverse CDF for several values. FIG.17D shows enrichment vs. starting (lower) abundance in simulated dataset. Lower abundance VHHs are more likely to have higher enrichments. Each point represents a distinct VHH in a pair of samples from the simulated dataset. FIG.17E shows conditional CDF calculated from distribution in FIG.17D. The empirical CDF for joint distribution was calculated by joint kernel density estimation to data in FIG.17D. The ECDF was then divided by the probability of each abundance (marginal probabilities) to calculate an empirical CDF of enrichment, conditioned on abundance.2D spline fit to resulting surface to estimate conditional ECDF for VHHs in the main dataset. FIGs.18A-18D examine metrics for ranking VHH enrichments. FIG.18A-18B shows binary enrichment probability: for each antigen and each VHH, given there were k antigen-positive selections and that VHH was significantly enriched (FIG.17A-17E) in N୩ାselections, a random draw was performed of k antigen-negative selections and calculate N^୩ି, 9 55382181.3 Attorney Docket No.047162-7503WO1 (02594) the number of those negative selections where the VHH is significantly enriched. FIG.18AQ is performed with such draws and plot the distribution of N^ି ୩୯. From this , it is estimated ୫ୟ^^^,∑ ^^^ష வ^శbinary enrichment probability” P^Nା ି బಬ౧ಬ్ ౡ౧ ౡ^ ^the “ ୩ ^ N୩^ ^. ^ FIG.18B shows for each VHH, the binary enrichment probability P^Nା୩ ^ N୩ି^ is plotted against the fraction of antigen-positive samples where the selection is enriched, e.g. N୩ା / k. FIGs.19A-19H examine the choosing of anti-OprM rVHHs. Expanded version of FIG.4A–4D. Metrics described in FIG.18A-18D were applied to all VHHs in OprM+ samples. VHHs with a binary enrichment probability < 1, along with the top 50 most abundant VHHs in the final round of selection are shown on this plot and listed in the legend at the bottom-right. The VHHs selected for recombinant expression and testing are opaque and the remaining VHHs are faded. FIGs.19A–19D correspond to panels A–D in FIG.4. FIGs.19E–19G show abundances and enrichments of each OprM+ sample. Each column of panels is a distinct selection. FIG.19E shows enrichment-abundance plots. Each point is a distinct VHH. Points in the upper-right quadrant have high enrichments and a high final abundance. FIG.19F shows enrichment traces. Each trace represents a different VHH, showing enrichment over several rounds of selection. FIG.19G shows barplots. Each bar represents the abundance of a VHH at some round of selection. FIG.19H shows cladogram of maximum-likelihood phylogeny for CDR3 sequences of VHHs shown in this plot. FIGs.20A-20H show the choosing of anti-(flagellar filament) rVHHs. FIGs.20A— 20H correspond to those in FIGs.19A-19H, but shown are FliC+. FIG.21A-21H show the choosing of anti-(flagellar hook-basal body) rVHHs. FIGs. 21A—21H correspond to those in FIGs.19A-19H but samples are (flagellar hook-basal body)+ and FliC-. FIGs.22A-22H show the choosing of anti-(OprN) rVHHs. FIGs.22A—22H correspond to those in FIGs.19A-19H but samples are OprN+. FIGs.23A-23H show the choosing of anti-(OprJ) rVHHs. FIGs.23A—23H correspond to those in FIGs.19A-19H but samples are OprJ+. FIGs.24A-24E show the gating strategy for flow cytometry experiments. Cells were stained with the nuclear permable dye SYTO9 to distinguish cells from non-cell debris. SYTO9-stained cells and PE-stained compensation beads were used to perform compensation; all further analysis was conducted on compensated parameters. FIG.24A shows SYTO9-positive events were used to confirm position of the cell gate on FSC-H / SSC- 10 55382181.3 Attorney Docket No.047162-7503WO1 (02594) H. FIG.24B shows cells gated by size. FIG.24C shows singlets are distinguished by gating on SSC-H ≈ SSC-A. The position of this gate was determined by earlier control experiments. FIG.24D shows SYTO9+ gate is drawn using unstained cells FIG.24E shows secondary antibodies were PE conjugated. PE+ gates were drawn to capture the top 1% highest fluorescent cells of the antigen-negative sample (in this case, PAK ΔflhA) stained with the primary and secondary antibody (rabbit anti-flagella antiserum YU573 and anti-rabbit::PE in this case). Staining of the antigen-positive sample with the same reagents is shown below for comparison. FIG.25 examines flow cytometry for all putative anti-(OprM) rVHHs. PAO1 “∆efflux” carrying the high-copy plasmid mpMQ72-mexAB-oprM or an empty vector grown overnight in 1% arabinose to induce expression of the efflux system were stained with rVHH, with the following quantities of rVHH added per sample: B5, 0.8 µg; C5, 4.0 µg; D5, 2.7 µg; E5, 9.6 µg; G5, 7.1 µg; H5, 9.2 µg; A6, 9.7 µg; B6, 7.0 µg; C6, 3.4 µg; E6, 7.9 µg; G6, 4.9 µg; H6, 1.9 µg. FIG.26 examines flow cytometry for all putative anti-(OprJ) rVHHs. PAO1 “∆efflux” carrying the high-copy plasmid mpMQ72-mexCD-oprJ or an empty vector grown overnight in 1% arabinose to induce expression of the efflux system were stained with rVHH, with the following quantities of rVHH added per sample: A9, 19.0 µg; C9, 22.7 µg; D9, 24.0 µg; E9, 16.7 µg; F9, 5.2 µg; H9, 5.1 µg; C10, 19.5 µg; D10, 16.6 µg. FIG.27 examines flow cytometry for all putative anti-(OprN) rVHHs. PAO1 “∆efflux” carrying the high-copy plasmid mpMQ72-mexEF-oprN or an empty vector grown overnight in 2% or 1% arabinose respectively to induce expression of the efflux system were stained with rVHH, with the following quantities of rVHH added per sample: B7, 12.9 µg; C7, 37.2 µg; D7, 28.3 µg; F7, 43.2 µg; G7, 13.5 µg; H7, 54.2 µg; B8, 21.9 µg; C8, 30.5 µg; E8, 25.0 µg; F8, 4.5 µg; H8, 40.4 µg. FIG.28 examines flow cytometry for rVHHs selected to recognize multiple efflux pumps. Each group of three plots shows the results for a single rVHH. PAO1 “∆efflux” cells carrying the high-copy plasmid mpMQ72-mexAB-oprM, mpMQ72-mexCD-oprJ, mpMQ72- mexEF-oprN or an empty vector grown overnight in 1% arabinose to induce expression of the efflux system were stained with rVHH, with the following quantities of rVHH added per sample: isotype, 8.8 µg; A11, 11.7 µg; B11, 10.1 µg; C11, 7.7 µg; D11, 11.4 µg; E11, 1.6 µg; F11, 9.7 µg; G11, 6.4 µg. FIG.29 examines flow cytometry for all putative anti-(flagellar hook basal body) rVHHs. rVHHs were applied at the eluted concentration, with the following quantity of 11 55382181.3 Attorney Docket No.047162-7503WO1 (02594) rVHH added per sample: A1, 0.112 µg; A2, 0.033 µg; B1, 0.263 µg; B2, 0.143 µg; C1, 0.143 µg; D1, 0.138 µg; D2, 0.073 µg; E1, 0.226 µg; E2, 0.271 µg; F1, 0.201 µg; G1, 0.260 µg; H1, 0.184 µg. FIGs.30A-30B examine flow cytometry for putative anti-(OprM) and anti-porin rVHHs against chromosomally-expressed efflux pumps. PAO1 “∆efflux” cells were complemented by insertion of pBAD-mexAB-oprM at the chromosomal attB site. Cells were grown overnight in 1% arabinose to induce the efflux system, then stained with rVHH. FIG. 30A shows anti-OprM rVHHs. FIG.30B shows anti-(multiple porin) rVHHs. FIG.31 examines flow cytometry of selected rVHHs against clinical isolates. Several multidrug-resistant clinical isolates and one pan-susceptible isolate (AP1156) were tested for binding to rVHHs that recognize multiple efflux pumps. Antimicrobial susceptibility of each isolate is given in the table, according to CLSI breakpoints. S, susceptible; I, intermediate; R, resistant. FIGs.32A-32B examine flow cytometry of selected rVHHs against additional genotypes. FIG.32A shows selected anti-(flagellar hook-basal body) rVHHs, or isotype control, tested against additional genotypes. FIG.32B shows selected anti-(OprM) rVHHs, or isotype control, tested against additional genotypes. FIGs.33A-33E show ordinations from FIG.5B highlighting smaller subsets of the selections. Each point represents a single selection, colored according to the main type of antigen targeted by the selection. FIG.33A shows exopolysaccharides. FIG.33B shows efflux pumps and outer-membrane porins. FIG.33C shows motility and Cup fimbriae. FIG. 33D shows secretion systems. FIG.33E shows clinical isolates, lab strains, and input library. FIG.34 show class label balance for classifiers trained in FIGs.5A-5G. Each position on the x-axis represents a different antigen. Positive bars show the number of selections that were considered positive for that antigen. Negative bars show the number of selections that were negative for that antigen, whether because that antigen was not expected to differ between the counter-selection and the selection cells (bars), because that antigen was decreased in the counter-selection cells compared to the selection cells (bars), or because that sample was a contrived control consisting of input libraries (bars). Classifiers were only trained and evaluated for antigens with a reasonable number of both antigen-positive and antigen-negative selections, since otherwise cross-validation is not reliable. DETAILED DESCRIPTION The invention as disclosed herein describes in one aspect the use of phage display as a 12 55382181.3 Attorney Docket No.047162-7503WO1 (02594) tool for interrogating bacterial surface antigens. In certain embodiments, the phage library displays VHH recognition domains (“NANOBODIES™”) derived from camelid heavy chain- only immunoglobulins. VHHs have comparable antigen specificity to full-length immunoglobulins but are smaller, more stable, and more soluble. As described herein, in certain embodiments phage display is combined with high- throughput sequencing (HTS) for greater insight into the dynamics of selection, an approach known as “Phage-seq”: a high-throughput, highly-multiplexed technology for unbiased profiling and quantification of bacterial surface antigens. Phage-seq produces both a dataset—describing the bacterial “surface-ome” of a given strain or population—as well as VHH reagents useful for further study. Importantly, Phage- seq does not require antigens to be known in advance and decouples profiling from antigen identification. This technique is well-suited for studying bacteria when mutations are frequent and readily observed, but their phenotypic consequences are unpredictable. The construction of a phage-displayed VHH library against P. aeruginosa antigens enabled the identification of VHHs against multiple P. aeruginosa antigens via both conventional biopanning and Phage-seq. Datasets generated by Phage-seq were found to capture biologically-important information about the bacterial cell surface. The methods, dataset, and reagents generated herein are useful for other applications that require profiling of the P. aeruginosa cell surface, including studies of virulence, antibiotic resistance, and longitudinal bacterial adaptation in chronic infection. These reagents can also guide the de novo choice of therapies such as lytic phage or anti-pseudomonal biologics. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, illustrative methods and materials are described. As used herein, each of the following terms has the meaning associated with it in this section. Reference will now be made in detail to certain embodiments of the disclosed subject matter. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter. Throughout this document, values expressed in a range format should be interpreted 13 55382181.3 Attorney Docket No.047162-7503WO1 (02594) in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of “about 0.1% to about 5%” or “about 0.1% to 5%” should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement “about X to Y” has the same meaning as “about X to about Y,” unless indicated otherwise. Likewise, the statement “about X, Y, or about Z” has the same meaning as “about X, about Y, or about Z,” unless indicated otherwise. In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process. In this document, the terms “a,” “an,” or “the” are used to include one or more than one unless the context clearly dictates otherwise. The term “or” is used to refer to a nonexclusive “or” unless otherwise indicated. The statement “at least one of A and B” or “at least one of A or B” has the same meaning as “A, B, or A and B.” In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. A disease or disorder is “alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced. As used herein the terms “alteration,” “defect,” “variation” or “mutation” refer to a mutation in a gene in a cell that affects the function, activity, expression (transcription or 14 55382181.3 Attorney Docket No.047162-7503WO1 (02594) translation) or conformation of the polypeptide it encodes, including missense and nonsense mutations, insertions, deletions, frameshifts and premature terminations. The term “antibody,” as used herein, refers to an immunoglobulin molecule that is able to specifically bind to a specific epitope on an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. The term “antibody fragment” refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab’, F(ab’)2, and Fv fragments, linear antibodies, scFv antibodies, single-domain antibodies such as sdAb (either VL or VH), such as camelid antibodies (Riechmann, 1999, J. Immunol. Meth.231:25-38), camelid VHH domains, composed of either a VL or a VH domain that exhibit sufficient affinity for the target, and multispecific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated complementarity-determining region (CDR) or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger & Hudson, 2005, Nature Biotech. 23:1126-1136). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (U.S. Patent No.6,703,199, which describes fibronectin polypeptide minibodies). The antibody fragment also includes a human antibody or a humanized antibody or a portion of a human antibody or a humanized antibody. The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. An antigen can be presented by a bacterium. A skilled artisan will understand that any DNA, which comprises a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit 15 55382181.3 Attorney Docket No.047162-7503WO1 (02594) the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid. The term “coding sequence,” as used herein, means a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and / or translated to produce the mRNA and / or the polypeptide or a fragment thereof. Coding sequences include exons in a genomic DNA or immature primary RNA transcripts, which are joined together by the cell’s biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom. In contrast, the term “non-coding sequence,” as used herein, means a sequence of a nucleic acid or its complement, or a part thereof, that is not translated into amino acid in vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA transcripts, and gene- associated sequences such as promoters, enhancers, silencers, and the like. As used herein, the term “composition” or “pharmaceutical composition” refers to a mixture of at least one compound described herein with a pharmaceutically acceptable carrier. The pharmaceutical composition facilitates administration of the compound to a patient or subject. Multiple techniques of administering a compound exist in the art including, but not limited to, intravenous, oral, aerosol, parenteral, ophthalmic, pulmonary and topical administration. As used herein, the terms “conservative variation” or “conservative substitution” as used herein refers to the replacement of an amino acid residue by another, biologically similar residue. Conservative variations or substitutions are not likely to change the shape of the peptide chain. Examples of conservative variations, or substitutions, include the replacement of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments of any of the aspects described herein, the terms “reduce”, “reduction” or “decrease” or “inhibit” typically mean a decrease by at least 10% as compared to a reference level (e.g., the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at 16 55382181.3 Attorney Docket No.047162-7503WO1 (02594) least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate. As used herein, the term “display library” or “display-based library” refers to a collection of one or more binding molecules (proteins, polypeptides, nucleic acids and others), each of which is physically linked to another molecule (generally a nucleic acid) which encodes or identifies the binding molecule. Examples of display libraries include but are not limited to, phage display libraries, ribosome display libraries, mRNA display libraries, yeast display libraries, and bacterial display libraries. Display libraries can be used to identify high-affinity binding molecules which recognize a particular target molecule, cell, or mixture. A “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health. As used herein, the terms “effective amount,” “pharmaceutically effective amount” and “therapeutically effective amount” refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, 17 55382181.3 Attorney Docket No.047162-7503WO1 (02594) used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. As used herein, the term “fragment,” as applied to a nucleic acid, refers to a subsequence of a larger nucleic acid. A “fragment” of a nucleic acid can be at least about 15, 50-100, 100-500, 500-1000, 1000-1500 nucleotides, 1500-2500, or 2500 nucleotides (and any integer value in between). As used herein, the term “fragment,” as applied to a protein or peptide, refers to a subsequence of a larger protein or peptide, and can be at least about 20, 50, 100, 200, 300 or 400 amino acids in length (and any integer value in between). As used herein, the term “Fc” refers to a human IgG (immunoglobulin) Fc domain. Subtypes of IgG such as IgG1, IgG2, IgG3, and IgG4 are contemplated for usage as Fc domains. The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount. In some embodiments of any of the aspects described herein, the terms “increased”, “increase”, “enhance” or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold, or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. “Instructional material,” as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression that can be used to communicate the usefulness of the nucleic acid, peptide, and / or compound of the disclosure in the kit for identifying or alleviating or treating the various diseases or disorders recited herein. “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a polypeptide naturally present in a living animal is not “isolated,” but the same nucleic acid or polypeptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell. The term “high-throughput sequencing,” HTS, “ next generation sequencing”, “NGS”, “massive parallel sequencing”, “massively parallel sequencing”, or “second- generation sequencing” refers to any number of technologies that use massive parallel sequencing via spatially separated, clonally amplified DNA templates or single DNA 18 55382181.3 Attorney Docket No.047162-7503WO1 (02594) molecules in a flow cell. DNA sequencing libraries are first generated in vitro by one of several methods, such as clonal amplification by polymerase chain reaction (PCR), mechanical fragmentation, or restriction digestion. Then, the DNA is sequenced by synthesis, such that the DNA sequence is determined by the addition of nucleotides to the complementary strand rather than through chain-termination chemistry. Then, the spatially segregated, amplified DNA templates are sequenced simultaneously in a massively parallel fashion without the requirement for a physical separation step. These steps are followed in most NGS platforms, but with distinct strategies. Non-limiting examples of NGS platforms include Roche 454, GS FLX Titanium, Illumina MiSeq, Illumina NextSeq, Illumina HiSeq, Illumina Genome Analyzer IIX, Life Technologies SOLiD4, Life Technologies Ion Proton, Complete Genomics, Helicos Biosciences Heliscope, and Pacific Biosciences SMRT. By “nucleic acid” is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil). The term “nucleic acid” typically refers to large polynucleotides. In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine. An “oligonucleotide” or “polynucleotide” is a nucleic acid ranging from at least 2, in certain embodiments at least 8, 15 or 25 nucleotides in length, but may be up to 50, 100, 1000, or 5000 nucleotides long or a compound that specifically hybridizes to a polynucleotide. As used herein, the term “panning” or “biopanning” refers to a technique to select peptides with affinity for a certain target. First, a library is prepared wherein multiple peptides of interest are physically linked to nucleic acids encoding or labeling those peptides, typically by phage display. Second, the library is exposed to and allowed to bind the target. The target may include, but is not limited to, a protein, a carbohydrate, a lipid, a cell, a tissue, or a complex mixture thereof. The target may be affixed to a solid surface, an affinity tag, a magnetic bead, or any other means of physically separating the target from a complex 19 55382181.3 Attorney Docket No.047162-7503WO1 (02594) mixture. Third, the target is washed, such that only library peptides which bind strongly to the target are retained. Finally, library peptides which remain bound to the target are eluted, whether by pH change, proteolysis, or other means. The resulting library is then amplified such that the process can be repeated multiple times. The result is a library of peptides which bind to the target. The terms “patient,” “subject,” or “individual” are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human. The term “phagemid” refers to a plasmid bearing a bacteriophage packaging signal. “Helper phage” refers to a bacteriophage whose genome contains a defective packaging signal. When a suitable bacterial host strain is infected with both the helper phage and the phagemid, bacteriophage particles are secreted into the medium which preferentially carry the phagemid. As used herein, the term “phage-displayed VHH library” or “phage-displayed library” refers to a large number of antibody fragment-encoding nucleic acid sequences, each carried within a bacteriophage virion, with the corresponding antibody fragment peptide displayed on the surface of the virion. The antibody fragment-encoding genes can be amplified from mRNA derived from B-cells of animals (e.g. alpacas) or humans, whether immunized with a particular antigen or naïve, or the genes can be generated synthetically. In either case, complementary DNA (cDNA) is cloned into a plasmid that contains a packing signal (phagemid), such that the gene is expressed as a fusion protein that is displayed on the surface of the phage virion, while the phagemid is packaged within the virion. There are different bacteriophage strains that can be used for expression and production of a phage- displayed VHH library. Examples include, but are not limited to E . coli filamentous bacteriophages such as M13, f1, or fd (where antibody fragments are fused to coat proteins, e.g. pIII, p.VIII, pVI, pVII, pIX), T4 phage display system (where antibody fragments are fused to HOC or SOC), T7 phage display system (where antibody fragments are fused to pX), and Lambda phage display system (where antibody fragments are fused to pD and pV). In some embodiments, the phage used is a filamentous bacteriophage. These libraries are used to produce high quality and high affinity antigen-specific antibodies. Additional sources of antibody fragment mRNA include, but are not limited to chickens, rabbits, sheep, cows, and nonhuman primates. A library can comprise at least 102clones, at least 103clones, at least 104clones, at least 105clones, at least 106clones, at least 107clones, at least 108clones, at least 109clones, at least 1010clones, at least 1011clones, or more. 20 55382181.3 Attorney Docket No.047162-7503WO1 (02594) As used herein, the term “pharmaceutically acceptable” refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. As used herein, the language “pharmaceutically acceptable salt” refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, or clathrates thereof. Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate). Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2- hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, β-hydroxybutyric, salicylic, galactaric and galacturonic acid. Suitable pharmaceutically acceptable base addition salts of compounds described herein include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N,N’-dibenzylethylene-diamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound. As used herein, the term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its 21 55382181.3 Attorney Docket No.047162-7503WO1 (02594) intended function. Typically, such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, “pharmaceutically acceptable carrier” also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The “pharmaceutically acceptable carrier” may further include a pharmaceutically acceptable salt of the compound(s) described herein. Other additional ingredients that may be included in the pharmaceutical compositions used with the methods or compounds described herein are known in the art and described, for example in Remington’s Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference. As used herein, the term “polypeptide” refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds. As used herein, the term “prevent” or “prevention” means no disorder or disease development if none had occurred, or no further disorder or disease development if there had already been development of the disorder or disease. Also considered is the ability of one to prevent some or all of the symptoms associated with the disorder or disease. “Sample” or “biological sample” as used herein means a biological material isolated from a subject. The biological sample may contain any biological material suitable for detecting a mRNA, polypeptide or other marker of a physiologic or pathologic process in a 22 55382181.3 Attorney Docket No.047162-7503WO1 (02594) subject, and may comprise fluid, tissue, cellular and / or non-cellular material obtained from the individual. The term “substantially” as used herein refers to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term “substantially free of” as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less. The term “substantially free of” can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%. As used herein, “substantially purified” refers to being essentially free of other components. For example, a substantially purified polypeptide is a polypeptide that has been separated from other components with which it is normally associated in its naturally occurring state. Non-limiting embodiments include 95% purity, 99% purity, 99.5% purity, 99.9% purity and 100% purity. As used herein, the term “treatment” or “treating” is defined as the application or administration of a therapeutic agent, i.e., a compound useful within the disclosure (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnosis or ex vivo applications), who has a disease or disorder (such as, for example, ventilator-associated pneumonia, various sepsis syndromes, urinary tract infection, gastrointestinal infection, and skin and soft tissue infection) and / or a symptom of a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, and / or the symptoms of the disease or disorder. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. As used herein, the terms “VHH,” “VHH domain,” or “Nanobody™” are used interchangeably to refer to the heavy-chain or VH peptide fragments derived from heavy- chain only IgG antibodies. The terms can be used interchangeably throughout the application. As used herein, the term “wild-type” refers to a gene or gene product isolated from a 23 55382181.3 Attorney Docket No.047162-7503WO1 (02594) naturally occurring source. A wild-type gene is most frequently observed in a population and is thus arbitrarily designed the “normal” or “wild-type” form of the gene. In contrast, the term “modified” or “mutant” refers to a gene or gene product that displays modifications in sequence and / or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. Naturally occurring mutants can be isolated; these are identified by the fact that they have altered characteristics (including altered nucleic acid sequences) when compared to the wild-type gene or gene product. Ranges: throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Bacterium In one aspect as described herein is a method of identifying at least one member of a display library that binds to an antigen of interest associated with a bacterium. The bacterium can be selected from any bacterium that displays or is associated with an antigen of interest. The bacterium can cause a disease or disorder in a patient. In some embodiments, the bacterium can comprise of a bacterium that belongs to the genus Pseudomonas. Bacterium from the Pseudomonas genus include, but are not limited to Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas syringae, Pseudomonas stutzeri, Pseudomonas oryzhiabitans, Pseudomonas luteola, Ralstonia solanacearum, Pseudomonas mendocina, Pseudomonas corrugata, Pseudomonas protegens, Pseudomonas savastanoi, Pseudomonas alcaligenes, Pseudomonas monteilii, Pseudomonas mosselii, Pseudomonas fragi, Pseudomonas plecoglossicida, Pseudomonas otitidis, Pseudomonas viridiflava, Pseudomonas rhoesiae, Pseudomonas tolaasii, Pseudomonas synxantha, Pseudomonas nitroreducens, Pseudomonoas pseudoalcaligen, Pseudomonas taetrolens, Pseudomonas veronii, Pseudomonas anguilliseptica, Pelomonas saccharophila, Pseudomonas entomophila, Pseudomonas lundensis, Pseudomonas fuscovaginae, Pseudomonas thivervalensis, Pseudomonas knackmussii, Pseudomonas argentinensis, 24 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Pseudomonas avellanae, Pseudomonas resinovorans, Pseudomonas straminea, Pseudomonas vancoverensis, Pseudomonas salomonii, Pseudomonas rizosphaerae, Pseudomonoas tremae, Pseudomonas thermotolerans, Pseudomonas umsongensis, Malikia spinosa, and Pseudomonas trivialis. In some embodiments, the bacterium is Pseudomonas aeruginosa. Pseudomonas aeruginosa Pseudomonas aeruginosa is a common encapsulated, Gram-negative, aerobic- facultatively anaerobic, rod-shaped bacterium that can cause disease in plants and animals, including humans. As used herein, the terms “Pseudomonas aeruginosa”, “P. aeruginosa”, and “Pa” can be used interchangeably throughout the application. P. aeruginosa is a multidrug resistant pathogen recognized for its ubiquity and its intrinsically advanced antibiotic resistance mechanisms. Strains of P. aeruginosa can be classified in three main lineages, genetically characterized by the model strains PAO1, PA14, and the more divergent PA7, however there can be additional lineages not disclosed herein but yet contemplated herein. In some embodiments, the Pa is selected from the strains consisting of PAO1, PA14, PAK, and PA103. Diseases associated with P. aeruginosa include ventilator-associated pneumonia, hospital-acquired pneumonia, community-acquired pneumonia, bloodstream infections, endocarditis, and various sepsis syndromes, urinary tract infection, ocular infections, skin and soft tissue infection, chronic infections in patients with structural lung disease, which include cystic fibrosis, hardware-and-device associated infections, endovascular infections, and bone and joint infections. Current treatments for P. aeruginosa include, but are not limited to aminoglycosides (e.g., gentamicin, amikacin, tobramycin, but not kanamycin); quinolones (e.g., ciprofloxacin, levofloxacin, but not moxifloxacin); cephalosporins (ceftazidime, cefepime, cefoperazone, cefpirome, ceftobiprole, but not cefuroxime, cefotaxime, or ceftriaxone); antipseudomonal penicillins: carboxypenicillins (carbenicillin and ticarcillin), and ureidopenicillins (mezlocillin, azlocillin, and piperacillin); carbapenems (meropenem, imipenem, doripenem, but not ertapenem); polymyxins (polymyxin B and colistin); monobactams (aztreonam). A feature that contributes to antibiotic resistance of P. aeruginosa is the low permeability of the bacterial cellular envelopes. In addition to this intrinsic resistance, P. aeruginosa easily develops acquired resistance either by mutation in chromosomally encoded genes or by the horizontal gene transfer of antibiotic resistance determinants. Development of 25 55382181.3 Attorney Docket No.047162-7503WO1 (02594) multidrug resistance by P. aeruginosa isolates can require several different genetic events, including acquisition of different mutations and / or horizontal transfer of antibiotic resistance genes. Multidrug resistance by P. aeruginosa can also be acquired by mutation of a single gene (e.g. mexR or mexT). Hypermutation favors the selection of mutation-driven antibiotic resistance in P. aeruginosa strains producing chronic infections, whereas the clustering of several different antibiotic resistance genes in integrons favors the concerted acquisition of antibiotic resistance determinants. Some recent studies have shown phenotypic resistance associated to biofilm formation or to the emergence of small-colony variants may be important in the response of P. aeruginosa populations to antibiotic treatment. Mechanisms underlying antibiotic resistance have been found to include production of antibiotic-degrading or antibiotic-inactivating enzymes, outer membrane proteins to evict the antibiotics, and mutations to change antibiotic targets. P. aeruginosa has been reported to possess multidrug efflux pumps systems that confer resistance against a number of antibiotic classes, and the MexAB-OprM (Resistance-nodulation-division (RND) family) is considered as the most important. Resistance-nodulation-division (RND) family transporters are a category of bacterial efflux pumps, especially identified in Gram-negative bacteria and located in the cytoplasmic membrane, that actively transport substrates. The RND superfamily includes seven families: the heavy metal efflux (HME), the hydrophobe / amphiphile efflux-1 (gram-negative bacteria), the nodulation factor exporter family (NFE), the SecDF protein-secretion accessory protein family, the hydrophobe / amphiphile efflux-2 family, the eukaryotic sterol homeostasis family, and the hydrophobe / amphiphile efflux-3 family. Generating a Display VHH Library A display library can utilize different types of display systems including, but not limited to, yeast display, mRNA display, ribosome display, and phage display. In some embodiments, the VHH display library is a phage displayed VHH library. The phage displayed VHH library can be selected from an immune (or “immunized”) library, a naïve library, a semisynthetic library, and a synthetic library, depending on the source of the VHHs. In some embodiments, the phage display VHH library is an immune library and / or a synthetic library. One who is of skill in the art can create a phage-displayed VHH library targeting P. aeruginosa by the following steps: combining a suitable combination of antigens derived from P. aeruginosa; immunizing / boosting a camelid (e.g., an alpaca) with said antigen; 26 55382181.3 Attorney Docket No.047162-7503WO1 (02594) confirming the immune response of the alpaca (e.g. by ELISA, Western blot); harvesting circulating B cells from the alpaca; isolating mRNA from said B-cells; preparing cDNA; amplifying the framework / CDR regions of the VHH cDNA; cloning into a phagemid as a fusion to a phage coat protein such as pIII; and using a helper phage to package the phagemids into bacteriophage virions In some embodiments, the phage-displayed VHH library is generated in alpacas. Panning the Phage-Displayed VHH Library and Enriching for Selected VHHs In some embodiments, the panning comprises surface-immobilized P. aeruginosa antigen panning and / or cell-based panning. Surface-immobilized panning uses crude or purified antigen fixed to plates or other solid supports to which libraries are applied, and then use extensive washings in detergent-supplemented buffers to select specific phage antibodies that bind to the target antigen. Cell-based panning uses cells to present membrane embedded target antigens in their natural environment and conformation to antibody-bearing phages. Live-cell based panning utilizes intact cells during the panning process. In some further embodiments, the panning is cell-based panning or live-cell based panning. In some embodiments, the panning uses P. aeruginosa isolated from environmental and / or patient samples. Sources of environmental samples include, but are not limited to surface water, moist environments with low nutrient availability and low ionic strength, soil and vegetation, including vegetables and salads. In some embodiments, the antigen of interest can is an antigen presented on the surface of P. aeruginosa (e.g., flagella or T4P pilin). In some embodiments, the P. aeruginosa is intact. In some embodiments, the antigen of interest can be selected from the group consisting of a flagellar filament (FliC); a flagellar hook-basal body (HBB, also referred to as FlgEHKL); and efflux-associated outer membrane porins OprM, OprN, and OprJ. In some embodiments, the antigen of interest is OprM. In some embodiments, the antigen can be in its native conformation or in a denatured conformation. In some embodiments, the phage display panning select for VHH that recognize antigens in their native. At least 2,000 clones, at least 2,500 clones, at least 3,000 clones, at least 4,000 clones, at least 5,000 clones, at least 6,000 clones, at least 7,000 clones, at least 8,000 clones, at least 9,000 clones, at least 10,000 clones, at least 11,000 clones, at least 12,000 clones, at least 13,000 clones, at least 14,000 clones, at least 15,000 clones, at least 16,000 clones, at least 17,000 clones, at least 18,000 clones, at least 19,000 clones, at least 20,000 clones, at least 21,000 clones, at least 22,000 clones, at least 23,000 clones, at least 24,000 clones, at least 25,000 clones, at least 26,000 clones, at least 27,000 clones, at least 27 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 28,000 clones, at least 29,000 clones, at least 30,000 clones, at least 31,000 clones, at least 32,000 clones, at least 33,000 clones, at least 34,000 clones, at least 35,000 clones, at least 36,000 clones, at least 37,000 clones, at least 38,000 clones, at least 39,000 clones, at least 40,000 clones, at least 41,000 clones or more can be identified per sample. More clones can be encountered at a greater sequencing depth. At least 50 CDR3 clonotypes, at least 100 CDR3 clonotypes, at least 150 CDR3 clonotypes, at least 200 CDR3 clonotypes, at least 250 CDR3 clonotypes, at least 300 CDR3 clonotypes, at least 400 CDR3 clonotypes, at least 500 CDR3 clonotypes, at least 600 CDR3 clonotypes, at least 700 CDR3 clonotypes, at least 800 CDR3 clonotypes, at least 900 CDR3 clonotypes, at least 1000 CDR3 clonotypes, at least 1100 CDR3 clonotypes, at least 1200 CDR3 clonotypes, at least 1300 CDR3 clonotypes, at least 1400 CDR3 clonotypes, at least 1500 CDR3 clonotypes, at least 1600 CDR3 clonotypes, at least 1700 CDR3 clonotypes, at least 1800 CDR3 clonotypes, at least 1900 CDR3 clonotypes, at least 2000 CDR3 clonotypes, at least 2100 CDR3 clonotypes, at least 2200 CDR3 clonotypes, at least 2300 CDR3 clonotypes, at least 2400 CDR3 clonotypes, at least 2500 CDR3 clonotypes or more can be identified per sample. In some embodiments, panning can enrich a library for VHH clones that bind the antigen of interest while depleting all other clones. CDR3 clonotypes that can be selected include, but are not limited to SEQ ID NOs: 276-354. Sequencing the VHH Domains In some embodiments, the sequencing is performed using high-throughput sequencing. In some embodiments, the VHH amino acid sequences comprise at least one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125-200 (CDR2 sequences) and / or SEQ ID NOs: 276-354 (CDR3 sequences). In some embodiments, the VHH amino acid sequences comprise at least one of SEQ ID NOs: 2-64 (CDR1 sequences). In some embodiments, the VHH amino acid sequences comprise at least one of SEQ ID NOs: 125- 200 (CDR2 sequences). In some embodiments, the VHH amino acid sequences comprise at least one of SEQ ID NOs: 276-354 (CDR3 sequences). In some embodiments, the VHH amino acid sequences comprise at least one of SEQ ID NOs: 2-64 (CDR1 sequences) and at least one of SEQ ID NOs: 125-200 (CDR2 sequences) and at least one of SEQ ID NOs: 276- 354 (CDR3 sequences). 28 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ant FR1 CDR1 FR2 CDR2 FR3 CDR3 ige n Flg QVQLVESGG GFAFS MGWYRQAP ISHTGT NYVPSVKGRFTIS IPGVYYTGS EHK GLVQPGGSL TYA GLKRELVA ST RDNAKNTVYLQMN YFFDSWDDN L RLSCAAS (SEQ A (SEQ (SEQ SLKPDDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 65) 125) 201) NO: 276) 2) Flg QVQLVESGG GSIFS MGWYRQAP I- NYADSVKGRFTIS EHK GLVQPGGSL IYR GKQRELVA TSGGST RENAKNTVYLQMN L RLSCAAS (SEQ F (SEQ (SEQ SLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 66) 126) 202) 3) Flg QVQLVESGG GSTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AA----- EHK GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLHMN DQGSYYVHV L RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC DDVLEFEY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 127) 203) NO: 277) 4) Flg QVQLVESGG GRTFS MAWFRQPP ISVSGY NYADSVRGRFTIS AA----- EHK GLVQPGGSL TYA GKEREFVA GT RDNAKSTLYLQMN VRTYSGYAS L RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC SRRSDYDH (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 68) 128) 204) NO: 278) 5) Flg QVQLVESGG GRTFS MGWFRRAP ISWSSG AYTDSVKGRFTIS A------ EHK GLVQPGGSL NYA GKEREFVA ST RDNAKNTMYLQMN RSQYESIYY L RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC QRETNYAY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 69) 129) 205) NO: 279) 6) Flg QVQLVESGG GRTFS TGWFRQAP IGWSGG YYADSVKGRFTIS NA------ EHK GLVQPGGSL SYA GKEREFVA NT RDNAKNTVYLQMN VDPYYNGNY L RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC YYPATDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID 29 55382181.3 Attorney Docket No.047162-7503WO1 (02594) NO: 1) NO: 70) 130) 206) NO: 280) 7) Flg QVQLVESGG GSTFS MGWFRQAP ISQSGG YYADSVKGRFTIS A------- EHK GLVQPGGSL DYT GNEREFVS ST RDNAKNTVFLQMD RKQWSGSYY L RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTALYYC ARPSYDF (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 71) 131) 207) NO: 281) 8) Flg QVQLVESGG GSTFG MGWFRQAP ISRSGG YYQDSVKGRFTIS AA---- EHK GLVQPGGSL SYA GKERECVA NT RDNAKNTVYLEMT VRTSYSGSY L RLSCAAS (SEQ A (SEQ (SEQ TLIPADTAVYFC YYGPGSYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 72) 132) 208) NO: 282) 9) Flg QVQLVESGG GFTFS MGWYRQAP ITTSGG EHK GLVQPGGSL IYA GKEREIVA ST L RLSCAAS (SEQ T (SEQ (SEQ (SEQ ID ID ID NO: ID NO: NO: 1) NO: 73) 133) 10) Flg QVQLVESGG GSTFS MAWFRQAP ITRTGG FYADSVKGRFTIS AA------- EHK GLVQPGGSL TYV GKERELVA TT RDNDKNTVYLQMN - L RLSCAAS (SEQ A (SEQ (SEQ SLRPEDTSIYFC DYYWRGNSP (SEQ ID ID ID NO: ID NO: (SEQ ID NO: SQYDV NO: 1) NO: 74) 134) 209) (SEQ ID 11) NO: 283) Flg QVQLVESGG GFTFS MTWVRQAP INSGGA KYADSVKGRFTIS AKGIGSFGN EHK GLVQPGGSL SYA GKGLEWVS NT RDNAKNTLYLQIS --------- L RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 75) 135) 210) NO: 284) 12) Flg QVQLVESGG GSTFS MGWYRQAP I- NYADSVKGRFTIS NA------- EHK GLVQPGGSL IFS GKQRELVA TSDSKT RDNAKKTVYLQMN --- L RLSCAAS (SEQ V (SEQ (SEQ SLKPEDTASYYC DHTSSFGGR (SEQ ID ID ID NO: ID NO: (SEQ ID NO: YDY (SEQ NO: 1) NO: 76) 136) 211) ID NO: 30 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 13) 285) Flg QVQLVESGG GRTFS MGWFRQPP ISRSGG NYANSVKGRFTIS AA------- EHK GLVQPGGSL NFA GKEREFVA AI RDNAKNTVHLQMN TLGSIYYTT L RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ITTYNY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 77) 137) 212) NO: 286) 14) Fli QVQLVESGG GRTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AA- C GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN HLQANIDPG RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ICSYYFYME (SEQ ID ID ID NO: ID NO: (SEQ ID NO: YDY (SEQ NO: 1) NO: 67) 127) 206) ID NO: 7) 287) Fli QVQLVESGG GFTFS MGWFRQAP ISGGAN YYADSVKGRFTIS VA------- C GLVQPGGSL TTS GKDREFVA ST RDNAKNTVYLQMN - RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC KGGSAYAIA (SEQ ID ID ID NO: ID NO: (SEQ ID NO: MQQRY NO: 1) NO: 78) 138) 206) (SEQ ID 15) NO: 288) Fli QVQLVESGG GRTFS IGWFRQAP ASSELG FYADSVKGRFTIS A--- C GLVQPGGSL SYA GKEREGVS ST RDNAKNVVYLQMN TPSSDDSRD RLSCAAS (SEQ I (SEQ (SEQ SLKPEDTAVYYC CIATMWGGY SEQ ID ID ID NO: ID NO: (SEQ ID NO: ND (SEQ NO: 1) NO: 79) 139) 213) ID NO: 7) 289) Fli QVQLVESGG GRTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AA------- C GLVQPGGSL SYA GKEREFVA ST RDGAKNTVYLQMN --- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC DDYDDEADE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: YDY (SEQ NO: 1) NO: 67) 127) 214) ID NO: 7) 290) Fli QVQLVESGG GRTLS MGWVRQPP ISASAG TYAASVKGRFTIS VG------- C GLVQPGGSL TYD GKEHEIVA VT RDNAANTVYLQMD ----- RLSCAAS (SEQ A (SEQ (SEQ RLKPEDTAVYFC KGPGTNDFG (SEQ ID ID ID NO: ID NO: (SEQ ID NO: Y (SEQ ID NO: 1) NO: 80) 140) 215) NO: 291) 16) 31 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Fli QVQLVESGG GRTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AAALDGPAK C GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN LFHSNDWAP RLSCAAS (SEQ A (SEQ (SEQ SLKPEGTAVYYC SYEYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 127) 216) NO: 292) 7) Fli QVQLVESGG GRTFR MGWFRQAP ISWNGD YYSNSVKGRFTIS AA------- C GLVQPGGSL TNA GKERECVA DI RDNAKNAVYLQLN -- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC GNTRVILTD (SEQ ID ID ID NO: ID NO: (SEQ ID NO: TPDY (SEQ NO: 1) NO: 81) 141) 217) ID NO: 17) 293) Fli QVQLVESGG GRSFS VAWFRQAP INWSGR HYSDNVKGRFTIS A------ C GLVQPGGSL NYH GKEREFVA VT RDNAKNAVYLQMN TGPEASVYA RLSCAAS (SEQ T (SEQ (SEQ GLKAEDTAIYYC PAPSHFDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 82) 142) 218) NO: 294) 18) Fli QVQLVESGG GRTFT MGWFRQAP INWSSG YYADSVRGRSTIS AA------- C GLVQPGGSL SIY GKEREFVA IT RENAKNTVYLQMD NRYWTGSEN RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTALYYC ARHYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 83) 143) 219) NO: 295) 19) Fli QVQLVESGG GSIFS MAWYRQAP I- DYADSVKGRFTIS C GLVQPGGSL GNA GKQRELVA TSRGST RDNAKNTLSLQMN RLSCAAS (SEQ S (SEQ (SEQ SLTPEDTAVYY- (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 84) 144) 220) 20) Fli QVQLVESGG GRTFS MTWFRQAP ISWGGG YYADSVKGRFTIS AA------ C GLVQPGGSL TYA GKEREFVA ST RDNAKNTVYLQMN RPDKGWGIR RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC LESTYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 85) 145) 206) NO: 296) 5) Fli QVQLVESGG GSTFS MGWYRQAP I- DYADFAKGRFTIS NA-------32 55382181.3 Attorney Docket No.047162-7503WO1 (02594) C GLVQPGGSL IDT GKERELVA NSHGIT RDNAKNTVSLLMN ------ RLSCAAS (SEQ L (SEQ (SEQ SLKPEDTNVYYC NDVRLPYEH (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 86) 146) 221) NO: 297) 21) Fli QVQLVESGG GFTFS MSWVRQAP ITYGGG KYADSVKGRFTIS A-------- C GLVQPGGSL SNH GKGLEWVA DI RDNVKNLLSPQMN ----- RLSCAAS (SEQ Y (SEQ (SEQ SLAPEDTAVYYC KHRTVVGGE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: F (SEQ ID NO: 1) NO: 87) 147) 222) NO: 298) 22) Fli QVQLVESGG GFAFS MNWVRQAP ISSGGG NYADSVKGRFTIS TEGVPNTSS C GLVQPGGSL IYP GKGLEWVS IT RDNAKNTLYLQMN --------- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 88) 148) 223) NO: 299) 23) Fli QVQLVESGG GRSIS MDWIRQAP ISWRGG FYADSVKGRFTIS AA------- C GLVQPGGSL SYT GKEREFVA SP RDNAKNTVFLQMN -- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ALRPTTKYY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: EYDY (SEQ NO: 1) NO: 89) 149) 224) ID NO: 24) 300) Fli QVQLVESGG GRTFS MVWFRQAP IAWNGD SYADSVKGRFTIS AA---- C GLVQPGGSL NYD GRERKFIA ST RDNAKNTMYLQMN SAELLLFSS RLSCAAS (SEQ Y (SEQ (SEQ SLKSEDTAVYYC RTDPGRYGY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 90) 150) 225) NO: 301) 25) Fli QVQLVESGG GRTLS VGWFRQAP ISWSGG YYADSVKGRFTIS AA------- C GLVQPGGSL TYA GKEREFVA ST RDNVKNTVSLQMN GPPVEVLLR RLSCAAS (SEQ A (SEQ (SEQ SLKPEDAAVYYC LEEYVY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 91) 127) 226) NO: 302) 26) Fli QVQLVESGG GRTFS MGWFRQAP ISWSGD YYADSVKGRFTIS AA------- C GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN DSLYVPRLA 33 55382181.3 Attorney Docket No.047162-7503WO1 (02594) RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC SEGYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 151) 206) NO: 303) 7) Fli QVQLVESGG GSTFS MGWFRQAT ISASGV YHANFAKGRFTIS AA------- C GLVQPGGSL SYS GKGRDLVA NK RANAVNTLYLQMN - RLSCAAS (SEQ A (SEQ (SEQ NLKPEDTAVYYC VLHRGLFVG (SEQ ID ID ID NO: ID NO: (SEQ ID NO: LNYDY NO: 1) NO: 92) 152) 227) (SEQ ID 27) NO: 304) Mex QVQLVESGG GIIVS MAWYRQAP I- HYADSVKGRFTIS AB GLVQPGGSL DNS GKQREMVA TNDGST RDGVKNAVYLQMN RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 93) 153) 228) 28) Opr QVQLVESGG GSTFR MGWFRQAP ITWSGG DYALSVKGRFTIS AA------- M GLVQPGGSL SYG GKGREFVA AT RDNAKNTVYLQMN SLKGILTAL RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTAVYYC RNMYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 94) 154) 229) NO: 305) 29) Opr QVQLVESGG GSTFS MAWYRQTP I- EYTDSVKGRFTIS NGDRGPLVV M GLVQPGGSL FYS GKQRELVA TRSGST RDNAKNTMYLQMD PQRDS---- RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 95) 155) 230) NO: 306) 30) Opr QVQLVESGG GRTFT MGWFRQAP VAWNGV RYADSVKGRFTIS A----- M GLVQPGGSL NYA GKEREFVG ST RDNAENTVYLQMN FPSLSYSLI RLSCAAS (SEQ G (SEQ (SEQ SLKPEDTAVYYC PTSAPEVGY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO:1) NO: 96) 156) 231) NO: 307) 31) Opr QVQLVESGG GST- MGWFRQAP ILWGGI YYADSVKGRFTLS AV----- M GLVQPGGSL SSYT GKEREFVA ST RDNAKKTLYLQMN SDRFSREVE RLSCAAS (SEQ A (SEQ (SEQ SLTPDDTAVYYC ADQGAYRY 34 55382181.3 Attorney Docket No.047162-7503WO1 (02594) (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 157) 232) NO: 308) 31) Opr QVQLVESGG GRSFS MGWFRQAP LAWDGI RYADSVKGRFTIS M GLVQPGGSL NYA GKEREFVG ST GDNAKKTVYLQMN RLSCAAS (SEQ G (SEQ (SEQ NLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 96) 158) 233) 32) Opr QVQLVESGG GRTFS MGWFRQAP ITWNGR SYADSVTGRFTIS AA---- M GLVQPGGSL MFA GKEREFVA ST RDNAKNTVYLQMN IPSYSSTWL RLSCAAS (SEQ A (SEQ (SEQ SLEPEESAVYYC AKQAKQYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 159) 234) NO: 309) 33) Opr QVQLVESGG GSTFS MGWYRQAP I- VYADSVKGRFTIS NA------- M GLVQPGGSL IYA GKQRELVA TSGGGT RDNAKNTVYVQMN --- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYTC KPYYSAPDE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: SDY (SEQ NO: 1) NO: 97) 160) 235) ID NO: 34) 310) Opr QVQLVESGG GRTFS MGWFRQAP ISWNGG YYADSVKGRFTIS VA------ M GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN DHDPWANGL RLSCAAS (SEQ S (SEQ (SEQ SVKREDTAVYYC GYPSYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 83) 161) 236) NO: 311) 7) Opr QVQLVESGG GFTFS MGWVRQAP INSDGV SYADSVKGRFTIS M GLVQPGGSL SYA GKGLEWVS ST RDNAKNMLYLQMN RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 98) 162) 237) 12) Opr QVQLVESGG GRTFS MGWFRQAP I- YYADSVRGRFTIS AA------- M GLVQPGGSL NYF GKEREFVV TSSGAA RDNAKNTLSLQMN NSRGPSFTD RLSCAAS (SEQ R (SEQ (SEQ SLKPEDTAVYYC PRRYSY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID 35 55382181.3 Attorney Docket No.047162-7503WO1 (02594) NO: 1) NO: 99) 163) 238) NO: 312) 35) Opr QVQLVESGG GSTFS MAWLRQAP IASGGG SYEDSVKGRFTIS A-------- M GLVQPGGSL AYA GKGLEWLS RT RDNTKNTLYLQMN -------- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC KDVVGSY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 100) 164) 239) NO: 313) 36) Opr QVQLVESGG GRTFS MGWFRQAP ISRSGT LYADSVKGRFTIS AG------- M GLVQPGGSL SYR GKEREFVA GT RDNAANTVYLQMN -- RLSCAAS (SEQ V (SEQ (SEQ SLKPEDTAVYYC DPNGYYAYT (SEQ ID ID ID NO: ID NO: (SEQ ID NO: EYIY (SEQ NO: 1) NO: 101) 165) 240) ID NO: 37) 314) Opr QVQLVESGG GRTGS MGWFRQAP IKLDGG YYADSVKGRFTIS M GLVQPGGSL SYA GKEREFVA AT RDNAKNTLYLEMN RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 83) 166) 241) 38) Opr QVQLVESGG GSTFS MGWFRQAP ISWSGG YYADSVKGRFTIS NA------- M GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN -------- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC DNRGAAY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 127) 206) NO: 315) 4) Opr QVQLVESGG GRAFS MGWFRQAP ISWNVR NYADSVKGRFTIS AA------- M GLVQPGGSL SRP GKEREFVA IT RDNAKNTVFLQMS --- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC GHMYTERSE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: YAY (SEQ NO: 1) NO: 102) 167) 242) ID NO: 39) 316) Opr QVQLVESGG GRTSI MAWFRQAP ITWSGR HYANSMKGRFTIS AA------- N GLVQPGGSL KYA GKEREFVA ST REFAGNTVYLQMN ------- RLSCAAS (SEQ S (SEQ (SEQ SLQSEDTAAYYC EGNSGYEY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 103) 168) 243) NO: 317) 36 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 40) Opr QVQLVESGG GRTLS MGWFRQAP ISATGG YYSGSEKGRFTIS AA---- N GLVQPGGSL SYI GKEREFVT SK RDNAKNTVYLQMN GPGASALMA RLSCAAS (SEQ A (SEQ (SEQ SLEPEDTAVYYC MVTPEKYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 104) 169) 244) NO: 318) 41) Opr QVQLVESGG GDTVS MGWFRQAL ISWNGV YYADSVKGRFTIS NSEPRL--- N GLVQPGGSL SYS GQERSFVA ST RDNAKNTVYLQMN ------- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC GSGVGLEV (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 105) 170) 206) NO: 319) 42) Opr QVQLVESGG GRPFS MAWFRQVP LDWSAG YYADSVKGRFTIS AA----- N GLVQPGGSL NYN GKEREFIA ST RDNAADTVYLQMN APLRRPTRP RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAIYFC NARYGYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 106) 171) 245) NO: 320) 43) Opr QVQLVESGG GFTFG MNWVRQAP IRSGGG SYAESVKGRFTIS TKAGE---- N GLVQPGGSL SYT GKGLEWVS ST RDNAKNTLYLQMD --------- RLSCAAS (SEQ R (SEQ (SEQ SLKPEDTAVYFC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 107) 172) 246) NO: 321) 44) Opr QVQLVESGG GRTLS MGWFRQAP ISWSGG DYADSVKGRFTIS AA------- N GLVQPGGSL GYA GKEREFVA IT RDNAKNTVYLQMN - RLSCAAS (SEQ S (SEQ (SEQ SLKPEDTAVYYC DNGDFSDYE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: PVFNF NO: 1) NO: 83) 173) 247) (SEQ ID 45) NO: 322) Opr QVQLVESGG GSTFS MGWFRRAP ISWSGH YYADSVKGRFTIS AA------- N GLVQPGGSL TYT GKEREFVA NT RDNAKNTVDLQMN --- RLSCAAS (SEQ A (SEQ (SEQ TLKPDDTAVYYC DRRDPPPKE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: YQY (SEQ NO: 1) NO: 69) 174) 248) ID NO: 46) 323) 37 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Opr QVQLVESGG GRTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AA------ N GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQMN DHEHTIVQI RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC TTGVSRY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 127) 206) NO: 324) 7) Opr QVQLVESGG GRTFS MGWFRQAP ITWSGS CTSYAGAVKGRFT SCNA----- N GLVQPGGSL SYA GKEREFVA ST ISRDNAKNTMYLQ -- RLSCAAS (SEQ A (SEQ (SEQ MNSLKPEDTAVY DPEVAGIAD (SEQ ID ID ID NO: ID NO: (SEQ ID NO: TYDY (SEQ NO: 1) NO: 67) 175) 249) ID NO: 7) 325) Opr QVQLVESGG GRTIS MAWFRQAP ITWSGG SYADSVKGRFTIS AA------ N GLVQPGGSL SYY GKEREFVA NT RDNAKNTVYLQMN SIYGLGPGT RLSCAAS (SEQ G (SEQ (SEQ SLKPEDTAVYYC KYLMYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 108) 176) 250) NO: 326) 47) Opr QVQLVESGG GSTFS MGWYRQAP IGTSGG VYADSVKGRFTIS NA------- N GLVQPGGSL IYR GTQRELVA ST RDAAKNTVYLQMN --- RLSCAAS (SEQ - (SEQ (SEQ SLKPEDTAVYYC KPYYSAPDE (SEQ ID ID ID NO: ID NO: (SEQ ID NO: DDY (SEQ NO: 1) NO: 109) 177) 251) ID NO: 48) 327) Opr QVQLVESGG GRTFI MAWFRQGP IGRWGL SYADSVKGRFTIS AGRPVTMAT N GLVQPGGSL TYS GKEREFVA SS RDNAKNTVYLQMN RVADFDS-- RLSCAAS (SEQ N (SEQ (SEQ SLKPEDTAVYQC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 110) 178) 252) NO: 328) 49) Opr QVQLVESGG GRTFS MGWFRQAP ISWSGD YYADSVKGRFTIS AA------- N GLVQPGGSL SYA GKEREFVA YT RDNAENTVYLQMN DSLYVPRLP RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC SEGYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 179) 253) NO: 329) 7) Opr QVQLVESGG GRTFS MGWFRQAP ISKSGG SYADSVKARFTIS AA---38 55382181.3 Attorney Docket No.047162-7503WO1 (02594) N GLVQPGGSL LHA GKEREFVA ST RDNAKNTVYLQMS RNVRVADVV RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYRC TFQSAYEYD (SEQ ID ID ID NO: ID NO: (SEQ ID NO: Y (SEQ ID NO: 1) NO: 67) 180) 254) NO: 330) 50) Opr QVQLVESGG GFTFS MSWVRQAP INNVGD TYADSVKGRSTIS A--- N GLVQPGGSL SYA GKGLEWLS IT RDNAKNTLYLQMN KHIHTIVLF RLSCAAS (SEQ A (SEQ (SEQ SLKPDDTAVYIC TPTRTLDEY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: DH (SEQ NO: 1) NO: 67) 181) 255) ID NO: 12) 331) Opr QVQLVESGG GSTFS MGWYRQAP I- NYADSVKGRFTIS NAVNRGLG- N GLVQPGGSL INT GKQRELVA GNGGNT RDNAKRAVYLQMN --------- RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 97) 182) 256) NO: 332) 51) Opr QVQLVESGG GRTFS MGWFRQGP INWSGG YHADSVKGRFTIS AA--- J GLVQPGGSL NYV GKERDFVA RT RDNAKNTVYLRMN GGGGSRWSL RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC APYFTDEYD (SEQ ID ID ID NO: ID NO: (SEQ ID NO: Y (SEQ ID NO: 1) NO: 111) 183) 257) NO: 333) 52) Opr QVQLVESGG GITFS MAWYRQAP VISTGG NYADSVKGRFTIS NA------- J GLVQPGGSL SYD GEERDFLA ST RDNAKSTVYLQMN ------ RLSCAAS (SEQ R (SEQ (SEQ GLKPEDTAMYYC RYDWWGLNY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 112) 184) 258) NO: 334) 53) Opr QVQLVESGG GSIFR MGWYRQAP L- DYADSVKGRFTIS J GLVQPGGSL FYA GKQRELVA GPSGSA RDNAKNTVYLQMN RLSCAAS (SEQ T (SEQ (SEQ SLKPEDTAVYYC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: NO: 1) NO: 97) 185) 247) 54) Opr QVQLVESGG GSTFS MAWYRQAP I- RYADSVKGRLVIS NA------- J GLVQPGGSL FYT GKERELVA SRGGKT KDDAKSTVYLQMN --- 39 55382181.3 Attorney Docket No.047162-7503WO1 (02594) RLSCAAS (SEQ E (SEQ (SEQ SLKPEDTAVYYC DLRPPHLAA (SEQ ID ID ID NO: ID NO: (SEQ ID NO: GIY (SEQ NO: 1) NO: 113) 186) 259) ID NO: 55) 335) Opr QVQLVESGG GSTFS MGWYRQAP I- NYADSVKGRFTIS NADGRDYEL J GLVQPGGSL IYA GKQRELVA TSGGST RDNAKNTVYLQMN VNFGS---- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 114) 126) 260) NO: 336) 34) Opr QVQLVESGG GSIFS MGWYRQAP I- SYADSVKGRFTIS NPPLPDSDY J GLVQPGGSL VNA GKQRELVA SSSGST RDNAKNTVYLQLN DLDNS---- RLSCAAS (SEQ G (SEQ (SEQ RLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 115) 187) 261) NO: 337) 56) Opr QVQLVESGG GRTFS MGWFRQAP IAWNGV RYVDSVKGRFTIS A----- J GLVQPGGSL GYA GKEREFVG ST RDNAKNTVYLQMN LPSLSYSLI RLSCAAS (SEQ G (SEQ (SEQ SLKPEDTAVYYC PTSAPEVAY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 96) 188) 262) NO: 338) 57) Opr QVQLVESGG GRTFS MGWFRQAP INWSGG YYADSVKGRFTIS AAAPRSDST J GLVQPGGSL TYA GKEREFVA ST RDNAKNTVYLQMN --------- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ------ (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 189) 206) NO: 339) 5) Opr QVQLVESGG GRTFS MGWFRQAP ISWSGG YYADSVKGRFTIS AA------- J GLVQPGGSL SYA GKEREFVV ST RDNAKNTVYLQMN ---- RLSCAAS (SEQ V (SEQ (SEQ SLKPEDTAVYYC ETPQLLSRC (SEQ ID ID ID NO: ID NO: (SEQ ID NO: DY (SEQ NO: 1) NO: 116) 127) 206) ID NO: 7) 340) Opr QVQLVESGG GFTFS MTWVRQTP ISNSGS RSADSVKGRFTIS AKCPSGSHY J GLVQPGGSL SYA GKGIEWVS YT RDNAKNTLYLQMN DCSAYVRGS RLSCAAS (SEQ R (SEQ (SEQ SLKPEDTAVYYC ------ 40 55382181.3 Attorney Docket No.047162-7503WO1 (02594) (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 117) 190) 263) NO: 341) 12) Opr QVQLVESGG GRTLS VGWFRQAP ISWSGG YYADSVKGRFTIS AS------- J GLVQPGGSL TYA GKEREFVA RT RDNVKNTVSLQMN GPPVEVPLR RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC LEEYVY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 91) 191) 264) NO: 342) 26) Opr QVQLVESGG GRTFS MGWFRQAP LSYSGR DYADSVKGRFTIS AA------- J GLVQPGGSL NYV GKEREFVA IT RDNAKNTVHLQMN NRVMSIGSG RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC RPDYEY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 67) 192) 265) NO: 343) 52) Opr QVQLVESGG GRTFS VGWFRQAP VSGTGG YYGESEKGRFTIS AA--- M, GLVQPGGSL GYA GKEREFVA SM RDNAKNTVYLQMN KYPQNFALR Opr RLSCAAS (SEQ G (SEQ (SEQ SLQPEDTAVYYC SFGRANEYD N (SEQ ID ID ID NO: ID NO: (SEQ ID NO: Y (SEQ ID NO: 1) NO: 119) 193) 266) NO: 344) 57) Opr QVQLVESGG GSIFS MGWHRQAP I- NYADSVKGRFTIS SV----- M, GLVQPGGSL INT GKQRELVT TSGGTT RDNTKNTVYLQMN DGLVRLNYS Opr RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC GTYYYTKH N (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 120) 194) 267) NO: 345) 58) Opr QVQLVESGG GRTFS MGWFRQAP I- YYADSVKGRFTIS AA------- M, GLVQPGGSL SYA GKEREFVA TSGGST RDNAKNTVYLQMN ------ Opr RLSCAAS (SEQ A (SEQ (SEQ NLQPEDAAVYYC RREGGKYDY N, (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID Opr NO: 1) NO: 67) 126) 268) NO: 346) J 7) Opr QVQLVESGG GRTFS MGWFRQAP VSWSGG YYADSVKGRFTIS AEGDFDDSG M, GLVQPGGSL DYA GKEREFVA ST RDYAKNTVYLQMN SYYPFGS-- Pil RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC ------ Q (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID 41 55382181.3 Attorney Docket No.047162-7503WO1 (02594) NO: 1) NO: 67) 195) 269) NO: 347) 59) Opr QVQLVESGG GRTFS MGWFRQAP TSWSGG YYADSVKGRFTIS AA------- N, GLVQPGGSL SYA GKEREFVA ST RDNAKNTVYLQLN -- Flg RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC GGALGAASR EHK (SEQ ID ID ID NO: ID NO: (SEQ ID NO: WYDY (SEQ L? NO: 1) NO: 67) 196) 270) ID NO: 7) 348) Opr QVQLVESGG GRTSI MAWFRQAP ITWSGR HYADSMKGRFTIS AA------- M, GLVQPGGSL KYA GKEREFVA ST REFAGNTVYLQMN ------- Opr RLSCAAS (SEQ S (SEQ (SEQ SLQSEDTAVYYC EGNSGYDY N, (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID Opr NO: 1) NO: 103) 168) 271) NO: 349) J 40) Opr QVQLVESGG GRTVS MAWFRQAP ISASGG YYGKSEKGRFTIS A-------- N, GLVQPGGSL SSA GKERELVA FK RDNAKNTVYLEMH LHVDGSLYS Opr RLSCAAS (SEQ G (SEQ (SEQ SLKPEDTALYTC SRGYAY M (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 121) 197) 272) NO: 350) 60) bad QVQLVESGG GITFS MTWYRQAP IISTGG SYADSVKGRFTIS NA------- GLVQPGGSL SYY GKERELVA ST RDNAKSTVYLQMN ------ RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC RYDPWGLNY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 122) 198) 273) NO: 351) 61) bad QVQLVESGG GRTFS MGWFRQAP IGNSGS NYAGSVKGRFTIS AARNAYGTG GLVQPGGSL LYA GKEREFVA NT RDNAKNTMYLQMN SGYQREIGY RLSCAAS (SEQ L (SEQ (SEQ SLKPEDTAVYYC HS---- (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 123) 199) 274) NO: 352) 62) bad QVQLVESGG GSIFS MGWYRQAP I- NYADSVKGRFTIS NA------- GLVQPGGSL INA GKQRELVA TSGGST RDNAKNTVYLQMN --------- RLSCAAS (SEQ A (SEQ (SEQ SLKPEDTAVYYC EVRYTY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 114) 126) 260) NO: 353) 42 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 63) bad QVQLVESGG GST- MAWFRQAP ITGNGG YYAKSVKGRCTIS AA------ GLVQPGGSL SSYA GKERDFVA ST RDSAKNTVYLQMN AREGNTLTT RLSCAAS (SEQ G (SEQ (SEQ SLKPEDTAVYYC TGKFYDY (SEQ ID ID ID NO: ID NO: (SEQ ID NO: (SEQ ID NO: 1) NO: 124) 200) 275) NO: 354) 64) In certain embodiments, the VHH comprises a complementary-determining region 1 (CDR1), a complementary-determining region 2 (CDR2), and a complementary-determining region 3 (CDR3). In certain embodiments, the VHH comprises a complementary-determining region 1 (CDR1), and a complementary-determining region 2 (CDR2). In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 2, a CDR2 of amino acid sequence of SEQ ID NO: 125, and a CDR3 of amino acid sequence of SEQ ID NO: 276. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 3, and a CDR2 of amino acid sequence of SEQ ID NO: 126. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 277. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 128, and a CDR3 of amino acid sequence of SEQ ID NO: 278. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 6, a CDR2 of amino acid sequence of SEQ ID NO: 129, and a CDR3 of amino acid sequence of SEQ ID NO: 279. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 130, and a CDR3 of amino acid sequence of SEQ ID NO:280. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 8, a CDR2 of amino acid sequence of SEQ ID NO: 131, and a CDR3 of amino acid sequence of SEQ ID NO: 281. 43 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 9, a CDR2 of amino acid sequence of SEQ ID NO: 132, and a CDR3 of amino acid sequence of SEQ ID NO: 282. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 10, and a CDR2 of amino acid sequence of SEQ ID NO: 133. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 11, a CDR2 of amino acid sequence of SEQ ID NO: 134, and a CDR3 of amino acid sequence of SEQ ID NO: 283. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 135, and a CDR3 of amino acid sequence of SEQ ID NO: 284. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 13, a CDR2 of amino acid sequence of SEQ ID NO: 136, and a CDR3 of amino acid sequence of SEQ ID NO: 285. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 14, a CDR2 of amino acid sequence of SEQ ID NO: 137, and a CDR3 of amino acid sequence of SEQ ID NO: 286. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 287. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 15, a CDR2 of amino acid sequence of SEQ ID NO: 138, and a CDR3 of amino acid sequence of SEQ ID NO: 288. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 139, and a CDR3 of amino acid sequence of SEQ ID NO: 289. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 290. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 16, a CDR2 of amino acid sequence of SEQ ID NO: 140, and a CDR3 of amino acid sequence of SEQ ID NO: 291. 44 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 292. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 17, a CDR2 of amino acid sequence of SEQ ID NO: 141, and a CDR3 of amino acid sequence of SEQ ID NO: 293. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 18, a CDR2 of amino acid sequence of SEQ ID NO: 142, and a CDR3 of amino acid sequence of SEQ ID NO: 294. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 19, a CDR2 of amino acid sequence of SEQ ID NO: 143, and a CDR3 of amino acid sequence of SEQ ID NO: 295. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 20, and a CDR2 of amino acid sequence of SEQ ID NO: 144. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 145, and a CDR3 of amino acid sequence of SEQ ID NO: 296. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 21, a CDR2 of amino acid sequence of SEQ ID NO: 146, and a CDR3 of amino acid sequence of SEQ ID NO: 297. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 22, a CDR2 of amino acid sequence of SEQ ID NO: 147, and a CDR3 of amino acid sequence of SEQ ID NO: 298. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 23, a CDR2 of amino acid sequence of SEQ ID NO: 148, and a CDR3 of amino acid sequence of SEQ ID NO: 299. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 24, a CDR2 of amino acid sequence of SEQ ID NO: 149, and a CDR3 of amino acid sequence of SEQ ID NO: 300. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 25, a CDR2 of amino acid sequence of SEQ ID NO: 150, and a CDR3 of amino acid sequence of SEQ ID NO: 301. 45 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 302. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 151, and a CDR3 of amino acid sequence of SEQ ID NO: 303. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 27, a CDR2 of amino acid sequence of SEQ ID NO: 152, and a CDR3 of amino acid sequence of SEQ ID NO: 304. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 28, and a CDR2 of amino acid sequence of SEQ ID NO: 153. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 29, a CDR2 of amino acid sequence of SEQ ID NO: 154, and a CDR3 of amino acid sequence of SEQ ID NO: 305. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 30, a CDR2 of amino acid sequence of SEQ ID NO: 155, and a CDR3 of amino acid sequence of SEQ ID NO: 306. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 156, and a CDR3 of amino acid sequence of SEQ ID NO: 307. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 157, and a CDR3 of amino acid sequence of SEQ ID NO: 308. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 32, and a CDR2 of amino acid sequence of SEQ ID NO: 158. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 33, a CDR2 of amino acid sequence of SEQ ID NO: 159, and a CDR3 of amino acid sequence of SEQ ID NO: 309. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 160, and a CDR3 of amino acid sequence of SEQ ID NO: 310. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 161, and a CDR3 of amino acid sequence of SEQ ID NO: 311. 46 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 12, and a CDR2 of amino acid sequence of SEQ ID NO: 162. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 35, a CDR2 of amino acid sequence of SEQ ID NO: 163, and a CDR3 of amino acid sequence of SEQ ID NO: 312. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 36, a CDR2 of amino acid sequence of SEQ ID NO: 164, and a CDR3 of amino acid sequence of SEQ ID NO: 313. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 37, a CDR2 of amino acid sequence of SEQ ID NO: 165, and a CDR3 of amino acid sequence of SEQ ID NO: 314. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 38, and a CDR2 of amino acid sequence of SEQ ID NO: 166. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 315. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 39, a CDR2 of amino acid sequence of SEQ ID NO: 167, and a CDR3 of amino acid sequence of SEQ ID NO: 316. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 317. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 41, a CDR2 of amino acid sequence of SEQ ID NO: 169, and a CDR3 of amino acid sequence of SEQ ID NO: 318. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 42, a CDR2 of amino acid sequence of SEQ ID NO: 170, and a CDR3 of amino acid sequence of SEQ ID NO: 319. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 43, a CDR2 of amino acid sequence of SEQ ID NO: 171, and a CDR3 of amino acid sequence of SEQ ID NO: 320. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 44, a CDR2 of amino acid sequence of SEQ ID NO: 172, and a CDR3 of amino acid sequence of SEQ ID NO: 321. 47 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 45, a CDR2 of amino acid sequence of SEQ ID NO: 173, and a CDR3 of amino acid sequence of SEQ ID NO: 322. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 46, a CDR2 of amino acid sequence of SEQ ID NO: 174, and a CDR3 of amino acid sequence of SEQ ID NO: 323. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 324. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 175, and a CDR3 of amino acid sequence of SEQ ID NO: 325. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 47, a CDR2 of amino acid sequence of SEQ ID NO: 176, and a CDR3 of amino acid sequence of SEQ ID NO: 326. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 48, a CDR2 of amino acid sequence of SEQ ID NO: 177, and a CDR3 of amino acid sequence of SEQ ID NO: 327. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 49, a CDR2 of amino acid sequence of SEQ ID NO: 178, and a CDR3 of amino acid sequence of SEQ ID NO: 328. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 179, and a CDR3 of amino acid sequence of SEQ ID NO: 329. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 50, a CDR2 of amino acid sequence of SEQ ID NO: 180, and a CDR3 of amino acid sequence of SEQ ID NO: 330. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 181, and a CDR3 of amino acid sequence of SEQ ID NO: 331. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 51, a CDR2 of amino acid sequence of SEQ ID NO: 182, and a CDR3 of amino acid sequence of SEQ ID NO: 332. 48 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 183, and a CDR3 of amino acid sequence of SEQ ID NO: 333. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 53, a CDR2 of amino acid sequence of SEQ ID NO: 184, and a CDR3 of amino acid sequence of SEQ ID NO: 334. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 54, and a CDR2 of amino acid sequence of SEQ ID NO: 185. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 55, a CDR2 of amino acid sequence of SEQ ID NO: 186, and a CDR3 of amino acid sequence of SEQ ID NO: 335. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 336. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 56, a CDR2 of amino acid sequence of SEQ ID NO: 187, and a CDR3 of amino acid sequence of SEQ ID NO: 337. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 188, and a CDR3 of amino acid sequence of SEQ ID NO: 338. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 189, and a CDR3 of amino acid sequence of SEQ ID NO: 339. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 340. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 190, and a CDR3 of amino acid sequence of SEQ ID NO: 341. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 191, and a CDR3 of amino acid sequence of SEQ ID NO: 342. 49 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 192, and a CDR3 of amino acid sequence of SEQ ID NO: 343. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 193, and a CDR3 of amino acid sequence of SEQ ID NO: 344. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 58, a CDR2 of amino acid sequence of SEQ ID NO: 194, and a CDR3 of amino acid sequence of SEQ ID NO: 345. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 346. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 59, a CDR2 of amino acid sequence of SEQ ID NO: 195, and a CDR3 of amino acid sequence of SEQ ID NO: 347. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 196, and a CDR3 of amino acid sequence of SEQ ID NO: 348. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 349. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 60, a CDR2 of amino acid sequence of SEQ ID NO: 197, and a CDR3 of amino acid sequence of SEQ ID NO: 350. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 61, a CDR2 of amino acid sequence of SEQ ID NO: 198, and a CDR3 of amino acid sequence of SEQ ID NO: 351. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 62, a CDR2 of amino acid sequence of SEQ ID NO: 199, and a CDR3 of amino acid sequence of SEQ ID NO: 352. In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 63, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 353. 50 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In certain embodiments, the VHH comprises a CDR1 of amino acid sequence of SEQ ID NO: 64, a CDR2 of amino acid sequence of SEQ ID NO: 200, and a CDR3 of amino acid sequence of SEQ ID NO: 354. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 65, SEQ ID NO: 125, SEQ ID NO: 201, and SEQ ID NO: 276. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 66, SEQ ID NO: 126, and SEQ ID NO: 202. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 203, and SEQ ID NO: 277. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 68, SEQ ID NO: 128, SEQ ID NO: 204, and SEQ ID NO: 278. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 69, SEQ ID NO: 129, SEQ ID NO: 205, and SEQ ID NO: 279. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 70, SEQ ID NO: 130, SEQ ID NO: 206, and SEQ ID NO: 280. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 71, SEQ ID NO: 131, SEQ ID NO: 207, and SEQ ID NO: 281. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 72, SEQ ID NO: 132, SEQ ID NO: 208, and SEQ ID NO: 282. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 73, and SEQ ID NO: 133. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 74, SEQ ID NO: 134, SEQ ID NO: 209, and SEQ ID NO: 283. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 75, SEQ ID NO: 135, SEQ ID NO: 210, and SEQ ID NO: 284. 51 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 13, SEQ ID NO: 76, SEQ ID NO: 136, SEQ ID NO: 211, and SEQ ID NO: 285. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 77, SEQ ID NO: 137, SEQ ID NO: 212, and SEQ ID NO: 286. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 287. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 78, SEQ ID NO: 138, SEQ ID NO: 206, and SEQ ID NO: 288. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 79, SEQ ID NO: 139, SEQ ID NO: 213, and SEQ ID NO: 289. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 214, and SEQ ID NO: 290. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 16, SEQ ID NO: 80, SEQ ID NO: 140, SEQ ID NO: 215, and SEQ ID NO: 291. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 216, and SEQ ID NO: 292. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 16, SEQ ID NO: 80, SEQ ID NO: 140, SEQ ID NO: 215, and SEQ ID NO: 291. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 216, and SEQ ID NO: 292. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 81, SEQ ID NO: 141, SEQ ID NO: 217, and SEQ ID NO: 293. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 52 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1, SEQ ID NO: 18, SEQ ID NO: 82, SEQ ID NO: 142, SEQ ID NO: 218, and SEQ ID NO: 294. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 19, SEQ ID NO: 83, SEQ ID NO: 143, SEQ ID NO: 219, and SEQ ID NO: 295. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 20, SEQ ID NO: 84, SEQ ID NO: 144, and SEQ ID NO: 220. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 85, SEQ ID NO: 145, SEQ ID NO: 206, and SEQ ID NO: 296. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 86, SEQ ID NO: 146, SEQ ID NO: 221, and SEQ ID NO: 297. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 87, SEQ ID NO: 147, SEQ ID NO: 222, and SEQ ID NO: 298. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 23, SEQ ID NO: 88, SEQ ID NO: 148, SEQ ID NO: 223, and SEQ ID NO: 299. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 24, SEQ ID NO: 89, SEQ ID NO: 149, SEQ ID NO: 224, and SEQ ID NO: 300. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 25, SEQ ID NO: 90, SEQ ID NO: 150, SEQ ID NO: 225, and SEQ ID NO: 301. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 26, SEQ ID NO: 91, SEQ ID NO: 127, SEQ ID NO: 226, and SEQ ID NO: 302. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 151, SEQ ID NO: 206, and SEQ ID NO: 303. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 27, SEQ ID NO: 92, SEQ ID NO: 152, SEQ ID NO: 227, and SEQ ID NO: 304. 53 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 28, SEQ ID NO: 93, SEQ ID NO: 153, and SEQ ID NO: 228. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 29, SEQ ID NO: 94, SEQ ID NO: 154, SEQ ID NO: 229, and SEQ ID NO: 305. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 30, SEQ ID NO: 95, SEQ ID NO: 155, SEQ ID NO: 230, and SEQ ID NO: 306. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 31, SEQ ID NO: 96, SEQ ID NO: 156, SEQ ID NO: 231, and SEQ ID NO: 307. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 31, SEQ ID NO: 67, SEQ ID NO: 157, SEQ ID NO: 232, and SEQ ID NO: 308. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 32, SEQ ID NO: 96, SEQ ID NO: 158, and SEQ ID NO: 233. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 33, SEQ ID NO: 67, SEQ ID NO: 159, SEQ ID NO: 234, and SEQ ID NO: 309. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 34, SEQ ID NO: 97, SEQ ID NO: 160, SEQ ID NO: 235, and SEQ ID NO: 310. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 83, SEQ ID NO: 161, SEQ ID NO: 236, and SEQ ID NO: 311. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 98, SEQ ID NO: 162, and SEQ ID NO: 237. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 99, SEQ ID NO: 163, SEQ ID NO: 238, and SEQ ID NO: 312. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 36, SEQ ID NO: 100, SEQ ID NO: 164, SEQ ID NO: 239, and SEQ ID NO: 313. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 54 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1, SEQ ID NO: 37, SEQ ID NO: 101, SEQ ID NO: 165, SEQ ID NO: 240, and SEQ ID NO: 314. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 38, SEQ ID NO: 83, SEQ ID NO: 166, and SEQ ID NO: 241. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 315. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 39, SEQ ID NO: 102, SEQ ID NO: 167, SEQ ID NO: 242, and SEQ ID NO: 316. In some embodiments, the VHH comprises SEQ ID NO: 1, SEQ ID NO: 40, SEQ ID NO: 103, SEQ ID NO: 168, SEQ ID NO: 243, and SEQ ID NO: 317. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 41, SEQ ID NO: 104, SEQ ID NO: 169, SEQ ID NO: 244, and SEQ ID NO: 318. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 42, SEQ ID NO: 105, SEQ ID NO: 170, SEQ ID NO: 206, and SEQ ID NO: 319. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 43, SEQ ID NO: 106, SEQ ID NO: 171, SEQ ID NO: 245, and SEQ ID NO: 320. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 44, SEQ ID NO: 107, SEQ ID NO: 172, SEQ ID NO: 246, and SEQ ID NO: 321. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 173, SEQ ID NO: 247, and SEQ ID NO: 322. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 46, SEQ ID NO: 69, SEQ ID NO: 174, SEQ ID NO: 248, and SEQ ID NO: 323. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 324. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 55 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1, SEQ ID NO: 47, SEQ ID NO: 108, SEQ ID NO: 176, SEQ ID NO: 250, and SEQ ID NO: 326. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 48, SEQ ID NO: 109, SEQ ID NO: 177, SEQ ID NO: 251, and SEQ ID NO: 327. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 49, SEQ ID NO: 110, SEQ ID NO: 178, SEQ ID NO: 252, and SEQ ID NO: 328. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 179, SEQ ID NO: 253, and SEQ ID NO: 329. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 67, SEQ ID NO: 180, SEQ ID NO: 254, and SEQ ID NO: 330. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 67, SEQ ID NO: 181, SEQ ID NO: 255, and SEQ ID NO: 331. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 51, SEQ ID NO: 97, SEQ ID NO: 182, SEQ ID NO: 256, and SEQ ID NO: 332. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 53, SEQ ID NO: 112, SEQ ID NO: 184, SEQ ID NO: 258, and SEQ ID NO: 334. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 52, SEQ ID NO: 111, SEQ ID NO: 183, SEQ ID NO: 257, and SEQ ID NO: 333. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 54, SEQ ID NO: 97, SEQ ID NO: 185, and SEQ ID NO: 247. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 55, SEQ ID NO: 113, SEQ ID NO: 186, SEQ ID NO: 259, and SEQ ID NO: 335. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 34, SEQ ID NO: 114, SEQ ID NO: 126, SEQ ID NO: 260, and SEQ ID NO: 336. 56 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 56, SEQ ID NO: 115, SEQ ID NO: 187, SEQ ID NO: 261, and SEQ ID NO: 337. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 57, SEQ ID NO: 96, SEQ ID NO: 188, SEQ ID NO: 262, and SEQ ID NO: 338. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 67, SEQ ID NO: 189, SEQ ID NO: 206, and SEQ ID NO: 339. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 116, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 340. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 117, SEQ ID NO: 190, SEQ ID NO: 263, and SEQ ID NO: 341. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 26, SEQ ID NO: 91, SEQ ID NO: 191, SEQ ID NO: 264, and SEQ ID NO: 342. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 52, SEQ ID NO: 67, SEQ ID NO: 192, SEQ ID NO: 265, and SEQ ID NO: 343. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 57, SEQ ID NO: 119, SEQ ID NO:193, SEQ ID NO: 266, and SEQ ID NO: 344. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 58, SEQ ID NO: 120, SEQ ID NO: 194, SEQ ID NO: 267, and SEQ ID NO: 345. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 126, SEQ ID NO: 268, and SEQ ID NO: 346. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 195, SEQ ID NO: 269, and SEQ ID NO: 347. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 57 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 196, SEQ ID NO: 270, and SEQ ID NO: 348. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 40, SEQ ID NO: 103, SEQ ID NO: 168, SEQ ID NO: 271, and SEQ ID NO: 349. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO:1, SEQ ID NO: 60, SEQ ID NO: 121, SEQ ID NO: 197, SEQ ID NO: 272, and SEQ ID NO: 350. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 61, SEQ ID NO: 122, SEQ ID NO: 198, SEQ ID NO: 273, and SEQ ID NO: 351. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 62, SEQ ID NO: 123, SEQ ID NO: 199, SEQ ID NO: 274, and SEQ ID NO: 352. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 63, SEQ ID NO: 114, SEQ ID NO: 126, SEQ ID NO: 260, and SEQ ID NO: 353. In some embodiments, the VHH comprises the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 200, SEQ ID NO: 275, and SEQ ID NO: 354. As used herein, the symbol “—” denotes a direct linkage between two amino acid sequences, as would be understood by one skilled in the art. In such context, the notation “SEQ ID NO: X1—SEQ ID NO: X2—SEQ ID NO: X3” represents a construct wherein the C-terminus of the amino acid sequence of SEQ ID NO: X1 is fused to the N-terminus of the amino sequence of SEQ ID NO: X2 and the C-terminus of the amino acid sequence of SEQ ID NO: X2 is fused to the N-terminus of the amino sequence of SEQ ID NO: X3. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 2—SEQ ID NO: 65—SEQ ID NO: 125—SEQ ID NO: 201—SEQ ID NO: 276. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 3—SEQ ID NO: 66—SEQ ID NO: 126—SEQ ID NO: 202. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 4—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 203—SEQ ID NO: 277. 58 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 68—SEQ ID NO: 128—SEQ ID NO: 204—SEQ ID NO: 278. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 6—SEQ ID NO: 69—SEQ ID NO: 129—SEQ ID NO: 205—SEQ ID NO: 279. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 70—SEQ ID NO: 130—SEQ ID NO: 206—SEQ ID NO: 280. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 8—SEQ ID NO: 71—SEQ ID NO: 131—SEQ ID NO: 207—SEQ ID NO: 281. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 9—SEQ ID NO: 72—SEQ ID NO: 132—SEQ ID NO: 208—SEQ ID NO: 282. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 10—SEQ ID NO: 73—SEQ ID NO: 133. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 11—SEQ ID NO: 74—SEQ ID NO: 134—SEQ ID NO: 209—SEQ ID NO: 283. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 75—SEQ ID NO: 135—SEQ ID NO: 210—SEQ ID NO: 284. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 13—SEQ ID NO: 76—SEQ ID NO: 136—SEQ ID NO: 211—SEQ ID NO: 285. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 14—SEQ ID NO: 77—SEQ ID NO: 137—SEQ ID NO: 212—SEQ ID NO: 286. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 287. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 15—SEQ ID NO: 78—SEQ ID NO: 138—SEQ ID NO: 206—SEQ ID NO: 59 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 288. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 79—SEQ ID NO: 139—SEQ ID NO: 213—SEQ ID NO: 289. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 214—SEQ ID NO: 290. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 16—SEQ ID NO: 80—SEQ ID NO: 140—SEQ ID NO: 215—SEQ ID NO: 291. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 216—SEQ ID NO: 292. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 16—SEQ ID NO: 80—SEQ ID NO: 140—SEQ ID NO: 215—SEQ ID NO: 291. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 216—SEQ ID NO: 292. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 17—SEQ ID NO: 81—SEQ ID NO: 141—SEQ ID NO: 217—SEQ ID NO: 293. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 18—SEQ ID NO: 82—SEQ ID NO: 142—SEQ ID NO: 218—SEQ ID NO: 294. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 19—SEQ ID NO: 83—SEQ ID NO: 143—SEQ ID NO: 219—SEQ ID NO: 295. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 20—SEQ ID NO: 84—SEQ ID NO: 144—SEQ ID NO: 220. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 85—SEQ ID NO: 145—SEQ ID NO: 206—SEQ ID NO: 296. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 60 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1—SEQ ID NO: 21—SEQ ID NO: 86—SEQ ID NO: 146—SEQ ID NO: 221—SEQ ID NO: 297. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 22—SEQ ID NO: 87—SEQ ID NO: 147—SEQ ID NO: 222—SEQ ID NO: 298. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 23—SEQ ID NO: 88—SEQ ID NO: 148—SEQ ID NO: 223—SEQ ID NO: 299. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 24—SEQ ID NO: 89—SEQ ID NO: 149—SEQ ID NO: 224—SEQ ID NO: 300. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 25—SEQ ID NO: 90—SEQ ID NO: 150—SEQ ID NO: 225—SEQ ID NO: 301. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 26—SEQ ID NO: 91—SEQ ID NO: 127—SEQ ID NO: 226—SEQ ID NO: 302. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 151—SEQ ID NO: 206—SEQ ID NO: 303. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 27—SEQ ID NO: 92—SEQ ID NO: 152—SEQ ID NO: 227—SEQ ID NO: 304. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 28—SEQ ID NO: 93—SEQ ID NO: 153—SEQ ID NO: 228. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 29—SEQ ID NO: 94—SEQ ID NO: 154—SEQ ID NO: 229—SEQ ID NO: 305. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 30—SEQ ID NO: 95—SEQ ID NO: 155—SEQ ID NO: 230—SEQ ID NO: 306. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 31—SEQ ID NO: 96—SEQ ID NO: 156—SEQ ID NO: 231—SEQ ID NO: 307. 61 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 31—SEQ ID NO: 67—SEQ ID NO: 157—SEQ ID NO: 232—SEQ ID NO: 308. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 32—SEQ ID NO: 96—SEQ ID NO: 158—SEQ ID NO: 233. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 33—SEQ ID NO: 67—SEQ ID NO: 159—SEQ ID NO: 234—SEQ ID NO: 309. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 34—SEQ ID NO: 97—SEQ ID NO: 160—SEQ ID NO: 235—SEQ ID NO: 310. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 83—SEQ ID NO: 161—SEQ ID NO: 236—SEQ ID NO: 311. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 98—SEQ ID NO: 162—SEQ ID NO: 237. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 35—SEQ ID NO: 99—SEQ ID NO: 163—SEQ ID NO: 238—SEQ ID NO: 312. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 36—SEQ ID NO: 100—SEQ ID NO: 164—SEQ ID NO: 239—SEQ ID NO: 313. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 37—SEQ ID NO: 101—SEQ ID NO: 165—SEQ ID NO: 240—SEQ ID NO: 314. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 38—SEQ ID NO: 83—SEQ ID NO: 166—SEQ ID NO: 241. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 4—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 315. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 39—SEQ ID NO: 102—SEQ ID NO: 167—SEQ ID NO: 242—SEQ ID NO: 316. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 62 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 1—SEQ ID NO: 40—SEQ ID NO: 103—SEQ ID NO: 168—SEQ ID NO: 243—SEQ ID NO: 317. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 41—SEQ ID NO: 104—SEQ ID NO: 169—SEQ ID NO: 244—SEQ ID NO: 318. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 42—SEQ ID NO: 105—SEQ ID NO: 170—SEQ ID NO: 206—SEQ ID NO: 319. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 43—SEQ ID NO: 106—SEQ ID NO: 171—SEQ ID NO: 245—SEQ ID NO: 320. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 44—SEQ ID NO: 107—SEQ ID NO: 172—SEQ ID NO: 246—SEQ ID NO: 321. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 45—SEQ ID NO: 83—SEQ ID NO: 173—SEQ ID NO: 247—SEQ ID NO: 322. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 46—SEQ ID NO: 69—SEQ ID NO: 174—SEQ ID NO: 248—SEQ ID NO: 323. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 324. In some embodiments, the VHH comprises SEQ ID NO: 1—SEQ ID NO: 47—SEQ ID NO: 108—SEQ ID NO: 176—SEQ ID NO: 250—SEQ ID NO: 326. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 48—SEQ ID NO: 109—SEQ ID NO: 177—SEQ ID NO: 251—SEQ ID NO: 327. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 49—SEQ ID NO: 110—SEQ ID NO: 178—SEQ ID NO: 252—SEQ ID NO: 328. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 179—SEQ ID NO: 253—SEQ ID NO: 329. 63 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 50—SEQ ID NO: 67—SEQ ID NO: 180—SEQ ID NO: 254—SEQ ID NO: 330. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 67—SEQ ID NO: 181—SEQ ID NO: 255—SEQ ID NO: 331. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 51—SEQ ID NO: 97—SEQ ID NO: 182—SEQ ID NO: 256—SEQ ID NO: 332. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 53—SEQ ID NO: 112—SEQ ID NO: 184—SEQ ID NO: 258—SEQ ID NO: 334. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 52—SEQ ID NO: 111—SEQ ID NO: 183—SEQ ID NO: 257—SEQ ID NO: 333. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 54—SEQ ID NO: 97—SEQ ID NO: 185—SEQ ID NO: 247. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 55—SEQ ID NO: 113—SEQ ID NO: 186—SEQ ID NO: 259—SEQ ID NO: 335. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 34—SEQ ID NO: 114—SEQ ID NO: 126—SEQ ID NO: 260—SEQ ID NO: 336. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 56—SEQ ID NO: 115—SEQ ID NO: 187—SEQ ID NO: 261—SEQ ID NO: 337. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 57—SEQ ID NO: 96—SEQ ID NO: 188—SEQ ID NO: 262—SEQ ID NO: 338. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 67—SEQ ID NO: 189—SEQ ID NO: 206—SEQ ID NO: 339. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 116—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 64 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 340. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 117—SEQ ID NO: 190—SEQ ID NO: 263—SEQ ID NO: 341. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 26—SEQ ID NO: 91—SEQ ID NO: 191—SEQ ID NO: 264—SEQ ID NO: 342.. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 52—SEQ ID NO: 67—SEQ ID NO: 192—SEQ ID NO: 265—SEQ ID NO: 343. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 57—SEQ ID NO: 119—SEQ ID NO:193—SEQ ID NO: 266—SEQ ID NO: 344. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 58—SEQ ID NO: 120—SEQ ID NO: 194—SEQ ID NO: 267—SEQ ID NO: 345. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 126—SEQ ID NO: 268—SEQ ID NO: 346. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 59—SEQ ID NO: 67—SEQ ID NO: 195—SEQ ID NO: 269—SEQ ID NO: 347. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 196—SEQ ID NO: 270—SEQ ID NO: 348. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 40—SEQ ID NO: 103—SEQ ID NO: 168—SEQ ID NO: 271—SEQ ID NO: 349. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO:1—SEQ ID NO: 60—SEQ ID NO: 121—SEQ ID NO: 197—SEQ ID NO: 272—SEQ ID NO: 350. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 61—SEQ ID NO: 122—SEQ ID NO: 198—SEQ ID NO: 273—SEQ ID NO: 351. 65 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 62—SEQ ID NO: 123—SEQ ID NO: 199—SEQ ID NO: 274—SEQ ID NO: 352. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 63—SEQ ID NO: 114—SEQ ID NO: 126—SEQ ID NO: 260—SEQ ID NO: 353. In some embodiments, the VHH comprises the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 64—SEQ ID NO: 124—SEQ ID NO: 200—SEQ ID NO: 275—SEQ ID NO: 354. Phage-Displayed VHH Library against P. aeruginosa In another aspect described herein is a phage-displayed VHH library comprising a plurality of VHH generated against P. aeruginosa. In some embodiments, the library further comprises enriching for a subset of the phage-displayed VHH library that targets an antigen of interest on P. aeruginosa. Methods The disclosure provides in one aspect is a method of identifying at least one member of a display library that binds to an antigen of interest associated with a bacterium, the method comprising: a) generating the display library, b) panning the display library against an antigen of interest associated with the bacterium, c) enriching for at least one member of the library that bind the antigen of interest, and d) high-throughput sequencing the gene encoding the at least one member of the display library; thus identifying at least one member of the display library that binds to the antigen of interest. The disclosure provides in another aspect a method of treating, ameliorating, and / or preventing a disease arising from Pseudomonas aeruginosa infection in a patient. In certain embodiments, the method comprises administering to the subject a therapeutically effective amount of a VHH comprising at least one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125-200 (CDR2 sequences), and SEQ ID NOs: 276-354 (CDR3 sequences). The disclosure provides in another aspect a method of diagnosing a Pseudomonas aeruginosa infection in a patient. In certain embodiments, the method comprises contacting a biological sample from the patient with a phage-displayed VHH library of the disclosure and / or a VHH of the 66 55382181.3 Attorney Docket No.047162-7503WO1 (02594) disclosure. In certain embodiments, the method comprises identifying binding between at least one antigen in the biological sample with the phage-displayed VHH library of the disclosure and / or the VHH(s) of the disclosure. Administration / Dosage / Formulations The regimen of administration may affect what constitutes an effective amount. The therapeutic compounds and / or compositions may be administered to the subject either prior to or after the onset of a disease or disorder contemplated herein. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic compounds and / or compositions may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation. Administration of the compounds and / or compositions of the present disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat, ameliorate, and / or prevent a disease or disorder contemplated herein. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat a disease or disorder contemplated herein. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound described herein is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation. Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general 67 55382181.3 Attorney Docket No.047162-7503WO1 (02594) health and prior medical history of the patient being treated, and like factors well, known in the medical arts. A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds described herein employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms described herein are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease or disorder contemplated herein. In certain embodiments, the compositions described herein are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions described herein comprise a therapeutically effective amount of a compound described herein and a pharmaceutically acceptable carrier. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin. In certain embodiments, the compositions described herein are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, 68 55382181.3 Attorney Docket No.047162-7503WO1 (02594) the compositions described herein are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions described herein varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account. Compounds described herein for administration may be in the range of from about 1 µg to about 10,000 mg, about 20 µg to about 9,500 mg, about 40 µg to about 9,000 mg, about 75 µg to about 8,500 mg, about 150 µg to about 7,500 mg, about 200 µg to about 7,000 mg, about 350 µg to about 6,000 mg, about 500 µg to about 5,000 mg, about 750 µg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween. In some embodiments, the dose of a compound described herein is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound described herein used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof. In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective 69 55382181.3 Attorney Docket No.047162-7503WO1 (02594) amount of a compound described herein, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a disease or disorder contemplated herein. Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents. Routes of administration of any of the compositions described herein include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the disclosure may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, intraocular, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration. Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein. In some embodiments, the composition as described herein can be administered as an implant or as part of a bone graft. Types of bone grafts include, but are not limited to autogenous bone graft, xenogenic bone graft, a demineralized bone matrix, a graft composite, a bone graft substitute, allograft, xenograft, an alloplastic graft, and a cortical bone graft. The composition as described herein can be administered in combination with a bone morphogenic protein(s) (BMP). In some embodiments, the implant can be from biological material (e.g., donor bone tissue) or from inorganic material (e.g., metal, degradable synthetic 70 55382181.3 Attorney Docket No.047162-7503WO1 (02594) polymer). One who is of skill in the art will be able to establish an implant and / or bone graft and administer the composition as part of the treatment. In some embodiments, the composition as described herein can be administered using an Fc-based drug carrier. Different types of Fc-based drug carriers include, but are not limited to Fc-fusion, albumin-fusion, IgG or albumin engineering, monomeric Fc- and CH domains, Fc-decorated protein nanocontainers, or fusions to alternate FcRn binding ligands. One who is of skill in the art will be able to utilize the Fc-based drug carrier to administer the composition as part of the treatment. Oral Administration For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent. For oral administration, the compounds described herein may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropyl methylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and 71 55382181.3 Attorney Docket No.047162-7503WO1 (02594) preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid). Compositions as described herein can be prepared, packaged, or sold in a formulation suitable for oral or buccal administration. A tablet that includes a compound as described herein can, for example, be made by compressing or molding the active ingredient, optionally with one or more additional ingredients. Compressed tablets may be prepared by compressing, in a suitable device, the active ingredient in a free-flowing form such as a powder or granular preparation, optionally mixed with one or more of a binder, a lubricant, an excipient, a surface active agent, and a dispersing agent. Molded tablets may be made by molding, in a suitable device, a mixture of the active ingredient, a pharmaceutically acceptable carrier, and at least sufficient liquid to moisten the mixture. Pharmaceutically acceptable excipients used in the manufacture of tablets include, but are not limited to, inert diluents, granulating and disintegrating agents, dispersing agents, surface-active agents, disintegrating agents, binding agents, and lubricating agents. Suitable dispersing agents include, but are not limited to, potato starch, sodium starch glycollate, poloxamer 407, or poloxamer 188. One or more dispersing agents can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more dispersing agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Surface-active agents (surfactants) include cationic, anionic, or non-ionic surfactants, or combinations thereof. Suitable surfactants include, but are not limited to, behentrimonium chloride, benzalkonium chloride, benzethonium chloride, benzododecinium bromide, carbethopendecinium bromide, cetalkonium chloride, cetrimonium bromide, cetrimonium chloride, cetylpyridine chloride, didecyldimethylammonium chloride, dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, domiphen bromide, lauryl methyl gluceth-10 hydroxypropyl dimonium chloride, tetramethylammonium hydroxide, thonzonium bromide, stearalkonium chloride, octenidine dihydrochloride, olaflur, N-oleyl-1,3-propanediamine, 2-acrylamido-2-methylpropane sulfonic acid, alkylbenzene sulfonates, ammonium lauryl sulfate, ammonium perfluorononanoate, docusate, disodium cocoamphodiacetate, magnesium laureth sulfate, perfluorobutanesulfonic acid, perfluorononanoic acid, perfluorooctanesulfonic acid, perfluorooctanoic acid, potassium lauryl sulfate, sodium alkyl sulfate, sodium dodecyl sulfate, sodium laurate, sodium laureth 72 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sulfate, sodium lauroyl sarcosinate, sodium myreth sulfate, sodium nonanoyloxybenzenesulfonate, sodium pareth sulfate, sodium stearate, sodium sulfosuccinate esters, cetomacrogol 1000, cetostearyl alcohol, cetyl alcohol, cocamide diethanolamine, cocamide monoethanolamine, decyl glucoside, decyl polyglucose, glycerol monostearate, octylphenoxypolyethoxyethanol CA-630, isoceteth-20, lauryl glucoside, octylphenoxypolyethoxyethanol P-40, Nonoxynol-9, Nonoxynols, nonyl phenoxypolyethoxylethanol (NP-40), octaethylene glycol monododecyl ether, N-octyl beta- D-thioglucopyranoside, octyl glucoside, oleyl alcohol, PEG-10 sunflower glycerides, pentaethylene glycol monododecyl ether, polidocanol, poloxamer, poloxamer 407, polyethoxylated tallow amine, polyglycerol polyricinoleate, polysorbate, polysorbate 20, polysorbate 80, sorbitan, sorbitan monolaurate, sorbitan monostearate, sorbitan tristearate, stearyl alcohol, surfactin, Triton X-100, and Tween 80. One or more surfactants can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more surfactants can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Suitable diluents include, but are not limited to, calcium carbonate, magnesium carbonate, magnesium oxide, sodium carbonate, lactose, microcrystalline cellulose, calcium phosphate, calcium hydrogen phosphate, and sodium phosphate, Cellactose ® 80 (75 % α- lactose monohydrate and 25 % cellulose powder), mannitol, pre-gelatinized starch, starch, sucrose, sodium chloride, talc, anhydrous lactose, and granulated lactose. One or more diluents can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more diluents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Suitable granulating and disintegrating agents include, but are not limited to, sucrose, copovidone, corn starch, microcrystalline cellulose, methyl cellulose, sodium starch glycollate, pregelatinized starch, povidone, sodium carboxy methyl cellulose, sodium alginate, citric acid, croscarmellose sodium, cellulose, carboxymethylcellulose calcium, colloidal silicone dioxide, crosspovidone and alginic acid. One or more granulating or 73 55382181.3 Attorney Docket No.047162-7503WO1 (02594) disintegrating agents can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more granulating or disintegrating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Suitable binding agents include, but are not limited to, gelatin, acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, anhydrous lactose, lactose monohydrate, hydroxypropyl methylcellulose, methylcellulose, povidone, polyacrylamides, sucrose, dextrose, maltose, gelatin, polyethylene glycol. One or more binding agents can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more binding agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Suitable lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, hydrogenated castor oil, glyceryl monostearate, glyceryl behenate, mineral oil, polyethylene glycol, poloxamer 407, poloxamer 188, sodium laureth sulfate, sodium benzoate, stearic acid, sodium stearyl fumarate, silica, and talc. One or more lubricating agents can each be individually present in the composition in an amount of about 0.01% w / w to about 90% w / w relative to weight of the dosage form. One or more lubricating agents can each be individually present in the composition in an amount of at least, greater than, or less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% w / w relative to weight of the dosage form. Tablets can be non-coated or they may be coated using known methods to achieve delayed disintegration in the gastrointestinal tract of a subject, thereby providing sustained release and absorption of the active ingredient. By way of example, a material such as glyceryl monostearate or glyceryl distearate may be used to coat tablets. Further by way of example, tablets may be coated using methods described in U.S. Patent Nos.4,256,108; 4,160,452; and 4,265,874 to form osmotically controlled release tablets. Tablets may further comprise a sweetening agent, a flavoring agent, a coloring agent, a preservative, or some combination of these in order to provide for pharmaceutically elegant and palatable preparation. 74 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Tablets can also be enterically coated such that the coating begins to dissolve at a certain pH, such as at about pH 5.0 to about pH 7.5, thereby releasing a compound as described herein. The coating can contain, for example, EUDRAGIT ® L, S, FS, and / or E polymers with acidic or alkaline groups to allow release of a compound as described herein in a particular location, including in any desired section(s) of the intestine. The coating can also contain, for example, EUDRAGIT ® RL and / or RS polymers with cationic or neutral groups to allow for time controlled release of a compound as described herein by pH-independent swelling. Parenteral Administration For parenteral administration, the compounds described herein may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used. Sterile injectable forms of the compositions of this disclosure may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as lauryl, stearyl, or oleyl alcohols, or similar alcohol. Additional Administration Forms Additional dosage forms of this disclosure include dosage forms as described in U.S. Patents Nos.6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this disclosure also include dosage forms as described in U.S. Patent Applications Nos.20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 75 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757. Controlled Release Formulations and Drug Delivery Systems In certain embodiments, the formulations of the present disclosure may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations. The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form. For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method described herein may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation. In one embodiment, the compounds described herein are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation. The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours. The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration. The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration. As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration. As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 76 55382181.3 Attorney Docket No.047162-7503WO1 (02594) hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration. Dosing The therapeutically effective amount or dose of a composition of the present disclosure depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of the disease or disorder in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors. A suitable dose of a compound of the present disclosure may be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses. It is understood that the amount of compound dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on. In the case wherein the patient’s status does improve, upon the doctor’s discretion the administration of the inhibitor described herein is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a “drug holiday”). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Once improvement of the patient’s conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long-term basis upon any recurrence of symptoms 77 55382181.3 Attorney Docket No.047162-7503WO1 (02594) and / or infection. The compositions for use in the method described herein may be formulated in unit dosage form. The term “unit dosage form” refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose. Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LD50(the dose lethal to 50% of the population) and the ED50(the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50and ED50. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size / volume, and experimental reagents, such as solvents, catalysts, pressures, atmospheric conditions, e.g., nitrogen atmosphere, and reducing / oxidizing agents, with art- recognized alternatives and using no more than routine experimentation, are within the scope of the present application. EXAMPLES The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any 78 55382181.3 Attorney Docket No.047162-7503WO1 (02594) and all variations which become evident as a result of the teaching provided herein. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. Example 1: Phage display panning identifies VHHs specific to purified P. aeruginosa proteins A VHH phage display library was constructed from an alpaca (Vicugna pacos) immunized with a mixture of soluble and membrane proteins from several P. aeruginosa laboratory strains cultured under various conditions. The library’s diversity was estimated at ~80,000 clones by HTS (FIG.6A-6F). This phage display library was panned against purified P. aeruginosa flagella and Type IV Pili (T4P) (FIG.1A) and yielded numerous VHH clones recognizing these antigens—either as purified proteins (FIG.1B) or on intact P. aeruginosa cells fixed to microplates with methanol (FIG.1C). These VHHs exhibited similar specificity when expressed as soluble recombinant VHHs (“rVHHs,” FIGs.11A-11B). However, when tested for binding to intact, live bacterial cells—both by live-cell dot blot (FIG.13A-13B) and flow cytometry (FCM) (FIG.12A-12B)—these rVHHs showed weak or absent staining. Cell fixation restored rVHH staining as analyzed by FCM (FIG.1H). Panning against surface- immobilized antigens had selected nanobodies specific for non-native conformations of these antigens. Phage-seq reveals different dynamics of phage display selection against bacterial cells Based on these results, phage display panning was performed against live P. aeruginosa cells in suspension, with the goal of selecting VHHs that recognized surface antigens in their native conformations (FIG.2A). Selection cells expressed flagella or T4P, while isogenic mutants deleted for the antigen of interest (i.e. flagellin or pilin) served as counter-selection cells. Samples generated by both cell-based and solid-phase panning were analyzed by HTS of the complementarity-determining regions (CDRs) 1-3. Between ~2,500 to >40,000 VHH clones per sample were identified, with more clones encountered at greater sequencing depth. Given the dominant contribution of CDR3 to antibody binding specificity, reads were pooled with the same CDR3 sequence (“CDR3 clonotype”) in the analysis. The number of CDR3 79 55382181.3 Attorney Docket No.047162-7503WO1 (02594) clonotypes per sample was ~100–2,500 (FIG.2B). Panning should enrich a library for VHH clones that bind the antigen of interest while depleting all other clones. Simultaneously, VHH fusions expressed and amplified efficiently in the E. coli host will be advantaged over others. Both types of selective pressure would result in a smaller number of VHH clones at relatively higher abundance. Whittaker plots (rank abundance curves) showed that richness (number of clones) and evenness (relative rarity of each clone) of CDR3 clonotypes per sample both declined over rounds of panning (FIGs.2B-2C). For solid-phase selections, a large difference was observed after the second round of selection (FIG.2B); for cell-based selections, this change was more gradual (FIG. 2C). Richness and evenness were higher at the end of the cell-based versus the solid-phase campaign. Barplots revealed that, in solid-phase selections, a small number of clones dominated the library after 1–2 rounds of selection and persisted during subsequent rounds (FIG.2D). By contrast, in cell-based selections the number of clones gradually decreased over four rounds of selection (FIG.2E). A few CDR3 clonotypes were highly abundant in the final rounds of both solid phase and cell-based selections targeting the same antigen (e.g. clones e06677, 97861c, 0cf8fb, and 97861c). Usually, however, the most abundant clones differed between cell-based vs. solid-phase selections against the same antigen. Cell-based panning, like solid-phase panning, narrowed the population of VHHs, albeit more slowly. This reflects the greater diversity of antigens available for binding and / or the less stringent conditions used for selection in the cell-based campaign compared to the solid-phase campaign. High-throughput Phage-seq biopanning 180 pairs of P. aeruginosa genotypes were panned next, testing the performance of Phage-seq on a diversity of antigens and in a 96-well format (FIG.3A). Most selections were carried out using isogenic wild-type / mutant pairs differing for a single antigen or structure; growth conditions were selected to promote expression of the antigen(s) of interest (FIG.3B; Table 6). In this experiment, the relationship between selection pair and antigen was many- to-many, rather than one-to-one. Multiple antigens were predicted to differ within some pairs of selection and counter-selection cells (e.g. all proteins comprising a Type 3 secretion apparatus). In other instances, antigens differed across more than one selection (e.g. mutants in structural and regulatory elements both leading to the absence of the same antigen). Expectations of antigen presence vs absence are summarized for each pair of selection and counter-selection cells (FIG.3B, Table 6). Selections were considered “positive” for an antigen expressed by selection cells but not by counter-selection cells, and “negative” if the 80 55382181.3 Attorney Docket No.047162-7503WO1 (02594) antigen was either missing from both cell types or more abundant on the counter-selection cells. Selections were labeled “unknown” if no a priori prediction could be made about the antigen status of a pair. High-throughput sequencing of phage over four rounds of selection showed progressive changes from the input library to the final round of selection as visualized by PCA (FIG.3C, FIGs.9A-9B). In contrast to the previous small-scale selections (FIG.2A- 2E), library composition did not change substantially throughout this selection campaign (FIGs.15, 16A-16C); in most selections, the 50–100 most abundant clones comprised <25% of the reads in the final round. Many selections showed no clear changes in the final abundance of the top 40 clones or in the richness / evenness of the samples (e.g. FIG.3D). Panning in 96 well format necessitated protocol modifications, e.g. reduced cell numbers and wash steps, and altered methods for cell / phage resuspension and separation. To test whether these affected selections, a subset of genotype pairs was tested (FIG.3B, bolded / bulleted). Over three additional rounds of selection, one (1) increased wash stringency; (2) increased cell number; and (3) carried out 3 sequential counter-selection steps per round before selection on antigen-positive cells. In an additional set of selections, it was tested whether a higher cell-to-phage ratio would lead to stronger convergence of phage populations by diluting input phage 100-fold before applying to counter-selection cells in rounds 6 and 7. Titers of phage eluted from selection cells increased after round 7 of these “extended” selection campaigns as compared to counter-selection eluate titers, with the greatest difference seen for those selections where the input phage was diluted 100-fold (FIG. 10E). HTS of these extended selections revealed marked changes in library diversity (FIG. 3E), suggesting that more stringent washing and counter-selection had successfully tightened the selection bottleneck. Most selections nonetheless remained relatively diverse rather than converging on a small number of CDR3s. Two closely-related CDR3 clonotypes, ad6f8f and 2c7c51, became highly abundant in numerous samples, suggesting these clones were non-specific binders and / or very effectively replicated in the E. coli host. Samples where ad6f8f and 2c7c51 comprised >80% of the reads were excluded from further analysis. Selections with a 1 / 100x bottleneck showed more pronounced changes in library composition (FIGs.19A-19E, 20A-20H, 21E-21F), suggesting that higher cell-to-phage ratios favored convergence. In aggregate, these data indicated that high-throughput cell-based selections converged on VHH clones with affinity for the antigens of interest. 81 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Phage-seq identifies nanobodies specific to the P. aeruginosa cell surface The goal of the cell-based campaign was to select VHH specific for native- conformation antigens on live cells; these VHHs could then be identified from the HTS data, expressed and experimentally tested. Nanobodies were searched in the data set that were enriched (i.e. increased in abundance over rounds of selection), as selections had not converged on a few high-abundance nanobodies and because previous studies of peptide phage display showed no correlation between final round clone abundance and binding strength to the target antigen. Several metrics of VHH enrichment were developed in HTS data to guide the choice of nanobodies to resynthesize. Ultimately, a composite of several metrics was used to shortlist CDR3 clonotypes enriched in multiple antigen-positive samples as illustrated for the MDR efflux porin OprM (FIG.4A-4D); a similar analysis was conducted for several antigens (FIGs.19A-19H-FIGs.23A-23E). Each candidate CDR3 was then manually inspected across all samples, to assess distribution of enrichment and final abundances across antigen-positive, antigen-negative, and antigen-unknown samples (FIG. 4E). CDR3s were favored for which enrichment and abundance were highest in the antigen- positive selections and disregarded those with very high enrichment in many samples (e.g. 2c7c51 and ad6f8f). For each chosen CDR, a gene fragment encoding the consensus full- length VHH amino acid sequence was designed, synthesized and expressed as a fusion to human IgG1-Fc. VHHs targeting five antigens were resynthesized: the flagellar filament (FliC); the flagellar hook-basal body (HBB, “FlgEHKL”); and three efflux-associated outer-membrane porins (OprM, OprN, and OprJ). Of 84 rVHHs cloned (12–20 rVHHs per antigen), 66 were successfully expressed (FIG.4F). Expressed rVHHs were assayed by FCM using unfixed antigen-positive and antigen-negative cells as targets. The method identified 8 rVHHs (of 11 expressed) recognizing the flagellar hook- basal bod (HBB) (FIG.4F; FIG.29). Most stained PAK ΔfliC ΔfleN cells (which express several hook-basal bodies but no flagellar filaments) with an intensity ~1000-fold higher than aflagellate PAK ΔflhA cells. Clone 13c8b9 (E1) stained PAK ΔfleN cells (which express several entire flagella) more strongly than PAK ΔfliC ΔfleN cells; clone 99f9fc (E2) exhibited the opposite staining pattern (FIGs.32A-32B). These two rVHHs may bind different HBB epitopes or be sensitive to HBB conformations specific to the presence of the flagellar filament. Twenty rVHHs recognized the various outer membrane porins (OprM, OprJ, and OprN) associated with RND-type MDR efflux systems (FIGs.4H-4I; FIGs.25-27). Three 82 55382181.3 Attorney Docket No.047162-7503WO1 (02594) rVHHs were enriched in multiple selections against different efflux porins and found to recognize both OprM and OprJ (FIG.4I, FIG.28). Several rVHHs were tested against P. aeruginosa clinical isolates and stained those with MDR phenotypes (FIG.31). Altogether, this data demonstrated that phage-displayed panning coupled with analysis of Phage-seq HTS data yields numerous nanobodies that selectively bound P. aeruginosa antigens in their native conformations on live cells, including clinical isolates. Mapping the P. aeruginosa cell surface with Phage-seq Since the extended panning successfully yielded selective VHHs, the large high- throughput panning dataset was re-examined to test whether Phage-seq had captured information about the structure of bacterial cell surfaces during earlier rounds of selection. Principal component analysis (PCA) of final round abundances showed that panned samples were well-separated from the input library along the first axis, then separated according to growth condition along the second and third axis (FIG.5A). Among selections carried out on surface-grown cells, those targeting exopolysaccharides, the related transporter CdrAB, and small colony variants formed a distinct manifold, whereas others (e.g. targeting T4P and the type VI secretion system) were contiguous with selections from exponential-phase liquid cultures (FIG.5A). A rough clustering was apparent, with efflux pump selections appearing close together, while selections for flagella and pili also clustered together (FIG.5B; FIG. 33A-33E). Notably, selections on clinical isolates did not separate from other selections against P. aeruginosa laboratory strains. canonical correspondence analysis (CCA) on the enrichment matrix revealed that the presence or absence of biological features (e.g. flagella, OprM, type III secretion system) could explain variance in VHH enrichments across samples (FIG.5C). To further evaluate the dataset’s ability to characterize an isolate, a series of classifiers were trained to distinguish antigen-positive versus antigen-negative selections. The goal was to test whether Phage-seq data could recapitulate characteristics of well- characterized isolates in the selection campaign, not to predict antigens of unknown isolates. A separate ensemble of classifiers was trained for each antigen where >5 antigen-positive and antigen-negative selections had been carried out. Data were repeatedly divided into 5 folds, with four of five folds used for training and the fifth used to evaluate classifier performance. The performance of all classifiers was measured to estimate their average, best- and worst- case performance. As a control, a similar procedure was performed on the same set of selections after randomly permuting the antigen-positive / antigen-negative labels. This “shuffled labels” control demonstrated that the models were not excessively flexible (i.e. they 83 55382181.3 Attorney Docket No.047162-7503WO1 (02594) did not overfit to distinguish arbitrary subsets of the data). The classifiers performed acceptably, with mean area under the receiver-operator characteristic curves (AUROC) ranging from 0.7–0.86. AUROCs for the shuffled controls were ≤0.52, indicating performance similar to or worse than chance. VHH populations measured by Phage-seq reflect biological differences between selection conditions. Selected Discussion In this study, phage display selection and high-throughput sequencing were combined to create a tool for probing the surface of living bacterial cells. The approach identified nanobodies that recognize multiple virulence-associated P. aeruginosa antigens, including T4P, flagellin, the flagellar hook-basal body, and efflux-associated outer membrane porins. The high-dimensional VHH abundance datasets generated by this approach also captured biologically relevant information about the bacterial cell surface. The study built on two lines of prior work: combining phage display with HTS and using bacterial cells as bait for panning. Phage display studies have used HTS to estimate library diversity, identify novel antigens, perform affinity maturation, or quantify many antigens in parallel. However, these techniques have not been applied to bacteria. Prior panning against bacterial cells sought to identify antibodies recognizing any antigen on a particular strain or species. By contrast, the study employed selection / counter-selection between bacterial mutants, allowing us to link genotype to phenotype (antigen expression). This strategy aligned well with bacterial genetics, where knockout and overexpression mutants in many genes are readily available, and the antigen products of these genes could be investigated with Phage-seq. The promise of this method was demonstrated by discovering nanobodies against several membrane-associated protein complexes which stain live, intact cells. Phage display is usually performed on purified, surface-immobilized antigens. Using this approach, VHHs were identified specific to immobilized antigen but blind to the same antigen on live cells. Surface-immobilized protein antigens are likely denatured, and this is known to affect antibodies selected by phage display, particularly VHHs which are highly conformation-sensitive. The solid phase-selected VHHs recognized methanol-fixed, antigen- positive cells, suggesting that methanol somewhat mimicked the effects of surface-binding on these antigens. The study identified key variables affecting the performance of phage display panning on intact bacterial cells, which converged gradually on larger sets of candidate VHHs than 84 55382181.3 Attorney Docket No.047162-7503WO1 (02594) obtained from solid-phase selections. The relative complexity of antigens presented by a cell surface compared to a purified protein likely contributed to this outcome. More critically, the ratio of bait antigen to phage was lower in cell-based selections. Most of a cell’s surface presented irrelevant biomass—in contrast to selections against purified protein, where nearly 100% of well binding capacity was occupied by target antigen. This ratio of antigen to phage was even lower in high-throughput experiments (FIGs.3A-3E) than in initial cell-based pannings (FIGs.2A-2E) and likely contributed to the slow convergence of selections in the high-throughput format. Experimental manipulation of this ratio in the extended high- throughput pannings, either by doubling the number of cells per well or by diluting the input phage 1 / 100x, resulted in more dramatic changes in VHH population composition than in the prior four rounds of selection. HTS datasets generated by Phage-seq posed unique problems. VHHs do not map to an existing ontology, unlike 16S amplicons to taxa or RNA-seq reads to genes. Yet statistical challenges relevant to microbiome or RNA-seq data also existed for Phage-seq data: sparsity, zero inflation, high dimensionality, compositionality, and sensitivity of diversity measures to sequencing depth. VHH sequences could be mapped to multiple “feature spaces”—e.g. each CDR3 clonotype is reflected in multiple VHH amino acid sequences, each in turn encoded by multiple nucleic acid sequences. Conversion between these feature spaces was necessary for the work: e.g., resynthesizing a VHH required identifying all VHH sequences encoding a given CDR3 clonotype and calculating a consensus. Interactive querying for CDR3 or VHH sequences similar to a given clone was also useful. A custom pipeline and Python package was built to correct sequencing errors, map reads to VHH amino acid sequences, identify CDR and framework regions, and calculate VHH abundance and enrichment. Considering the statistical pathologies above, a naïve approach of calculating relative abundances was used (dividing counts by library size per sample), dividing these relative abundances to calculate enrichments, and ranking VHHs according to their enrichments in several samples. The majority of rVHHs that were identified and successfully expressed demonstrated specificity by FCM. Many of the VHHs, particularly those against RND-type MDR efflux system components, hold promise as tools for diagnostics, therapeutics, and research. Several rVHHs also stained MDR clinical isolates by FCM. Monoclonal antibodies against OprM, OprJ, and OprN can be used to rapidly recognize MDR P. aeruginosa isolates. These antibodies can also be used to target antimicrobials to MDR organisms, or even as direct cytotoxic agents. 85 55382181.3 Attorney Docket No.047162-7503WO1 (02594) In its current form, Phage-seq is an indirect tool for bacterial surface -omics. However, the modeling suggests that even early high-throughput pannings captured biologically meaningful information about the cell surface, which can be leveraged to generate useful reagents and insights about the cell surface. Many thousands of VHHs against numerous bacterial genotypes were enriched in the high-throughput panning experiments. Example 2: Methods 1. Bacterial strains and growth conditions Bacterial strains discussed in the main text are shown in Table 1. Strains used in phage display selections are shown in Table 6. Luria Broth (LB) agar and LB broth were used for growth of P. aeruginosa unless noted otherwise. Bacteria were streaked from glycerol stocks onto LB agar plates, then liquid cultures inoculated from well-isolated single colonies and grown overnight. Bacterial growth was at 37 °C, with liquid cultures shaking at 220 rpm. Unless noted, washes of P. aeruginosa cells were performed in PBS+MC (PBS pH 7.4 plus 0.9 mM calcium, 0.9 M magnesium). Pelleted cells were resuspended by “racking” (gently dragging a tube across a plastic tube rack) or by shaking at 1200 rpm for 30 seconds (for cells in V-bottom 96-well plates). 2. Alpaca immunization Four P. aeruginosa laboratory strains (PA14 [serotype O10], PAO1 [O5], PAK [O6] and PA103 [O11]) were grown to exponential phase in liquid LB and overnight on LB agar. Cells were collected by centrifugation or scraping plates and resuspended in 20 mM HEPES, 150 mM NaCl, 10 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF). Cells were lysed by french press (>14,000 psi) and the lysate clarified by centrifugation (5000 rcf for 10 min). Membrane proteins were separated from soluble proteins by centrifugation (20,000 rcf for 30 min). Membrane proteins were enriched by centrifugation through sucrose density gradients; membrane proteins were collected from the interface of a 60% / 25% sucrose step gradient. Additionally, PA14 and PAO1 were grown as static biofilms in petri dishes in both LB and M9 minimal media at 30 ˚C for 36h, harvested by scraping, and lysed as above. The soluble proteins, enriched membrane proteins, and biofilm extracts were pooled to generate a mixed antigen preparation and stored in single-use aliquots at -80 °C. A single adult male alpaca (Vicugna pacos) was immunized with the P. aeruginosa antigen (2 mg per injection) adjuvanted with alum. Four subcutaneous immunizations were 86 55382181.3 Attorney Docket No.047162-7503WO1 (02594) administered at 3–4 week intervals. Serum was collected prior to each immunization and four days after the final immunization. Peripheral blood lymphocytes were harvested from the final bleed, and RNA was prepared from one aliquot of fresh peripheral blood lymphocytes (PBLs), then stored at -80 °C. ELISA wells were coated with the P. aeruginosa antigen preparation used for immunization (10 µg / mL), then incubated with 2–5 fold dilutions of alpaca serum (beginning at 1:100), followed by secondary incubation with anti-llama IgG-HRP conjugate. Protein preparations prepared from the different P. aeruginosa strains were prepared as described elsewhere herein, then separated by SDS-PAGE (1 µg / lane), blotted to PVDF, and incubated with alpaca pre-immunization and post-immunization serum (diluted 1:5000). 3. Construction of a VHH phage display library Three cDNA synthesis reactions were performed in parallel using Superscript III First-Strand Kit (Invitrogen), each with different primers: random hexamers, oligo dT, and alpaca gene-specific primers (Al.CH2, AlCH2.2). cDNA was amplified by PCR, using AlVHH-F1 as the forward primer and either AlVHH-shR1 or AlVHH-lhR1 as the reverse primer; these primers recognize the alpaca VHH cDNA at conserved sites within the FR1 domain and the short or long hinge domains respectively. Replicate PCRs were pooled and amplicons purified by silica column cleanup (Qiagen), then restriction-digested with NotI / AscI and the digest gel-purified. The phagemid vector pD was derived from pCANTAB (GE Healthcare) via pJSC. The cloning site of this vector is in-frame with the C-terminus of phage coat protein P3; downstream from the cloning site is an E-epitope tag, separated by an amber stop codon. The vector was prepared, digested as above, and gel purified. Vector and insert were ligated using T4 ligase (NEB), cleaned up (Geneclean Turbo column, MPBio), and transformed into electrocompetent TG1 (Agilent). An aliquot of the transformation reaction was serially- diluted to estimate a titer of 4 x 106transformants; the remaining transformants were plated on a large area of selective media, scraped, combined, aliquotted, and stored at -80 °C. 96 clones from the transformed library were randomly selected; plasmid preparation and Sanger sequencing was performed by a vendor (Beckman-Coulter). Chromatograms were manually trimmed. A multiple sequence alignment was constructed using MUSCLE and the consensus sequence was used as a reference sequence in downstream analysis. To prepare infectious phage from the library, 1 mL of frozen TG1 cells containing library phagemid transformants were diluted into 25 mL of 2YT media with carbenicillin. This culture was grown for two hours, M13KO7 added to 1e11 pfu / mL and grown for 1 hour 87 55382181.3 Attorney Docket No.047162-7503WO1 (02594) further. This culture was added to 1 L of 2YT plus carbenicillin and kanamycin and grown overnight. Cells were removed by centrifugation; ~5e9 cells were collected and phagemids isolated for sequencing; the supernatant was PEG / NaCl-precipitated as described below. Aliquots of this library were considered “passage 1”. One aliquot from passage 1, was amplified as described below to ~1 L to form passage 2. All subsequent experiments were performed using aliquots of passage 2. 4. Isolation of flagella and pili Flagella were isolated following 10 mL of exponential-phase cells were harvested by centrifugation, 3500 rpm for 10 min at 4 °C and resuspended in 100 mL of flagella buffer (50 mM sodium phosphate [pH 7], 10 mM magnesium chloride). Flagella were sheared in a Waring blender for 30 seconds, then the pulse repeated. Loss of swimming was confirmed by microscopy. Cells were removed by centrifugation at 20,000 rcf for 30 min at 4 °C. Flagella were collected from this supernatant by ultracentrifugation at ~105,000 rcf for 1 hour. Pellets were resuspended in a total volume of 3 mL Tris-NaCl (150 mM NaCl, 50 mM Tris pH 7.6). Pilin were prepared from solid media and removed by vortexing; cells were grown overnight on 2–3150 cm2plates, then collected using a cell scraper and resuspended in 10 mL total volume of TPM buffer (10 mM Tris HCl pH 7.5, 1 mM KPO4 [pH 7], 8 mM MgSO4). Cells were vortexed for 3 minutes, then cells removed by centrifugation at 20,000 rcf for 5 min at 4 °C. Supernatants were transferred to microfuge tubes, magnesium chloride added to a final concentration of 100 mM, and incubated on ice overnight. Pili were harvested by centrifugation >20,000 rcf for 15 min at 4 °C. The supernatant was resuspended in a total volume of 5 mL Tris-NaCl. Large insoluble aggregates were removed by centrifugation 13,000 rcf for 5 min at 4 °C. Protein preparations were kept on ice and quantified by SDS-PAGE and / or bicinchoninic acid (BCA) assay the same or next day, then diluted to single-use aliquots, snap frozen, and stored at -20 °C until ready for use. 5. Terminology “Selection” refers to enrichment of a distinct population of phage-displayed VHHs via multiple rounds of panning against a particular pair of antigen conditions (e.g. counter- selection and selection bacterial cells, antigen-negative and antigen-positive protein-coated wells, etc.). An observation of that population at one point in time is a “sample.” The high- titer phage population, prior to round N of panning, is the “round N input phage”; phage eluted from the wells / cells after that round are the “round N output phage.” The round N output phage are expanded in E. coli to produce the round (N+1) input phage, and so on. 88 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Unless otherwise noted, sequencing data is obtained for high-titer “input” phage populations, as sequencing library preparation is most consistent from these templates. Therefore in all figures showing sequencing data, round N phage refers to the round N input phage, i.e. the result of performing (N-1) rounds of panning. 6. Common phage display methods OmniMAX 2 E. coli were used as the host strain for all phage display experiments. OmniMAX E. coli were grown in 2YT media supplemented with tetracycline 10 µg / mL to maintain the F episome. Kanamycin 25 µg / mL was added when necessary to maintain the M13KO7 helper phage. Carbenicillin 100 µg / mL was added when necessary to maintain the phagemid. E. coli_ was grown overnight in 2YT + tetracycline, then subcultured 1 / 50–1 / 100x in the same and grown to exponential phase. Before use, E. coli were routinely tested for maintenance of the F episome and for pre-infection with phagemid or helper phage by confirming an exponential phase culture could grow in 2YT plus tetracycline and could not grow in 2YT plus carbenicillin or kanamycin. For each selection, one aliquot of library at 1e13 pfu / mL was used; library was PEG- precipitated after thawing from -80 °C. Sufficient quantity of library for a given experiment was thawed and pooled; four volumes of ice-cold PBT (PBS plus 0.9 mM calcium, 0.9 M magnesium, 0.5% w / v bovine serum albumin (BSA), 0.05% v / v Tween-20, filter sterilized) and one volume ice cold sterile PEG-NaCl solution (20% w / v PEG-8000, 2.5 M NaCl) was added to one volume library. Phage were PEG-precipitated on ice for 20 minutes, harvested by centrifugation at 20,000 rcf for 20 minutes; the phage pellet was resuspended in PBT and stored on ice. Immediately before use, phage solutions were spun as before for 5 minutes to remove insoluble material. Preparation of bait, washes, and elution are described below. After elution, phage were amplified by infecting E. coli. One volume of neutralized phage eluate was added to nine volumes (solid-phase and small-scale cell-based panning) or two volumes (high- throughput panning) of exponential-phase E. coli (OD 0.3–0.6). Infected cultures were grown for 45 minutes; helper phage M13KO7 (NEB) was added to 1010pfu / mL final concentration and cultures were grown for 1 hour. Finally, one volume cultures was added to five volumes (solid-phase and small-scale) or one volume (high-throughput) 2YT, supplemented with carbenicillin and kanamycin to the proper final concentration. Cultures were grown for at least 16 hours. After amplification, cells were removed by centrifugation at 3750 rcf for 10 minutes. The supernatant was transferred to a new tube and one volume ice cold sterile PEG-NaCl 89 55382181.3 Attorney Docket No.047162-7503WO1 (02594) solution was added to five volumes culture. Phage were PEG-precipitated on ice for 20 minutes (solid-phase and small-scale) or 1 hour (high-throughput), then harvested at 20000 rcf for 20 minutes (solid-phase and small-scale) or 5500 rcf for 1 hour (high-throughput). Phage pellets were resuspended and spun before use as described above. Phage titers were measured by preparing serial 10-fold dilutions of phage particles in PT buffer (PBS plus calcium, magnesium, and 0.05% v / v Tween-20, filter sterilized), then transferring one volume of phage to 10 volumes of exponential phase E. coli. Infected cells were incubated shaking for 15–30 minutes, then 10 µL of each dilution was spotted onto LB plus carbenicillin and LB plus kanamycin plates. Colonies were enumerated using Ilastik 1.4.0 in object density mode. The greatest dilution with more than 10 visible colonies was used to calculate the titer. To assay individual clones, the phagemid-infected E. coli culture was plated on LB agar plus carbenicillin. Individual colonies were picked to 1 mL of 2YT plus carbenicillin plus M13KO7 at 1e10 pfu / mL and grown shaking overnight. 7. Solid-phase panning Solid phase panning protocol was adapted. Briefly, for each antigen, four wells of a high-binding ELISA plate (Nunc MaxiSorp, Invitrogen) were coated with 0.5 µg of purified protein (or mock purification) diluted in sodium carbonate buffer (50 mM, pH 9.6) overnight at 4 °C. Wells were decanted and blocked for 90 minutes in blocking buffer (PBS plus 0.5% w / v BSA).100 µL of input library at 1013pfu / mL was added to each counter-selection well and incubated for 1 hour at room temperature nutating. Phage were transferred from counter- selection to selection wells and incubated for 2 hours. Phage were decanted and wells washed 10 times with PT buffer. Phage were eluted by adding 100 µL per well HCl (100 mM), incubating 5 minutes, then neutralizing with 1 / 8 volume (50 µL) of Tris 1 M, pH 11. Eluted phage were rescued and amplified as described above. 8. Cell-based panning P. aeruginosa cells were grown overnight, then subcultured 1 / 50x into 5 mL of LB and grown to mid-exponential phase (OD 0.4–0.6); subculture, washing, and blocking of selection cells was staggered one hour later than counter-selection cells. Cells were harvested by centrifugation at 3750 rcf for 5 minutes, then washed twice by resuspending in 1 mL PBS+MC and centrifugation 2700 rcf in a microcentrifuge.1e7 cells were transferred to a 2 mL microcentrifuge tube, pelleted, resuspended in 2 mL blocking buffer, and incubated rocking for 1 hour at RT. Counter-selection cells were collected by centrifugation, resuspended in 1 mL of re-precipitated, cleared library at 1e13 pfu / mL, and incubated for 1 90 55382181.3 Attorney Docket No.047162-7503WO1 (02594) hour rocking at room temperature. Counter-selection cells were pelleted and selection cells resuspended in the supernatant; selection cells were incubated with the phage library for 2 hours. Selection and counter-selection cells were pelleted, then washed four times in 1 mL PT buffer; cells were pelleted and supernatant decanted thoroughly. Phage were eluted by addition of 800 µl of 0.1 N HCl to cells and incubation for 5 min; cells were removed by centrifugation at 18,000 rcf at 4 °C for 5 minutes; the supernatant was neutralized in 100 µL 1 M Tris-HCl, pH 11. Residual phage attached to cells were eluted by addition of 640 µL / well 0.1 M triethylamine (TEA) and incubation for 5 min. Cells were removed as before and supernatant neutralized in 260 µL / well of Tris pH 6.8. The neutralized supernatants from the acid elution and the base elution steps were combined to form the final eluate.450 µL, approximately 1 / 4 of this volume, was expanded as above to generate the input library for subsequent rounds. 9. High-throughput cell-based panning P. aeruginosa cells were arranged and stored in glycerol in 96-well format; 96-well microplates containing 150 µl / well of sterile LB agar were prepared. Two days prior to the experiment, 10 µL / well of sterile LB broth was added to each well and a multichannel pipette was used to inoculate this semi-solid “master plate” from the arrayed glycerol stocks. For bacteria panned after growth on solid media, a flame-sterilized loop was used to densely streak from this solid master plate 1 / 8th of a 100 mm petri dish containing LB agar; these plates were incubated overnight. For bacteria panned in liquid, a multichannel pipette was used to inoculate duplicate liquid cultures of 1.2 mL per well from the solid media microplate. These cultures were incubated overnight. For bacteria panned in exponential phase, the stationary phase cultures were diluted 1 / 50 in appropriate media and incubated for 3 hours. Solid-media cultures were scraped into 1.2 mL / well of LB; solid-media and stationary-phase cultures were transferred to a single microplate along with exponential- phase cultures. Duplicate plates were combined and optical density was measured but not standardized. Subculture, wash, and blocking of the selection cells was staggered by 2 hours after the counter-selection cells. Cells were harvested by centrifugation at 3750 rcf for 10 minutes, washed twice with 1 mL / well PBT, and resuspended by shaking 750 rpm x 5 min in 100 µl / well of PBT.250 µL of re-precipitated, cleared library at 1e13 pfu / mL was added to counter-selection cells and incubated at RT shaking 750 rpm for 1 hour. Counter-selection cells were removed by centrifugation 3750 rcf for 15 minutes at RT; the was supernatant transferred to the selection cells and resuspended by gently pipetting up and down. Selection cells were incubated with phage for 1 hour shaking, then 1 hour nutating. Selection cells were 91 55382181.3 Attorney Docket No.047162-7503WO1 (02594) pelleted, supernatant decanted, then selection and counter-selection cells were washed three times as above. Phage were eluted from selection and counter-selection cells by both acid and base above, with the following modifications: add 200 µL / well 0.1 N HCl; shake 750 rpm for 10 minutes; add 25 µL 1 M Tris-HCl, pH 11 to neutralize; spin 3750 rpm for 10 minutes; the supernatant was passed through a 0.22 µm PVDF filter (Millipore MSGVS2210). This filter was found to be particularly effective at removing residual bacteria while allowing phage to pass through without clogging. The pellet was eluted again with base: add 200 µl / well of 0.1 M TEA; incubate shaking 750 rpm for 10 minutes; add 80 µL / well Tris pH 6.8 to neutralize; spin 3750 rpm for 10 minutes; pass supernatant thought a 0.22 µm filter. Filtered acid- and base-eluted eluates were combined, titered, and amplified. Phage were expanded as described above; 200 µl / well of eluate phage was added to 400 µl / well of exponential-phase E. coli in 96-well format, incubated, M13KO7 was added to a final concentration of 1e11 pfu / mL, incubated, and 2YT plus kanamycin and carbenicillin were added to a final volume of 1.2 mL per well. This culture was grown overnight. Cells were removed by centrifugation 6000 rcf for 10 minutes and the supernatant transferred to a clean microplate on ice. PEG-precipitation was performed in this microplate; the PEG- precipitated phage were resuspended by shaking at 750 rpm for 10 minutes, then stored on ice overnight until the next round of panning was to be conducted. 10. Extended cell-based panning Subsequent rounds of phage display panning were performed as above, except that three separate sets of counter-selection cells were prepared identically. Phage were incubated with the first set of counter-selection cells for 30 minutes, then cells removed and the supernatant transferred to the second set of counter-selection cells. This process was repeated once more for a total of three counter-selection phases. 11. Library preparation for high-throughput sequencing For initial high-throughput sequencing of the input library, phagemid DNA was purified, digested using NotI / AscI, and gel purified. The sequencing library was prepared by end-repair and blunt-end ligation of sequencing adapters using a commercial kit (Illumina Nextera). Paired-end 300 bp sequencing was performed on an Illumina MiSeq. Subsequent HTS libraries were prepared by polymerase chain reaction (PCR).2 µL of amplified phage particles at ~1e13 pfu / mL, or 10 µL of phage eluate were used as template for an initial PCR (Phusion, NEB) with primers CDR123-seq-F / CDR123-seq-R which added Illumina R1 and R2 primer binding sites. Silica column cleanup was performed and an additional PCR added combinatorial dual indexes. Yield and size of all products was verified 92 55382181.3 Attorney Docket No.047162-7503WO1 (02594) by gel electrophoresis and individual reactions repeated as necessary. Amplicons were pooled using Just-a-Plate 96 PCR Normalization (Charm Biotech). The pooled library was column- and then gel purified. Library purity and concentration was verified by automated electrophoresis (e.g. Fragment Analyzer, Agilent) and qPCR. Paired-end 150 bp sequencing was performed in an Illumina NovaSeq S4 to a target depth of 100,000 reads per round per selection. 12. High-throughput sequencing data analysis Primer sequences were removed with Cutadapt, and reads lacking a primer sequence were discarded. Reads were deduplicated and denoised using DADA2, with each sample processed independently. Distinct read sequences were aligned to the reference sequence described above using Bowtie 2. For paired-end 150 nt sequencing experiments, the reads were not expected to overlap in all cases, as the full-length sequenced amplicon was greater than 300 nt; to ensure that a given read pair captured the full length of the variable portion of the VHH gene, the forward read was required to contain the entirety of CDR1 and CDR2, plus at least 3 nt, while the reverse read was required to contain the entirety of CDR3 plus at least 3 nt. Reads which did not meet this criteria were discarded. Overlapping read pairs were stitched together, with any disagreements being resolved in favor of the forward read. For read pairs which passed the filter but did not overlap, the gap between the two reads was filled with corresponding bases from the reference sequence. The merged read pairs were translated to amino acid sequences (amber stop codons UAG were translated as Gln). Amino acid sequences were grouped into zero edit-distance clusters (i.e. two or more reads with 100% identity and overlap beyond a threshold length were grouped together) using the linclust routine from the MMseqs2 package. Amino acid sequences were then aligned to a reference sequence in order to identify the boundaries of CDR1–3. Reads were filtered according to minimum lengths for CDR1 (≥ 4 aa), CDR2 (≥ 6 aa), CDR3 (≥ 3 aa), and FR4 (≥ 2 aa) and the full-length amino acid sequences (≥ 69 aa). Two feature tables (contingency tables of sample vs. feature) were constructed in the biom format, one where the columns (features) were distinct amino acid sequences (e.g. all nucleic acid sequences with the same translation were summed) and one where the columns were distinct CDR3 sequences. Feature tables from multiple sequencing runs, if applicable, were summed. Relative abundance was calculated by dividing counts by the sum for each sample (row). Enrichment was calculated for each feature for each selection by dividing the ending abundance by the starting abundance. The starting abundance was defined as either: the relative abundance of that feature in the input library or, if undefined, the relative abundance of that feature in the first 93 55382181.3 Attorney Docket No.047162-7503WO1 (02594) round of selection where the feature was observed. The ending abundance was the relative abundance of that feature in the last round of selection. 13. Diversity analysis The number of distinct full-length VHH amino acid sequences (encompassing the region beginning with CDR1 and ending after CDR3) in the input library was estimated using the breakaway method from the breakaway R package. 14. VHH selection metrics Let ^^^,^,^be the relative abundance of VHH ^^ in selection ^^ at round ^^. Define ^^^,^ൌ ^^^,^,ோ / ^^^,^,^as the enrichment of VHH ^^ in selection ^^ during a selection campaign ^^ rounds. The enrichment probability was defined as ^^൫^^^,^ ^ ^^|^^^,^,^ ൌ ^^൯, as the probabilityof observing an enrichment ^^, given a starting abundance of ^^, due only to experimental noise unrelated to the selective pressures of phage display panning. To estimate this quantity, we repeatedly re-sequenced two passages of the input library. This sample captures both variation due to library preparation and due to changes in phage proportion due to expansionin E. coli, precipitation of the phage, etc. ^^ ൌ 12 samples of the library were obtained andcalculated a table of enrichments and initial abundances: ^^^^,^ ൌ ^^^^,^ / ^^^ଶ,^;^^^^,^,^ ൌ^^^^,^ ,∀^^1,^^2 ∈ ^1...^^^ ൈ ^1...^^^, ^^ ∈ ^^, ^^ ∈ ^0...^^ଶ^. For all further calculations, we tookthe logarithm of both abundance and enrichment. It was visually confirmed this joint distribution was unimodal. A Gaussian kernel density estimate was performed on this table toestimate a joint probability mass function ^^^^^, ^^^ ൌ ^^൫^^^^,^ ൌ ^^ ∩ ^^^^,^,^ ൌ ^^൯. This functionwas evaluated on a 2D grid of abundances and over the first axisto calculate the marginal probability of abundance (e.g. ^^൫^^^^,^,^ ൌ ^^൯ ൌ ∑^ ^^ ^^^, ^^^). Thediscretized joint was divided PMF by the marginal distribution of abundance to create a conditional PMF. The cumulative sum of these quantities was taken over the first axis to calculate a conditional cumulative distribution function. Then a 2D spline to this surface was fitted in order to estimate the enrichment probabilities for unknown values. To calculate the binary enrichment probability, ^^^^^ା^ ^ ^^^ି^, simulations were used.For a given antigen, assume there are ^^ antigen-positive selections; and a particular VHH is significantly enriched in ^^^ାof those ^^ selections. Among ^^ random antigen-negative selections, let ^^^ିbe the number of antigen-negative selections where the VHH is significantly enriched. ^^ି^ is a random variable with a support of ^0... ^^^. This probabilitywas estimated by repeatedly choosing ^^ antigen-negative selections, counting ^^^^ିfor those 94 55382181.3 Attorney Docket No.047162-7503WO1 (02594) selections, then counting the fraction of these simulations where ^^ା^ ^ ^^^^ି. Only a finite number of simulations were performed, so if ^^ା^ ^ ^^^^ିin all simulations, we say^^^^^ା^ ^ ^^ି^ ^ ^ 1 െ ^1 / ^^^, where ^^ was the number of simulations.To calculate the normalized rank: Let ^^^,^be the enrichment of enrichment of VHH ^^in selection ^^; let ^^^,^^^ ^ ^^^,^^^ ^ ^^^,^^^ be the ranks of VHHs in selection ^^ where ^^ VHHswere observed. The normalized rank of VHH ^^ in selection ^^ is the rank divided by thenumber of VHHs in a sample, i.e. NR^^^, ^^^ ൌ ^^^,^^^ / ^^. The normalized rank sum for VHH ^^ ina group of selections ^^ ൌ ^^^^, ^^^, … , ^^ே^, is the sum of the normalized ranks, NR^^^, ^^^ ൌ∑^∈ௌ NR ^^^, ^^^. 15. Relative abundances at the final round of selection were normalized for sequencing depth with the scran package. truncated single value decomposition (TSVD) was performed using the scikit-learn package with the top 100 components. For CCA, ordination was performed on the log-transformed enrichment matrix using the scikit-bio package. 16. Machine learning and antigen predictions Classifiers were gradient-boosted trees trained using XGBoost via the scikit-learnpackage. Models were evaluated with repeated stratified ^^-fold cross-validation, with ^^ ൌ 5,and ^^ ൌ 15 repeats and scored by mean AUROC over all test folds. The effect of learningrate ^^ was evaluated for several antigens and optimal values (the fastest learning rate that still achieved maximum mean AUROC) found to be ~0.01–0.05. For each antigen, models were trained using three datasets: enrichment matrix only, enrichment plus final round abundance, or enrichment plus abundance for all rounds; the dataset with highest performance was chosen per-antigen. Additional model hyperparameters (e.g. min_child_weight, subsample, colsample_bytree, gamma, reg_alpha) were chosen by Bayesian optimization using the BayesSearchCV class from the scikit-optimize package. Using this final set of hyperparameters, models were trained and evaluated using the cross-validation procedure described above; +ROC for each training fold, plus a mean over all folds, are shown in FIGs. 5D-5G. ^^-value for mean accuracy determined by one-sided Student’s ^^-test. ^^-value for mean AUROC > 0.5 was determined by Mann-Whitney U test. 17. Expression of recombinant VHHs in bacteria Phagemid dsDNA was purified from overnight cultures of phagemid-infected E. coli, digested with NotI / AscI, and the gel-purified insert was ligated with gel-purified, NotI / AscI- digested pJEG3, then transformed into DH5α. Clones were verified by Sanger sequencing, 95 55382181.3 Attorney Docket No.047162-7503WO1 (02594) then transformed into BL21(DE3) for expression. BL21(DE3) cells were grown overnight in 2YT plus carbenicillin plus 2% w / v glucose, subcultured 1:20 in 100 mL of the same, then media removed and cells transferred to 200 mL 2YT plus carbenicillin and 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). Cells were grown 19 hours shaking at 27 °C. Cells were harvested at 10,000 rpm in JA-10 rotor (17,650 rcf) and resuspended in a lysis buffer (50 mM sodium phosphate [pH 8.0], 300 mM NaCl, 10 mM imidazole, 1x cOmplete™ (a type of protease inhibitor cocktail), EDTA-free Protease Inhibitor Cocktail [Sigma], 1 mM PMSF). Cells were spheroplasted for 30 minutes at RT by addition of lysozyme to ~1 mg / mL and DNaseI to 5 µg / mL, then lysed by three freeze-thaw cycles. Lysates were cleared by centrifugation 20,000 rcf at 4 °C for 20 minutes. IMAC was performed; Ni-NTA resin (2.5–5 mg protein / 1 mL slurry) were diluted 1 / 5x in sample and lysis buffer. Slurry was packed on a gravity filtration column and washed with eight bed volumes of wash buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 20 mM imidazole) and 1 / 2 bed volume of 100 mM imidazole. Protein was eluted with 2 bed volumes of 250 mM imidazole, and buffer exchanged to PBS+MC using PD-10 desalting columns (Cytiva). Samples were flash-frozen and stored at -20 °C. Yield was measured by BCA assay and purify monitored by SDS- PAGE. 18. Expression and purification of recombinant VHHs in human cells Nucleic acid sequences were synthesized as gene fragments (Twist Biosciences), reconstituted, and amplified by PCR. Unpurified amplicons were cloned using NEBuilder HiFi DNA Assembly system into the pCER243 mammalian expression vector, which had previously been linearized with XhoI and gel purified. pCER243 is modified from pD2610- v12 (ATUM Bio), adding an upstream H7 leader sequence and downstream an in-frame (GGGGS)3 linker (SEQ ID NO: 369) and human IgG1 Fc with the N297A mutation. Assembly products were transformed into 5-alpha competent E. coli (NEB), plated on solid selective media, scraped, and grown overnight in liquid; plasmids were purified. For each VHH clone, presence of the insert was verified by NotI / XbaI digestion. rVHH-Fcs were expressed by transient transfection of the pCER243-rVHH plasmid using the Expi293F Transfection Kit (Gibco), following the manufacturer’s instructions. Briefly, Expi293F cells were grown in Expi293 media in shaking at 125 rpm in non-baffled, vent-cap polystyrene Erlenmeyer flasks at 37°C, 8% CO2to a density of 3—5e6 cells / mL. Cells were seeded to 2e6 cells / mL and grown shaking overnight. In a 2 mL, V-bottom 96-well plate, 0.5 µg plasmid DNA was diluted in Opti-MEM media (Gibco) to 25 µL final volume. A master mix of 1.35 µl / well Expifectamine and 23.65 µl / well Opti-MEM media was prepared, then 25 96 55382181.3 Attorney Docket No.047162-7503WO1 (02594) µL / well of this mixture was added to each well and incubated at room temperature for 20 minutes to form DNA-Expifectamine complexes. Expi293F cells were diluted to 2e6 cells / mL and 425 µl cells were added dropwise to this mixture. Cells were grown shaking at 1200 rpm in conditions described above. After at least 20 hours of growth, 2.5 µL of transfection enhancer 1 and 25 µL of transfection enhancer 2 were added to each well, and cells were returned to grow for 4 days further (5 days total). rVHHs were purified from clarified supernatants using protein A magnetic beads. Cultures were clarified by centrifugation at 600 rcf for 10 min at room temperature.12.5 µL Protein A magnetic beads (Lytic Solutions) were added to supernatants and supernatants shaken at 750 rpm for 2 hours at 4 °C. Beads were harvested, washed three times in PBS, then rVHHs eluted in 100 µL glycine (100 mM, pH 3.0-3.2). Eluates were neutralized with 10 µL tris (1 M, pH 8) and 100 µL PBS. Concentration was measured using the Pierce BCA assay kit (Thermo Scientific). rVHHs with yields >100 ng / µL in final eluate were tested for activity. 19. Standard ELISAs MaxiSorp plates were coated with antigen and blocked as described above for solid- phase phage display. Each condition was performed in triplicate. Individual phage clones were grown as above; cells removed by centrifugation 3750 rcf for 10 minutes, then supernatants diluted 1 / 3x in PBT. Rabbit antisera was used as a positive control; YU573 is rabbit polyclonal antisera raised against PAK flagella; YU586 is polyclonal antisera raised against PAK pilin. Antisera was diluted 1 / 10,000 in PBT.100 µL / well of diluted phage or antisera was applied to coated wells and incubated 1 hour, nutating. Liquid was decanted and wells washed 4 times with 100 µL / well PT buffer. Secondary antibodies (Goat anti- rabbit::HRP [Bio-Rad Cat #170-6515, RRID:AB_11125142], Mouse anti-M13::HRP [Sino Biological Cat #11973-MM05T, RRID:AB_2857926]) were diluted 1 / 3000x in PBT; 100 µl / well was applied and incubated 45 minutes at RT. Wells were washed 5 times, then plates blotted dry on paper towel. +TMB, 100 µL / well was added and incubated at RT until the control wells containing no primary antibody began to turn blue.100 µL / well 1 N H2SO4 was used to quench the reaction, and absorbance read at 450 nm. 20. Cell-based ELISAs Plates were coated with cells and fixed with methanol following the method with modifications. Overnight cultures of P. aeruginosa were subcultured 1 / 50x and grown to mid-exponential phase, harvested by centrifugation 3750 rcf x 10 minutes, resuspended and washed twice in PBS+MC. Cells were diluted to OD 0.3 and 100 µL / well (~3e7) were added 97 55382181.3 Attorney Docket No.047162-7503WO1 (02594) to a microplate. Cells were incubated at 37 °C for 2 hours.100 µL / well of ice cold methanol was added and cells were incubated rocking at room temperature for 10 minutes. Methanol was removed by gentle aspiration from the wall of the well, and plates were dried 10 minutes uncovered in the fume hood. PEG-precipitated phage clones at ~1e13 pfu / mL were diluted 1 / 100 in PBT; antisera were diluted 1 / 20,000x in PBT; 100 µL / well of primary antibody was added and incubated 2 hours with fixed cells. Wells were washed five times with PT, then stained with secondary antibody and developed as above. Cell-based ELISAs with bacterial rVHHs were performed as above, except purified rVHHs at 2 mg / mL were diluted 1 / 100 and used as primary antibodies. For brVHHs rabbit anti-E-tag (Novus Biologicals Cat# NB600-527, RRID:AB_10001463), 1 mg / mL secondary was used at 1 / 500x dilution as the secondary antibody; cells were incubated 30 minutes and washed three times. Goat anti-rabbit::HRP (Bio-Rad Cat #170-6515, RRID:AB_11125142) was used as the tertiary antibody for detection. 21. Live cell-based ELISAs For cell-based ELISAs performed on live cells, overnight cultures were subcultured 1 / 50x and grown to mid-exponential phase, then harvested by centrifugation 3750 rcf x 5 min. Cells were washed once in PBS, then ~1e9 cells were resuspended in PBS + 0.5% BSA + 0.05% Tween-20, added to a microcentrifuge tube, and incubated rocking for 1 hour. Cells were pelleted, then resuspended in 1 mL of PBS + 0.5% BSA + primary antibody (either antiserum at 1 / 100x dilution or brVHH @ ~40 µg / mL final concentration) + SYTO9 at 1 / 250x and incubated rocking for 1 hour protected from light. Cells were pelleted and washed once; brVHH samples were resuspended in secondary antibody rabbit anti-E-tag (Novus Biologicals Cat# NB600-527, RRID:AB_10001463), 1 mg / mL at 1 / 500x dilution in 1 mL PBS + 0.5% BSA + 0.05% Tween-20; antisera samples were resuspended in buffer; samples were incubated 1 hour, then pelleted and washed once. Cells were resuspended in Goat anti- rabbit::HRP (Bio-Rad Cat #170-6515, RRID:AB_11125142) tertiary antibody at 1 / 1000x and incubated 1 hour, then pelleted and washed once. Cells were resuspended in 100 µL of PBS, then diluted 1 / 2x, 1 / 4x, or 1 / 8x; each dilution of cells was added to the plate. OD600, SYTO9 fluorescence, and A450 were measured. +TMB and H2SO4were added as with standard ELISA. A450 signal saturated detection in some wells, so samples were diluted 1 / 2x in PBS and read. 22. Bacterial dot blots P. aeruginosa cells in stationary phase were harvested, washed once in PBS, and diluted to 2e+10 cells / mL (nominal OD = 20). Serial 5-fold dilutions were performed in PBS. 98 55382181.3 Attorney Docket No.047162-7503WO1 (02594) 3 µL of cells were spotted at each dilution on a 2.5 cm x 2.5 cm nitrocellulose membrane. Cells were allowed to dry 30 minutes, then stained 5 minutes in 0.1% w / v Ponceau S stain in 1% glacial acetic acid and destained 2 minutes in water. Blots were blocked and fully destained in 1x TBST (Tris HCl pH 8, 100 mM; NaCl, 1.5 M; Tween-20, 0.05% v / v) plus 5% non-fat milk. Blots were washed once with TBST and probed with primary antibody.3 µg of purified rVHH was diluted in 100 µL of TBST, spotted into a clean 6-well plate, and the membrane placed face down in this puddle. Plates were sealed with tape and incubated overnight at 4 °C. Blots were washed three times for 5 minutes with 2 mL TBST. Secondary antibodies (Goat anti-Human IgG::HRP, Secondary Antibody, Invitrogen Cat# SA5-10283, RRID:AB_2868331 @ 1 mg / mL) were diluted 1 / 5000x in 500 µL TBST and applied to blots; blots were incubated 30 minutes at RT and washed three times. Enhanced chemiluminescence (ECL) substrate was prepared (100 mM Tris pH 8.5, 1.25 mM luminol, 225 µM coumaric acid, 0.00001% H2O2); 1 mL ECL substrate was added to each blot, then blots were imaged for 3 minutes using a Chemidoc MP (Bio-Rad). 23. Live cell dot blots Stationary phase cells were washed once in PBS and diluted to 1.5e8 cells / mL, then 7.5e6 cells (50 µL) per well were added to a 2 mL V-bottom 96-well plate. SYTO9 was diluted to a final concentration of 1 / 250x and added along with 300 ng / well of rVHH to cells for in a total volume of 100 µl / well. Pre-cleared polyclonal antisera YU573 and YU586 were used at a final concentration of 1 / 100x. Cells were incubated, protected from light, for 40 minutes, then washed twice by addition of 500 µL / well PBS, centrifugation 4000 rcf for 10 min @ 10 °C, and decanting. Cells were resuspended in 50 µL PBS by pipetting, then 5 µL / well was spotted onto a nitrocellulose membrane and allowed to dry for 30 min protected from light. The membrane was blocked in 5% nonfat milk + TBST at 4°C overnight, then rinsed and stained with secondary as above. Before addition of the +ECL substrate, blot was exposed for fluorescence in the AlexaFluor 488 channel (Ex = 460−490 nm, Em = 518–546 nm, 0.05 sec). Blot was developed and imaged for ECL (10 minute exposure). 24. Bacterial flow cytometry All solutions used for FCM were passed through a 0.22 µm filter on the day of the experiment. Bacterial cells in stationary phase (16 hours of growth) were harvested in round- bottom culture flasks by centrifugation 3500 rcf x 10 min at room temperature. Supernatants were decanted, the pellet disrupted by dragging the tube across a rack (“racking”), cells resuspended in 1 mL FACS buffer (PBS supplemented with 0.05% v / v Tween-20 and 0.5% 99 55382181.3 Attorney Docket No.047162-7503WO1 (02594) w / v BSA, filter sterilized), and suspension transferred to 1.7 mL microcentrifuge tubes. Cells were centrifuged at 3500 rcf, room temperature for 5 minutes, decanted, pellet disrupted by racking, then resuspended in 1 mL FACS buffer by flicking and inverting for 1–5 minutes. Gentle handling (disrupting pellet by racking, resuspension by flicking and inverting rather than vortexing, low speed centrifugation) was critical to achieving reproducible staining of P. aeruginosa. Cells were resuspended to an OD of 0.2 and 50 µL of cells (1e7 cells) per condition added to a 2 mL 96-well V-bottom plate (Corning). The primary antibody (or VHH) was diluted in FACS buffer to 2x final concentration, then 50 µL primary antibody added to cells. Cells were incubated with primary antibody at room temperature on a microplate shaker (750 rpm) for 30 minutes. Soluble IgG1-Fc served as a negative control. To wash, 500 µL per well of FACS buffer was added; bacteria were collected by centrifugation at 4000 rcf, 10 °C for 10 minutes and buffer was decanted. The wash was repeated once. A mixture of secondary antibody at appropriate concentration and SYTO9 nuclear stain at 1 / 500x dilution was prepared in FACS buffer; 50 µL per well of this mixture was added to cells and mixed by gently pipetting up and down 10 times with a multichannel pipette. Cells were incubated with the secondary antibody as above, for 15 minutes. The cells were washed once as above. Cells were fixed in 1% paraformaldehyde (PFA) to prevent efflux of the nuclear stain SYTO9. Briefly, paraformaldehyde (Electron Microscopy Solutions) 16% w / v, was diluted to 4% in filter-sterilized PBS and stored at -20 °C with minimal headroom (to prevent oxidation). Single-use aliquots of 4% w / v PFA were thawed and diluted to 1% final concentration in sterile PBS. Cells were incubated with 1% PFA at room temperature as above for 20 minutes. Excess aldehydes were quenched by addition of 0.75 M Tris pH 8 and cells incubated for 10 minutes further. Cells were washed by addition of 500 µL FACS buffer, centrifuged, and decanted as above. Cells were resuspended in 250 µL FACS buffer (5x dilution compared to their original density), then 200 µL cells were passed through a 40 µm filter mesh. Cells were analyzed on a CytoFLEX LX flow cytometer (Beckman-Coulter) with the following settings: flow rate, 15 µL / min; event rate-setting, high; threshold, side- scatter height (SSC-H) > 10,000; voltages, FSC = 165, SSC = 400, B525-FITC = 150, Y585- PE = 500–1000. Data was collected for at least 20 seconds or until >50,000 events were recorded in the gate identifying bacteria. Data were gated to identify single bacterial cells (see FIG.24A-24E). To distinguish intact bacteria from similarly-sized debris, events with SYTO9 fluorescence greater than that of unstained cells were marked as bacteria. Analysis was performed using FlowJo. 100 55382181.3 Attorney Docket No.047162-7503WO1 (02594) For each rVHH, an “rVHH+” gate was drawn starting at the 99th percentile of fluorescence for the antigen-negative cells stained with that rVHH; the fraction of antigen- positive cells that were rVHH-positive were calculated, as well as the mean fluorescence intensity for both antigen-negative and antigen-positive cells. An rVHH was considered successful if the %rVHH+ for antigen-positive cells was at least three times higher than the %rVHH+ for antigen-negative cells. This threshold was established by performing the same gating procedure on the isotype control and observing that the %rVHH+ cells for the antigen- positive population was never greater than three times that for the antigen-negative cells. Table 1: Bacterial strains used in this study Strain no. Background Genotype Notes P. aeruginosa 220 PAO1 wild-type 1468, PAO1 Δ(mexAB-oprM) nfxB Δ(mexCD-oprJ) deletion of five efflux systems and PAO397 Δ(mexJKL) Δ(mexXY) OpmH+ outer membrane porins; “Δefflux” ΔopmH362 Δ(mexEF-oprN) 1469 PAO397 attB::(pBAD-mexAB-oprM) efflux mutant with mexAB oprM expressed in trans from chromosome 1470 PAO397 attB::(pBAD-mexCD-oprJ) efflux mutant with mexCD oprJ expressed in trans from chromosome 1471 PAO397 attB::(pBAD-mexEF-oprN) efflux mutant with mexEF oprN expressed in trans from chromosome 1472 PAO397 attB::(pBAD-mexJK-oprM) efflux mutant with mexJK oprM expressed in trans from chromosome 1473 PAO397 attB::(pBAD-mexXY-oprM) efflux mutant with mexXY oprM expressed in trans from chromosome 1469 PAO397 mpMQ72::(pBAD-mexAB-oprM) efflux mutant with mexAB oprM expressed in trans from high-copy plasmid 1470 PAO397 mpMQ72::(pBAD-mexCD-oprJ) efflux mutant with mexCD oprJ expressed in trans from high-copy plasmid 1471 PAO397 mpMQ72::(pBAD-mexEF-oprN) efflux mutant with mexEF oprN expressed in trans from high-copy plasmid 1472 PAO397 mpMQ72::(pBAD-mexJK-oprM) efflux mutant with mexJK oprM expressed in trans from high-copy plasmid 1473 PAO397 mpMQ72::(pBAD-mexXY-oprM) efflux mutant with mexXY oprM expressed in trans from high-copy plasmid 101 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Strain no. Background Genotype Notes 517 PAK wild-type 822 PAK ΔflhA does not produce flagellum 388 PAK ΔfliC produces flagellar hook-basal body but not filament 1330 PAK ΔfliC ΔfleN produces multiple flagellar hook- basal body assemblies but no filaments 1299 PAK ΔfleN produces multiple flagella PAK ΔpilA does not produce the type IV pilus 209 PA103 wild-type 430 PA14 wild-type E. coli BL21(DE3) OmniMAX™ F´ {proAB lacIqlacZΔM15 Tn10(TetR) OmniMAX™ 2 T1R 2 T1RΔ(ccdAB)} mcrA Δ(mrr hsdRMS- mcrBC) Φ 80(lacZ)ΔM15 Δ(lacZYA- argF)U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD DH5α Used for subcloning Table 2: Plasmids used in this study Plasmid name Description pD phage display vector, derived from pCANTAB5e (GE Healthcare) pJEG3 E. coli expression vector; pET32b NotI / AscI Thrombin Enterokinase Trx E-tag 6xHis S-tag pCER243 mammalian expression vector; pD2610-v12 (ATUM Bio), H7 leader sequence, XhoI site, (GGGGS)3human IgG1 Fc (N297A) Table 3: Primers used in this study Name Description Sequence Al.CHcDNA synthesisATGGAGAGGACGTCCTTGGGT (SEQ ID NO: 355)2 AlCH2cDNA synthesisTTCGGGGGGAAGAYRAAGAC (SEQ ID NO: 356).2 AlVHAlpaca VHH, forwardCTTGCGGCCGCTCAGKTGCAGCTCGTGGAGWCNGGNH-F1 GG (SEQ ID NO: 357) AlVH Alpaca VHH, reverse, GATCGGCGCGCCGAGGGGTCTTCGCTGTGGTGCG H- short-hinge (SEQ ID NO: 358) shR1 AlVH Alpaca VHH, reverse, GATCGGCGCGCCGGTTGTGGTTTTGGTGTCTTGGG H-lhR1 long-hinge (SEQ ID NO: 359) pD-seq Sanger sequencing of TCCGGCTCGTATGTTGTGTGGAAT (SEQ ID NO: 360) phage clones CDR12 HTS library preparation; tcgtcggcagcgtcagatgtgtataagagacagTCCTGTGCAGCCTC 3-seq-F amplifies CDR1—3; adds (SEQ ID NO: 361) Illumina R1 sequencing 102 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Name Description Sequence primer binding site CDR12 HTS library preparation; gtctcgtgggctcggagatgtgtataagagacagACCTGGGTCCCCTG 3-seq- amplifies CDR1—3; adds (SEQ ID NO: 362) R Illumina R2 sequencing primer binding site i5-seq- HTS library preparation; AATGATACGGCGACCACCGAGATCTACACnnnnnnnntcgt F adds i5 index sequence cggcagcgtc (SEQ ID NO: 363) and Illumina P5 flow cell adapter i7-seq- HTS library preparation; CAAGCAGAAGACGGCATACGAGATnnnnnnnngtctcgtgggc R adds i7 index sequence tcgg (SEQ ID NO: 364) and Illumina P7 flow cell adapter rVHH- resynthesized VHH CTGTTTAGAGGCGTTCAGTCTCAGGTGCAGCTGGTGG F fragment amplification AGTCTGGCGGAGGCCTGGTGC (SEQ ID NO: 365) for cloning into pCER243 rVHH- resynthesized VHH TCCACCAGAGCCACCTCCGCCGGAGGAG (SEQ ID NO: R fragment amplification 366) for cloning into pCER243 pD- cloning from pD into ctgtttagaggcgttcagtCTCAGTTGCAGCTCGTGGAGTCG (SEQ pCER- pCER243 ID NO: 367) F pD- cloning from pD into tccaccagagccacctccgcCaGAGGAGACGGTGACCTGGGTCC pCER- pCER243 (SEQ I NO: 368) R Table 4: table of strains / conditions for solid-phase protein panning. CS, counter-selection; S, selection selection ID antigen CS cells S cells 1 flagellum PAK ∆fliC PAK WT 2 flagellum PAO1 ∆fliC tetR PAO1 WT 3 pilus PA103 ∆pilA PA103 WT 4 pilus PAK ∆pilA PAK WT Table 5: table of strains / conditions for small-scale cell-based panning. CS, counter-selection; S, selection selection ID antigen CS cells S cells 1 flagellum PAK ∆fliC PAK WT 2 flagellum PAO1 ∆fliC tetR PAO1 WT 3 pilus PA103 ∆pilA PA103 WT 103 55382181.3 Attorney Docket No.047162-7503WO1 (02594) selection ID antigen CS cells S cells 4 pilus PAK ∆pilA PAK WT 5 Pel / Psl PAO1 ∆pel ∆psl PAO1 WT 6 Efflux pumps PAO1 MB5919 ∆efflux PAO1 WT Table 6: Strains / conditions for large-scale panning. CS, counter-selection; S, selection. sel. ID antigen CS cells S cells 1.A1 pleiotropic PA14 ∆lasR (stationary) PA14 WT (stationary) 1.A2 pleiotropic PA14 WT (stationary) PA14 ∆lasR (stationary) 1.A3 pleiotropic PA14 rhlR::Tn PA14 WT (stationary) (stationary) 1.A4 pleiotropic PA14 WT (stationary) PA14 rhlR::Tn (stationary) 1.A5 pleiotropic PA14 qscR::Tn PA14 WT (stationary) (stationary) 1.A6 pleiotropic PA14 WT (stationary) PA14 qscR::Tn (stationary) 1.A7 T2SS secretin PA14 xcpQ::Tn PA14 WT (stationary) + products (stationary) 1.A8 T2SS secretin PA14 xcpQ::Tn PA14 WT (stationary) + products (stationary) 1.A9 T2SS secretin PA14 xcpQ::Tn PA14 xcpR::Tn (stationary) (stationary) 1.A10 T2SS secretin PA14 xcpQ::Tn PA14 xcpR::Tn (stationary) (stationary) 1.A11 pleiotropic PA14 pvdS::Tn PA14 WT (stationary) (stationary) 1.A12 pyoverdine PA14 pvdA::Tn PA14 WT (stationary) (stationary) 1.B1 pleiotropic SA113 (scrape) PA14 ladS#PA14_19340::Tn (scrape) 1.B2 Pa SA113 (scrape) PAK WT (scrape) 104 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 1.B3 Pa SA113 (scrape) PAO1 WT (scrape) 1.B4 Pa SA113 (scrape) PA103 WT (scrape) 1.B5 Pa SA113 (scrape) PA14 WT (scrape) 1.B6 Pa SA113 (scrape) PA14 WT (scrape) 1.B7 Pa SA113 (scrape) PA14 WT (scrape) 1.B8 Pel PA14 pelA::Tn (scrape) PA14 WT (scrape) 1.B9 CdrB PA14 PA14 WT (scrape) cdrB#PA14_61190::Tn (scrape) 1.B10 CdrA PA14 PA14 WT (scrape) cdrA#PA14_61200::Tn (scrape) 1.B11 PA14 PA14 WT (scrape) wspA#PA14_08450::Tn (scrape) 1.B12 PA14 PA14 WT (scrape) wspE#PA14_16470::Tn (scrape) 1.C1 alginate PA14 algU::Tn (scrape) PA14 WT (scrape) 1.C2 mucoid PA14 WT (scrape) PA14 mucB::Tn (scrape) 1.C3 mucoid PA14 WT (scrape) PA14 mucB::Tn (scrape) 1.C4 alginate PA14 WT (scrape) PA14 dsbM#PA14_00700::Tn (scrape) 1.C5 alginate PA14 WT (scrape) PA14 mucD::Tn (scrape) 1.C6 biofilm PA14 WT (scrape) PA14 bfiR#PA14_09690::Tn (scrape) 1.C7 SCV PA14 WT (scrape) PA14 yfiR#PA14_49880::Tn (scrape) 105 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 1.C8 SCV PA103 ∆fimX#PA4959 PA103 ∆fimX (scrape) yfiR#PA1121::Tn.2(Tc) (scrape) 1.C9 SCV PA103 ∆fimX#PA4959 PA103 ∆fimX (scrape) PA0171::Tn.12(Tc) (scrape) 1.C10 MexAB- PA14 oprM::Tn (scrape) PA14 OprM rocA2#PA14_24710::Tn (scrape) 1.C11 Pel PAO1 ∆pelA (scrape) PAO1 WT (scrape) 1.C12 Psl PAO1 ∆pslBCD (scrape) PAO1 WT (scrape) 1.D1 Pel / Psl PAO1 ∆pel ∆psl (scrape) PAO1 WT (scrape) 1.D2 T4P PAO1 ∆pilA (scrape) PAO1 WT (scrape) 1.D3 T4P PAK ∆pilA::gmR PAK WT (scrape) (scrape) 1.D4 T4P PAO1 ∆fliC ∆pilA PAO1 ∆fliC::TcR (scrape) (scrape) 1.D5 T4P PAO1 ∆fliC ∆pilA PAO1 ∆fliC::TcR (scrape) (scrape) 1.D6 T4P PA103 ∆pilA (scrape) PA103 WT (scrape) 1.D7 PilQ PAO1 ∆pilQ (scrape) PAO1 ∆pilA (scrape) 1.D8 PilQ PAO1 ∆pilQ (scrape) PAO1 ∆pilA (scrape) 1.D9 PilQ PAO1 ∆pilQ (scrape) PAO1 ∆pilA (scrape) 1.D10 PilQ PA103 ∆pilQ (scrape) PA103 ∆pilA::gmR (scrape) 1.D11 PilQ PA14 pilQ::Tn (scrape) PA14 pilB::Tn (scrape) 1.D12 T6SS PAO1 gacA::Tn(GmR) PAO1 retS::Tn(GmR) fliC::TcR ∆pilA (scrape) fliC::TcR ∆pilA (scrape) 1.E1 MexAB- PA0397 (mPMQ72) PA0397 (mPMQ72 OprM ::(ZTP) ∆efflux (GEN +mexAB +oprM) 15 µg / mL+0.2% ara) ::(ZTP) ∆efflux (GEN 15 µg / mL+0.2% ara) 1.E2 MexCD-OprJ PA0397 (mPMQ72) PA0397 (mPMQ72 ::(ZTP) ∆efflux (GEN +mexCD +oprJ) ::(ZTP) 106 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 15 µg / mL+0.2% ara) ∆efflux (GEN 15 µg / mL+0.2% ara) 1.E3 MexEF-OprN PA0397 (mPMQ72) PA0397 (mPMQ72 ::(ZTP) ∆efflux (GEN +mexEF +oprN) ::(ZTP) 15 µg / mL+0.2% ara) ∆efflux (GEN 15 µg / mL+0.2% ara) 1.E4 MexJK-OprM PA0397 (mPMQ72) PA0397 (mPMQ72 ::(ZTP) ∆efflux (GEN +mexJK +oprM) 15 µg / mL+0.2% ara) ::(ZTP) ∆efflux (GEN 15 µg / mL+0.2% ara) 1.E5 MexXY- PA0397 (mPMQ72) PA0397 (mPMQ72 OprM ::(ZTP) ∆efflux (GEN +mexXY +oprM) 15 µg / mL+0.02% ara) ::(ZTP) ∆efflux (GEN 15 µg / mL+0.02% ara) 1.E6 T3SS PA14 ∆exsA PA14 ∆exsA (pMMB67EH) (CAR (pMMB67EH 200 µg / mL + 1 mM pTac::exsA) (CAR 200 IPTG) µg / mL + 1 mM IPTG) 1.E7 OprP PA14 oprP::Tn (PO4- PA14 WT (PO4- deficient media) deficient media) 1.E8 OpdH PA14 PA14 opdH#PA14_54520::Tn tctD#PA14_54500::Tn (mVBM) (mVBM) 1.E9 T3SS PA14 ∆exsA (MinS) PA14 ∆exsD (MinS+NTA) 1.E10 T3SS PA103 ∆exsA (MinS) PA103 ∆exsD (MinS+NTA) 1.E11 OprD PA14 oprD::Tn (BM2 PA14 WT (BM2 media media + 20mM alanine) + 20mM alanine) 1.E12 c-di-GMP PAK attB::pAra::rocR PAK (0.2% arabinose) attB::pAra::PA1120 (0.2% arabinose) 1.F1 MexAB- PA0397 ∆efflux (0.2% PA0397 OprM arabinose) attB::pBAD::mexAB- oprM (0.2% arabinose) 1.F2 MexCD-OprJ PA0397 ∆efflux (0.2% PA0397 arabinose) attB::pBAD::mexCD- 107 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells oprJ (0.2% arabinose) 1.F3 MexEF-OprN PA0397 ∆efflux (0.2% PA0397 arabinose) attB::pBAD::mexEF- oprN (0.2% arabinose) 1.F4 MexJK-OprM PA0397 ∆efflux (0.2% PA0397 arabinose) attB::pBAD::mexJK- oprM (0.2% arabinose) 1.F5 MexXY- PA0397 ∆efflux (0.2% PA0397 OprM arabinose) attB::pBAD::mexXY- oprM (0.2% arabinose) 1.F6 MexXY- PA0397 ∆efflux (LB) PAO1 WT (tetracycline OprM 4 µg / mL) 1.F7 MexEF-OprN PA0397 ∆efflux (LB) PAO1 WT (chloramphenicol 16 µg / mL) 1.F8 PirA (FepA) PA14 PA14 WT (M9 + pirA#PA14_52230::Tn Chelex 100) (M9 + Chelex 100) 1.F9 PhuR PA14 PA14 WT (M9 + phuR#PA14_62350::Tn Chelex 100) (M9 + Chelex 100) 1.F10 TonB PA14 tonB::Tn (M9 + PA14 WT (M9 + Chelex 101) Chelex 101) 1.F11 FpvA PA14 fpvA::Tn (M9 + PA14 WT (M9 + Chelex 102) Chelex 102) 1.F12 FptA PA14 fptA::Tn (M9 + PA14 WT (M9 + Chelex 103) Chelex 103) 1.G1 PfeA PA14 pfeA::Tn (LB) PA14 WT (LB) 1.G2 SCV PA14 PA14 WT wspF#PA14_16480::Tn 1.G3 SCV PA14 WT PA14 wspF#PA14_16480::Tn 1.G4 MexT PA14 mexT::Tn PA14 WT 1.G5 MexI PA14 mexI::Tn PA14 WT 108 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 1.G6 MexAB- PA14 oprM::Tn PA14 OprM nalC#PA14_16280::Tn 1.G7 MexAB- PA14 oprM::Tn PA14 OprM nalC#PA14_16280::Tn 1.G8 MexAB- PA14 oprM::Tn PA14 OprM nalD#PA14_18080::Tn 1.G9 MexXY- PA14 oprM::Tn PA14 OprM mexZ#PA14_38380::Tn 1.G10 MexCD-OprJ PA14 WT PA14 nfxB::Tn 1.G11 MexJK-OprM PA14 oprM::Tn PA14 mexL#PA14_16790::Tn 1.G12 MexAB- MB5919 ∆efflux PAO1 WT OprM 1.H1 MexAB- PA0397 ∆efflux PAO1 WT OprM 1.H2 CupB5 PA14 cupB5::Tn PA14 WT adhesin 1.H3 CupA fimbrae PA14 cupA3::Tn PA14 mvaT::Tn 1.H4 CupB fimbrae PA14 cupB3::Tn PA14 rocR#PA14_12810::Tn 1.H5 CupB fimbrae PA14 cupB3::Tn PA14 rocR#PA14_12810::Tn 1.H6 CupC fimbrae PA14 cupC3::Tn PA14 rocR#PA14_12810::Tn 1.H7 CupC fimbrae PA14 cupC3::Tn PA14 rocR#PA14_12810::Tn 1.H8 CupD fimbrae PA14 PA14 pvrR::Tn cupD3#PA14_59735::Tn 1.H9 CupD fimbrae PA14 PA14 pvrR::Tn cupD3#PA14_59735::Tn 1.H10 Pa SA113 PA14 WT 1.H11 Pa SA113 PA14 WT 1.H12 Pa SA113 PA14 WT 109 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 2.A1 Pa SA113 PAK WT 2.A2 Pa SA113 PAO1 WT 2.A3 Pa SA113 PA103 WT 2.A4 LPS CoreOS PA14 galU::Tn PA14 WT [galU] 2.A5 LPS OSA PA14 PA14 WT waaL#PA14_66100::Tn 2.A6 LPS OSA PA103 wzy::aacC1 PA103 WT [Short-Very Long] 2.A7 LPS OSA PA14 wzz::Tn PA14 WT [Long] 2.A8 LPS OSA PA14 wbpL::Tn PA14 WT 2.A9 LPS OSA PA14 wbpM::Tn PA14 WT 2.A10 LPS PA14 PA14 WT palmitoyl- pagP#PA14_46900::Tn lipid A 2.A11 LPS PA14 PA14 WT lptD#PA14_07770::Tn 2.A12 LPS PA14 PA14 WT lptD#PA14_07770::Tn 2.B1 LPS Lipid A PA14 WT PA14 phoQ::Tn [L-Ara4N] 2.B2 flagellum PA103 WT PA103 fleQ>fleQ(V240G) 2.B3 flagellum PA14 fleQ::Tn PA14 WT 2.B4 flagellum PAK ∆flhA PAK ∆fleN 2.B5 flagellum PA14 fleQ::Tn PA14 fleN::Tn 2.B6 flagellum PAO1 ∆pilQ PAO1 WT 2.B7 T4P PA103 ∆pilQ PA103 WT 2.B8 T4P / flagellum PA14 pilQ::Tn PA14 fleQ::Tn 110 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 2.B9 flagellin PAK ∆fliC::TcR PAK WT 2.B10 flagellin PAO1 ∆fliC::TcR PAO1 WT 2.B11 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 2.B12 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 2.C1 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 2.C2 flagellin PAO1 ∆fliC ∆pilA PAO1 ∆pilA 2.C3 OprL PA14 oprL::Tn PA14 WT 2.C4 OprF PA14 oprF::Tn PA14 WT 2.C5 OprG PA14 oprG::Tn PA14 WT 2.C6 OprF PA14 oprF::Tn PA14 oprD::Tn 2.C7 OprH PA14 oprH::Tn PA14 WT 2.C8 OprH / LPS PA14 oprH::Tn PA14 phoQ::Tn Lipid A [L- Ara4N] 2.C9 OprB PA14 oprB::Tn PA14 gltR::Tn 2.C10 pleiotropic PA14 ampC::Tn PA14 WT 2.C11 pleiotropic PA103 PA103 WT ∆retS#PA103_4856 2.C12 pleiotropic PA103 WT PA103 ∆retS#PA103_4856 2.D1 pleiotropic PA14 WT PA14 gacS#PA14_52260::Tn 2.D2 pleiotropic PA14 WT PA14 gacS#PA14_52260::Tn 2.D3 pleiotropic PA14 phoP::Tn PA14 phoQ::Tn 2.D4 pleiotropic PA14 WT PA14 phoQ::Tn 111 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells 2.D5 pleiotropic PA14 phoQ::Tn PA14 WT 2.D6 pleiotropic PA14 rpoS::Tn PA14 WT 2.D7 pleiotropic PA14 WT PA14 rpoS::Tn 2.D8 PA14 PA14 WT rbdA#PA14_53140::Tn 2.D9 pleiotropic PA14 pmrA::Tn PA14 WT 2.D10 pleiotropic PA14 pmrB::Tn PA14 WT 2.D11 pleiotropic PA14 envZ::Tn PA14 WT 2.D12 pleiotropic PA14 phoP::Tn PA14 phoQ::Tn 2.E1 T6SS PAO1 gacA::Tn(GmR) PAO1 retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 2.E2 pleiotropic SA113 PA14 ladS#PA14_19340::Tn 2.E3 pleiotropic PA103 ∆hfq PA103 WT 2.E4 pleiotropic PA103 WT PA103 ∆hfq 2.E5 pleiotropic PAK ∆flhF ∆vfr PAK ∆flhF ∆vfr 2.E6 pleiotropic PAK ∆flhF PAK ∆flhF ∆vfr 2.E7 BAM- PA14 PA14 WT dependent bamB#PA14_14910::Tn products 2.E8 BAM- PA14 PA14 WT dependent bamC#PA14_51260::Tn products 2.E9 T6SS PA14 mvfR::Tn PA14 WT 2.E10 T6SS PAO1 gacA::Tn(GmR) PAO1 retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 2.E11 T6SS PAO1 gacA::Tn(GmR) PAO1 retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 2.E12 T3SS PA103 PA103 ∆exsD ∆retS#PA103_4856 2.F1 Sec secretion PA14 secB::Tn PA14 WT 112 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells products 2.F2 Tat secretion PA14 tatC::Tn PA14 WT products 2.F3 lon protease PA14 lon::Tn PA14 WT 2.F4 dsbM- PA14 PA14 WT dependent dsbM#PA14_00700::Tn secretion products 2.F5 bam system PA14 PA14 WT secretion bamB#PA14_14910::Tn products 2.F6 T1SS Apr PA14 aprF::Tn PA14 WT 2.F7 T5aSS EstA PA14 estA::Tn PA14 WT 2.F8 T2SS sec PA14 secB::Tn PA14 WT secretion products 2.F9 T5dSS PlpD PA14 PA14 WT plpD#PA14_20870::Tn 2.F10 T5bSS LepA PA14 lepA::Tn PA14 WT 2.F11 T2SS tat PA14 tatC::Tn PA14 WT secretion products 2.F12 T5bSS LepB PA14 lepB::Tn PA14 WT 2.G1 clinical SA113 AP#1018 isolate 2.G2 clinical SA113 AP#1030 isolate 2.G3 clinical SA113 AP#1076 isolate 2.G4 clinical SA113 AP#1085 isolate 2.G5 clinical SA113 AP#1089 isolate 2.G6 clinical SA113 AP#1153 113 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells isolate 2.G7 clinical SA113 AP#1156 isolate 2.G8 clinical SA113 AP#1157 isolate 2.G9 clinical SA113 AP#1198 isolate 2.G10 clinical SA113 AP#1236 isolate 2.G11 clinical SA113 AP#1264B isolate 2.G12 clinical SA113 AP#1247A isolate 2.H1 clinical SA113 AP#1321A isolate 2.H2 clinical SA113 AP#1336A isolate 2.H3 clinical SA113 AP#1160 isolate 2.H4 clinical SA113 AP#1353 isolate 2.H5 clinical SA113 AP#1363 isolate 2.H6 clinical SA113 AP#1364 isolate 2.H7 clinical SA113 AP#1358 isolate 2.H8 clinical SA113 AP#1377 isolate 2.H9 clinical SA113 AP#1424 isolate 2.H10 clinical SA113 AP#1429 isolate 2.H11 clinical SA113 AP#1469A 114 55382181.3 Attorney Docket No.047162-7503WO1 (02594) sel. ID antigen CS cells S cells isolate 2.H12 clinical SA113 AP#1474 isolate Table 7: Table of strains / conditions for extended panning. “Sel. ID” refers to the parent selection identifier from Table 6. ext. sel. sel. ID ID antigen CS cells S cells 1.A1 1.D7 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.A2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexAB- arabinose) oprM (0.2% arabinose) 1.A3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% attB::pBAD::mexCD- arabinose) oprJ (0.2% arabinose) 1.A4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% attB::pBAD::mexEF- arabinose) oprN (0.2% arabinose) 1.A5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexJK- arabinose) oprM (0.2% arabinose) 1.A6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexXY- arabinose) oprM (0.2% arabinose) 1.A7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.A8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.A9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 115 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ext. sel. sel. ID ID antigen CS cells S cells 1.A10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.A11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.A12 2.B11 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 1.B1 1.D8 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.B2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexAB- arabinose) oprM (0.2% arabinose) 1.B3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% attB::pBAD::mexCD- arabinose) oprJ (0.2% arabinose) 1.B4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% attB::pBAD::mexEF- arabinose) oprN (0.2% arabinose) 1.B5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexJK- arabinose) oprM (0.2% arabinose) 1.B6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexXY- arabinose) oprM (0.2% arabinose) 1.B7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.B8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.B9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 116 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ext. sel. sel. ID ID antigen CS cells S cells 1.B10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.B11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.B12 2.B12 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 1.C1 1.D9 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.C2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexAB- arabinose) oprM (0.2% arabinose) 1.C3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% attB::pBAD::mexCD- arabinose) oprJ (0.2% arabinose) 1.C4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% attB::pBAD::mexEF- arabinose) oprN (0.2% arabinose) 1.C5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexJK- arabinose) oprM (0.2% arabinose) 1.C6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% attB::pBAD::mexXY- arabinose) oprM (0.2% arabinose) 1.C7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.C8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.C9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 117 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ext. sel. sel. ID ID antigen CS cells S cells 1.C10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.C11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.C12 2.C1 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 1.E1 1.D7 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.E2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% +mexAB+oprM arabinose) (0.2% arabinose) 1.E3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% +mexCD+oprJ (0.2% arabinose) arabinose) 1.E4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% +mexEF+oprN arabinose) (0.2% arabinose) 1.E5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% +mexJK+oprM arabinose) (0.2% arabinose) 1.E6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% +mexXY+oprM arabinose) (0.2% arabinose) 1.E7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.E8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.E9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 1.E10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.E11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) 118 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ext. sel. sel. ID ID antigen CS cells S cells fliC::TcR ∆pilA fliC::TcR ∆pilA 1.E12 2.B11 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 1.F1 1.D8 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.F2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% +mexAB+oprM arabinose) (0.2% arabinose) 1.F3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% +mexCD+oprJ (0.2% arabinose) arabinose) 1.F4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% +mexEF+oprN arabinose) (0.2% arabinose) 1.F5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% +mexJK+oprM arabinose) (0.2% arabinose) 1.F6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% +mexXY+oprM arabinose) (0.2% arabinose) 1.F7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.F8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.F9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 1.F10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.F11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.F12 2.B12 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body 119 55382181.3 Attorney Docket No.047162-7503WO1 (02594) ext. sel. sel. ID ID antigen CS cells S cells 1.G1 1.D9 PilQ PAO1 ∆pilQ PAO1 ∆pilA (scrape) (scrape) 1.G2 1.F1 MexAB- PA0397 ∆efflux PA0397 OprM (0.2% +mexAB+oprM arabinose) (0.2% arabinose) 1.G3 1.F2 MexCD- PA0397 ∆efflux PA0397 OprJ (0.2% +mexCD+oprJ (0.2% arabinose) arabinose) 1.G4 1.F3 MexEF- PA0397 ∆efflux PA0397 OprN (0.2% +mexEF+oprN arabinose) (0.2% arabinose) 1.G5 1.F4 MexJK- PA0397 ∆efflux PA0397 OprM (0.2% +mexJK+oprM arabinose) (0.2% arabinose) 1.G6 1.F5 MexXY- PA0397 ∆efflux PA0397 OprM (0.2% +mexXY+oprM arabinose) (0.2% arabinose) 1.G7 1.E9 T3SS PA14 ∆exsA PA14 ∆exsD (MinS) (MinS+NTA) 1.G8 1.E10 T3SS PA103 ∆exsA PA103 ∆exsD (MinS) (MinS+NTA) 1.G9 2.B4 flagellum PAK ∆flhA PAK ∆fleN 1.G10 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.G11 2.E10 T6SS PAO1 PAO1 gacA::Tn(GmR) retS::Tn(GmR) fliC::TcR ∆pilA fliC::TcR ∆pilA 1.G12 2.C1 flagellar PAK ∆flhA PAK ∆fliC ∆fleN hook / basal body Example 3: Background & Preliminary Data Phage display for antigen discovery. 120 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Phage display is a tool for studying protein-protein interactions and is particularly useful for finding antibodies against specific antigens. The display of a peptide (e.g. antibody) by a bacteriophage physically links the peptide to the gene encoding it. The antibody is fused to a phage minor coat protein, and a plasmid encoding that construct (“phagemid”) is packaged inside the phage capsid. A diverse library of phage-displayed antibodies is mixed with the antigen of interest, and unbound phage are washed away. Bound phage are then eluted and amplified in a culture of E. coli. This “panning” process can be repeated for several rounds to enrich the phage pool for antibodies which bind antigen(s) of interest. To find antibodies against cell surface epitopes in native conformation, phage can be panned against whole cells instead of surface-immobilized proteins. In this case, antibodies that bind to antigen-negative “counter-selection cells” are removed before applying the remaining antibodies to antigen-positive “selection cells”. Traditionally, phage clones identified by panning are individually picked and screened using ELISAs to find strong binders. In one aspect, the present study aimed to combine phage display with high-throughput sequencing (HTS) as a primary readout of the dynamics of selection, an approach that has not been previously reported in bacteria. This allowed one to develop a high-throughput, highly multiplexed technology for unbiased profiling and quantification of bacterial surface antigens, which was named “Phage-seq”. Phage-seq produces both a dataset (“fingerprint”), describing the bacterial surfaceome of a given strain or population, as well as reagents useful for further studies. Importantly, Phage- seq does not require antigens to be known in advance, as it decouples profiling from antigen identification. Although other unbiased ‘omics methods are used to probe bacterial adaptation, they do not directly predict surface feature changes (genomics, RNA-seq) or are difficult to apply to many samples (spectral counting proteomics). Two phage libraries were used in development of Phage-seq. Both display VHH recognition domains (“nanobodies”) as found in camelid heavy chain-only immunoglobulins; VHHs have comparable antigen specificity to full-length immunoglobulins but are smaller, more stable, and more soluble. One library (“alpaca”) was generated by immunization of an alpaca with complex mixtures of soluble and membrane antigens prepared from four well- characterized Pa strains (PAO1, PA14, PAK, PA103) grown under various conditions. The library contains ~80,000 unique clones as estimated by HTS, and was used to generate the data presented in these studies. This work also involved a synthetic phage display, which was adapted from the yeast-displayed version described in the literature. The significantly higher diversity of the synthetic library (>1010clones) provides theoretical advantages for the 121 55382181.3 Attorney Docket No.047162-7503WO1 (02594) present work. In initial experiments, the library converged slowly over rounds of panning and yielded fewer candidate nanobodies; the alpaca library was then used to generate the data that forms the basis for this study. Application of Phage-seq to hundreds of selection / counter-selection pairs. The alpaca library was initially panned against purified, surface-immobilized Pa antigens. This yielded many nanobodies that recognized their target antigen on fixed cells (by flow cytometry (FCM) or whole cell dot-blotting) but stained antigen-positive live bacteria weakly or not at all. A cell-based panning method was developed (FIG.1), which was adapted from tube to 96-well format and carried out on 180 pairs of Pa selection / counter- selection cells. Most selections were carried out using isogenic wild-type / mutant pairs differing for a single antigen or structure, with growth conditions chosen to promote expression of the antigen(s) of interest. CF and non-CF Pa patient isolates were also included (using Staphylococcus aureus as the counter-selection strain), as well as Pa pairs in which a pleiotropic regulator was mutated. Selections were considered “positive” for an antigen expressed by selection cells but not by counter-selection cells, and “negative” if the antigen was either missing from both cell types or more abundant on the counter-selection cells. Selections were labeled “unknown” if no a priori prediction could be made about the antigen status of a pair. After each of 4 rounds of selection, both phage titers were measured and VHH CDR1- 3 sequences determined by Illumina sequencing. Given the dominant contribution of CDR3 to antibody binding specificity, reads were pooled with the same CDR3 sequence (“CDR3 clonotype”) in the analysis. The number of CDR3 clonotypes per sample was ~100–2,500. One expected panning to enrich a library for clones that bound the antigen of interest while depleting all other clones, thereby decreasing both the richness (# of clones) and evenness (relative rarity of each clone) of the sample. Whittaker plots (rank abundance curves) showed this expected change for purified antigen and cell-based (tube) selections, while barplots of clonotype abundance showed narrowing of the VHH population over rounds of panning (FIG. 3). However, an analysis of the results of the massively parallel phage display panning experiment (96 well format) did not show similar clear evidence of clonotype selection (FIG. 4, top panel). Without wishing to be limited by any theory, protocol modifications required by the change to 96 well format (reduced cell numbers and wash steps, altered methods for cell / phage resuspension and separation) affected the selection. These were systematically tested by extending the campaign for a subset of genotype pairs (FIG.2) for three additional 122 55382181.3 Attorney Docket No.047162-7503WO1 (02594) rounds, during which one (1) increased wash stringency; (2) increased cell number; and (3) carried out 3 sequential counter-selection steps per round before selection on antigen-positive cells. In an additional set of selections, it was tested whether a higher cell-to-phage ratio would lead to stronger convergence of phage populations by diluting input phage 100-fold before applying to counter-selection cells in rounds 6 and 7. HTS of extended selections revealed marked changes in library diversity (Fig 4, bottom panel) suggesting that protocol modifications had successfully tightened the selection bottleneck. Additional sequencing of “pre” v “post” amplification phage at one round of selection (e.g. eluted phage sample before and after E. coli amplification) allowed one to identify and exclude nanobodies with amplification bias, which showed no overlap with the most enriched VHHs, as predicted. Confirming that Phage-Seq identifies nanobodies specific to the Pa cell surface. The goal of the cell-based campaign was to select VHH specific for native- conformation antigens on live cells; these VHHs could in principle be identified from the HTS data, expressed and experimentally tested. One searched for nanobodies that were enriched (i.e. increased in abundance over rounds of selection), as selections had not converged on a few high-abundance nanobodies and because previous studies of peptide phage display showed no correlation between final round clone abundance and binding strength to the target antigen. One developed several metrics of VHH enrichment to guide the choice of nanobodies to resynthesize (FIGs.5A-5D). Ultimately, a composite of several metrics was used to shortlist CDR3 clonotypes enriched in multiple antigen-positive samples, then the behavior of each candidate examined across all selections.84 CDR3 clonotypes for 5 different antigens were selected by this approach. Each was resynthesized as a gene fragment encoding the consensus full-length VHH amino acid and expressed as a fusion to human IgG1-Fc. Of the 66 that were successfully expressed, 28 were validated by flow cytometry to have the predicted specificity when staining live Pa cells. Phage-seq captures information about the bacterial cell surface. After confirming that the extended panning yielded selective VHHs, the large high- throughput dataset were re-examined to test whether Phage-seq had captured information about the structure of bacterial cell surfaces during earlier rounds of selection. Principal component analysis (PCA) of round four abundances showed that panned samples were well- separated from the input library along the first axis, then separated according to growth condition along the second and third axis. A rough clustering was apparent, with efflux pump 123 55382181.3 Attorney Docket No.047162-7503WO1 (02594) selections appearing close together, while selections for flagella and pili also clustered together. Notably, selections on clinical isolates did not separate from other selections against Pa laboratory strains. Canonical correspondence analysis (CCA) on the enrichment matrix revealed that the presence or absence of biological features (e.g. flagella, OprM, type III secretion system) could explain variance in VHH enrichments across samples. To further evaluate the dataset’s ability to characterize an isolate, a series of classifiers was trained to distinguish Ag+ versus Ag- selections. The goal was to test whether Phage-seq data could recapitulate characteristics of well-characterized isolates in the selection campaign, not to predict antigens of unknown isolates. A separate ensemble of classifiers was trained for each antigen where >5 antigen-positive and antigen-negative selections had been carried out. Data were repeatedly divided into 5 folds, with four of five folds used for training and the fifth used to evaluate classifier performance. The performance of all classifiers was measured to estimate their average, best- and worst-case performance. As a control, a similar procedure was performed on the same set of selections after randomly permuting the antigen-positive / antigen-negative labels. This “shuffled labels” control demonstrated that the models were not excessively flexible (i.e. they did not overfit to distinguish arbitrary subsets of the data). The classifiers performed acceptably, with mean area under the receiver-operator characteristic curves (AUROC) between 0.7–0.86. AUROCs for the shuffled controls were ≤0.52, indicating performance similar or worse than chance. Phage-seq is both technically and conceptually innovative. The present approach uses selection / counter-selection between bacterial mutants, allowing us to link genotype to phenotype (antigen expression). This strategy aligns well with bacterial genetics, where knockout and overexpression mutants in many genes are readily available, and the antigen products of these genes cand be investigated with Phage-seq. the approach can also be used to discover epitopes that differ when a pleiotropic regulator is disrupted, or between clinical isolates before and after exposure to antibiotics or a host immune system. Furthermore, the method generates relevant antibody reagents without a priori knowledge of epitopes or targets. The promise of this method was demonstrated by discovering nanobodies against several membrane-associated protein complexes which stain live, intact cells. Example 4: Identifying nanobodies recognizing Pa surface-displayed antigens that distinguish bacterial phenotype. An experimental and computational pipeline that enables identification of nanobodies 124 55382181.3 Attorney Docket No.047162-7503WO1 (02594) that recognize surface features of live Pa cells has been developed and optimized. In this study the knowledge and optimized methods are used to extend the spectrum of Pa phenotypes fingerprinted by Phage-seq. This is “de-risked” by the results with the alpaca library. As an initial step, one will explicitly test the ability of the synthetic library to identify a larger and more diverse set of Pa antigens than can be achieved with the alpaca library. Measure VHH enrichment after panning the synthetic library across a matrix of Pa clinical isolates / growth conditions. The size (~1010clones) of the synthetic library greatly increases the likelihood that non-specifically binding phage will slow / block selection of specific binders during panning. One will use sequential counterselections to remove “sticky” phage and non-Pa binders.1013phage will be incubated sequentially with S. aureus SA113 (1012cells / 100 ml) x3, then Saccharomyces cerevisiae (1011cells / 100ml) x3; phage titer will be followed. Unbound phage will be divided and applied to a set of 12 Pa clinical isolates (PAO1, PA14, LESB58, PA7, plus eight isolates to represent early / late pwCF, acute pneumonia, sepsis, chronic wound ±MDR; chosen to sample pangenome diversity and provide overlap with alpaca library data). Each isolate will be prepared from 3 conditions (exponential SCFM), stationary SCFM, polystyrene bead grown biofilms / SCFM) and panned in replicate (n=5); replicate samples will be pooled prior to re-amplification / re-panning. Increasing stringency of washes over 6 rounds of selection, ongoing incorporation of sequential counterselections with SA113 and maintaining phage / cell ratio <10 are expected to result in measurable changes in library composition (determined by HTS). If this is not observed, the campaign will be extended for 4 additional rounds. (Samples generated for HTS: 36 per round of panning.) This “Pa selected” set of samples (12 isolates x3 conditions) will be pooled at the end of this selection campaign and tested by panning in triplicate on sets of counterselection / selection strains for OprM, the flagellar hook-basal body, T3SS and Pel / Psl, using the extended-panning modifications employed with the alpaca library (Fig 4); samples will be sequenced at each round of selection (Samples generated for HTS: 12 per round of panning). One expects this “Pa selected” subset of the synthetic (PAS3) library to show clear evidence of VHH enrichment for each of these antigens over 4-5 rounds of panning if one has successfully reduced its complexity by removing irrelevant nanobodies and enriching for pseudomonas-avid nanobodies. Extend the spectrum of Pa phenotypes interrogated by Phage-seq. From databases and studies of Pa adaptations during infection, ~1,000 genes with predicted effects on the Pa cell surface were identified. These genes encode structural 125 55382181.3 Attorney Docket No.047162-7503WO1 (02594) proteins, enzymes, or regulatory factors expected to be highly pleiotropic. This information has been used to assemble a training “genotype collection” composed of ~300 strain pairs that broadly samples Pa surface diversity (FIG.2A-2E and data not shown). Mutants expected to decrease antigen production serve as counter-selection strains for isogenic wildtype; those that increase production are used as selection strains vs WT. If the effect of the mutation is unclear (e.g. ∆algU), both arrangements are tested. Selection / counter- selection pairs are cultured under the condition(s) expected to magnify the difference in antigen expression. All pannings will be carried out in quadruplicate; in order to provide high-quality training data to classifiers.5-8 positive and negative selections will be assayed for each antigen, varying strain / genotype / condition to achieve this. For example, a deep training set can be assembled for the antigen “flagellum”, with strains representing a-type v b-type flagellin; single or multiple complete flagella vs hook-basal bodies; and aflagellate mutants. Similar sets have been assembled for other surface organelles, secretion systems, porins, siderophore receptors, LPS variants, and exopolysaccharides, allowing us to analyze ~20 broadly defined “antigens”, each with ~6 positive and negative selections; carrying these out in quadruplicate over 5 rounds of panning accounts for 240 samples per antigen for HTS. 20 pairs of clinical isolates (e.g. pre / post lytic phage therapy; early / late pwCF isolates) will also be assayed to ensure nanobodies recognizing epitopes unique to clinical isolates are not excluded from further study. Each pair will be analyzed twice, once with the “pre” / ”early” isolate serving as the selection, the other with it providing the counterselection. This will generate an additional 800 samples. Lastly, pairwise comparisons between the type strains used (PAO1vsLESB58; PAO1vsPA7; LESB58vsPA7; PA14vsPA7; PA14vsLESB58) will allow us to pan on surface features unique to strains not represented in the mutant collection. Carrying out selections in both directions on these 5 pairs generates 200 samples. Use classifiers to test ability of VHH fingerprints to predict phenotypes. The data indicate that VHH fingerprints provide biologically meaningful information about the strain being profiled. the goal is to predict functions and phenotypes of unknown strains based on their VHH fingerprints, or on reagents derived from such nanobodies. VHHs that, alone or in combination, predict clinically relevant phenotypes (e.g. antimicrobial or lytic phage susceptibility) will yield useful tools, independent of the rest of the project. Importantly, this will be used to evaluate the performance of VHH sub-libraries and build a curated library. A curated library will be assembled by using supervised and unsupervised machine learning techniques to reduce the number of nanobodies which preserving the underlying data 126 55382181.3 Attorney Docket No.047162-7503WO1 (02594) structure. Three methods will be used to shortlist nanobodies and the curated library will be assembled from the union of these lists. In one aspect, for each of the twenty antigens characterized by Phage-seq, a classifier will be trained to distinguish Ag+ / - selections using VHH enrichments, as described elsewhere herein. Briefly: one will reserve ~10% of selections for testing, then use the remaining data to train gradient-boosted tree classifiers via the XGBoost package. Hyperparameters will be tuned by randomized and Bayesian grid search and evaluated by 5- fold cross-validation within the training set. Performance of each classifier on the withheld test set will be evaluated by computing the AUROC. One will use those classifiers which perform well (AUROC > 0.7) to select nanobodies, using variable importance analysis to rank those nanobodies which contribute most to classifier performance. These nanobodies will be added to the curated library. One can optimize the number of features per antigen by repeatedly removing low-importance features from the dataset, re-fitting the classifier, and observing for a point below which performance degrades precipitously. In another aspect, the phenotypes of antibiotic resistance (using Sensititre GNX3F* MIC plates) and lytic phage susceptibility (to OMKO1, TIVP-H6, and LPS-5) will be experimentally measured for the 20 pairs of clinical isolates described elsewhere herein. Canonical correlation analysis will then be used to identify VHH features correlated with these phenotypes. Cross-validation and label permutation (assign phenotype data for a strain to a VHH fingerprint from a random strain; compare the real model to this model), will appraise the proposed correlations. This step is intended to capture nanobodies which may predict resistance phenotypes that may not be present on the laboratory strains present in the set of training strains. In yet another aspect, unsupervised techniques will be used to identify high-variance features in the dataset. For instance, PCA will be performed, then 10% of nanobodies with the highest loadings chosen. One will then calculate what percentage of variance in the dataset is explained by this subset of features, as a rough estimate of how accurately this subset captures structure in the full dataset. More sophisticated methods for unsupervised feature selection, such as sparse PCA and principal feature analysis, will also be considered. This approach intends to capture nanobodies which are highly discriminatory between selections but do not match obvious biological features of the strains. Curate a library of nanobodies. In an uncurated library (e.g. PAS3 and alpaca), the abundance of nanobodies in the input pool cannot be controlled. Multiple rounds of panning are needed to eliminate non- 127 55382181.3 Attorney Docket No.047162-7503WO1 (02594) specific clones from an un-curated library. Passaging exaggerates amplification bias; informative but low abundance clones may dropout. A curated library reduces unnecessary complexity (noise) by removing nanobodies that do not bind Pa surfaces specifically and allows more reproducible profiles of surface biomarker abundance to be obtained, optimally with a single panning. A curated library enables a method that is technically easier, improves rigor & reproducibility, has improved signal-to-noise characteristics, and is more broadly useful. A list of N nanobodies will be generated from which will form the curated library. To determine the optimal size (N) of the curated library, the VHH fingerprint dataset will be computationally reduced to only include the top N ranked nanobodies, then this subset evaluated using the techniques described. The performance of the curated VHHset will be compared to those of the full Phage-seq dataset and to that of a random set of N VHHs (negative control). In certain embodiments, one can find some N beyond which adding additional nanobodies produces diminishing returns, which would define the optimal size of the curated library. As Phage-seq yields the exact nucleotide sequence of each VHH- encoding gene, the top N ranked VHH sequences will be synthesized as an oligo pool (at the ~300nt scale) and cloned into the phagemid vector. The number of oligos (N) in the pool is not limiting but will influence the next steps. For N <500, phagemid-containing transformants will be picked and arrayed, then sequenced to map inserts. This phagemid library will serve as an indefinitely renewable resource for assembling a curated phage display library (after packaging, amplification, titering, and pooling phage in equal ratios). For N>500, phagemid library will not be arrayed, but instead sequenced to determine evenness and representation of VHH sequences. When this library is panned, enrichment between output / input will be analyzed, rather than abundance. In both cases, interesting VHH sequences can be subcloned from the phagemid library for expression and further applications. Express and test humanized nanobodies as reagents for discovery, diagnostic and therapeutic applications. A pipeline has been established to identify, resynthesize and express high-yield VHHs as fusions to human IgG1-Fc (“rVHH”). Here, one will (i) use the optimized methods to extend the spectrum of bacterial surface antigens targeted by rVHHs; (ii) assay rVHH for their ability to opsonize and target bacteria; and (iii) measure rVHH inhibition of phenotypes associated with P. aeruginosa virulence. The results will be a panel of characterized VHH- IgG1-Fc reagents ready for development as research, diagnostic and therapeutic tools. 128 55382181.3 Attorney Docket No.047162-7503WO1 (02594) Express and characterize rVHH that recognize Pa surface features of interest. Nanobodies enriched by panning against counterselection / selection pairs of WT / mutant genotypes can be identified by Phage-seq and are a high-yield source of rVHH that bind live, antigen-expressing cells with specificity. The set of rVHH reagents will be extended using the previous results as a guide, prioritizing nanobodies that identify cells expressing virulence-associated surface features. These will fall into two classes: nanobodies that distinguish Ag+ v Ag- cells and are likely to bind the selection antigen (or a co- expressed surface marker), and nanobodies that distinguish cells of a specific phenotype (e.g. OKOM1 phage resistant or aminoglycoside-R or LEBS58 ‘unique’) for which the target is not obvious. Nanobodies will be cloned and expressed as human IgG1 Fc fusions in transiently transfected Expi293F cells, and affinity purified using Protein G beads (FIG.5A-5G). VHH- IgG1-Fc (“rVHH”) binding will be assayed by flow cytometry and / or by cell-based ELISA, using Ag+ / Ag- cells to confirm specificity. Titration ELISAs will be done to estimate rVHH dissociation constants. The binding partners of high-avidity VHH-Fc fusions will be identified by immunoprecipitation-mass spectrometry (IP-MS), following standard methods for membrane protein purification in Gram negative bacteria. Briefly, one will lyse cells using a French press, collect membranes by ultracentrifugation, and solubilize membranes using a non-ionic detergent. rVHH will be incubated with membranes; protein-VHH complexes captured with Protein G-conjugated magnetic beads; and bound proteins identified by MS (Keck Biotechnology Resource Laboratory). IP-MS will be performed on both high- binding / Ag+ and low-binding / Ag- strains in parallel, while IP-MS on Ag+ samples using a GFP-IgG1 Fc fusion will serve as a negative control. These controls will allow one to identify and exclude non-specific or implausible binding partners for each rVHH reagent. Assay rVHH for their ability to opsonize and target bacteria. Reagents that recognize and bind live Pa cells have research, diagnostic and therapeutic potential. In this substudy, it will be tested whether rVHH already identified (anti- OprM and anti-flagellum / hook-basal body) increase opsonization and antibody-mediated phagocytosis of Ag+ bacteria. Anti-bacterial antibodies continue to be explored not only for their ability to neutralize virulence factors and / or facilitate immune-mediated pathogen killing, but also for their potential to engage innate and adaptive arms of the immune system and induce long-lasting protection against infection. Ag+ / msfGFP+ or Ag- / CFP+ cells will be incubated with TPA-differentiated THP-1 macrophages (MOI 50) in the absence of serum / rVHH (non-opsonic phagocytosis), in the 129 55382181.3 Attorney Docket No.047162-7503WO1 (02594) presence of 0.5% human serum (opsonic phagocytosis), or with rVHH ± 0.5% human serum (antibody-dependent phagocytosis) for 15-60 mins, then washed and analyzed by flow cytometry and microscopy to determine the percentage of THP-1 cells with internalized FP+ bacteria. Aminoglycoside protection of internalized bacteria under each condition will be used to enumerate numbers of phagocytized bacteria. IgG1-Fc (isotype control, FIG.5) will serve as a negative control for non-specific effects of IgG, while a Fc-mutated version of the rVHH-fusion (IgG1-Fc(N297A), in pCER243 expression vector, initially used in theVHH expression work) will confirm that effects are dependent on FcR engagement, as expected. If rVHH promotes phagocytosis of Ag+ bacteria >>Ag- bacteria, one will test whether this effect is intrinsic to bacterial genotype by mixing Ag+ / Ag- cells 1:1 and repeating these assays. (As expression of surface features among a bacterial population is often heterogeneous, this will allow us to determine if rVHH-mediated macrophage activation promotes “bystander” uptake of Ag- bacteria.) Measure rVHH inhibition of virulence-associated phenotypes. One will test whether opsonizing nanobodies can block phenotypes associated with their targets. Such rVHH could represent leads for sought-after “anti-virulence” therapies, particularly as they have been selected for their ability to recognize targets as presented on live bacteria. Experiments focusing on rVHH in hand are described that recognize the RND- associated porin OprM or the T3SS (but will add additional nanobodies identified with PAS3); as rVHH with additional targets are identified, similar in vitro assays will be developed. Efflux function of OprM will be tested. Unfixed OprM+ bacteria stained with SYTO9 efflux this dye, losing GFP fluorescence over 30-60 min as measured by flow cytometry; isogenic ∆efflux bacteria remain stably bright. This forms the basis for a simple quantitative FCM assay testing whether addition of anti-OprM rVHH (or irrelevant rVHH as negative controls) inhibits SYTO9 efflux. As complemented ∆efflux strains expressing mexABoprM under the arabinose-inducible pBad promoter were engineered, either from the chromosomal attB site or from a plasmid, one can titrate the expression of OprM over a wide range when testing efficacy of anti-OprM rVHH efflux inhibition. Second, the ability of anti-T3SS rVVH to block T3SS-dependent hemolysis will be assayed. Functional neutralization appears to require high-affinity binding to C-terminal surface exposed epitopes within the pentameric T3SS apparatus “tip” protein PcrV. As culture conditions that result in assembly of multiple, non-secreting T3SS needles on the surface of PA103 and PA14 bacteria, as visualized by cryo-electron tomography, have been 130 55382181.3 Attorney Docket No.047162-7503WO1 (02594) developed, one has confidence that panning with the PAS3 library will yield such neutralizing rVHH reagents. Characterize in vitro and in vivo evolved Pa isolates to test consequences of infection associated selective pressures. One will use Phage-seq to study how bacteria adapt to selective pressures during infection, and map changes in surface epitopes during adaptation. One will carry out in vitro evolution experiments, and complement these with analysis of patient-derived, in vivo evolved isolates. Patient-derived isolates are obtained from three sources. A large study was carried out examining host and bacterial factors associated with human infection vs colonization. One will use deidentified isolates collected serially from pwCF, with associated data reporting antibiotic treatment. One will also use deidentified Pa isolates collected before, during and after courses of lytic phage administration. Use Phage-seq to identify cell surface changes that occur during antibiotic pressure. Molecular mechanisms leading to antibiotic resistance are well-described; however, the adaptations that occur in response to antibiotic pressure, and their consequences for virulence factor expression, cross-resistance and fitness are less well delineated. One will test the potential of Phage-seq to provide information about phenotypes of antibiotic evolved bacteria that complements and extends whole genome sequencing (WGS) data. Characterize adaptation to ciprofloxacin. A single colony of pan-sensitive Pa isolate AP1094, an initial isolate from the series associated with a ureteral stent infection, will be serially passaged for 10d in SCFM to allow adaptation to media. The experimental scheme for evolving CiproR A. baumanii will be followed to evolve AP1094 in (i) no antibiotic, (ii) 0.5XMIC CIP, or (iii) increasing CIP every 3 days (0.5X / 1X / 2X / 4X MIC) for a total of 12 days, with daily bacterial sub-culture to fresh media in all cases. Three replicates per selection scheme will be evolved in parallel in liquid SCFM; 3 additional replicates will be evolved by daily transfer of polystyrene beads with associated bacteria to tubes containing fresh SCFM and sterile beads. Samples of each population will be frozen daily throughout the 12 day experiment. Twenty individual clones will be picked and frozen from each replicate population at d12. Whole genome sequencing (WGS) of the ancestral strain and of selected replicate populations will be used to map mutations, following the scheme and analysis used – this will allow one to directly compare the identity and trajectory of mutations that arise and become fixed in Pa versus in the 131 55382181.3 Attorney Docket No.047162-7503WO1 (02594) published case for A. baumanii. In addition, a single round of Phage-seq panning using the curated library (1C) will be performed on the ancestral isolate and for each replicate population that is sequenced. Counter-selection and multiple rounds of panning are not required, since all nanobodies in the curated library will be known to bind Pa. Characterize adaptation to ceftazidime, with or without “history”. Adaptation to the presence of an antibiotic results in measurable increases in resistance to that antibiotic; however, the “...

Claims

Attorney Docket No.047162-7503WO1 (02594) CLAIMS What is claimed is:

1. A method of identifying at least one member of a display library that binds to an antigen of interest associated with a bacterium, the method comprising: a) generating the display library, b) panning the display library against an antigen of interest associated with the bacterium, c) enriching for at least one member of the library that bind the antigen of interest, and d) high-throughput sequencing the gene encoding the at least one member of the display library; thus identifying at least one member of the display library that binds to the antigen of interest.

2. The method of claim 1, wherein the bacterium is Pseudomonas aeruginosa (P. aeruginosa).

3. The method of any one of claims 1-2, wherein the display library is generated using a phage-display system.

4. The method of claim 3, wherein the phage display library is an immune or a synthetic library.

5. The method of any one of claims 1-4, wherein the display library is a VHH library.

6. The method of any one of claims 1-5, wherein the member of a display library is a VHH.

7. The method of any one of claims 1-6, wherein the phage-displayed VHH library is generated in an alpaca.

8. The method of any one of claims 1-7, wherein the panning comprises purified, surface-immobilized P. aeruginosa antigen panning and / or cell-based panning. 171 55382181.3Attorney Docket No.047162-7503WO1 (02594) 9. The method of claim 8, wherein the panning is cell-based panning.

10. The method of any one of claims 1-9, wherein the panning uses P. aeruginosa isolated from environmental and / or patient samples.

11. The method of any of claims 1-10, wherein the phage display panning selects for VHH recognition domains.

12. The method of any of claims 1-11, wherein the antigen of interest is an antigen presented on the surface of P. aeruginosa.

13. The method of claim 12, wherein the P. aeruginosa is intact.

14. The method of claim 12, wherein the antigen of interest is selected from the group consisting of a flagellar filament (FliC); a flagellar hook-basal body (HBB); and efflux- associated outer-membrane porins OprM, OprN, and OprJ.

15. The method of claim 14, wherein the antigen of interest is OprM.

16. The method of any one of claims 1-15, wherein the enriching depletes at least a fraction of other VHH library members that have not bound to the antigen of interest, optionally wherein the enriching depletes all other VHH library members that have not bound to the antigen of interest.

17. The method of any one of claims 1-16, wherein the sequencing is performed using high-throughput sequencing.

18. The method of any one of claims 1-17, wherein the at least one VHH comprises at least one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125-200 (CDR2 sequences), and SEQ ID NOs: 276-354 (CDR3 sequences), optionally wherein the at least one VHH comprises at least one of SEQ ID NOs: 2-64 (CDR1 sequences), at least one of SEQ ID NOs: 125-200 (CDR2 sequences), and at least one of SEQ ID NOs: 276-354 (CDR3 sequences). 172 55382181.3Attorney Docket No.047162-7503WO1 (02594) 19. The method of any one of claims 1-18, wherein the at least one VHH comprises one of the following: a CDR1 of amino acid sequence of SEQ ID NO: 2, a CDR2 of amino acid sequence of SEQ ID NO: 125, and a CDR3 of amino acid sequence of SEQ ID NO: 276; a CDR1 of amino acid sequence of SEQ ID NO: 3, and a CDR2 of amino acid sequence of SEQ ID NO: 126; a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 277; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 128, and a CDR3 of amino acid sequence of SEQ ID NO: 278; a CDR1 of amino acid sequence of SEQ ID NO: 6, a CDR2 of amino acid sequence of SEQ ID NO: 129, and a CDR3 of amino acid sequence of SEQ ID NO: 279; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 130, and a CDR3 of amino acid sequence of SEQ ID NO:280; a CDR1 of amino acid sequence of SEQ ID NO: 8, a CDR2 of amino acid sequence of SEQ ID NO: 131, and a CDR3 of amino acid sequence of SEQ ID NO: 281; a CDR1 of amino acid sequence of SEQ ID NO: 9, a CDR2 of amino acid sequence of SEQ ID NO: 132, and a CDR3 of amino acid sequence of SEQ ID NO: 282; a CDR1 of amino acid sequence of SEQ ID NO: 10, and a CDR2 of amino acid sequence of SEQ ID NO: 133; a CDR1 of amino acid sequence of SEQ ID NO: 11, a CDR2 of amino acid sequence of SEQ ID NO: 134, and a CDR3 of amino acid sequence of SEQ ID NO: 283; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 135, and a CDR3 of amino acid sequence of SEQ ID NO: 284; a CDR1 of amino acid sequence of SEQ ID NO: 13, a CDR2 of amino acid sequence of SEQ ID NO: 136, and a CDR3 of amino acid sequence of SEQ ID NO: 285; a CDR1 of amino acid sequence of SEQ ID NO: 14, a CDR2 of amino acid sequence of SEQ ID NO: 137, and a CDR3 of amino acid sequence of SEQ ID NO: 286; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 287; a CDR1 of amino acid sequence of SEQ ID NO: 15, a CDR2 of amino acid sequence of SEQ ID NO: 138, and a CDR3 of amino acid sequence of SEQ ID NO: 288; 173 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 139, and a CDR3 of amino acid sequence of SEQ ID NO: 289; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 290; a CDR1 of amino acid sequence of SEQ ID NO: 16, a CDR2 of amino acid sequence of SEQ ID NO: 140, and a CDR3 of amino acid sequence of SEQ ID NO: 291; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 292; a CDR1 of amino acid sequence of SEQ ID NO: 17, a CDR2 of amino acid sequence of SEQ ID NO: 141, and a CDR3 of amino acid sequence of SEQ ID NO: 293; a CDR1 of amino acid sequence of SEQ ID NO: 18, a CDR2 of amino acid sequence of SEQ ID NO: 142, and a CDR3 of amino acid sequence of SEQ ID NO: 294; a CDR1 of amino acid sequence of SEQ ID NO: 19, a CDR2 of amino acid sequence of SEQ ID NO: 143, and a CDR3 of amino acid sequence of SEQ ID NO: 295; a CDR1 of amino acid sequence of SEQ ID NO: 20, and a CDR2 of amino acid sequence of SEQ ID NO: 144; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 145, and a CDR3 of amino acid sequence of SEQ ID NO: 296; a CDR1 of amino acid sequence of SEQ ID NO: 21, a CDR2 of amino acid sequence of SEQ ID NO: 146, and a CDR3 of amino acid sequence of SEQ ID NO: 297; a CDR1 of amino acid sequence of SEQ ID NO: 22, a CDR2 of amino acid sequence of SEQ ID NO: 147, and a CDR3 of amino acid sequence of SEQ ID NO: 298; a CDR1 of amino acid sequence of SEQ ID NO: 23, a CDR2 of amino acid sequence of SEQ ID NO: 148, and a CDR3 of amino acid sequence of SEQ ID NO: 299; a CDR1 of amino acid sequence of SEQ ID NO: 24, a CDR2 of amino acid sequence of SEQ ID NO: 149, and a CDR3 of amino acid sequence of SEQ ID NO: 300; a CDR1 of amino acid sequence of SEQ ID NO: 25, a CDR2 of amino acid sequence of SEQ ID NO: 150, and a CDR3 of amino acid sequence of SEQ ID NO: 301; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 302; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 151, and a CDR3 of amino acid sequence of SEQ ID NO: 303; a CDR1 of amino acid sequence of SEQ ID NO: 27, a CDR2 of amino acid sequence of SEQ ID NO: 152, and a CDR3 of amino acid sequence of SEQ ID NO: 304; 174 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 28, and a CDR2 of amino acid sequence of SEQ ID NO: 153; a CDR1 of amino acid sequence of SEQ ID NO: 29, a CDR2 of amino acid sequence of SEQ ID NO: 154, and a CDR3 of amino acid sequence of SEQ ID NO: 305; a CDR1 of amino acid sequence of SEQ ID NO: 30, a CDR2 of amino acid sequence of SEQ ID NO: 155, and a CDR3 of amino acid sequence of SEQ ID NO: 306; a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 156, and a CDR3 of amino acid sequence of SEQ ID NO: 307; a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 157, and a CDR3 of amino acid sequence of SEQ ID NO: 308; a CDR1 of amino acid sequence of SEQ ID NO: 32, and a CDR2 of amino acid sequence of SEQ ID NO: 158; a CDR1 of amino acid sequence of SEQ ID NO: 33, a CDR2 of amino acid sequence of SEQ ID NO: 159, and a CDR3 of amino acid sequence of SEQ ID NO: 309; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 160, and a CDR3 of amino acid sequence of SEQ ID NO: 310; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 161, and a CDR3 of amino acid sequence of SEQ ID NO: 311; a CDR1 of amino acid sequence of SEQ ID NO: 12, and a CDR2 of amino acid sequence of SEQ ID NO: 162; a CDR1 of amino acid sequence of SEQ ID NO: 35, a CDR2 of amino acid sequence of SEQ ID NO: 163, and a CDR3 of amino acid sequence of SEQ ID NO: 312; a CDR1 of amino acid sequence of SEQ ID NO: 36, a CDR2 of amino acid sequence of SEQ ID NO: 164, and a CDR3 of amino acid sequence of SEQ ID NO: 313; a CDR1 of amino acid sequence of SEQ ID NO: 37, a CDR2 of amino acid sequence of SEQ ID NO: 165, and a CDR3 of amino acid sequence of SEQ ID NO: 314; a CDR1 of amino acid sequence of SEQ ID NO: 38, and a CDR2 of amino acid sequence of SEQ ID NO: 166; a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 315; a CDR1 of amino acid sequence of SEQ ID NO: 39, a CDR2 of amino acid sequence of SEQ ID NO: 167, and a CDR3 of amino acid sequence of SEQ ID NO: 316; a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 317; 175 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 41, a CDR2 of amino acid sequence of SEQ ID NO: 169, and a CDR3 of amino acid sequence of SEQ ID NO: 318; a CDR1 of amino acid sequence of SEQ ID NO: 42, a CDR2 of amino acid sequence of SEQ ID NO: 170, and a CDR3 of amino acid sequence of SEQ ID NO: 319; a CDR1 of amino acid sequence of SEQ ID NO: 43, a CDR2 of amino acid sequence of SEQ ID NO: 171, and a CDR3 of amino acid sequence of SEQ ID NO: 320; a CDR1 of amino acid sequence of SEQ ID NO: 44, a CDR2 of amino acid sequence of SEQ ID NO: 172, and a CDR3 of amino acid sequence of SEQ ID NO: 321; a CDR1 of amino acid sequence of SEQ ID NO: 45, a CDR2 of amino acid sequence of SEQ ID NO: 173, and a CDR3 of amino acid sequence of SEQ ID NO: 322; a CDR1 of amino acid sequence of SEQ ID NO: 46, a CDR2 of amino acid sequence of SEQ ID NO: 174, and a CDR3 of amino acid sequence of SEQ ID NO: 323; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 324; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 175, and a CDR3 of amino acid sequence of SEQ ID NO: 325; a CDR1 of amino acid sequence of SEQ ID NO: 47, a CDR2 of amino acid sequence of SEQ ID NO: 176, and a CDR3 of amino acid sequence of SEQ ID NO: 326; a CDR1 of amino acid sequence of SEQ ID NO: 48, a CDR2 of amino acid sequence of SEQ ID NO: 177, and a CDR3 of amino acid sequence of SEQ ID NO: 327; a CDR1 of amino acid sequence of SEQ ID NO: 49, a CDR2 of amino acid sequence of SEQ ID NO: 178, and a CDR3 of amino acid sequence of SEQ ID NO: 328; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 179, and a CDR3 of amino acid sequence of SEQ ID NO: 329; a CDR1 of amino acid sequence of SEQ ID NO: 50, a CDR2 of amino acid sequence of SEQ ID NO: 180, and a CDR3 of amino acid sequence of SEQ ID NO: 330; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 181, and a CDR3 of amino acid sequence of SEQ ID NO: 331; a CDR1 of amino acid sequence of SEQ ID NO: 51, a CDR2 of amino acid sequence of SEQ ID NO: 182, and a CDR3 of amino acid sequence of SEQ ID NO: 332; a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 183, and a CDR3 of amino acid sequence of SEQ ID NO: 333; a CDR1 of amino acid sequence of SEQ ID NO: 53, a CDR2 of amino acid sequence of SEQ ID NO: 184, and a CDR3 of amino acid sequence of SEQ ID NO: 334; 176 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 54, and a CDR2 of amino acid sequence of SEQ ID NO: 185; a CDR1 of amino acid sequence of SEQ ID NO: 55, a CDR2 of amino acid sequence of SEQ ID NO: 186, and a CDR3 of amino acid sequence of SEQ ID NO: 335; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 336; a CDR1 of amino acid sequence of SEQ ID NO: 56, a CDR2 of amino acid sequence of SEQ ID NO: 187, and a CDR3 of amino acid sequence of SEQ ID NO: 337; a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 188, and a CDR3 of amino acid sequence of SEQ ID NO: 338; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 189, and a CDR3 of amino acid sequence of SEQ ID NO: 339; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 340; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 190, and a CDR3 of amino acid sequence of SEQ ID NO: 341; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 191, and a CDR3 of amino acid sequence of SEQ ID NO: 342; a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 192, and a CDR3 of amino acid sequence of SEQ ID NO: 343; a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 193, and a CDR3 of amino acid sequence of SEQ ID NO: 344; a CDR1 of amino acid sequence of SEQ ID NO: 58, a CDR2 of amino acid sequence of SEQ ID NO: 194, and a CDR3 of amino acid sequence of SEQ ID NO: 345; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 346; a CDR1 of amino acid sequence of SEQ ID NO: 59, a CDR2 of amino acid sequence of SEQ ID NO: 195, and a CDR3 of amino acid sequence of SEQ ID NO: 347; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 196, and a CDR3 of amino acid sequence of SEQ ID NO: 348; a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 349; a CDR1 of amino acid sequence of SEQ ID NO: 60, a CDR2 of amino acid sequence of SEQ ID NO: 197, and a CDR3 of amino acid sequence of SEQ ID NO: 350; 177 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 61, a CDR2 of amino acid sequence of SEQ ID NO: 198, and a CDR3 of amino acid sequence of SEQ ID NO: 351; a CDR1 of amino acid sequence of SEQ ID NO: 62, a CDR2 of amino acid sequence of SEQ ID NO: 199, and a CDR3 of amino acid sequence of SEQ ID NO: 352; a CDR1 of amino acid sequence of SEQ ID NO: 63, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 353; a CDR1 of amino acid sequence of SEQ ID NO: 64, a CDR2 of amino acid sequence of SEQ ID NO: 200, and a CDR3 of amino acid sequence of SEQ ID NO:

354.

20. A phage-displayed VHH library comprising a plurality of VHHs generated from P. aeruginosa.

21. The library of claim 20, wherein the P. aeruginosa is selected from the strains consisting of PAO1, PA14, PAK, and PA103.

22. The library of any one of claims 20-21, wherein the phage-displayed VHH library is generated in an alpaca.

23. The library of any one of claims 20-22, which is enriched for a subset of the phage- displayed VHH library that targets an antigen of interest on P. aeruginosa.

24. The library of claim 23, wherein the antigen of interest is an antigen presented on the surface of P. aeruginosa.

25. The library of any one of claims 23-24, wherein the antigen of interest is selected from the group consisting of a flagellar filament (FliC); a flagellar hook-basal body (HBB) and efflux-associated outer-membrane porins OprM, OprN, and OprJ.

26. The library of any one of claims 23-25, wherein the antigen of interest is OprM.

27. The library of any one of claims 23-26, which is depleted of the phage-displayed VHH library that do not bind to the antigen of interest.

28. The library of any one of claims 23-27, wherein the subset of VHH comprises at least 178 55382181.3Attorney Docket No.047162-7503WO1 (02594) one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125-200 (CDR2 sequences), and SEQ ID NOs: 276-354 (CDR3 sequences), optionally wherein the subset of VHHs comprises at least one of SEQ ID NOs: 2-64 (CDR1 sequences), at least one of SEQ ID NOs: 125-200 (CDR2 sequences), and at least one of SEQ ID NOs: 276-354 (CDR3 sequences).

29. The library of any one of claims 23-27, wherein the subset of VHH comprises at least one VHH comprising one of the following: a CDR1 of amino acid sequence of SEQ ID NO: 2, a CDR2 of amino acid sequence of SEQ ID NO: 125, and a CDR3 of amino acid sequence of SEQ ID NO: 276; a CDR1 of amino acid sequence of SEQ ID NO: 3, and a CDR2 of amino acid sequence of SEQ ID NO: 126; a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 277; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 128, and a CDR3 of amino acid sequence of SEQ ID NO: 278; a CDR1 of amino acid sequence of SEQ ID NO: 6, a CDR2 of amino acid sequence of SEQ ID NO: 129, and a CDR3 of amino acid sequence of SEQ ID NO: 279; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 130, and a CDR3 of amino acid sequence of SEQ ID NO:280; a CDR1 of amino acid sequence of SEQ ID NO: 8, a CDR2 of amino acid sequence of SEQ ID NO: 131, and a CDR3 of amino acid sequence of SEQ ID NO: 281; a CDR1 of amino acid sequence of SEQ ID NO: 9, a CDR2 of amino acid sequence of SEQ ID NO: 132, and a CDR3 of amino acid sequence of SEQ ID NO: 282; a CDR1 of amino acid sequence of SEQ ID NO: 10, and a CDR2 of amino acid sequence of SEQ ID NO: 133; a CDR1 of amino acid sequence of SEQ ID NO: 11, a CDR2 of amino acid sequence of SEQ ID NO: 134, and a CDR3 of amino acid sequence of SEQ ID NO: 283; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 135, and a CDR3 of amino acid sequence of SEQ ID NO: 284; a CDR1 of amino acid sequence of SEQ ID NO: 13, a CDR2 of amino acid sequence of SEQ ID NO: 136, and a CDR3 of amino acid sequence of SEQ ID NO: 285; a CDR1 of amino acid sequence of SEQ ID NO: 14, a CDR2 of amino acid sequence of SEQ ID NO: 137, and a CDR3 of amino acid sequence of SEQ ID NO: 286; 179 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 287; a CDR1 of amino acid sequence of SEQ ID NO: 15, a CDR2 of amino acid sequence of SEQ ID NO: 138, and a CDR3 of amino acid sequence of SEQ ID NO: 288; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 139, and a CDR3 of amino acid sequence of SEQ ID NO: 289; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 290; a CDR1 of amino acid sequence of SEQ ID NO: 16, a CDR2 of amino acid sequence of SEQ ID NO: 140, and a CDR3 of amino acid sequence of SEQ ID NO: 291; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 292; a CDR1 of amino acid sequence of SEQ ID NO: 17, a CDR2 of amino acid sequence of SEQ ID NO: 141, and a CDR3 of amino acid sequence of SEQ ID NO: 293; a CDR1 of amino acid sequence of SEQ ID NO: 18, a CDR2 of amino acid sequence of SEQ ID NO: 142, and a CDR3 of amino acid sequence of SEQ ID NO: 294; a CDR1 of amino acid sequence of SEQ ID NO: 19, a CDR2 of amino acid sequence of SEQ ID NO: 143, and a CDR3 of amino acid sequence of SEQ ID NO: 295; a CDR1 of amino acid sequence of SEQ ID NO: 20, and a CDR2 of amino acid sequence of SEQ ID NO: 144; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 145, and a CDR3 of amino acid sequence of SEQ ID NO: 296; a CDR1 of amino acid sequence of SEQ ID NO: 21, a CDR2 of amino acid sequence of SEQ ID NO: 146, and a CDR3 of amino acid sequence of SEQ ID NO: 297; a CDR1 of amino acid sequence of SEQ ID NO: 22, a CDR2 of amino acid sequence of SEQ ID NO: 147, and a CDR3 of amino acid sequence of SEQ ID NO: 298; a CDR1 of amino acid sequence of SEQ ID NO: 23, a CDR2 of amino acid sequence of SEQ ID NO: 148, and a CDR3 of amino acid sequence of SEQ ID NO: 299; a CDR1 of amino acid sequence of SEQ ID NO: 24, a CDR2 of amino acid sequence of SEQ ID NO: 149, and a CDR3 of amino acid sequence of SEQ ID NO: 300; a CDR1 of amino acid sequence of SEQ ID NO: 25, a CDR2 of amino acid sequence of SEQ ID NO: 150, and a CDR3 of amino acid sequence of SEQ ID NO: 301; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 302; 180 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 151, and a CDR3 of amino acid sequence of SEQ ID NO: 303; a CDR1 of amino acid sequence of SEQ ID NO: 27, a CDR2 of amino acid sequence of SEQ ID NO: 152, and a CDR3 of amino acid sequence of SEQ ID NO: 304; a CDR1 of amino acid sequence of SEQ ID NO: 28, and a CDR2 of amino acid sequence of SEQ ID NO: 153; a CDR1 of amino acid sequence of SEQ ID NO: 29, a CDR2 of amino acid sequence of SEQ ID NO: 154, and a CDR3 of amino acid sequence of SEQ ID NO: 305; a CDR1 of amino acid sequence of SEQ ID NO: 30, a CDR2 of amino acid sequence of SEQ ID NO: 155, and a CDR3 of amino acid sequence of SEQ ID NO: 306; a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 156, and a CDR3 of amino acid sequence of SEQ ID NO: 307; a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 157, and a CDR3 of amino acid sequence of SEQ ID NO: 308; a CDR1 of amino acid sequence of SEQ ID NO: 32, and a CDR2 of amino acid sequence of SEQ ID NO: 158; a CDR1 of amino acid sequence of SEQ ID NO: 33, a CDR2 of amino acid sequence of SEQ ID NO: 159, and a CDR3 of amino acid sequence of SEQ ID NO: 309; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 160, and a CDR3 of amino acid sequence of SEQ ID NO: 310; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 161, and a CDR3 of amino acid sequence of SEQ ID NO: 311; a CDR1 of amino acid sequence of SEQ ID NO: 12, and a CDR2 of amino acid sequence of SEQ ID NO: 162; a CDR1 of amino acid sequence of SEQ ID NO: 35, a CDR2 of amino acid sequence of SEQ ID NO: 163, and a CDR3 of amino acid sequence of SEQ ID NO: 312; a CDR1 of amino acid sequence of SEQ ID NO: 36, a CDR2 of amino acid sequence of SEQ ID NO: 164, and a CDR3 of amino acid sequence of SEQ ID NO: 313; a CDR1 of amino acid sequence of SEQ ID NO: 37, a CDR2 of amino acid sequence of SEQ ID NO: 165, and a CDR3 of amino acid sequence of SEQ ID NO: 314; a CDR1 of amino acid sequence of SEQ ID NO: 38, and a CDR2 of amino acid sequence of SEQ ID NO: 166; a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 315; 181 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 39, a CDR2 of amino acid sequence of SEQ ID NO: 167, and a CDR3 of amino acid sequence of SEQ ID NO: 316; a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 317; a CDR1 of amino acid sequence of SEQ ID NO: 41, a CDR2 of amino acid sequence of SEQ ID NO: 169, and a CDR3 of amino acid sequence of SEQ ID NO: 318; a CDR1 of amino acid sequence of SEQ ID NO: 42, a CDR2 of amino acid sequence of SEQ ID NO: 170, and a CDR3 of amino acid sequence of SEQ ID NO: 319; a CDR1 of amino acid sequence of SEQ ID NO: 43, a CDR2 of amino acid sequence of SEQ ID NO: 171, and a CDR3 of amino acid sequence of SEQ ID NO: 320; a CDR1 of amino acid sequence of SEQ ID NO: 44, a CDR2 of amino acid sequence of SEQ ID NO: 172, and a CDR3 of amino acid sequence of SEQ ID NO: 321; a CDR1 of amino acid sequence of SEQ ID NO: 45, a CDR2 of amino acid sequence of SEQ ID NO: 173, and a CDR3 of amino acid sequence of SEQ ID NO: 322; a CDR1 of amino acid sequence of SEQ ID NO: 46, a CDR2 of amino acid sequence of SEQ ID NO: 174, and a CDR3 of amino acid sequence of SEQ ID NO: 323; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 324; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 175, and a CDR3 of amino acid sequence of SEQ ID NO: 325; a CDR1 of amino acid sequence of SEQ ID NO: 47, a CDR2 of amino acid sequence of SEQ ID NO: 176, and a CDR3 of amino acid sequence of SEQ ID NO: 326; a CDR1 of amino acid sequence of SEQ ID NO: 48, a CDR2 of amino acid sequence of SEQ ID NO: 177, and a CDR3 of amino acid sequence of SEQ ID NO: 327; a CDR1 of amino acid sequence of SEQ ID NO: 49, a CDR2 of amino acid sequence of SEQ ID NO: 178, and a CDR3 of amino acid sequence of SEQ ID NO: 328; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 179, and a CDR3 of amino acid sequence of SEQ ID NO: 329; a CDR1 of amino acid sequence of SEQ ID NO: 50, a CDR2 of amino acid sequence of SEQ ID NO: 180, and a CDR3 of amino acid sequence of SEQ ID NO: 330; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 181, and a CDR3 of amino acid sequence of SEQ ID NO: 331; a CDR1 of amino acid sequence of SEQ ID NO: 51, a CDR2 of amino acid sequence of SEQ ID NO: 182, and a CDR3 of amino acid sequence of SEQ ID NO: 332; 182 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 183, and a CDR3 of amino acid sequence of SEQ ID NO: 333; a CDR1 of amino acid sequence of SEQ ID NO: 53, a CDR2 of amino acid sequence of SEQ ID NO: 184, and a CDR3 of amino acid sequence of SEQ ID NO: 334; a CDR1 of amino acid sequence of SEQ ID NO: 54, and a CDR2 of amino acid sequence of SEQ ID NO: 185; a CDR1 of amino acid sequence of SEQ ID NO: 55, a CDR2 of amino acid sequence of SEQ ID NO: 186, and a CDR3 of amino acid sequence of SEQ ID NO: 335; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 336; a CDR1 of amino acid sequence of SEQ ID NO: 56, a CDR2 of amino acid sequence of SEQ ID NO: 187, and a CDR3 of amino acid sequence of SEQ ID NO: 337; a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 188, and a CDR3 of amino acid sequence of SEQ ID NO: 338; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 189, and a CDR3 of amino acid sequence of SEQ ID NO: 339; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 340; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 190, and a CDR3 of amino acid sequence of SEQ ID NO: 341; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 191, and a CDR3 of amino acid sequence of SEQ ID NO: 342; a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 192, and a CDR3 of amino acid sequence of SEQ ID NO: 343; a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 193, and a CDR3 of amino acid sequence of SEQ ID NO: 344; a CDR1 of amino acid sequence of SEQ ID NO: 58, a CDR2 of amino acid sequence of SEQ ID NO: 194, and a CDR3 of amino acid sequence of SEQ ID NO: 345; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 346; a CDR1 of amino acid sequence of SEQ ID NO: 59, a CDR2 of amino acid sequence of SEQ ID NO: 195, and a CDR3 of amino acid sequence of SEQ ID NO: 347; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 196, and a CDR3 of amino acid sequence of SEQ ID NO: 348; 183 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 349; a CDR1 of amino acid sequence of SEQ ID NO: 60, a CDR2 of amino acid sequence of SEQ ID NO: 197, and a CDR3 of amino acid sequence of SEQ ID NO: 350; a CDR1 of amino acid sequence of SEQ ID NO: 61, a CDR2 of amino acid sequence of SEQ ID NO: 198, and a CDR3 of amino acid sequence of SEQ ID NO: 351; a CDR1 of amino acid sequence of SEQ ID NO: 62, a CDR2 of amino acid sequence of SEQ ID NO: 199, and a CDR3 of amino acid sequence of SEQ ID NO: 352; a CDR1 of amino acid sequence of SEQ ID NO: 63, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 353; a CDR1 of amino acid sequence of SEQ ID NO: 64, a CDR2 of amino acid sequence of SEQ ID NO: 200, and a CDR3 of amino acid sequence of SEQ ID NO: 354; 30. A VHH comprising one of SEQ ID NOs: 2-64 (CDR1 sequences), SEQ ID NOs: 125- 200 (CDR2 sequences), and SEQ ID NOs: 276-354 (CDR3 sequences), optionally wherein the VHH comprises at least one of SEQ ID NOs: 2-64 (CDR1 sequences), at least one of SEQ ID NOs: 125-200 (CDR2 sequences), and at least one of SEQ ID NOs: 276-354 (CDR3 sequences).

31. The VHH of claim 30, wherein the VHH comprises at least one of the following: the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 65, SEQ ID NO: 125, SEQ ID NO: 201, and SEQ ID NO: 276; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 66, SEQ ID NO: 126, and SEQ ID NO: 202; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 203, and SEQ ID NO: 277; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 68, SEQ ID NO: 128, SEQ ID NO: 204, and SEQ ID NO: 278; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 69, SEQ ID NO: 129, SEQ ID NO: 205, and SEQ ID NO: 279; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 70, SEQ ID NO: 130, SEQ ID NO: 206, and SEQ ID NO: 280; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 8, SEQ ID NO: 71, SEQ ID NO: 131, SEQ ID NO: 207, and SEQ ID NO: 281; 184 55382181.3Attorney Docket No.047162-7503WO1 (02594) the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 72, SEQ ID NO: 132, SEQ ID NO: 208, and SEQ ID NO: 282; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 73, and SEQ ID NO: 133; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 74, SEQ ID NO: 134, SEQ ID NO: 209, and SEQ ID NO: 283; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 75, SEQ ID NO: 135, SEQ ID NO: 210, and SEQ ID NO: 284; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 13, SEQ ID NO: 76, SEQ ID NO: 136, SEQ ID NO: 211, and SEQ ID NO: 285; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 77, SEQ ID NO: 137, SEQ ID NO: 212, and SEQ ID NO: 286; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 287; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 15, SEQ ID NO: 78, SEQ ID NO: 138, SEQ ID NO: 206, and SEQ ID NO: 288; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 79, SEQ ID NO: 139, SEQ ID NO: 213, and SEQ ID NO: 289; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 214, and SEQ ID NO: 290; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 16, SEQ ID NO: 80, SEQ ID NO: 140, SEQ ID NO: 215, and SEQ ID NO: 291; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 216, and SEQ ID NO: 292; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 16, SEQ ID NO: 80, SEQ ID NO: 140, SEQ ID NO: 215, and SEQ ID NO: 291; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 216, and SEQ ID NO: 292; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 17, SEQ ID NO: 81, SEQ ID NO: 141, SEQ ID NO: 217, and SEQ ID NO: 293; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 18, SEQ ID NO: 82, SEQ ID NO: 142, SEQ ID NO: 218, and SEQ ID NO: 294; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 19, SEQ ID NO: 83, SEQ ID NO: 143, SEQ ID NO: 219, and SEQ ID NO: 295; 185 55382181.3Attorney Docket No.047162-7503WO1 (02594) the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 20, SEQ ID NO: 84, SEQ ID NO: 144, and SEQ ID NO: 220; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 85, SEQ ID NO: 145, SEQ ID NO: 206, and SEQ ID NO: 296; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 21, SEQ ID NO: 86, SEQ ID NO: 146, SEQ ID NO: 221, and SEQ ID NO: 297; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 87, SEQ ID NO: 147, SEQ ID NO: 222, and SEQ ID NO: 298; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 23, SEQ ID NO: 88, SEQ ID NO: 148, SEQ ID NO: 223, and SEQ ID NO: 299; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 24, SEQ ID NO: 89, SEQ ID NO: 149, SEQ ID NO: 224, and SEQ ID NO: 300; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 25, SEQ ID NO: 90, SEQ ID NO: 150, SEQ ID NO: 225, and SEQ ID NO: 301; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 26, SEQ ID NO: 91, SEQ ID NO: 127, SEQ ID NO: 226, and SEQ ID NO: 302; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 151, SEQ ID NO: 206, and SEQ ID NO: 303; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 27, SEQ ID NO: 92, SEQ ID NO: 152, SEQ ID NO: 227, and SEQ ID NO: 304; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 28, SEQ ID NO: 93, SEQ ID NO: 153, and SEQ ID NO: 228; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 29, SEQ ID NO: 94, SEQ ID NO: 154, SEQ ID NO: 229, and SEQ ID NO: 305; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 30, SEQ ID NO: 95, SEQ ID NO: 155, SEQ ID NO: 230, and SEQ ID NO: 306; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 31, SEQ ID NO: 96, SEQ ID NO: 156, SEQ ID NO: 231, and SEQ ID NO: 307; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 31, SEQ ID NO: 67, SEQ ID NO: 157, SEQ ID NO: 232, and SEQ ID NO: 308; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 32, SEQ ID NO: 96, SEQ ID NO: 158, and SEQ ID NO: 233; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 33, SEQ ID NO: 67, SEQ ID NO: 159, SEQ ID NO: 234, and SEQ ID NO: 309; 186 55382181.3Attorney Docket No.047162-7503WO1 (02594) the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 34, SEQ ID NO: 97, SEQ ID NO: 160, SEQ ID NO: 235, and SEQ ID NO: 310; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 83, SEQ ID NO: 161, SEQ ID NO: 236, and SEQ ID NO: 311; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 98, SEQ ID NO: 162, and SEQ ID NO: 237; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 99, SEQ ID NO: 163, SEQ ID NO: 238, and SEQ ID NO: 312; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 36, SEQ ID NO: 100, SEQ ID NO: 164, SEQ ID NO: 239, and SEQ ID NO: 313; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 37, SEQ ID NO: 101, SEQ ID NO: 165, SEQ ID NO: 240, and SEQ ID NO: 314; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 38, SEQ ID NO: 83, SEQ ID NO: 166, and SEQ ID NO: 241; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 315; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 39, SEQ ID NO: 102, SEQ ID NO: 167, SEQ ID NO: 242, and SEQ ID NO: 316; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 40, SEQ ID NO: 103, SEQ ID NO: 168, SEQ ID NO: 243, and SEQ ID NO: 317; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 41, SEQ ID NO: 104, SEQ ID NO: 169, SEQ ID NO: 244, and SEQ ID NO: 318; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 42, SEQ ID NO: 105, SEQ ID NO: 170, SEQ ID NO: 206, and SEQ ID NO: 319; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 43, SEQ ID NO: 106, SEQ ID NO: 171, SEQ ID NO: 245, and SEQ ID NO: 320; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 44, SEQ ID NO: 107, SEQ ID NO: 172, SEQ ID NO: 246, and SEQ ID NO: 321; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 173, SEQ ID NO: 247, and SEQ ID NO: 322; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 46, SEQ ID NO: 69, SEQ ID NO: 174, SEQ ID NO: 248, and SEQ ID NO: 323; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 324; 187 55382181.3Attorney Docket No.047162-7503WO1 (02594) the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 47, SEQ ID NO: 108, SEQ ID NO: 176, SEQ ID NO: 250, and SEQ ID NO: 326; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 48, SEQ ID NO: 109, SEQ ID NO: 177, SEQ ID NO: 251, and SEQ ID NO: 327; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 49, SEQ ID NO: 110, SEQ ID NO: 178, SEQ ID NO: 252, and SEQ ID NO: 328; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 179, SEQ ID NO: 253, and SEQ ID NO: 329; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 67, SEQ ID NO: 180, SEQ ID NO: 254, and SEQ ID NO: 330; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 67, SEQ ID NO: 181, SEQ ID NO: 255, and SEQ ID NO: 331; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 51, SEQ ID NO: 97, SEQ ID NO: 182, SEQ ID NO: 256, and SEQ ID NO: 332; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 53, SEQ ID NO: 112, SEQ ID NO: 184, SEQ ID NO: 258, and SEQ ID NO: 334; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 52, SEQ ID NO: 111, SEQ ID NO: 183, SEQ ID NO: 257, and SEQ ID NO: 333; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 54, SEQ ID NO: 97, SEQ ID NO: 185, and SEQ ID NO: 247; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 55, SEQ ID NO: 113, SEQ ID NO: 186, SEQ ID NO: 259, and SEQ ID NO: 335; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 34, SEQ ID NO: 114, SEQ ID NO: 126, SEQ ID NO: 260, and SEQ ID NO: 336; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 56, SEQ ID NO: 115, SEQ ID NO: 187, SEQ ID NO: 261, and SEQ ID NO: 337; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 57, SEQ ID NO: 96, SEQ ID NO: 188, SEQ ID NO: 262, and SEQ ID NO: 338; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 67, SEQ ID NO: 189, SEQ ID NO: 206, and SEQ ID NO: 339; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 116, SEQ ID NO: 127, SEQ ID NO: 206, and SEQ ID NO: 340; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 12, SEQ ID NO: 117, SEQ ID NO: 190, SEQ ID NO: 263, and SEQ ID NO: 341; 188 55382181.3Attorney Docket No.047162-7503WO1 (02594) the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 26, SEQ ID NO: 91, SEQ ID NO: 191, SEQ ID NO: 264, and SEQ ID NO: 342; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 52, SEQ ID NO: 67, SEQ ID NO: 192, SEQ ID NO: 265, and SEQ ID NO: 343; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 57, SEQ ID NO: 119, SEQ ID NO:193, SEQ ID NO: 266, and SEQ ID NO: 344; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 58, SEQ ID NO: 120, SEQ ID NO: 194, SEQ ID NO: 267, and SEQ ID NO: 345; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 126, SEQ ID NO: 268, and SEQ ID NO: 346; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 59, SEQ ID NO: 67, SEQ ID NO: 195, SEQ ID NO: 269, and SEQ ID NO: 347; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 67, SEQ ID NO: 196, SEQ ID NO: 270, and SEQ ID NO: 348; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 40, SEQ ID NO: 103, SEQ ID NO: 168, SEQ ID NO: 271, and SEQ ID NO: 349; the amino acid sequences of SEQ ID NO:1, SEQ ID NO: 60, SEQ ID NO: 121, SEQ ID NO: 197, SEQ ID NO: 272, and SEQ ID NO: 350; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 61, SEQ ID NO: 122, SEQ ID NO: 198, SEQ ID NO: 273, and SEQ ID NO: 351; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 62, SEQ ID NO: 123, SEQ ID NO: 199, SEQ ID NO: 274, and SEQ ID NO: 352; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 63, SEQ ID NO: 114, SEQ ID NO: 126, SEQ ID NO: 260, and SEQ ID NO: 353; the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 200, SEQ ID NO: 275, and SEQ ID NO:

354.

32. The VHH of any one of claims 30-31, wherein the VHH comprises at least one of the following: a CDR1 of amino acid sequence of SEQ ID NO: 2, a CDR2 of amino acid sequence of SEQ ID NO: 125, and a CDR3 of amino acid sequence of SEQ ID NO: 276; a CDR1 of amino acid sequence of SEQ ID NO: 3, and a CDR2 of amino acid sequence of SEQ ID NO: 126; 189 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 277; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 128, and a CDR3 of amino acid sequence of SEQ ID NO: 278; a CDR1 of amino acid sequence of SEQ ID NO: 6, a CDR2 of amino acid sequence of SEQ ID NO: 129, and a CDR3 of amino acid sequence of SEQ ID NO: 279; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 130, and a CDR3 of amino acid sequence of SEQ ID NO:280; a CDR1 of amino acid sequence of SEQ ID NO: 8, a CDR2 of amino acid sequence of SEQ ID NO: 131, and a CDR3 of amino acid sequence of SEQ ID NO: 281; a CDR1 of amino acid sequence of SEQ ID NO: 9, a CDR2 of amino acid sequence of SEQ ID NO: 132, and a CDR3 of amino acid sequence of SEQ ID NO: 282; a CDR1 of amino acid sequence of SEQ ID NO: 10, and a CDR2 of amino acid sequence of SEQ ID NO: 133; a CDR1 of amino acid sequence of SEQ ID NO: 11, a CDR2 of amino acid sequence of SEQ ID NO: 134, and a CDR3 of amino acid sequence of SEQ ID NO: 283; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 135, and a CDR3 of amino acid sequence of SEQ ID NO: 284; a CDR1 of amino acid sequence of SEQ ID NO: 13, a CDR2 of amino acid sequence of SEQ ID NO: 136, and a CDR3 of amino acid sequence of SEQ ID NO: 285; a CDR1 of amino acid sequence of SEQ ID NO: 14, a CDR2 of amino acid sequence of SEQ ID NO: 137, and a CDR3 of amino acid sequence of SEQ ID NO: 286; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 287; a CDR1 of amino acid sequence of SEQ ID NO: 15, a CDR2 of amino acid sequence of SEQ ID NO: 138, and a CDR3 of amino acid sequence of SEQ ID NO: 288; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 139, and a CDR3 of amino acid sequence of SEQ ID NO: 289; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 290; a CDR1 of amino acid sequence of SEQ ID NO: 16, a CDR2 of amino acid sequence of SEQ ID NO: 140, and a CDR3 of amino acid sequence of SEQ ID NO: 291; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 292; 190 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 17, a CDR2 of amino acid sequence of SEQ ID NO: 141, and a CDR3 of amino acid sequence of SEQ ID NO: 293; a CDR1 of amino acid sequence of SEQ ID NO: 18, a CDR2 of amino acid sequence of SEQ ID NO: 142, and a CDR3 of amino acid sequence of SEQ ID NO: 294; a CDR1 of amino acid sequence of SEQ ID NO: 19, a CDR2 of amino acid sequence of SEQ ID NO: 143, and a CDR3 of amino acid sequence of SEQ ID NO: 295; a CDR1 of amino acid sequence of SEQ ID NO: 20, and a CDR2 of amino acid sequence of SEQ ID NO: 144; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 145, and a CDR3 of amino acid sequence of SEQ ID NO: 296; a CDR1 of amino acid sequence of SEQ ID NO: 21, a CDR2 of amino acid sequence of SEQ ID NO: 146, and a CDR3 of amino acid sequence of SEQ ID NO: 297; a CDR1 of amino acid sequence of SEQ ID NO: 22, a CDR2 of amino acid sequence of SEQ ID NO: 147, and a CDR3 of amino acid sequence of SEQ ID NO: 298; a CDR1 of amino acid sequence of SEQ ID NO: 23, a CDR2 of amino acid sequence of SEQ ID NO: 148, and a CDR3 of amino acid sequence of SEQ ID NO: 299; a CDR1 of amino acid sequence of SEQ ID NO: 24, a CDR2 of amino acid sequence of SEQ ID NO: 149, and a CDR3 of amino acid sequence of SEQ ID NO: 300; a CDR1 of amino acid sequence of SEQ ID NO: 25, a CDR2 of amino acid sequence of SEQ ID NO: 150, and a CDR3 of amino acid sequence of SEQ ID NO: 301; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 302; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 151, and a CDR3 of amino acid sequence of SEQ ID NO: 303; a CDR1 of amino acid sequence of SEQ ID NO: 27, a CDR2 of amino acid sequence of SEQ ID NO: 152, and a CDR3 of amino acid sequence of SEQ ID NO: 304; a CDR1 of amino acid sequence of SEQ ID NO: 28, and a CDR2 of amino acid sequence of SEQ ID NO: 153; a CDR1 of amino acid sequence of SEQ ID NO: 29, a CDR2 of amino acid sequence of SEQ ID NO: 154, and a CDR3 of amino acid sequence of SEQ ID NO: 305; a CDR1 of amino acid sequence of SEQ ID NO: 30, a CDR2 of amino acid sequence of SEQ ID NO: 155, and a CDR3 of amino acid sequence of SEQ ID NO: 306; a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 156, and a CDR3 of amino acid sequence of SEQ ID NO: 307; 191 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 31, a CDR2 of amino acid sequence of SEQ ID NO: 157, and a CDR3 of amino acid sequence of SEQ ID NO: 308; a CDR1 of amino acid sequence of SEQ ID NO: 32, and a CDR2 of amino acid sequence of SEQ ID NO: 158; a CDR1 of amino acid sequence of SEQ ID NO: 33, a CDR2 of amino acid sequence of SEQ ID NO: 159, and a CDR3 of amino acid sequence of SEQ ID NO: 309; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 160, and a CDR3 of amino acid sequence of SEQ ID NO: 310; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 161, and a CDR3 of amino acid sequence of SEQ ID NO: 311; a CDR1 of amino acid sequence of SEQ ID NO: 12, and a CDR2 of amino acid sequence of SEQ ID NO: 162; a CDR1 of amino acid sequence of SEQ ID NO: 35, a CDR2 of amino acid sequence of SEQ ID NO: 163, and a CDR3 of amino acid sequence of SEQ ID NO: 312; a CDR1 of amino acid sequence of SEQ ID NO: 36, a CDR2 of amino acid sequence of SEQ ID NO: 164, and a CDR3 of amino acid sequence of SEQ ID NO: 313; a CDR1 of amino acid sequence of SEQ ID NO: 37, a CDR2 of amino acid sequence of SEQ ID NO: 165, and a CDR3 of amino acid sequence of SEQ ID NO: 314; a CDR1 of amino acid sequence of SEQ ID NO: 38, and a CDR2 of amino acid sequence of SEQ ID NO: 166; a CDR1 of amino acid sequence of SEQ ID NO: 4, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 315; a CDR1 of amino acid sequence of SEQ ID NO: 39, a CDR2 of amino acid sequence of SEQ ID NO: 167, and a CDR3 of amino acid sequence of SEQ ID NO: 316; a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 317; a CDR1 of amino acid sequence of SEQ ID NO: 41, a CDR2 of amino acid sequence of SEQ ID NO: 169, and a CDR3 of amino acid sequence of SEQ ID NO: 318; a CDR1 of amino acid sequence of SEQ ID NO: 42, a CDR2 of amino acid sequence of SEQ ID NO: 170, and a CDR3 of amino acid sequence of SEQ ID NO: 319; a CDR1 of amino acid sequence of SEQ ID NO: 43, a CDR2 of amino acid sequence of SEQ ID NO: 171, and a CDR3 of amino acid sequence of SEQ ID NO: 320; a CDR1 of amino acid sequence of SEQ ID NO: 44, a CDR2 of amino acid sequence of SEQ ID NO: 172, and a CDR3 of amino acid sequence of SEQ ID NO: 321; 192 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 45, a CDR2 of amino acid sequence of SEQ ID NO: 173, and a CDR3 of amino acid sequence of SEQ ID NO: 322; a CDR1 of amino acid sequence of SEQ ID NO: 46, a CDR2 of amino acid sequence of SEQ ID NO: 174, and a CDR3 of amino acid sequence of SEQ ID NO: 323; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 324; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 175, and a CDR3 of amino acid sequence of SEQ ID NO: 325; a CDR1 of amino acid sequence of SEQ ID NO: 47, a CDR2 of amino acid sequence of SEQ ID NO: 176, and a CDR3 of amino acid sequence of SEQ ID NO: 326; a CDR1 of amino acid sequence of SEQ ID NO: 48, a CDR2 of amino acid sequence of SEQ ID NO: 177, and a CDR3 of amino acid sequence of SEQ ID NO: 327; a CDR1 of amino acid sequence of SEQ ID NO: 49, a CDR2 of amino acid sequence of SEQ ID NO: 178, and a CDR3 of amino acid sequence of SEQ ID NO: 328; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 179, and a CDR3 of amino acid sequence of SEQ ID NO: 329; a CDR1 of amino acid sequence of SEQ ID NO: 50, a CDR2 of amino acid sequence of SEQ ID NO: 180, and a CDR3 of amino acid sequence of SEQ ID NO: 330; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 181, and a CDR3 of amino acid sequence of SEQ ID NO: 331; a CDR1 of amino acid sequence of SEQ ID NO: 51, a CDR2 of amino acid sequence of SEQ ID NO: 182, and a CDR3 of amino acid sequence of SEQ ID NO: 332; a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 183, and a CDR3 of amino acid sequence of SEQ ID NO: 333; a CDR1 of amino acid sequence of SEQ ID NO: 53, a CDR2 of amino acid sequence of SEQ ID NO: 184, and a CDR3 of amino acid sequence of SEQ ID NO: 334; a CDR1 of amino acid sequence of SEQ ID NO: 54, and a CDR2 of amino acid sequence of SEQ ID NO: 185; a CDR1 of amino acid sequence of SEQ ID NO: 55, a CDR2 of amino acid sequence of SEQ ID NO: 186, and a CDR3 of amino acid sequence of SEQ ID NO: 335; a CDR1 of amino acid sequence of SEQ ID NO: 34, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 336; a CDR1 of amino acid sequence of SEQ ID NO: 56, a CDR2 of amino acid sequence of SEQ ID NO: 187, and a CDR3 of amino acid sequence of SEQ ID NO: 337; 193 55382181.3Attorney Docket No.047162-7503WO1 (02594) a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 188, and a CDR3 of amino acid sequence of SEQ ID NO: 338; a CDR1 of amino acid sequence of SEQ ID NO: 5, a CDR2 of amino acid sequence of SEQ ID NO: 189, and a CDR3 of amino acid sequence of SEQ ID NO: 339; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 127, and a CDR3 of amino acid sequence of SEQ ID NO: 340; a CDR1 of amino acid sequence of SEQ ID NO: 12, a CDR2 of amino acid sequence of SEQ ID NO: 190, and a CDR3 of amino acid sequence of SEQ ID NO: 341; a CDR1 of amino acid sequence of SEQ ID NO: 26, a CDR2 of amino acid sequence of SEQ ID NO: 191, and a CDR3 of amino acid sequence of SEQ ID NO: 342; a CDR1 of amino acid sequence of SEQ ID NO: 52, a CDR2 of amino acid sequence of SEQ ID NO: 192, and a CDR3 of amino acid sequence of SEQ ID NO: 343; a CDR1 of amino acid sequence of SEQ ID NO: 57, a CDR2 of amino acid sequence of SEQ ID NO: 193, and a CDR3 of amino acid sequence of SEQ ID NO: 344; a CDR1 of amino acid sequence of SEQ ID NO: 58, a CDR2 of amino acid sequence of SEQ ID NO: 194, and a CDR3 of amino acid sequence of SEQ ID NO: 345; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 346; a CDR1 of amino acid sequence of SEQ ID NO: 59, a CDR2 of amino acid sequence of SEQ ID NO: 195, and a CDR3 of amino acid sequence of SEQ ID NO: 347; a CDR1 of amino acid sequence of SEQ ID NO: 7, a CDR2 of amino acid sequence of SEQ ID NO: 196, and a CDR3 of amino acid sequence of SEQ ID NO: 348; a CDR1 of amino acid sequence of SEQ ID NO: 40, a CDR2 of amino acid sequence of SEQ ID NO: 168, and a CDR3 of amino acid sequence of SEQ ID NO: 349; a CDR1 of amino acid sequence of SEQ ID NO: 60, a CDR2 of amino acid sequence of SEQ ID NO: 197, and a CDR3 of amino acid sequence of SEQ ID NO: 350; a CDR1 of amino acid sequence of SEQ ID NO: 61, a CDR2 of amino acid sequence of SEQ ID NO: 198, and a CDR3 of amino acid sequence of SEQ ID NO: 351; a CDR1 of amino acid sequence of SEQ ID NO: 62, a CDR2 of amino acid sequence of SEQ ID NO: 199, and a CDR3 of amino acid sequence of SEQ ID NO: 352; a CDR1 of amino acid sequence of SEQ ID NO: 63, a CDR2 of amino acid sequence of SEQ ID NO: 126, and a CDR3 of amino acid sequence of SEQ ID NO: 353; a CDR1 of amino acid sequence of SEQ ID NO: 64, a CDR2 of amino acid sequence of SEQ ID NO: 200, and a CDR3 of amino acid sequence of SEQ ID NO:

354. 194 55382181.3Attorney Docket No.047162-7503WO1 (02594) 33. The VHH of any one of claims 30-32, wherein the VHH comprises at least one of the following: the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 2—SEQ ID NO: 65—SEQ ID NO: 125—SEQ ID NO: 201—SEQ ID NO: 276; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 3—SEQ ID NO: 66—SEQ ID NO: 126—SEQ ID NO: 202; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 4—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 203—SEQ ID NO: 277; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 68—SEQ ID NO: 128—SEQ ID NO: 204—SEQ ID NO: 278; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 6—SEQ ID NO: 69—SEQ ID NO: 129—SEQ ID NO: 205—SEQ ID NO: 279; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 70—SEQ ID NO: 130—SEQ ID NO: 206—SEQ ID NO: 280; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 8—SEQ ID NO: 71—SEQ ID NO: 131—SEQ ID NO: 207—SEQ ID NO: 281; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 9—SEQ ID NO: 72—SEQ ID NO: 132—SEQ ID NO: 208—SEQ ID NO: 282; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 10—SEQ ID NO: 73— SEQ ID NO: 133; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 11—SEQ ID NO: 74— SEQ ID NO: 134—SEQ ID NO: 209—SEQ ID NO: 283; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 75— SEQ ID NO: 135—SEQ ID NO: 210—SEQ ID NO: 284; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 13—SEQ ID NO: 76— SEQ ID NO: 136—SEQ ID NO: 211—SEQ ID NO: 285; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 14—SEQ ID NO: 77— SEQ ID NO: 137—SEQ ID NO: 212—SEQ ID NO: 286; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 287; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 15—SEQ ID NO: 78— SEQ ID NO: 138—SEQ ID NO: 206—SEQ ID NO: 288; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 79—SEQ 195 55382181.3Attorney Docket No.047162-7503WO1 (02594) ID NO: 139—SEQ ID NO: 213—SEQ ID NO: 289; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 214—SEQ ID NO: 290; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 16—SEQ ID NO: 80— SEQ ID NO: 140—SEQ ID NO: 215—SEQ ID NO: 291; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 216—SEQ ID NO: 292; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 16—SEQ ID NO: 80— SEQ ID NO: 140—SEQ ID NO: 215—SEQ ID NO: 291; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 216—SEQ ID NO: 292; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 17—SEQ ID NO: 81— SEQ ID NO: 141—SEQ ID NO: 217—SEQ ID NO: 293; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 18—SEQ ID NO: 82— SEQ ID NO: 142—SEQ ID NO: 218—SEQ ID NO: 294; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 19—SEQ ID NO: 83— SEQ ID NO: 143—SEQ ID NO: 219—SEQ ID NO: 295; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 20—SEQ ID NO: 84— SEQ ID NO: 144—SEQ ID NO: 220; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 85—SEQ ID NO: 145—SEQ ID NO: 206—SEQ ID NO: 296; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 21—SEQ ID NO: 86— SEQ ID NO: 146—SEQ ID NO: 221—SEQ ID NO: 297; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 22—SEQ ID NO: 87— SEQ ID NO: 147—SEQ ID NO: 222—SEQ ID NO: 298; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 23—SEQ ID NO: 88— SEQ ID NO: 148—SEQ ID NO: 223—SEQ ID NO: 299; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 24—SEQ ID NO: 89— SEQ ID NO: 149—SEQ ID NO: 224—SEQ ID NO: 300; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 25—SEQ ID NO: 90— SEQ ID NO: 150—SEQ ID NO: 225—SEQ ID NO: 301; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 26—SEQ ID NO: 91— SEQ ID NO: 127—SEQ ID NO: 226—SEQ ID NO: 302; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ 196 55382181.3Attorney Docket No.047162-7503WO1 (02594) ID NO: 151—SEQ ID NO: 206—SEQ ID NO: 303; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 27—SEQ ID NO: 92— SEQ ID NO: 152—SEQ ID NO: 227—SEQ ID NO: 304; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 28—SEQ ID NO: 93— SEQ ID NO: 153—SEQ ID NO: 228; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 29—SEQ ID NO: 94— SEQ ID NO: 154—SEQ ID NO: 229—SEQ ID NO: 305; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 30—SEQ ID NO: 95— SEQ ID NO: 155—SEQ ID NO: 230—SEQ ID NO: 306; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 31—SEQ ID NO: 96— SEQ ID NO: 156—SEQ ID NO: 231—SEQ ID NO: 307; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 31—SEQ ID NO: 67— SEQ ID NO: 157—SEQ ID NO: 232—SEQ ID NO: 308; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 32—SEQ ID NO: 96— SEQ ID NO: 158—SEQ ID NO: 233; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 33—SEQ ID NO: 67— SEQ ID NO: 159—SEQ ID NO: 234—SEQ ID NO: 309; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 34—SEQ ID NO: 97— SEQ ID NO: 160—SEQ ID NO: 235—SEQ ID NO: 310; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 83—SEQ ID NO: 161—SEQ ID NO: 236—SEQ ID NO: 311; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 98— SEQ ID NO: 162—SEQ ID NO: 237; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 35—SEQ ID NO: 99— SEQ ID NO: 163—SEQ ID NO: 238—SEQ ID NO: 312; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 36—SEQ ID NO: 100— SEQ ID NO: 164—SEQ ID NO: 239—SEQ ID NO: 313; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 37—SEQ ID NO: 101— SEQ ID NO: 165—SEQ ID NO: 240—SEQ ID NO: 314; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 38—SEQ ID NO: 83— SEQ ID NO: 166—SEQ ID NO: 241; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 4—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 315; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 39—SEQ ID NO: 102— 197 55382181.3Attorney Docket No.047162-7503WO1 (02594) SEQ ID NO: 167—SEQ ID NO: 242—SEQ ID NO: 316; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 40—SEQ ID NO: 103— SEQ ID NO: 168—SEQ ID NO: 243—SEQ ID NO: 317; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 41—SEQ ID NO: 104— SEQ ID NO: 169—SEQ ID NO: 244—SEQ ID NO: 318; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 42—SEQ ID NO: 105— SEQ ID NO: 170—SEQ ID NO: 206—SEQ ID NO: 319; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 43—SEQ ID NO: 106— SEQ ID NO: 171—SEQ ID NO: 245—SEQ ID NO: 320; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 44—SEQ ID NO: 107— SEQ ID NO: 172—SEQ ID NO: 246—SEQ ID NO: 321; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 45—SEQ ID NO: 83— SEQ ID NO: 173—SEQ ID NO: 247—SEQ ID NO: 322; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 46—SEQ ID NO: 69— SEQ ID NO: 174—SEQ ID NO: 248—SEQ ID NO: 323; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 324; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 47—SEQ ID NO: 108— SEQ ID NO: 176—SEQ ID NO: 250—SEQ ID NO: 326; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 48—SEQ ID NO: 109— SEQ ID NO: 177—SEQ ID NO: 251—SEQ ID NO: 327; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 49—SEQ ID NO: 110— SEQ ID NO: 178—SEQ ID NO: 252—SEQ ID NO: 328; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 179—SEQ ID NO: 253—SEQ ID NO: 329; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 50—SEQ ID NO: 67— SEQ ID NO: 180—SEQ ID NO: 254—SEQ ID NO: 330; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 67— SEQ ID NO: 181—SEQ ID NO: 255—SEQ ID NO: 331; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 51—SEQ ID NO: 97— SEQ ID NO: 182—SEQ ID NO: 256—SEQ ID NO: 332; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 53—SEQ ID NO: 112— SEQ ID NO: 184—SEQ ID NO: 258—SEQ ID NO: 334; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 52—SEQ ID NO: 111— 198 55382181.3Attorney Docket No.047162-7503WO1 (02594) SEQ ID NO: 183—SEQ ID NO: 257—SEQ ID NO: 333; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 54—SEQ ID NO: 97— SEQ ID NO: 185—SEQ ID NO: 247; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 55—SEQ ID NO: 113— SEQ ID NO: 186—SEQ ID NO: 259—SEQ ID NO: 335; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 34—SEQ ID NO: 114— SEQ ID NO: 126—SEQ ID NO: 260—SEQ ID NO: 336; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 56—SEQ ID NO: 115— SEQ ID NO: 187—SEQ ID NO: 261—SEQ ID NO: 337; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 57—SEQ ID NO: 96— SEQ ID NO: 188—SEQ ID NO: 262—SEQ ID NO: 338; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 5—SEQ ID NO: 67—SEQ ID NO: 189—SEQ ID NO: 206—SEQ ID NO: 339; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 116— SEQ ID NO: 127—SEQ ID NO: 206—SEQ ID NO: 340; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 12—SEQ ID NO: 117— SEQ ID NO: 190—SEQ ID NO: 263—SEQ ID NO: 341; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 26—SEQ ID NO: 91— SEQ ID NO: 191—SEQ ID NO: 264—SEQ ID NO: 342;; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 52—SEQ ID NO: 67— SEQ ID NO: 192—SEQ ID NO: 265—SEQ ID NO: 343; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 57—SEQ ID NO: 119— SEQ ID NO:193—SEQ ID NO: 266—SEQ ID NO: 344; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 58—SEQ ID NO: 120— SEQ ID NO: 194—SEQ ID NO: 267—SEQ ID NO: 345; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 126—SEQ ID NO: 268—SEQ ID NO: 346; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 59—SEQ ID NO: 67— SEQ ID NO: 195—SEQ ID NO: 269—SEQ ID NO: 347; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 7—SEQ ID NO: 67—SEQ ID NO: 196—SEQ ID NO: 270—SEQ ID NO: 348; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 40—SEQ ID NO: 103— SEQ ID NO: 168—SEQ ID NO: 271—SEQ ID NO: 349; the amino acid sequence of SEQ ID NO:1—SEQ ID NO: 60—SEQ ID NO: 121— 199 55382181.3Attorney Docket No.047162-7503WO1 (02594) SEQ ID NO: 197—SEQ ID NO: 272—SEQ ID NO: 350; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 61—SEQ ID NO: 122— SEQ ID NO: 198—SEQ ID NO: 273—SEQ ID NO: 351; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 62—SEQ ID NO: 123— SEQ ID NO: 199—SEQ ID NO: 274—SEQ ID NO: 352; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 63—SEQ ID NO: 114— SEQ ID NO: 126—SEQ ID NO: 260—SEQ ID NO: 353; the amino acid sequence of SEQ ID NO: 1—SEQ ID NO: 64—SEQ ID NO: 124— SEQ ID NO: 200—SEQ ID NO: 275—SEQ ID NO:

354.

34. A method of treating, ameliorating, and / or preventing a disease arising from Pseudomonas aeruginosa infection in a patient, the method comprising administering to the patient a therapeutically effective amount of an agent selected from the display library of any one of claims 20-27 and the VHH of any one of claims 30-33.

35. The method of claim 34, wherein the disease is selected from the group consisting of ventilator-associated pneumonia; hospital-acquired pneumonia; community-acquired pneumonia; bloodstream infection, endocarditis, and various sepsis syndromes; urinary tract infection; ocular infections; skin and soft tissue infections; chronic infection in patients with structural lung disease, including cystic fibrosis; hardware- and device- associated infections; endovascular infections; bone infections; and joint infections.

36. The method of any one of claims 34-35, wherein the patient is human.

37. The method of any one of claims 34-36, wherein the agent is formulated in a pharmaceutical composition, further comprising at least one pharmaceutically acceptable carrier or excipient.

38. The method of any one of claims 34-37, wherein the agent, or a pharmaceutical composition comprising same, is administered by a route selected from the group consisting of oral, transdermal, transmucosal, (intra)ocular, (intra)nasal, (trans)rectal, intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical. 200 55382181.3Attorney Docket No.047162-7503WO1 (02594) 39. A method of diagnosing a Pseudomonas aeruginosa infection in a patient, the method comprising contacting a biological sample from the patient with an agent selected from the display library of any of claims 20-27 and the VHH of any one of claims 30-33, and identifying binding between at least one antigen in the biological sample with the agent. 201 55382181.3

Citation Information

Patent Citations

  • Antibodies Specifically Recognizing Pseudomonas Psl and Uses Thereof

    US20230295279A1

  • Methods of isolating Anti-ligands

    WO2023242125A1