Feline infectious peritonitis mRNA vaccine

An IVT RNA vaccine encoding a FCoV N protein antigen, optimized and delivered via LNPs, addresses the limitations of existing FIP vaccines by inducing a protective immune response against FCoV strains, minimizing ADE risks.

WO2025217575A1PCT designated stage Publication Date: 2025-10-16RGT UNIV OF CALIFORNIA
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/024358
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-12
Filing Date
2025-04-11
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Current vaccines for feline infectious peritonitis (FIP) are ineffective and pose safety concerns due to the complex host-virus relationship and unpredictable genetic mutations of Feline Coronavirus (FCoV), leading to antibody-dependent enhancement (ADE) and limited cross-protection between serotypes.

Method used

An in vitro-transcribed (IVT) RNA molecule encoding a FCoV nucleocapsid (N) protein antigen is developed, optimized for increased G/C content and modified with a 5'-cap, 5'-UTR, 3'-UTR, and poly(A) sequence, delivered via lipid nanoparticles (LNPs) to elicit a protective immune response.

Benefits of technology

The IVT RNA molecule effectively induces a safe and specific immune response against FCoV, reducing the risk of ADE and providing broad protection across various FCoV strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025024358_16102025_PF_FP_ABST
    Figure US2025024358_16102025_PF_FP_ABST
Patent Text Reader

Abstract

In vitro-transcribed (IVT) RNA molecules and uses thereof as a feline infectious peritonitis(FIP) vaccine are described. An example IVT RNA molecule comprises a polynucleotide encoding a Feline Coronavirus (FCoV) nucleocapsid protein antigen, which is optionally loaded in a Lipid Nanoparticle (LNP) formulation and capable of being expressed in vivo.
Need to check novelty before this filing date? Find Prior Art

Description

FELINE INFECTIOUS PERITONITIS mRNA VACCINECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 633,348, filed April 12, 2024, which is incorporated by reference herein in its entirety.INCORPORATION BY REFERENCE OF A SEQUENCE LISTING

[0002] A Sequence Listing is provided herewith as .xml file, “763616_TUC_009PC. xml” created on April 3, 2025, and having a size of 24,750 bytes. The contents of the sequence listing are incorporated by reference herein in their entirety.BACKGROUND

[0003] Feline infectious peritonitis (FIP) is a fatal disease caused by feline coronavirus (FCoV). FCoV is an enveloped, positive-sense, single-stranded RNA virus in the Alphacoronavirus genus. Taxonomically, FCoV is classified as species Alphacoronavirus 1 , along with canine coronavirus and transmissible gastroenteritis virus of pigs. These coronaviruses share similar biological features, including high transmissibility and prevalence, frequent recombination events, potential for persistence, and potential to cause significant disease in their respective hosts. Estimates of FCoV seroprevalence reach 87% in cats living in high density environments such as shelters and catteries. In these environments where FCoV is endemic, as many as 5-10% of cats may develop one of a spectrum of viral mutations that cause fatal systemic FIP. Despite the large burden of infection and disease, all attempts thus far to generate a safe and effective vaccine to prevent the development of FIP have failed.

[0004] Fundamentally, the reasons for FIP vaccine failure include a remarkably complicated host-virus relationship and gaps in the understanding of disease pathogenesis and immune correlates of protection. There are two “serotypes” of FCoV, with type 1 predominating worldwide. Serotype 2 is the result of a recombination event of type 1 FCoV with the closely related canine coronavirus spike (S) gene, therefore no cross-protection between serotypes from an immune response mounted towards S would be expected.

[0005] Upon initial infection, which typically occurs in very young kittens, FCoV replicates in intestinal epithelium where fecal shedding may persist for many months. According to the generally accepted “internal mutation” theory, an unpredictable subset of these infected cats may harbor viruses that undergo one of a number of mutations or deletions, each of which are considered a switch to the FIP virus (FIPV). These genetic changes are associated with alteredviral tropism from intestinal epithelium to monocytes / macrophages, resulting in widespread viral dissemination, multi-organ granulomatous disease, and death.

[0006] Because there are multiple genetic mutations associated with the FIPV switch, most of which occur in the spike (S) gene, vaccines targeting single FIPV protein epitopes or targeting only one of the two known serotypes of FCoV would only protect individual cats harboring specific mutations or with infections from a specific serotype. However, an antibody response to S has been experimentally shown to elicit paradoxical worsening of disease upon subsequent exposure to the virus. This phenomenon is known as antibody-dependent enhancement (ADE) of infection. ADE occurs when non-neutralizing or sub-neutralizing concentrations of antibodies bind to the viral surface, mediating uptake into monocytes and macrophages through Fc-receptor binding. Under normal conditions, this would help eliminate the pathogen and disease; however, FIPV replicates very efficiently in those cells, resulting in viral dissemination and augmented disease. For these reasons, a vaccine strategy targeting S carries with it risks of both inefficacy and, importantly, significant safety concerns.

[0007] A protective FIP vaccine for cats is a critical need in veterinary medicine. The field of antiviral therapy is rapidly progressing, but little movement in the field of vaccine development has been seen in the past few decades.SUMMARY

[0008] The present disclosure describes materials and methods for providing a protective immune response in an individual, such as an individual at risk of FIP disease.

[0009] In one aspect, the present disclosure provides an in vitro-transcribed (IVT) RNA molecule comprising a polynucleotide encoding a Feline Coronavirus (FCoV) nucleocapsid (N) protein antigen.

[0010] In certain embodiments, the polynucleotide encoding the FCoV N protein antigen has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 4, or an immunogenic fragment thereof.

[0011] In certain embodiments, the polynucleotide encoding the FCoV N protein antigen comprises a codon-optimized sequence.

[0012] In certain embodiments, the polynucleotide encoding the FCoV N protein antigen comprises an increased G / C content as compared to a wild type FCoV nucleocapsid protein nucleotide sequence or immunogenic fragment thereof, optionally wherein the nucleotide sequence encoding the FCoV N protein antigen has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence of SEQ ID NO: 2.

[0013] In certain embodiments, the polynucleotide encoding the FCoV N protein antigen comprises a 5' end and a 3' end and the IVT RNA molecule further comprises a 5'-cap, 5'- untranslated region (UTR), 3'-UTR, and poly(A) sequence.

[0014] In certain embodiments, the 5'-cap comprises a chemical structure selected from the group consisting of m7GpppG, m7G(5')ppp(5')G, m7GpppA, m7GpppC; GpppG, m2,7GpppG, m7G(5’)ppp(5’)(2’OmeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3’OmeG)(5’)ppp(5’)(2’OmeA)pG, m2,2,7GpppG, and m7Gpppm7G, and is located at the 5'- end of the nucleotide sequence.

[0015] In certain embodiments, the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap.

[0016] In certain embodiments, the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA and a 12S ribosomal RNA and the 3-UTR is positioned at the 3'-end of the polynucleotide.

[0017] In certain embodiments, the poly(A) sequence is positioned at the 3' end of the 3'- UTR and comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence.

[0018] In certain embodiments, the two stretches of adenosine nucleotides include a first stretch of 30 adenosine nucleotides and a second stretch of 70 adenosine nucleotides.

[0019] In certain embodiments, the nucleic acid molecule encoding the 5'-UTR, FCoV N protein antigen, 3'-UTR, and poly(A) sequence is encoded by nucleotide 688 to nucleotide 2272 of SEQ ID NO:5.

[0020] In certain embodiments, the polynucleotide encoding the FCoV N protein antigen comprises a modified nucleotide in place of at least one uridine.

[0021] In certain embodiments, the modified nucleotide is N1-methyl-pseudouridine (m1qj).

[0022] In certain embodiments, the IVT RNA molecule includes:(i) a polynucleotide encoding the FCoV N protein antigen comprising a 5' end and a 3' end;(ii) the polynucleotide comprises a nucleotide sequence encoding the FCoV N protein antigen having at least 95% identity to SEQ ID NO: 2, or an immunogenic fragment thereof;(iii) a 5'-cap;(iv) a 5'-untranslated region (UTR) positioned between the 5'-end of the nucleotide sequence and the 5'-cap;(v) a 3-UTR, and(vi) a poly(A) sequence.

[0023] In certain embodiments, the 5'-cap comprises a m7G(5')ppp(5')(2'OMeA)pG 5’ cap, the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, and the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA.

[0024] In certain embodiments, the nucleotide sequence encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

[0025] In certain embodiments, the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3'- UTR.

[0026] In another aspect, the present disclosure provides a lipid nanoparticle (LNP) formulation comprising loaded LNPs including the IVT RNA molecule according to any embodiment of the above aspect.

[0027] In certain embodiments, the loaded LNPs comprise a ratio of lipid to mRNA (N / P) of about 3 to about 7.

[0028] In certain embodiments, the loaded LNPs have a mean diameter of at least 50 nm.

[0029] In certain embodiments, the loaded LNPs have a polydispersity index within a range of from about 0.05 to about 0.2.

[0030] In certain embodiments, the loaded LNPs have a Z-average particle size within a range of from about 80 nm to about 125 nm.

[0031] In certain embodiments, the loaded LNPs include a cationic lipid, a non-cationic lipid, a structural lipid, sterol and / or a PEGylated lipid.

[0032] In certain embodiments, the loaded LNPs include 20-60 mol % ionizable cationic lipid, optionally selected from the group consisting of DLin-DMA, (6Z,9Z,28Z,31Z)-heptatriacont- 6,9,28,31 -tetraene-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2-(2,2-di((9Z,12Z)- octadeca-9,12-dien-l-yl)- 1 ,3-dioxolan-4-yl)-N,N-dimethylethan-l-amine (DLin-KC2-DMA), 1, 2- dioleyloxy-3- dimethylaminopropan (DODMA), 9-Heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6- (undecyloxy)hexyl]amino}octanoate (SM-102), 6-((2-hexyldecanoyl)oxy)-N-(6-((2- hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1 -aminium (ALC-0315), Bis[2-(4-{2-[4-(cis-9- octadecenoyloxy)phenylacetoxy]ethyl}piperidinyl)ethyl] disulfide (SS-OP), methylpyridiyl-dialkylacid (MPDACA), palmitoyl-oleoyl-nor- arginine (PONA), guanidino-dialkyl acid (GUADACA), 1 ,2- di-O- octadecenyl- 3 -trimethylammonium propane (DOTMA), 1 ,2-dioleoyl-3- trimethylammonium- propane (DOTAP), Bis{2-[N-methyl-N-(a-D- tocopherolhemisuccinatepropyl)amino]ethyl} disulfide (SS-33 / 3APO5), Bis {2-[4-(a-D- tocopherolhemisuccinateethyl)piperidyl] ethyl} disulfide (SS33 / 4PE15), Bis{2-[4-(cis-9- octadecenoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE16), Bis{2-[4-(cis,cis-9,12- octadecadienoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE13), [3-(dimethylamino)-2-[(Z)- octadec-9-enoyl]oxypropyl] (Z)-octadec-9-enoate (DODAP), Di-octadecyl-amido-glycyl- spermine (DOGS), {2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1- propanaminium trifluoroacetate} (DOSPA), 3P[N-(N',N'-dimethylaminoethane)-carbamoyl] cholesterol (DC-Chol), N4-Cholesteryl-Spermine (GL-67), bis(guanidinium)-tris(2- aminoethyl)amine-cholesterol (BGTC), Dimethyldioctadecylammonium (DDAB), 2,3-bis[(Z)- octadec-9-enoxy]propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DORIE), 2,3- di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DMRIE), N-(3-aminopro-pyl)- N,N-dimethyl-2,3-bis(dodecyloxy)-l-propanammonium bromide (GAP-DLRIE), N-t-butyl-N'- tetradecyl-3-tetradecylaminopropionamidine (diC14-amidine), di((Z)-non-2-en-l-yl) 9-((4- (dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 1 ,1'-((2-(4-(2-((2-(Bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), OF-02, N1 ,N3,N5-tris(2- aminoethyl)benzene- 1 ,3,5-tricarboxamide (TT3), and 3-[2-[3-[2-[bis[2-[bis(2-hydroxydecyl)amino]ethyl]amino]ethyl-(2- hydroxydecyl)amino]propanoylamino]ethyl-dimethylazaniumyl]propane-1 -sulfonate (ZA3-Ep10).

[0033] In certain embodiments, the loaded LNPs include 5-25 mol % structural lipid or non-cationic lipid, optionally selected from the group consisting of 1 ,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1 ,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 ,2-dipalmitoyl-sn-glycero-3- phosphocholine (DPPC), 1 ,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2-di-0-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1 ,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1 ,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1 ,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1 ,2-diphytanoyl-sn-glycero phosphoethanolamine (ME 16.0 PE), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dilinolenoyl-sn-glycerophosphoethanolamine, 1 ,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dioleoyl-sn-glycero-3-phospho-rac- (1 -glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0034] In certain embodiments, the loaded LNPs include 25-55 mol % sterol, optionally selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

[0035] In certain embodiments, the loaded LNPs include 0.5-15 mol % PEG-modified lipid, optionally selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG- modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, Methoxypolyethyleneglycoloxy(2000)-N,N- ditetradecylacetamide (ALC-0159), and mixtures thereof.

[0036] In certain embodiments, the loaded LNPs include a mixture of at least one ionizable cationic lipid, at least one structural lipid (e.g., a non-cationic lipid), at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid along with the IVT-RNA molecule cargo, in ratio of (A) 5-25 mol % structural lipid: (B) 25-55 mol % sterol: (C) 20-60 mol % ionizable cationic lipid; (D) 0.5-15 mol % PEG-modified lipid, optionally the mixture of noncationic lipid, sterol, at least one ionizable cationic lipid, and at least one PEG modified lipid is about 1-20:25-45:30-60:1-10, about 5-15:30-40:40-55:1-5, about 8-12:35-39:48-52:2-4, or about 10:37.5:50,2.5.

[0037] In certain embodiments, the loaded LNPs include an IVT RNA molecule encoded by nucleotide 688 to nucleotide 2272 of SEQ ID NO:5.

[0038] In another aspect, the present disclosure provides a Feline Infectious Peritonitis (FIP) vaccine composition comprising: (a) the IVT RNA molecule according to any embodiment of the first aspect; or (b) the LNP formulation according to any embodiment of the second aspect.

[0039] In another aspect, the present disclosure provides a method for eliciting an immune response in an individual in need thereof comprising administering the FIP vaccine composition of any embodiment of the above aspect to the individual.

[0040] In certain embodiments, the FIP vaccine composition includes loaded LNPs comprising an IVT RNA molecule encoded by nucleotide 688 to nucleotide 2272 of SEQ ID NO:5.

[0041] In another aspect, the present disclosure provides a method for eliciting an immune response in an individual in need thereof, the method including administering a FIP vaccine composition a comprising: (a) the IVT RNA molecule according to any embodiment ofthe first aspect; or (b) the LNP formulation according to any embodiment of the second aspect to the individual in an amount effective for eliciting an immune response

[0042] In certain embodiments, the amount of the FIP vaccine composition is a dose within the range of about 0.5-100 pg.

[0043] In certain embodiments, the dose is within the range of about 15-20 pg, about 20- 25 pg, about 25-30 pg, about 30-35 pg, about 35-40 pg, about 40-45 pg, or about 45-50 pg.

[0044] In certain embodiments, the amount of the FIP vaccine is effective for expressing about 10 ng to about 10 mg FCoV N protein antigen.

[0045] In certain embodiments, the individual has been exposed to FCoV.

[0046] In certain embodiments, the individual exhibits signs of an FCoV infection.

[0047] In certain embodiments, the individual has no prior FCoV exposure.

[0048] In certain embodiments, the individual is about 6 months of age or older.

[0049] In certain embodiments, the method further comprises administering a first dose and a second dose of the FIP vaccine composition.

[0050] In certain embodiments, the second dose is administered about 3 to about 5 weeks after administration of the first dose.

[0051] In certain embodiments, the FIP vaccine composition comprises loaded lipid nanoparticles (LNPs) comprising an IVT RNA molecule, wherein the IVT RNA molecule comprises:(i) a polynucleotide encoding the FCoV N protein antigen comprising a 5' end and a 3' end;(ii) the polynucleotide comprises a nucleotide sequence encoding the FCoV N protein antigen having at least 80% identity to SEQ ID NO: 4, or an immunogenic fragment thereof and / or the polynucleotide encoding the FCoV N protein antigen comprises an increased G / C content as compared to a wild type FCoV nucleocapsid nucleotide sequence or immunogenic fragment thereof;(iii) a 5'-cap;(iv) a 5'-untranslated region (UTR) positioned between the 5'-end of the nucleotide sequence and the 5'-cap;(v) a 3-UTR, and(vi) a poly(A) sequence.

[0052] In certain embodiments, the loaded LNPs comprise a mixture of at least one ionizable cationic lipid, at least one structural lipid, at least one sterol, and at least onepolyethylene glycol (PEG)-modified lipid in a ratio of 5-25 mol % structural lipid:25-55 mol % sterol:20-60 mol % ionizable cationic lipid:0.5-15 mol % PEG-modified lipid.

[0053] In certain embodiments, the 5'-cap comprises a m7G(5')ppp(5')(2'OMeA)pG 5’ cap, the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, and the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA.

[0054] In certain embodiments, the nucleotide sequence encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

[0055] In certain embodiments, the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3'- UTR.

[0056] In certain embodiments, the amount of the FIP vaccine sufficient to elicit an immune response is safe and tolerable.BRIEF DESCRIPTION OF DRAWINGS

[0057] Reference is made to the drawings, in which:

[0058] FIGs. 1A-B depict mRNA vaccine sequence and design. (A) Comparison of sequence identity between that chosen as template for vaccine (first sequence, KF530271 ) with ~40 additional published sequences. Genbank accessions used are shown across X axis. (B) Modifications applied to the 5’ and 3’ UTRs used for both WT mRNA (“WT”) and GC-content optimized mRNA (“GC”). For in vitro studies, identical sequences were used but co- transcriptional capping was not performed as an mRNA control without the presence of protein production.

[0059] FIGs. 2A-B depict relative mRNA abundance after in vitro transfection with FCoV N mRNA. Equivalent cell numbers were extracted for q-RT PCR at the indicated timepoints post transfection. Plotted are mean and standard deviation of relative cDNA copy number at each time point, with averages representing biological triplicates and qPCR run in technical triplicates per sample. (A) Comparison of capped WT vs GC mRNA; (B) comparison of uncapped WT vs GC mRNA.

[0060] FIGs. 3A-C depict relative protein expression by IFA after in vitro transfection with FCoV N mRNA. (A) Representative images of FCoV N expression (green, middle and right panels) at 1 day post transfection. Nuclei are stained with DAPI in blue; top panels represent transfection with WT mRNA and bottom panels represent transfection with GC mRNA. Images have been enhanced identically in this figure. (B) Integrated density was measured at the timepoints indicated, thresholded to mock-transfected and day 0 transfected average. Plotted are mean and standard deviation of ~10 10x images at each time point. (C) Western blot was run for cells transfected with indicated mRNAs at day 1 post transfection, with equivalent cell numbers loaded in each lane (expected size ~50kDa).

[0061] FIGs. 4A-C depict in vivo immune responses in mice. (A) Schematic of mouse study showing 10 mice were bled before vaccination (week 0), and vaccinated with WT (n=4), GC (n=4), or mock-vaccinated with PBS (n-2). Each group was boosted at week 6, euthanized at 5 weeks post boost and terminally bled, with spleens harvested for T cell stimulation and flow cytometry. (B) Serum antibody titers were measured by ELISA and plotted as reciprocal endpoint titers, with each mouse represented along the X axis (WT 1-4 represent each of the 4 mice vaccinated with WT; GC 1-4 represent each of the 4 mice vaccinated with GC) (95% confidence interval). (C) Splenocytes were harvested and stimulated overnight with overlapping peptides corresponding to the entire N protein, then analyzed by flow cytometry. Gating strategy followed by representative plots from 3 individual mice are shown here. Unvaccinated + stimulated = PBS (mock) vaccinated mouse stimulated with peptide pool; WT Vaccinated + Unstimulated = vaccinated and not stimulated with peptide pool; WT + Stimulated = same mouse as above but with peptide stimulation; and GC Vaccinated + Stimulated = vaccinated and stimulated with peptide pool. Markers of stimulation and immune activation are shown as percentages of CD8+ cells.

[0062] FIG. 5 depicts the results of bioanalyzer quality control from purified mRNA. Each construct was run for total RNA analysis with results for all four constructs shown here after column and cellulose purification (size: 1598nt).

[0063] FIG. 6 is a graphical representation of a portion of a pBluescript II SK(+) plasmid encoding an IVT RNA of the Examples, according to one or more embodiments of the present disclosure, which shows nucleotides 688 to 2272 of SEQ ID NO: 5. This portion encodes, 5' to 3', a feline alpha globin UTR (“Fe alpha globin 5' UTR”), a Kozak consensus sequence (“Kozak”), a GC-optimized polynucleotide encoding a FCoV N protein (“FCov GC optimized nucleoprotein”), a 3' UTR including a feline amino-terminal enhancer of split (“Fe AES”), a mitochondrially encoded 12S rRNA (“12S RNA"), and a segmented a poly(A) tail that includes a 30 adenosine residue segment linked to a 70 adenosine residue segment (“A30LA70”).

[0064] The various examples discussed herein are amenable to modifications and alternative forms.

[0065] While aspects of these modifications have been shown by way of example in the drawings, and described in detail below, the intention is not to limit the disclosure to theparticular examples described. Rather, the intention is to cover all modifications, equivalents, and alternatives falling within the scope of the disclosure, including aspects defined in the claims.DETAILED DESCRIPTION

[0066] The present disclosure describes an in vitro-transcribed (IVT) RNA molecule comprising a polynucleotide encoding a Feline Coronavirus (FCoV) nucleocapsid (N) protein antigen. The FCoV N protein antigen can include a full length FCoV N protein, an immunogenic fragment of the FCoV N protein, or an immunogenic variant thereof.

[0067] Definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed subject matter, the scope of which is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of the claimed subject matter. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below, and, unless explicitly stated otherwise, do not exclude the meaning that the term or phrase has acquired in the art to which it pertains.

[0068] As used herein, “FCoV” refers to any isolate, strain or variant of FCoV. As used herein, FCoV infection refers to viral infection and associated disease (FIP).

[0069] As used herein, the term “IVT RNA molecule” refers to a nucleic acid molecule encoding an antigen sequence to be expressed in a host for use as a vaccine, and which has at least one of the following characteristics: (i) the IVT RNA molecule can be generated by in vitro transcription, (ii) the IVT RNA molecule is not isolated from a cell; and (iii) the IVT RNA molecule is translatable in a mammalian (e.g., feline) cell or mammalian subject to produce a polypeptide comprising an antigen.

[0070] An “antigen” as used herein is a molecule capable of inducing an immune response (e.g., causing an immune system to produce antibodies against the antigens). The term “antigen” encompasses immunogenic proteins and immunogenic fragments.

[0071] As used herein, the term “immunogenic” refers to the capacity of a molecule or substance to induces or elicit an immune response to at least one FCoV. The term “protein” encompasses peptides and the term “antigen” encompasses antigenic fragments. Inducing or eliciting an immune response can include recognition by a T-cell antigen receptor or B-cell antigen receptor, and the like.

[0072] The terms “identical” or percent “identity” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same orhave a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, ALIGN, Megalign, BestFit, GCG Wisconsin Package, and variations thereof. In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In some embodiments, identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 40-60 residues, at least about 60-80 residues in length or any integral value 2 between. In some embodiments, identity exists over a longer region than 60-80 residues, such as at least about 80-100 residues, and in some embodiments the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence.

[0073] As used herein, the articles “a”, “an”, and “the” include plural referents, unless the context clearly indicates otherwise. As such, the term “a” (or “an”), “one or more” or “at least one” can be used interchangeably herein.

[0074] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.

[0075] As used herein the term “consisting essentially of’ refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0076] The term “consisting of’ refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.FCoV nucleocapsid protein antigens

[0077] An IVT RNA molecule of the present disclosure includes a polynucleotide encoding a FCoV nucleocapsid (N) protein antigen. In certain embodiments, a FCoV N protein antigen isa full-length FCoV N protein or an immunogenic fragment thereof. In certain embodiments, a FCoV N protein antigen is an immunogenic variant of a full-length FCoV N protein or an immunogenic fragment.

[0078] A FCoV N protein is a structural protein capable of binding and protecting FCoV genomic RNA. A FCoV N protein can have a molecular weight of approximately 50 kDa. The FCoV N protein antigen of the present disclosure can have an amino acid sequence of any FCoV strain or variant thereof. In certain embodiments, a FCoV N protein antigen can include a geographically-specific native or wild-type amino acid sequence. For example, a FCoV N protein antigen can include an amino acid sequence that has been identified in naturally infected cats within a geographic region. In certain embodiments, a FCoV N protein antigen encoded by a polynucleotide of the present disclosure (e.g., mRNA) has an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to the amino acid sequence of SEQ ID NO: 6 or 8, or a fragment thereof.

[0079] In certain embodiments, an IVT RNA molecule of the present disclosure includes a polynucleotide encoding an immunogenic fragment of a FCoV N protein. An immunogenic fragment can include an epitope, i.e., a collection of features of primary, secondary and tertiary peptide structure, and charge, of a FCoV nucleocapsid protein that forms a site recognized by, at least one of an immunoglobulin, T cell receptor, and chimeric antigen receptor. In certain embodiments, an immunogenic fragment includes a set of amino acid residues involved in recognition by a particular immunoglobulin, or in the context of T cells, residues for recognition by T cell receptor proteins.

[0080] In certain embodiments, a FCoV N protein or the immunogenic fragment thereof comprises a region (i.e., a contiguous series of amino acid residues) having 100% identity with a native or wild-type (WT) sequence. An immunogenic fragment of the native sequence can have a length of less than or equal to 300 amino acid residues, less than or equal to 250 amino acid residues, less than or equal to 100 amino acid residues, less than or equal to 85 amino acid residues, less than or equal to 75 amino acid residues, less than or equal to 65 amino acid residues, and less than or equal to 50 amino acid residues. In certain embodiments, an immunogenic fragment described herein is a peptide having a region with less than 51 amino acid residues having 100% identity to a native FCoV N protein peptide sequence, in any increment down to 5 amino acid residues; for example 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 amino acid residues, where the peptide forms a site recognized by, at least one of an immunoglobulin, T cell receptor, and chimeric antigenreceptor, and is capable of inducing an immune response, in particular a protective immune response against FCoV infection.

[0081] In certain embodiments, immunogenic fragment of the FCoV N protein antigen is a peptide of less than or equal to 300 amino acid residues, less than or equal to 250 amino acid residues, less than or equal to 100 amino acid residues, less than or equal to 85 amino acid residues, less than or equal to 75 amino acid residues, less than or equal to 65 amino acid residues, or less than or equal to 50 amino acid residues of the amino acid sequence of SEQ ID NO: 6 or 8, where the peptide forms a site that can be recognized by at least one of an immunoglobulin, T cell receptor, and chimeric antigen receptor and is capable of inducing an immune response, in particular a protective immune response against FCoV infection.

[0082] In certain embodiments, an IVT RNA molecule of the present disclosure includes a polynucleotide that encodes an immunogenic variant of a FCoV N protein antigen. As used herein, an “immunogenic variant” includes a protein or polypeptide sequence having one or more amino acid substitutions, insertions, or deletions, provided that the protein or polypeptide retains or substantially retains its ability to induce an immune response, in particular a protective immune response against FCoV infection. An immunogenic variant can differ in its amino acid sequence from a wild-type, native, or reference sequence. The substitutions, deletions, and / or insertions can be located at certain positions within the amino acid sequence, as compared to a native or reference sequence. An immunogenic variant can possess at least 50% identity to a wild-type, native or reference sequence. In certain embodiments, An immunogenic variant shares at least 80%, or at least 90% identity with a wild-type, native, or reference sequence.

[0083] An immunogenic variant can include a conservative amino acid substitution. In this case, an amino acid residue can be replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is a conservative substitution.Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate immunogenic activity are well-known in the art.

[0084] In certain embodiments, an immunogenic variant the present disclosure includes at least one amino acid changes that confers any of the following properties in a subject: enhancedimmunogenicity, expression, stability, or pharmacokinetic or pharmacodynamic properties, immunogenic variants can be obtained using routine mutagenesis techniques and assayed for a desired property using in vivo, in vitro, and in silico methods known in the art.Polynucleotides

[0085] An IVT RNA molecule of the present disclosure includes a polynucleotide encoding a FCoV N protein antigen as described above.

[0086] Except where otherwise noted, nucleic acid sequences set forth in the present disclosure can recite “T”s in a representative DNA sequence but where the sequence represents RNA (e.g., mRNA), the “T”s would be substituted for “U”s. Thus, any of the DNAs disclosed and identified by a particular sequence identification number herein also disclose the corresponding RNA (e.g., mRNA) sequence complementary to the DNA, where each “T” of the DNA sequence is substituted with “U.”

[0087] A polynucleotide encoding a FCoV N protein antigen can be prepared by isolation from a natural source, or synthesized according to standard protocols in the art. In certain embodiments, the polynucleotide be prepared from a genomic sequence. Non-limiting examples of FCoV genomic sequences include GenBank Accession numbers KF503271 , KU215420, KU215423, AB535528, AB781789, DQ160294, GQ152141 , AB907624, KP143507, EU186072, JN634064, DQ010921 , KC461237, AY994055, KC461236, KC461235, MW030109, DQ286389, JQ408980, JQ408981, FJ917520, FJ917534, FJ917535, FJ917521, FJ917522, FJ938052, AB781788, DQ848678, FJ938052, FJ938054, HQ012368, KY292377, MT239439, MQ030110, GU553361, and HQ012367, and other published FCoV sequences. In certain embodiments, the polynucleotide encoding a FCoV N protein antigen prepared from GenBank Accession number KF503271.

[0088] In certain embodiments, a polynucleotide of the present disclosure includes a messenger RNA (mRNA). Messenger RNA (mRNA) is any RNA that can be translated to produce the encoded protein or fragment thereof in vitro, in vivo, in situ, or ex vivo. The mRNA can include an open reading frame (ORF), a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG or TGA, or UAA, UAG or UGA). An IVT RNA molecule of the present disclosure can include RNA or multiple RNAs encoding two or more antigens of the same or different FCoV species. In some embodiments, composition includes an RNA or multiple RNAs encoding two or more FCoV N protein antigens. In some embodiments, the RNA may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more FCoV antigens in addition to an FCoV N protein antigen.

[0089] In certain embodiments, a polynucleotide of the present disclosure has a nucleotide sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to SEQ ID NO: 4.

[0090] In certain embodiments, a polynucleotide of the present disclosure includes nucleotide sequence that is optimized for expression in a specific host organism. In certain embodiments, the host organism is a feline.

[0091] In certain embodiments, a polynucleotide encoding a FCoV N protein antigen is codon optimized. Codon optimization methods are known in the art and can be used to match codon frequencies in target and host organisms to ensure proper folding; bias G / C content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.

[0092] In certain embodiments, a codon optimized sequence shares less than 95% sequence identity to a naturally-occurring or wild-type sequence ORF (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares less than 80% sequence identity to a naturally-occurring or wildtype sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild-typesequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally- occurring or wild-type mRNA sequence encoding a FCoV N protein antigen). In some embodiments, a codon-optimized sequence encodes an antigen that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than a FCoV N protein antigen encoded by a non- codon-optimized sequence.

[0093] In certain embodiments, a codon optimized polynucleotide includes enhanced levels of G / C. For example, codon-optimization of an IVT RNA molecule can increase the G / C content compared to wildtype by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more. In certain embodiments, the G / C content is optimized to about 50-60%. In certain embodiments, an IVT RNA molecule of the present disclosure includes polynucleotide (e.g., mRNA) having a nucleotide sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to SEQ ID NO: 2.

[0094] In certain embodiments, polynucleotide of the present disclosure is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g., dA, dG, dC, or dT).

[0095] In certain embodiments, polynucleotide of the present disclosure can include an RNA having an open reading frame encoding a FCoV N protein antigen, the polynucleotide of which can be standard (unmodified) or modified nucleotides and / or nucleosides as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include modifications at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art. For example, in certain embodiments, an IVT RNA (e.g., mRNA) of the present disclosure can include, for example, deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleicacids (LNAs) and modified LNAs, ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) and combinations thereof. Hence, polynucleotides of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can include standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally- occurring nucleotides and nucleosides, and any combination thereof.

[0096] In certain embodiments, polynucleotide of the present disclosure includes nonnatural modified nucleotides that are introduced during synthesis or post-synthesis. The modifications can be present on an internucleotide linkage, a purine or pyrimidine base, or a sugar. The modification can be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide of the present disclosure can be chemically modified.

[0097] In certain embodiments, a polynucleotide of the present disclosure includes a modified nucleobases, such as a 1-methyl-pseudouridine (ml qj), 1-ethyl-pseudouridine (e1 qj), 5- methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (qj). In some embodiments, an IVT RNA molecule of the present disclosure includes can include 5- methoxymethyl uridine, 5-methylthio uridine, 1 -methoxymethyl pseudouridine, 5-methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the modified nucleobases described above.

[0098] In certain embodiments, a polynucleotide of the present disclosure includes 1- methyl-pseudouridine (ml qj) substitutions at one or more or all uridine positions of the polynucleotide. In some embodiments, a polynucleotide of the present disclosure includes pseudouridine (w) substitutions at one or more or all uridine positions of the nucleic acid.

[0099] In some embodiments, a polynucleotide of the present disclosure can be uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methyl- pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1- methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

[0100] A polynucleotide of the present disclosure can include contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1 % to 50%, from 1 % to 60%, from 1 % to 70%, from 1 % to 80%, from 1 % to 90%, from 1% to 95%, from 10% to 20%, from 10% to25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). Any remaining percentage can be accounted for by the presence of unmodified A, G, U, or C.

[0101] A polynucleotide of the present disclosure can contain at a minimum 1 % and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).

[0102] A polynucleotide of the present disclosure can include one or more nucleotide elements as an untranslated region. For example, a polynucleotide containing an mRNA encoding at least one antigen can further include one or more of untranslated regions (UTRs). Any UTR from any gene can be incorporated into the regions of a polynucleotide of the present disclosure. Furthermore, multiple wild-type UTRs of any known gene or artificial UTRs which are not variants of wild type regions can be utilized. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5' or 3' UTR may be inverted, shortened, lengthened, made with one or more other 5' UTRs or 3' UTRs. As used herein, the term “altered” as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3' UTR or 5' UTR may be altered relative to a wild-type or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an “altered” UTR (whether 3' or 5') comprise a variant UTR.

[0103] In mRNA, the 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3' UTR starts immediately followingthe stop codon and continues until the transcriptional termination signal. A variety of 5' UTR and 3' UTR sequences are known and available in the art.

[0104] A 5' UTR of the present disclosure can be directly upstream (5') from the first codon of an mRNA transcript translated by a ribosome. In some cases, a 5' UTR of the present disclosure includes a naturally occurring 5' UTR comprising one or more features that plays a role in translation initiation (e.g., a Kozak consensus sequence). In some cases, a 5' UTR of the present disclosure includes a synthetic UTR ( i.e. , the UTR does not occur in nature).Exemplary 5' UTRs include UTRs of hemoglobin chains, such as a-globin or B-globin UTRs. In certain embodiments, the 5-UTR can include a feline a-globin UTR (e.g., Felis catus hemoglobin subunit alpha mRNA UTR, such as the sequence described in GenBank Accession number XM_003998972). In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5' UTR.

[0105] A 5' UTR of the present disclosure can include a Kozak consensus sequence. Exemplary Kozak sequences include short consensus sequences that allows for efficient initiation of translation of a polynucleotide (e.g., mRNA). A Kozak sequence can be inserted upstream downstream (5') of a polynucleotide encoding at least one antigen. In certain embodiments, a 5' UTR includes a Kozak consensus sequence comprising a GCCACC nucleotide sequence that is inserted upstream of a polynucleotide encoding at least one antigen.

[0106] A 3' UTR of the present disclosure can be directly downstream (3') from the codon of an mRNA transcript that signals a termination of translation. In some cases, a 3' UTR of the present disclosure includes AU rich elements. In some embodiments, a 3' UTR of the present disclosure can be heterologous or synthetic. In some embodiments, a double, triple or quadruple 3' UTR can be used. Examples of untranslated regions of mRNA that can be including in a 3' UTR include e.g., amino-terminal enhancer of split (AES), hemoglobin, Major histocompatibility complex, Phospholipase D family, Chemokine (C-C motif) ligand 22, Lymphocyte-specific protein, Fc fragment of IgG mRNA.

[0107] In certain embodiments, the 3’ UTR or untranslated region is selected from a highly expressed feline gene. In a specific embodiment, the 3ZUTR includes untranslated regions of a mitochondrially encoded 12S rRNA and feline amino-terminal enhancer of split (Fe AES) mRNA. AES is a distinct member of the family of Groucho / Transducin-like enhancers of split genes, which regulates androgen receptor genes’ transcriptional activity and Notch and Wnt signaling, and acts as a tumor suppressor. Mitochondrial DNA (mtDNA) contains 37 genes, 1 of which encodes a 12s rRNA (small ribosomal subunit). In a specific embodiment, the felineamino-terminal enhancer of split mRNA is directly upstream (5Z) of the mitochondrially encoded 12S rRNA.

[0108] Exemplary DNA UTR sequences are provided in SEQ ID NOs: 5 and 7; however, other UTR sequences can be used or exchanged for any of the UTR sequences described herein.

[0109] In a specific embodiment, an IVT RNA of the present disclosure has a 5' UTR with at least 80%, 81%, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence from nucleotide 688 to nucleotide 725 of SEQ ID NO: 5.

[0110] In certain embodiments, a polynucleotide of the present disclosure of the present disclosure further includes a poly(A) tail and / or a 5' cap.

[0111] In certain embodiments, a polynucleotide of the present disclosure includes a 5'- cap. Exemplary 5'-caps include a chemical structure selected from the group consisting of m7GpppG, m7G(5')ppp(5')G, m7GpppA, m7GpppC, GpppG, m2,7GpppG, m7G(5’)ppp(5’)(2’OmeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3’OmeG)(5’)ppp(5’)(2’OmeA)pG, m2,2,7GpppG, and m7Gpppm7G. A 5'-cap can be added to the mRNA transcript. In certain embodiments, 5'-capping occurs during in vitro transcription. In certain embodiments, 5'-capping occurs post-transcriptional ly by enzymatic activity. In a specific embodiment, an IVT RNA molecule includes a m7G(5')ppp(5')(2'OMeA)pG 5’ cap.

[0112] In certain embodiments, a polynucleotide of the present disclosure includes a poly(A) tail. A “poly(A) tail” can be a region of mRNA that is downstream, e.g., directly downstream (i.e., 3'), from the 3' UTR that contains multiple, consecutive adenosine monophosphates. A poly(A) tail can include a stretch of adenosine nucleotides added to the 3'- end of the transcribed mRNA. A poly(A) tail can include up to about 400 adenosine nucleotides, such as 10 to 300 adenosine monophosphates. In certain embodiments, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50 to 250 adenosine monophosphates.

[0113] In certain embodiments, a polynucleotide of the present disclosure can include a segmented poly(A) tail. A segmented poly(A) tail can include nucleotides other than adenosine nucleotides, positioned between at least two contiguous poly(A) sequences referred to as “stretches”. For example, a segmented poly(A) tail can include a two segments (or stretches) with contiguous sequences of 25 to 75 adenosine nucleotides, separated by at least one nucleotide that is not an adenosine nucleotide (a linker sequence), such as 2 to 10 nucleotides.A polynucleotide of the present disclosure can include two stretches of adenosine residues joined by a nucleotide linker sequence. In some cases, the two stretches can include a first stretch of 30 adenosine residues, a second stretch of 70 adenosine residues, and a 10 nucleotide linker. In a specific embodiment, the IVT RNA molecule comprises a poly(A) tail having at least 80%, 81%, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 11.

[0114] In a specific embodiment, an IVT RNA of the present disclosure has a 3' UTR and poly(A) tail with at least 80%, 81 %, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence from nucleotide 1860 to nucleotide 2272 of SEQ ID NO: 5.

[0115] In certain embodiments, a polynucleotide of the present disclosure includes 200 to 3,000 nucleotides. For example, a polynucleotide of the present disclosure can include 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

[0116] An IVT RNA molecule of the present disclosure can be an “isolated” or “partially purified” molecule. As used herein, “isolated” or “partially purified” refers, in the case of a polynucleotide or protein or fragment thereof that is separated from at least one other component that is present with polynucleotide or protein or fragment thereof after synthesis, transcription or translation thereof. A chemically synthesized nucleic acid or polypeptide or one synthesized using in vitro transcription / translation is considered “isolated.” An isolated IVT-RNA molecule of the present disclosure can be used to induce or elicit an immune response, such as in formulating a FCoV (or FIP) vaccine.In vitro Transcription of RNA

[0117] The present disclosure also provides a DNA plasmid or DNA template comprising a sequence which encodes an IVT RNA, for in vitro transcription. For example, a DNA plasmid or DNA template of the present disclosure can include a sequence which encodes a polynucleotide as described above (encoding a FCoV nucleocapsid protein, an immunogenic fragment thereof, or an immunogenic variant thereof (e.g., a FCoV N protein antigen)), and one or more of a UTR and poly(A) tail, as described above.

[0118] In certain embodiments, the sequence which encodes a polynucleotide encoding a FCoV N protein antigen includes a wild-type cDNA sequence, or fragment thereof. In a specific example, the sequence which encodes a polynucleotide encoding a FCoV N protein antigen has at least 80%, 81%, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 3.

[0119] In certain embodiments, the sequence which encodes a polynucleotide encoding a FCoV N protein antigen is a variant of a wild-type cDNA sequence, or fragment thereof. For example, the variant can encode a codon-optimized polynucleotide, as described above. In a specific example, the sequence which encodes a polynucleotide encoding a FCoV N protein antigen has at least 80%, 81%, 82%, 83%, 84%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1.

[0120] In certain embodiments, the part of the sequence that encodes the poly(A) tail comprises at least two regions consisting of 25 to 75 thymine nucleotides separated by at least one region comprising one or more nucleotides that are not thymine nucleotides, such as 2 to 10 non-thymidine nucleotides (i.e., a linker sequence). In some cases, the plasmid includes a sequence with two stretches of thymidine nucleotides joined by a nucleotide linker sequence. In some cases, the two stretches can include a first stretch of 30 thymidine nucleotides and a second stretch of 70 thymidine nucleotides.

[0121] A DNA plasmid can include an RNA polymerase promoter, e.g., a T7 promoter and / or T3 promotor located 5' to and operably linked to the sequence encoding an IVT RNA.

[0122] In a specific embodiment, the DNA plasmid has the sequence of SEQ ID NO: 7 or have the sequence of SEQ ID NO: 5.

[0123] A DNA plasmid or DNA template encoding the IVT-RNA described above may be transcribed using an in vitro transcription (IVT) system. In certain embodiments, the RNA transcript is generated using a non-amplified, linearized DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the template DNA is isolated DNA. In certain embodiments, the template DNA can be cDNA. In certain embodiments, the cDNA can be formed by reverse transcription of a RNA polynucleotide, for example, a FCoV mRNA. In certain embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells are transfected with a plasmid DNA as described above. In certain embodiments, transfected cells are cultured to replicate the plasmid DNA which is then isolated and purified.

[0124] An in vitro transcription system can include comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase. The NTPs can be selected from, but are not limited to, natural and unnatural (modified) NTPs, as described above.

[0125] Any number of RNA polymerases or variants can be used to synthesize an IVT- RNA of the present disclosure. Non-limiting examples of polymerases include phage RNA polymerases, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, andmutant polymerases such as, polymerases adapted to incorporate modified nucleotides, including chemically modified nucleotides, as described above.

[0126] In certain embodiments, the RNA transcript is capped via enzymatic capping to provide an IVT-RNA of the present disclosure. In a specific embodiment, an IVT-RNA includes 5'-cap obtained by co-transcriptional capping using m7G(5')ppp(5')(2’OMeA)pG. In particular, an IVT-RNA can be transcribed in vitro from a DNA plasmid of SEQ ID NO: 5 or 7, using N1- Methylpseudouridines, and be co-transcriptionally capped using m7G(5')ppp(5')(2'OMeA)pG.

[0127] A DNA template or DNA plasmid of the present disclosure can be synthesized cloning techniques that are known in the art, using DNA nucleic acid sequences that can be synthesized via solid-phase chemical synthesis, in whole or in part. In certain embodiments, a DNA template or DNA plasmid of the present disclosure, or part thereof, can be synthesized using liquid phase chemical synthesis.Lipid Nanoparticles (LNPs)

[0128] The present disclosure also provides a lipid nanoparticle (LNP) formulation comprising loaded LNPs. A loaded LNP can include an IVT RNA molecule as described above as cargo. A LNP is a lipid particles manufactured from a composition comprising at least one lipid (e.g., ionizable lipid, structural lipid, and / or sterol). A loaded LNP represents the physical organization of the lipid composition with at least one IVT RNA molecule. A loaded LNP can be a generally spherical assembly of lipid and cargo determined by charges, ratios, and hydrophobic / hydrophilic properties. A loaded LNP can have an aqueous interior surrounded by a lipid bilayer, or a solid interior comprising a matrix of nucleic acid and lipid.

[0129] A loaded LNP of the present disclosure can include one or more lipids, sterols, and polymeric components. In certain embodiments, a loaded LNP of the present disclosure can include at least one ionizable cationic lipid, at least one structural lipid (e.g., a non-cationic lipid), at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid along with the IVT-RNA molecule cargo. The loaded LNPs of the present disclosure can be generated using components, compositions, and methods known in the art.

[0130] In certain embodiments, a loaded LNP of the present disclosure includes 20-60 mol % ionizable cationic lipid, such as about 20-50 mol %, 20-40 mol %, 20-30 mol %, 30-60 mol %, 30-50 mol %, 30-40 mol %, 40-60 mol %, 40-50 mol %, or 50-60 mol % ionizable cationic lipid. In certain embodiments, an LNP of the present disclosure includes about 20 mol %, 30 mol %, 40 mol %, 50 mol %, or 60 mol % ionizable cationic lipid.

[0131] The ionizable cationic lipid can be selected from the group consisting of DLin-DMA, (6Z,9Z,28Z,31 Z)-heptatriacont-6,9,28,31 -tetraene- 19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-l-yl)- 1 ,3-dioxolan-4-yl)-N,N-dimethylethan-l- amine (DLin-KC2-DMA), l,2-dioleyloxy-3- dimethylaminopropan (DODMA), 9-Heptadecanyl 8- {(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102), 6-((2- hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4-hydroxybutyl)hexan-1-aminium (ALC-0315), Bis[2-(4-{2-[4-(cis-9- octadecenoyloxy)phenylacetoxy]ethyl}piperidinyl)ethyl] disulfide (SS-OP), methylpyridiyl-dialkyl acid (MPDACA), palmitoyl-oleoyl-nor- arginine (PONA), guanidino-dialkyl acid (GUADACA), 1 ,2-di-O- octadecenyl- 3 -trimethylammonium propane (DOTMA), 1 ,2-dioleoyl-3-trimethylammonium- propane (DOTAP), Bis{2-[N-methyl-N-(a-D- tocopherolhemisuccinatepropyl)amino]ethyl} disulfide (SS-33 / 3APO5), Bis {2-[4-(a-D- tocopherolhemisuccinateethyl)piperidyl] ethyl} disulfide (SS33 / 4PE15), Bis{2-[4-(cis-9- octadecenoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE16), Bis{2-[4-(cis,cis-9,12- octadecadienoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE13), [3-(dimethylamino)-2-[(Z)- octadec-9-enoyl]oxypropyl] (Z)-octadec-9-enoate (DODAP), Di-octadecyl-amido-glycyl- spermine (DOGS), {2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1- propanaminium trifluoroacetate} (DOSPA), 3P[N-(N',N'-dimethylaminoethane)-carbamoyl] cholesterol (DC-Chol), N4-Cholesteryl-Spermine (GL-67), bis(guanidinium)-tris(2- aminoethyl)amine-cholesterol (BGTC), Dimethyldioctadecylammonium (DDAB), 2,3-bis[(Z)- octadec-9-enoxy]propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DORIE), 2,3- di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DMRIE), N-(3-aminopro-pyl)- N,N-dimethyl-2,3-bis(dodecyloxy)-l-propanammonium bromide (GAP-DLRIE), N-t-butyl-N'- tetradecyl-3-tetradecylaminopropionamidine (diC14-amidine), di((Z)-non-2-en-l-yl) 9-((4- (dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 1 ,1'-((2-(4-(2-((2-(Bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), OF-02, N1 ,N3,N5-tris(2- aminoethyl)benzene- 1 ,3,5-tricarboxamide (TT3), and 3-[2-[3-[2-[bis[2-[bis(2-hydroxydecyl)amino]ethyl]amino]ethyl-(2- hydroxydecyl)amino]propanoylamino]ethyl-dimethylazaniumyl]propane-1 -sulfonate (ZA3-Ep10).

[0132] In certain embodiments, a loaded LNP of the present disclosure includes 5-25 mol % structural lipid or non-cationic lipid, such as about 5-20 mol %, 5-15 mol %, 5-10 mol %, IQ- 25 mol %, 10-20 mol %, 10-25 mol %, 15-25 mol %, 15-20 mol %, or 20-25 mol % structural lipid or non-cationic lipid. In certain embodiments, a loaded LNP of the present disclosure includes about 5 mol %, 10 mol %, 15 mol %, 20 mol %, or 25 mol % structural lipid or noncationic lipid.

[0133] The structural lipid or non-cationic lipid can be selected from the group consisting of 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1 ,2- dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 ,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1 ,2-diundecanoyl-sn-glycero- phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2-di-O- octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1 -hexadecyl-sn-glycero- 3-phosphocholine (C16 Lyso PC), 1 ,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1 ,2- diarachidonoyl-sn-glycero-3-phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3- phosphocholine, 1 ,2-diphytanoyl-sn-glycero phosphoethanolamine (ME 16.0 PE), 1 ,2- distearoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1 ,2-dilinolenoyl-sn-glycerophosphoethanolamine, 1 ,2-diarachidonoyl-sn- glycero-3-phosphoethanolamine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dioleoyl-sn-glycero-3-phospho-rac-(1 -glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0134] In certain embodiments, a loaded LNP of the present disclosure includes 25-55 mol % sterol, such as about 25-50 mol %, 25-45 mol %, 25-40 mol %, 25-35 mol %, 25-30 mol %, 30-55 mol %, 30-50 mol %, 30-45 mol %, 30-40 mol %, 30-35 mol %, 35-55 mol %, 35-50 mol %, 35-45 mol %, 35-40 mol %, 40-55 mol %, 40-50 mol %, 40-45 mol %, 45-55 mol %, 45- 50 mol %, or 50-55 mol % sterol. In certain embodiments, a loaded LNP of the present disclosure includes about 25 mol %, 30 mol %, 35 mol %, 40 mol %, 45 mol %, 50 mol %, or 55 mol % sterol.

[0135] The sterol can be selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alphatocopherol, and mixtures thereof.

[0136] In certain embodiments, a loaded LNP of the present disclosure includes 0.5-15 mol % PEG-modified lipid. For example, the lipid nanoparticle may comprise 0.5-10 mol %, 0.5- 5 mol %, 1-15 mol %, 1-10 mol %, 1-5 mol %, 2-15 mol %, 2-10 mol %, 2-5 mol %, 5-15 mol %, 5-10 mol %, or 10-15 mol % PEG-modified lipid. In certain embodiments, a loaded LNP of the present disclosure includes about 0.5 mol %, 1 mol %, 2 mol %, 3 mol %, 4 mol %, 5 mol %, 6 mol %, 7 mol %, 8 mol %, 9 mol %, 10 mol %, 11 mol %, 12 mol %, 13 mol %, 14 mol %, or 15 mol % PEG-modified lipid.

[0137] The PEG modified lipid can be selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG- modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol,Methoxypolyethyleneglycoloxy(2000)-N,N-ditetradecylacetamide (ALC-0159), and mixtures thereof.

[0138] In one or more embodiments, an LNP of the present disclosure can be formulated from a mixture of at least one ionizable cationic lipid, at least one structural lipid (e.g., a noncationic lipid), at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid along with the IVT-RNA molecule cargo, in a specific ratio. For example, the mixture can include (A) 5-25 mol % structural lipid, such as about 5-20 mol %, 5-15 mol %, 5-10 mol %, 10-25 mol %, 10-20 mol %, or 10-25 mol % structural lipid; (B) 25-55 mol % sterol, such as about 25-50 mol %, 25-45 mol %, 25-40 mol %, 25-35 mol %, 30-55 mol %, 30-50 mol %, 30-45 mol %, 30- 40 mol %, 30-35 mol %, 35-55 mol %, 35-50 mol %, 35-45 mol %, 35-40 mol % sterol; (C) 20-60 mol % ionizable cationic lipid, such as about 20-50 mol %, 30-60 mol %, 30-50 mol %, 40-60 mol %, 40-50 mol %, or 50-60 mol % ionizable cationic lipid; (D) 0.5-15 mol % PEG-modified lipid, such as about 0.5-10 mol %, 0.5-5 mol %, 1-15 mol %, 1-10 mol %, 1-5 mol %, 2-15 mol %, 2-10 mol %, or 2-5 mol % PEG-modified lipid.

[0139] In a specific embodiment, an LNP for use herein can include a mixture of noncationic lipid (e.g., DSPC), sterol (e.g., cholesterol), at least one ionizable cationic lipid, and at least one PEG modified lipid at a molar ratio ((A):(B):(C):(D)) of about 1-20:25-45:30-60:1-10, about 5-15:30-40:40-55:1-5, about 8-12:35-39:48-52:2-4, or about 10:37.5:50,2.5. The at least one ionizable cationic lipid can be selected from the group consisting of DLin-DMA, DLin-MC3- DMA, DLin-KC2-DMA, DODMA, SS-OP, MPDACA, PONA, GUADACA, DOTMA, DOTAP, SS- 33 / 3APO5SS33 / 4PE15, SS18 / 4PE16, SS18 / 4PE13, DODAP, DOGS, DOSPA, DC-Chol, GL- 67, BGTC, DDAB, DORIE, DMRIE, GAP-DLRIE, diC14-amidine, L319, C12-200, OF-02, TT3, and ZA3-Ep10, and the least one PEG-modified lipid can be selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0140] In a specific embodiment, an LNP can include DSPC, cholesterol, ionizable cationic lipid, and PEG-modified lipid at a molar ratio ((A):(B):(C):(D)) of about 10:38.5:50:1.5. 10:38.5:50:1 .5 M ratio). The Ionizable cationic lipids can be ALC-0315, SM-102 or MC3, and the PEG-modified lipid can be ALC-0159, DMG-PEG2k or DSPE-PEG2k,

[0141] In a specific embodiment, an LNP for use herein can include DSPC, cholesterol, ionizable cationic lipid, and DMG-PEG2k at a molar ratio ((A):(B):(C):(D)) of about 10:38.5:50:1.5. The ionizable cationic lipid can be ALC-0315, SM-102, DLin-MC3-DMA, DODAP, or DOTAP,

[0142] In a specific embodiment, a loaded LNP of the present disclosure comprises a mixture of lipids sold by Precision NanoSystems under the trade name GenVoy-ILM™.

[0143] A loaded LNP of the present disclosure can be characterized by an N / P ratio. As used herein, “N / P ratio” refers to the ratio of amine (N) groups of the lipid (e.g., ionizable cationic lipid) to phosphate (P) groups of the cargo (i.e. , the IVT RNA molecule).

[0144] A loaded LNP of the present disclosure can have a mole ratio of lipid to IVT RNA molecule (e.g., mRNA) (N / P) of from about 2:1 to about 30:1 , from about 3:1 to about 20:1 , from about 4:1 to about 10:1 , from about 5:1 to about 8:1 , or from about 6:1 to about 7:1. In certain embodiments, a loaded LNP of the present disclosure can have an N / P ratio of about 3:1 to about 7:1 . In certain embodiments, a loaded LNP of the present disclosure can have an N / P ratio about 3:1 , 4:1. 5:1 , 6:1 or 7:1 (i.e., about 3, about 4, about 5, about 6, or about 7). An N / P ratio can vary based upon the chemical properties of an IVT RNA molecule. For example, in a specific embodiment, an IVT RNA molecule that includes a codon-optimized polynucleotide can be formulated into LNPs having a different N / P ratio than an IVT RNA molecule that includes a wild-type polynucleotide cargo.

[0145] An LNP formulation can include a population of loaded LNPs. In certain embodiments, an LNP formulation of the present disclosure can include a population of loaded LNPs with an average diameter of at least about 50 nm. In certain embodiments, the average diameter can be within a range of from about 50 nm to about 150 nm or from about 80 nm to about 125 nm. In certain embodiments, the average diameter can be determined by dynamic light scattering (DLS) (e.g., a z-average particle size) or by nanoparticle tracking analysis (NTA) of a LNP formulation. The z-average is a size that is determined according to an ISO method ISO13321 : 1996 or ISO22412:2008 also referred to as the cumulants mean. Z-average is an Intensity-based calculated value and not directly comparable with a Mass or Number mean value produced by methods other than DLS. NTA permits visualization and measure of nanoparticles in suspension in the range from 10 - 1000 nm based on the analysis of Brownian motion. The size measured by NTS is the translational diffusion diameter of a sphere (i.e., a hydrodynamic diameter).

[0146] In certain embodiments, the population of loaded LNPs is monodisperse. For example, loaded LNPs can have a polydispersity index (PDI) within a range of from about 0.05 to about 0.2. The PDI is dimensionless and scaled such that values smaller than 0.05 are rarely seen other than with highly monodisperse standards. Values greater than 0.7 indicate that the sample has a very broad size distribution.

[0147] Loaded LNPs of the present disclosure can be prepared by mixing an ethanolic solution of lipids with an aqueous solution of IVT-RNA, as described above. Self-assembly of loaded LNPs can occur upon mixing. Among other factors, mixing parameters can influence characteristics such as particle size and PDL The total flowrate (TFR) and the Flow Rate Ratio (FRR) can be tuned for a desired particle size for a given application. The relationship between the working concentrations of the nucleic acid and the lipid mix in this formulation can be described by the following equation:Where [n] is the concentration of nucleotides, [L] is the lipid mix concentration, and X is the mole fraction of ionizable cationic lipid. The above equation shows that FRR, N / P ratio, [L] and [n] are all related to one another. Higher FRR and N / P ratios can be used with lower concentrations of RNA.

[0148] In a specific embodiment, loaded LNPs of the present disclosure can be prepared using an aqueous solution of IVT RNA molecules at a concentration of about 0.1 to about 0.2 mg / mL, an FRR of about 3:1 , with organic and aqueous solutions at N / P ratios of 3, 4, 5, 6, or 7 (i.e., a mole ratio of lipid to IVT RNA of 3:1 , 4:1 , 5:1 , 6:1 , or 7:1 ).

[0149] In certain embodiments, loaded LNPs can be buffer exchanged after preparation, such as in a PBS buffer.

[0150] In certain embodiments, two or more different IVT RNA molecules encoding structurally distinct antigens can be formulated in the same lipid nanoparticle.

[0151] In certain embodiments, two or more different IVT RNA molecules encoding structurally distinct antigens can be formulated in separate LNPs (i.e., each of the two or more IVT RNA molecules is formulated in a single LNP). The separately prepared LNPs can be combined in a LNP formulation of the present disclosure.

[0152] In certain embodiments, the LNP formulation has encapsulation efficiency of about 90% or greater. Encapsulation efficiency (%) describes the percentage of IVT RNA molecules in the sample encapsulated by LNPs. Encapsulation efficiency can be determined using a RiboGreen assay, for example.Vaccine compositions

[0153] The present disclosure also provides FIP vaccine compositions. For example, provided herein is an IVT RNA molecule comprising a polynucleotide encoding a FCoV N protein antigen for use in the prevention or treatment of a FCoV infection and associateddisease (e.g., FIP). A FIP vaccine composition can be for prevention or treatment of FCoV infection in an individual or subject, e.g., a feline subject.

[0154] A FIP vaccine composition can induce a humoral and / or cellular immune response against FCoV. An induced response can include a humoral immune response that includes neutralizing antibodies against FCoV and / or a cellular immune response that includes CD4+ and / or CD8+ T-cells against FCoV. In some cases, a cellular immune response includes levels of cytokines that are increased as compared to a cell that has not been contacted with the vaccine composition. For example, a cellular immune response can include levels of Interferon (lnf-y), TNF-a, and / or IL-2 that are increased as compared to an levels of lnf-y, TNF-a, and / or IL-2 in a cell that has not been contacted with the vaccine composition.

[0155] In certain embodiments, a FIP vaccine composition of the present disclosure can include an IVT RNA molecule as described above, optionally in combination with one or more acceptable excipients. Formulations for veterinary use are within the scope of the present disclosure. An acceptable excipient is one that is compatible with the other ingredients of the vaccine composition and physiologically innocuous to the recipient thereof. An excipient can be selected from the group consisting of solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, and preservatives.

[0156] In certain embodiments, a FIP vaccine composition of the present disclosure can include an IVT RNA formulated with one or more adjuvants. Adjuvants, in general, include adjuvants that create a depot effect, immune-stimulating adjuvants, and adjuvants that create a depot effect and stimulate the immune system. The adjuvant can be a felid-acceptable adjuvant. When used in reference to an adjuvant, “felid-acceptable” refers to an adjuvant that stimulates the immune system without a significant risk of causing persistent inflammation in a feline. Adjuvants that are not associated with a risk of persistent inflammation and subsequent neoplasia are known in the art. In some cases, a FIP vaccine composition does not include an adjuvant (i.e., the composition is adjuvant free).

[0157] In certain embodiments, a FIP vaccine composition can include an IVT RNA molecule formulated with one or more vectors or vehicles useful for producing a FCoV N protein antigen by expression in vivo. In certain embodiments, a vector suitable for the delivery and expression of an IVT RNA molecule into an individual's cells can be a viral or non-viral vector. Non-viral vectors include, for example, polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof. Viral vectors can be selected from non-replicating, non-pathogenic viruses engineered for the delivery of genetic material into cells.

[0158] Relative amounts of an IVT RNA molecule in a FIP vaccine composition can vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100%, e.g., between 0.5 and 50%, between 1- 30%, between 5-80%, at least 80% (w / w) IVT RNA molecule.

[0159] In certain embodiments, a FIP vaccine composition of the present disclosure can include a LNP formulation as described above. A FIP vaccine composition can include a sufficient amount of loaded LNPs to provide a prophylactically or therapeutically effective amount of an IVT RNA molecule encoding a FCoV N protein antigen. A prophylactically or therapeutically effective amount is an amount sufficient to induce an immune response, in particular a protective immune response against FCoV infection, in the individual to whom it is administered. The prophylactically or therapeutically effective amount can vary with the composition used, the route of administration, the physical characteristics of the specific individual under consideration, concurrent medication or infection, and other factors, that those skilled in the medical or veterinary arts will recognize.

[0160] In certain embodiments, a FIP vaccine composition containing a LNP formulation of loaded LNPs as described above can also contain one or more excipients suitable of a desired route of administration. In one or more embodiments, the excipient is selected from sodium chloride, monobasic potassium phosphate, potassium chloride, dibasic sodium phosphate dihydrate, tromethamine, tromethamine hydrochloride, acetic acid, sodium acetate, and sucrose. In certain embodiments, a FIP vaccine composition containing a LNP formulation of loaded LNPs as described, further includes a PBS buffer.

[0161] In certain embodiments, a FIP vaccine composition containing a LNP formulation of loaded LNPs as described above can further include one or more adjuvants, as described above. In certain embodiments, a vaccine composition of the present disclosure does not include an adjuvant.

[0162] A FIP vaccine composition of the present disclosure can be a combination vaccine that includes IVT RNA molecules encoding one or more FCoV N protein antigens and one or more antigen(s) of a different organism, such as LNPs loaded with IVT RNA molecules encoding one or more FCoV N protein antigens and one or more other antigen(s). Thus, the vaccines of the present disclosure can be combination vaccines that target one or more antigens of the same strain / species, or one or more antigens of different strains / species, e.g., antigens which induce immunity to organisms which are found in the same geographic areaswhere the risk of FCoV infection or FIP is high or organisms to which an individual is likely to be exposed to when exposed to FCoV.

[0163] In certain embodiments, a FIP vaccine composition including an IVT RNA molecule or a LNP formulation thereof can be formulated for systemic delivery, such as for parenteral administration by injection or by mucosal administration, such as intranasal administration, or mixed administration. A FIP vaccine composition can be a suspension, solution or emulsion in an oily or aqueous vehicle. In certain embodiments, a FIP vaccine composition can be formulated as a depot preparation or other long-acting formulation.

[0164] A FIP vaccine compositions of the present disclosure can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, optionally with an added preservative.

[0165] A FIP vaccine composition as described above can be prepared under sterile, pyrogen-free or both sterile and pyrogen-free conditions. General considerations in the formulation and / or manufacture vaccine compositions and techniques are explained in the literature and known to the skilled artisan.Methods of use

[0166] The present disclosure also describes methods for preventing FCoV infection in an individual, comprising: administering an effective amount of a FIP vaccine composition as described above to the individual.

[0167] In certain embodiments, a FIB vaccine composition can be administered prophylactically or therapeutically as part of an active immunization scheme to healthy individuals or early in infection during the incubation phase or during active infection after onset of symptoms.

[0168] An individual of the present disclosure can be any mammal. Typically, an individual is a felid (i.e., a mammal of the cat family), including a wild or domesticated felid. In certain embodiments, an individual of the present disclosure can be a felid that is susceptible to developing FIP. For example, a felid that is susceptible to developing FIP can be very young, such as less than three weeks of age, or between three months and two years of age, or older. In certain embodiments, an individual is a male cat. In certain embodiments, an individual is a purebred cats, including Abyssinian, Bengal, Birman, Himalayan, Ragdoll, and Devon Rex. In certain embodiments, an individual can be a cat living in a multi-cat household, shelter, or cattery. In certain embodiments, an individual can be a cat that has been recently re-homed, had surgery, or has a concurrent infection.

[0169] In certain embodiments, a vaccine composition as described above can be administered to a subject (e.g., a mammalian subject, such as a murine or felid subject), for translation of the IVT RNA polynucleotide therein in vivo to produce a FCoV N protein antigen. A felid subject can be selected from the felid individuals described above.

[0170] Administering an effective amount of a FIP vaccine can include any known route, dosages, and periods of time effective to induce a beneficial effect in the individual or subject. For example, administering can include intramuscular, intradermal, intravenous or subcutaneous injection, transdermal (such as a patch), mucosal (such as a spray or powder), oral, or mixed routes of administration. In certain embodiments, administering can be by injection, such as subcutaneous injection, or by a mucosal route, such as intranasal administration, or by mixed administration

[0171] In methods of the present disclosure, the effective amount is based upon an amount of antigen sufficient to induce an immune response against FCoV infection in the individual or subject to whom it is administered (e.g., a protective immune response). As used herein, the term “immune response” refers to any aspect of an innate or adaptive (also referred to as “cell-mediated”) immune response that reflects activation of an immune cell to proliferate, to perform an effector immune function, or to produce a gene product involved in an immune response.

[0172] An “effective amount” of a vaccine composition can be based, at least in part, on the route of administration, physical characteristics of the IVT-RNA (e.g., length, nucleotide composition, and / or extent of modified nucleosides), other components of the vaccine, and other determinants, such as age, body weight, height, sex and general health of the recipient. Typically, an effective amount of a composition provides an induced immune response as a function of antigen production in the cells of the subject.

[0173] In certain embodiments, an effective amount of a FIP vaccine composition is an amount sufficient to produce detectable levels of FCoV N protein antigen as measured in serum of the recipient at 1-72 hours post administration. In certain embodiments, an effective amount of a vaccine composition can include an amount sufficient to provide about 10 ng to about 10 mg FCoV N protein antigen to the individual or subject. In certain embodiments, between about 100 ng and 2.5 mg, about 1 pg and 500 pg, or between about 10 pg and 200 pg FCoV N protein antigen can be provided via administration of the effective amount of the vaccine composition. In certain embodiments, at least about 50 ng of a FIP vaccine composition can be administered (e.g., from about 0.05 pg to about 100 pg, or to about 1000 pg). In certain embodiments, about 0.05, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 pg ofa FIP vaccine composition comprising a LNP formulation can be administered. For example, a FIP vaccine comprising a LNP formulation with 0.05-0.5 pg, 0.5-1 pg, 1-5 pg, 5-10 pg, 10-15 pg, 15-20 pg, 20-25 pg, 25-30 pg, 30-35 pg, 35-40 pg, 40-45 pg, 45-50 pg, 50-55 pg, 55-60 pg, 60- 65 pg, 65-70 pg, 70-75 pg, 75-80 pg, 80-85 pg, 85-90 pg, 90-95 pg, or 95-100 pg loaded LNPs can be administered.

[0174] A method of the present disclosure can include administering a FIP vaccine composition more than once. For example, a FIP vaccine composition can be administered according to a prime-boost regimen that includes 2 or 3 administrations. A prime-boost regimen can include 2 administrations at an interval of at least 3 weeks. In certain embodiments, primeboost regimen includes 2 administration at an interval of 3, 4, 5 or 6 weeks. In certain embodiments, a prime-boost regimen can include 3 administrations at intervals of up to 3 weeks.

[0175] In certain embodiments, a method of the present disclosure includes administering a booster. As used herein, the term “booster” refers to an extra administration of the FIP vaccine composition. The time of administration between the initial administration of a FIP vaccine composition and a booster can be 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, or 2 years. In certain embodiments, the time between the initial administration and the booster is 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months or 1 year. In certain embodiments, an effective amount of a vaccine composition is an amount that provides a boosted immune response as a function of antigen production in the cells of the subject. Thus, an individual can be administered different effective amounts over a course of treatment that includes multiple administrations of a FIP vaccine composition.

[0176] Efficacy can be assessed by detecting gene products associated with in an immune response in a single cell or in a population of cells. Gene products can include secreted products (e.g., antibodies, cytokines, and chemokines) as well as intracellular and cell surface molecules characteristic of immune function (e.g., certain cluster of differentiation (CD) antigens, transcription factors, and gene transcripts). Production of cytokines and upregulation of cell surface markers of activation can be used to identify activation of the immune response by a FIP vaccine of the present disclosure, and can be assessed by any of several methods well known in the art, including biological response assays, enzyme-linked immunosorbent assay (ELISA), intracellular fluorescence-activated cell sorting (FACS) analysis, and reverse transcriptase / polymerase chain reaction (RT-PCR).

[0177] For example., efficacy can be assessed by measuring an anti-antigen antibody titer. An “anti-antigen antibody” is a serum antibody capable of specific binding to the antigen. An antibody titer is a measurement of the amount of antibodies within a subject, for example, antibodies that are specific to a particular antigen (e.g., an anti-FCoV N protein antigen). Antibody titer can be expressed as the inverse of the greatest dilution that provides a positive result. Enzyme-linked immunosorbent assay (ELISA) can be used for determining antibody titers, for example. In some embodiments, a method of the present disclosure achieves an increase in the anti-antigen antibody titer of 1 log to 10 log in the recipient following vaccination as compared to an unvaccinated subject.

[0178] Alternatively or additionally, efficacy can be assessed by testing serum or antibody from an immunized subject for its ability to neutralize viral uptake or reduce FCoV transformation of B lymphocytes, or by measuring T cell response(s) using art recognized techniques.EXAMPLES

[0179] The disclosure will be more fully understood by reference to the following examples. The examples should not, however, be construed as limiting the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

[0180] EXAMPLE I: Feline Infectious Peritonitis mRNA Vaccine Elicits Both Humoral and Cellular Immune Responses in Mice

[0181] 1. Introduction

[0182] Feline infectious peritonitis (FIP) is a devastating and highly fatal disease caused by feline coronavirus (FCoV). To date, there is no widely-used vaccine for FIP, and many attempts using a variety of platforms have been largely unsuccessful due to the disease’s highly complicated pathogenesis. One such complication is antibody-dependent enhancement (ADE) seen in FIP, which occurs when sub-neutralizing antibody responses to viral surface proteins paradoxically enhance disease. Described herein is a vaccine strategy which can overcome the risk of ADE - a lipid nanoparticle-encapsulated mRNA encoding the transcript for the internal nucleocapsid (N) FCoV protein. Also described are wild type and, by introduction of silent mutations, G / C content-optimized LNP-encapsulated mRNA vaccines for FCoV N.

[0183] The results below characterize in vitro mRNA durability by quantitative reversetranscriptase PCR and protein expression by immunofluorescence assay for one week after transfection of cultured feline cells. These show that both mRNA quantity and protein production in vitro are improved with the G / C-optimized construct as compared to wild type.

[0184] The following examples demonstrated in vivo nucleocapsid-specific humoral (by ELISA) and cytotoxic T cell (by flow cytometry) responses in a proof-of-concept mouse vaccination study. These data together demonstrate that an LNP-mRNA FIP vaccine targeting FCoV N is stable in vitro, capable of eliciting an immune response in mice, and supports safety and efficacy trials in cats.

[0185] 2. Materials and Methods

[0186] 2.1. Cell culture and transfection:

[0187] Crandell-Rees feline kidney (CRFK; ATCC #CCL-94) cells were grown in minimal essential medium with Earle’s balanced salts, supplemented with 10% fetal bovine serum, 100 units / mL penicillin, and 100 pg / mL streptomycin, 1 mM sodium pyruvate, and 1X non-essential amino acids, and incubated at 37°C and 5% CO2 in a humidified incubator. All cell culture reagents were purchased from Gibco / Thermo Scientific.

[0188] For quantitative reverse-transcriptase PCR (q-RT PCR), cells were transfected in24 well plates in biological triplicate for each construct and timepoint, using 500ng of mRNA per 90% confluent well (Lipofectamine 3000, Invitrogen). For immunofluorescence assay (IFA), two wells per construct and timepoint were used to transfect 8 well chamber slides with 250ng of mRNA per 90% confluent well. For downstream mRNA q-RT PCR, cells from each of 3 wells per construct were harvested at day 0, 1 , 2, 3, 5, and 7 post transfection (day 0 cells were washed 3 times then harvested immediately post transfection). For downstream immunofluorescence assay, cells were washed 3 times, then fixed in 4% paraformaldehyde for25 minutes at room temperature, then rinsed in phosphate buffered saline (PBS) and stored at 4°C until time of downstream analysis.

[0189] 2.2. In vitro transcription and mRNA purification:

[0190] Sequence from a circulating strain of FCoV (Genbank KF530271.1) was used as a basis for nucleocapsid constructs. Plasmids encoding silent mutations to optimize GC content (with preferential use of common feline codons) and wild type (WT) nucleocapsid were designed in-house and synthesized by GenScript. Additional modifications for optimized mRNA stability and protein expression were made as described by others. Linearized plasmid or amplified PCR product was transcribed in vitro (HiScribe T7, NEB), with co-transcriptional capping (CleanCap,TriLink BioTechnologies) and using N1-Methylpseudouridine (TriLink BioTechnologies) per manufacturer’s protocols. Uncapped mRNA for each construct with CleanCap eliminated from the transcription reaction was used as a control for in vitro studies. mRNA was column-purified (Monarch RNA, NEB) then subjected to cellulose purification per previously published protocol and stored at -80°C until further use. Quality control was performed using a 2100 BioAnalyzer RNA Nano Assay (Agilent), with no contamination seen (DNA Technologies and Expression Analysis Core, UC Davis) (FIG. 5).

[0191] 2.3. Measurement of nucleocapsid mRNA stability by quantitative reversetranscriptase PCR (q-RT PCR):

[0192] At each timepoint indicated, q-RT PCR was performed on RNA purified from transfected cells. Assay was performed with technical triplicates on each of 3 biological replicates per construct and timepoint; results are the average of the 9 replicates per construct and timepoint. Cells were washed 3 times in PBS, trypsinized, and harvested. RNA from each well was extracted separately (RNEasy, Qiagen). Extracted RNA was subjected to reverse transcription (QuantiTect Reverse Transcription, Qiagen) and used for qPCR using primers FCoV N.359F CCATGAACAAGCCAACGACACT (SEQ ID NO: 9) and FCoV N.464R CGGTTCACTTCAAGCTGGAATTG (SEQ ID NO: 10), amplifying a 106bp region of the gene (Maxima SYBR Green, Thermo Fisher). Limit of detection 50 copies / reaction.

[0193] 2.4. Immunofluorescence assay (I FA):

[0194] Fixed cells were permeabilized for 10 minutes in 0.5% sodium deoxycholate in PBS. Cells were then blocked in 5% normal goat serum in PBS + 0.1% Triton-X (PBS-T) for 1 hour at room temperature. Primary monoclonal mouse anti-feline nucleocapsid (Bio-Rad) was used at 1:1000 in PBS-T for 1h at room temperature. Cells were washed 5 times in PBS-T, then secondary goat anti-mouse AlexaFluor488 (Invitrogen) was used at 1:1000 for 20 minutes at room temperature; cells were counterstained with DAPI at 300nM for the last 5 minutes of secondary staining. Cells were washed 5 times in PBS-T, and left in PBS-T for imaging. Imaging was performed on an EVOS AMG digital inverted microscope (Life Technologies), and images were captured with equal intensity, brightness, and contrast. Approximately 10-12 20x representative images per well in areas of -80% cell confluence were captured for Imaged fluorescence quantification normalized to day 0 and uncapped transfected controls.

[0195] 2.5. Western blot:

[0196] CRFK cells at 1 day post transfection were lysed in RIPA lysis buffer containing protease inhibitor cocktail (Roche). Equivalent cell number was loaded on a 4-12% graded Tris-glycine SDS-polyacrylamide gel and proteins were transferred to a 0.2 pm PVDFmembrane (Life Technologies). Membranes were blocked in 5% milk in PBS with 0.05% Tween™-20 (polysorbate 20) for one hour at room temperature with rocking, and then incubated with primary mouse anti-feline nucleocapsid antibody in blocking buffer at 4°C overnight at a dilution of 1:1000 (BioRad). Secondary anti-mouse IgGK-HRP was diluted at 1:5000 in block buffer and incubated at 1 h at room temperature with rocking (Santa Cruz Biotechnology). Proteins were visualized with Supersignal™ West Pico PLUS chemiluminescent substrate (ThermoFisher) using FluorChem E (Protein Simple).

[0197] 2.6. LNP Encapsulation-.

[0198] LNPs were derived using a working concentration of 0.17mg / mL diluted in formulation buffer (Precision NanoSystems) and GenVoy-ILM™ at a flow rate ratio of 3:1. Organic and aqueous solutions were used at N / P ratios of 5 or 6 for optimization. Solutions were loaded in cartridges on the NanoAssemblr® Ignite™ apparatus and resulting LNPs were buffer exchanged in PBS on Centricon® centrifugal devices per manufacturer’s instructions (10kDa NMWL, Millipore).

[0199] Recovered LNP-mRNA size and dispersity was characterized by dynamic light scattering (Malvern Zetasizer Nano ZS, Zetasizer Software version 7.11), size and quantity characterized by nanoparticle tracking analysis, and encapsulation efficiency and concentration determined by RiboGreen RNA Assay Kit (Invitrogen) per previously described protocols provided by Precision NanoSystems. For nanoparticle tracking analysis (NTA), mRNA- encapsulated LNPs were diluted in 0.2 pm filtered PBS to a final concentration between 1x107and 2x109particles / mL and loaded by syringe pump (Harvard Bioscience, MA, USA). The NanoSight LM10 (Malvern Panalytical Ltd.) was used for data collection with NanoSight NTA 3.1. software for analysis. Three 90-sec videos were collected to determine an average concentration and size profile of particles with camera level of 10 and detection threshold of 2. Between samples, MilliQ® water was used to clear out the sample lines.

[0200] 2.7 Mouse vaccination and safety assays:

[0201] This study followed the ethical guidelines and was approved by UCD IACUC (protocol number 21796). Ten 12-week-old C57BL / 6J mice were bled prior to vaccination, then vaccinated with 10pg of WT (n=4), GC-optimized (n=4), or mock-vaccinated with PBS at weeks 0 and 6 by the subcutaneous route in the left pelvic limb. No adverse events were noted in mice after either prime or boost. Mice were euthanized at 5 weeks post boost and terminally bled at the time of euthanasia. Splenocytes were harvested for flow cytometry, and serum spun for antibody titers by enzyme-linked immunosorbent assay (ELISA).

[0202] 2.8. IgG-specific nucleoprotein antigen ELISA:

[0203] 96-well plates were coated with purified recombinant feline coronavirus nucleocapsid protein at 5pg / mL overnight at 4°C. Plates were blocked with 1% bovine serum albumin in PBS for 1h at 37°C. Mouse serum was added in twofold serial dilution in PBS and performed in technical duplicates, and positive control antibody (mouse anti-FCoV monoclonal, BioRad) was used at 1 :1000. Plates were incubated for 2h at room temperature, then washed 4x in PBS. Secondary anti-mouse IgGK-HRP (Santa Cruz Biotechnology) was diluted at 1:5000 and added for 1h at room temperature, then washed 4x in PBS. Detection with tetramethylbenzadine substrate and peroxide solution, with reaction stopped after ~4mins with 2M sulfuric acid, and plates were read for absorbance at 450nm. For each twofold dilution, technical duplicates of two representative negative samples (pooled pre-bled mouse serum from all 10 mice and pooled terminal bleed from PBS mock- vaccinated mice) were used to determine negative titers.

[0204] 2.9. Splenocyte stimulation assay:

[0205] After necropsy, spleens were homogenized by passing through a 40pm cell strainer. Red blood cells were lysed with ACK lysing solution (Gibco), washed and resuspended in RPMI media containing 2 mM L-Glutamine, 5% serum, 1x non-essential amino acids, 1mM sodium pyruvate, 100 units / mL penicillin, and 100 pg / mL streptomycin.

[0206] Splenocytes were plated at 2x106 cells / well in 96-well U-bottom plates and stimulated with 2pg / ml of a 15mer overlapping peptide pool spanning the entire FCoV N protein (Intavis). After two hours, golgi plug protein transport inhibitor (BD Biosciences) was added and cells were incubated overnight at 37°C 5% CO2 in a humidified incubator. Positive stimulation controls, using cell activation cocktail containing phorbol-12-myristate 13-acetate / ionomycin, was performed according to the manufacturer’s protocol (BioLegend). Unstimulated controls were treated with 0.5% DMSO. Cell counts were obtained using a TC20 automated cell counter (BioRad). Following stimulation, the cells were stained, fixed, and acquired the same day.

[0207] 2.10. Flow cytometry.

[0208] Fc receptor blocking was performed using TruStain FcX PLUS anti-mouse CD16 / 32 antibody (BioLegend) and surface antigen staining was performed at 4°C for 30 min using the following antibodies: APC / Fire 750 anti-mouse CD3E 145-2C11 (BioLegend, 1:50), AF 488 anti-mouse CD4 GK1.5 (BioLegend, 1 :100), APC-R700 Rat Anti-Mouse CD8a 53-6.7 (BD Biosciences, 1 :200). Dead cells were identified using Zombie Aqua Fixable Viability dye (BioLegend). Following surface staining the cells were fixed and permeabilized using the Cytofix / Cytoperm Plus Fixation / Permeabilization Kit (BD Biosciences) for 20 min at 4°C. Intracellular cytokine staining was performed using antibodies PE anti-mouse IL-2 JES6-5H4(BioLegend, 1:100), APC anti-mouse IFN-y XMG1.2 (BioLegend, 1:100) and PE / Cyanine7 antimouse TNF-a MP6-XT22 (BioLegend, 1 :100) in BD Perm / Wash buffer at 4°C for 30 minutes.

[0209] Sample fluorescence and cell characteristics were assessed using a Beckman Coulter Cytoflex S 4-laser, 13-color flow cytometer with CytExpert software v. 2.6.Compensation, gating and analysis were performed using FlowJo 10.9.0.

[0210] 2.11. Data analysis and statistics:

[0211] All data were analyzed in Graph Pad Prism (10.2.1). Unless otherwise indicated, all results represent two-sample t-tests. Serum ELISA titers were determined by previously described methods for determining endpoint titers using a 95% confidence interval based on two negative controls as described above.

[0212] 3. Results

[0213] 3.1. Vaccine design

[0214] Forty sequences from Genbank published within the last 20 years from locations spanning the globe were compared, and one sequence representing approximately 90% identity across the N genes in this subset was chosen as wild type (WT) template (Genbank accession # KF530271) (FIG. 1A). This WT sequence contains a GC content of 44.4%. Silent mutations were introduced to increase GC content to 57.6%, with preferential use of common codons in the cat; however, codon optimization was not a primary goal, as the wild type virus has been in circulation in the feline population for at least seven decades. Modifications to increase mRNA stability and protein production were made to the 5’ and 3’UTR and the poly-A tail, with cat-specific modifications introduced where appropriate (see, e.g., FIG. 6). These mRNAs and their resulting LNP-encapsulated vaccine constructs are referred to throughout as “WT” and “GC” (FIG. 1B). Uncapped mRNA constructs were derived as controls for in vitro experiments, which are identical in nature to their capped counterparts except that the co-transcriptional inclusion of a 5’ cap was omitted (and therefore cannot be translated). These constructs are referred to as “WT-uncapped” and “GC-uncapped” (FIG. 1B).

[0215] 3.2. mRNA stability and expression in vitro

[0216] Cultured Crandell-Rees feline kidney (CRFK) cells were transfected with purified mRNA and assayed for mRNA stability by quantitative reverse-transcriptase PCR (q-RT PCR) at days 1 , 2, 3, 5, and 7 post transfection (FIGs. 2A-B). mRNA quantity peaked at day 1 and decreased over the course of one week, remaining detectable at all timepoints tested. Both capped and uncapped GC constructs demonstrated significantly higher quantities of mRNA as compared to their respective WT constructs at all timepoints except for one (uncapped, day 5) where no difference was seen between the two. The rate of decay decreased over time with bothpairs of constructs, with the biggest difference in means between each pair occurring at day 1. Overall, these experiments demonstrate increased stability of GC mRNA in cultured feline cells as compared to wild type.

[0217] 3.3. Protein production in vitro

[0218] While mRNA quantity is often used as an ersatz for protein production, post transcriptional control of translation can affect the total amount of antigen produced by transfected cells; therefore, quantification of protein by immunofluorescence assay (IFA) was performed. CRFKs were transfected and fixed at the same timepoints as in section 3.2 then stained by indirect IFA. Multiple images were taken from each construct / timepoint from each transfected well, and protein was quantified with Imaged by measuring the integrated density of pixels from these images. Uncapped and day 0 (fixed immediately post-transfection) wells were used for thresholding; no overt fluorescence from N was visually noted in any of these samples. Representative images of day 1 post transfection show robust protein expression in both WT and GC constructs (FIGs. 3A). Quantitatively, day 1 was the only time point where no significant difference was seen between WT and GC constructs; all other timepoints demonstrated significantly increased protein from the GC construct, with protein expression persisting but declining through day 7 post transfection (FIG. 3B; p < 0.0001 for days 2-5, p=0.02 for day 7).

[0219] Finally, to characterize the size of the protein expressed, Western blot was performed on cells at 1 day post transfection, and correct size was confirmed (FIG. 3C).

[0220] These experiments together confirm protein production to closely follow mRNA quantity in vitro in feline cells, with increased protein produced from GC-transfected cells as compared to WT.TABLE 1. Characterization of WT and GC nucleocapsid mRNA-encapsulated LNP vaccinesTABLE 2. Mean percentage of CD8+ T cells expressing cytokines after stimulation in vaccinated miceSignificance represented for double TNFa +IFN-y positive CD8+ T cells for each vaccinated mouse as compared to PBS mock-vaccinated mice by ttest. * p < 0.05, ** p < 0.01 , *** p < 0.001.

[0221] 3.4. Mouse vaccination and humoral immune response

[0222] Vaccine constructs were characterized by size and dispersion using dynamic light scattering and nanoparticle tracking analysis, and for encapsulation efficiency by RiboGreen assay (TABLE 1). Based on particle size and encapsulation efficiency, optimal N / P ratio constructs were selected for in vivo studies (WT - N / P 5, GO - N / P 6).

[0223] 12-week old C57BL / 6J mice were vaccinated with a prime boost strategy at weeks 0 and 6 (FIG. 4A). Four mice per vaccine construct were used, with two PBS mock-vaccinated controls. Blood was collected prior to vaccination and again at euthanasia (week 11 ) for N-specific IgG quantification by ELISA. All 8 vaccinated mice elicited an immune response at the time of euthanasia, with endpoint titers ranging from 1 :640 to 1 :5120 (WT) and 1 :1280 to upper limit of detection at 1 :20,480 (GO) (FIG. 4B).

[0224] 3.5. Nucleocapsid-specific CD8+ T cell response

[0225] Splenocytes were harvested at the time of euthanasia (week 11 ) and stimulated with FCoV N overlapping peptides to detect antigen-specific T cell responses. Flow cytometry plots from representative mice in described vaccinated groups are presented in FIG. 4C, with details from individual mice presented in TABLE 2. After stimulation and compared to PBS controls, most mice developed N-specific CD-8+ T cells expressing IFN-y, with a range in WT-vaccinated mice from 0.17 - 1.7% of total CD8+ T cells and a range in GC-vaccinated mice from 0.14 - 0.54% as compared to PBS (mock-vaccinated) control mice (average 0.096%) (Table 2). CD8+ T cells which were double-positive for TNF-a and IFN-y were present at a range of 0.1-1 .6% of WT- vaccinated mice, and a range of 0.05-0.39% of GC-vaccinated mice, as compared to PBS controls (average 0.01%). When compared to PBS controls, all vaccinated mice in both groups had significantly higher percentages of TNF-a and IFN-y double positive CD8+ T cells after peptide stimulation, indicating that an effective N-specific CD8+ T cell immune response was elicited after vaccination.

[0226] Finally, splenocytes were analyzed for nucleocapsid mRNA by q-RT PCR after euthanasia; all results were negative (Ct above limit of detection).

[0227] 4. Discussion:

[0228] FIP remains one of the highest-burden fatal infectious diseases in cats. Diseases with the potential to cause ADE have been notoriously difficult to develop safe and effective vaccines for due to the risk of vaccination worsening patient outcomes. The only available FIP vaccine for use in the United States is limited by the range of virus it protects from (serotype 2) and the minimum age at which it is labeled to be administered to prevent initial FCoV infection (16 weeks, by which time most cats are already FCoV positive).

[0229] The rapidly increasing field of LNP-encapsulated mRNA vaccine development for widespread use has sparked a host of possibilities to prevent diseases for which previously there have been none. An effective vaccine strategy to protect cats from FIP should not only have the potential to limit spread after an initial FCoV infection, but should also help a persistently infected cat clear the virus prior to the onset of FIP. The strategy described here abrogates concerns of ADE by targeting N, which is internal to the viral envelope, and has the potential to elicit a robust cell-mediated immune response which could help clear either a novel or a previously established FCoV infection to preclude the development of FIP.

[0230] A protective FIP vaccine for cats is a critical need in veterinary medicine. The field of antiviral therapy is rapidly progressing, but little movement in the field of vaccine development has been seen in the past few decades. The results above show an LNP-encapsulated mRNA vaccine against FCoV N induces an immune response in animals.

[0231] References:1. Pedersen, N.C. A Review of Feline Infectious Peritonitis Virus Infection: 1963-2008. J Feline Med Surg 2009, 11 , 225-258.2. MacLachlan, N.; Dubovi, E. Coronaviridae; Academic Press, 2017.3. Jaimes, J.A.; Whittaker, G.R. Feline Coronavirus: Insights into Viral Pathogenesis Based on the Spike Protein Structure and Function. Virology 2018, 517, 108.4. Tuanthap, S.; Chiteafea, N.; Rattanasrisomporn, J.; Choowongkomon, K. Comparative Sequence Analysis of the Accessory and Nucleocapsid Genes of Feline Coronavirus Strains Isolated from Cats Diagnosed with Effusive Feline Infectious Peritonitis. Arch Virol 2021 , 166, 2779-2787.5. Le Poder, S. Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features. Adv Virol 2011 , 2011.6. Carstens, E.B. Ratification Vote on Taxonomic Proposals to the International Committee on Taxonomy of Viruses (2009). Arch Virol 2010, 155, 133-146.7. Underdahl, N.R.; Mebus, C.A.; Torres Medina, A. Recovery of Transmissible Gastroenteritis Virus from Chronically Infected Experimental Pigs. Am J Vet Res 1975, 36, 1473-1476.8. Addie, D.D.; T Schaap, LA.; Nicolson, L.; Jarrett Correspondence D Addie DDAddie, O.D. Persistence and Transmission of Natural Type I Feline Coronavirus Infection. microbiologyresearch.org 2003, 84, 2735-2744.9. Drechsler, Y.; Alcaraz, A.; Bossong, F.J.; Collisson, E.W.; Diniz, P.P.V.P. Feline Coronavirus in Multicat Environments. Veterinary Clinics of North America: Small Animal Practice 2011 , 41 , 1133-1169.10. Berliner, E.A. Feline Coronavirus and Feline Infectious Peritonitis. In Infectious Disease Management in Animal Shelters, Second Edition; Wiley, 2021 ; pp. 367-392 ISBN 9781119294382.11 . Healey, E.A.; Andre, N.M.; Miller, A.D.; Whitaker, G.R.; Berliner, E.A. Outbreak of Feline Infectious Peritonitis (FIP) in Shelter-Housed Cats: Molecular Analysis of the Feline Coronavirus S1 / S2 Cleavage Site Consistent with a ‘Circulating Virulent-Avirulent Theory’ of FIP Pathogenesis.12. Miller, L.; Janeczko, S.; Hurley, K. Infectious Disease Management in Animal Shelters; 2021 ; ISBN 9781119294368.13. Addie, D.D.; Toth, S.; Murray, G.D.; Jarrett, O. Risk of Feline Infectious Peritonitis in Cats Naturally Infected with Feline Coronavirus. Am J Vet Res 1995, 56, 429-434.14. Tizard, LR. Vaccination against Coronaviruses in Domestic Animals. Vaccine 2020, 38, 5123-5130.15. Pedersen, N.C. An Update on Feline Infectious Peritonitis: Virology and Immunopathogenesis. The Veterinary Journal 2014, 201 , 123-132.16. Pedersen, N.C. Serologic Studies of Naturally Occurring Feline Infectious Peritonitis. Am J Vet Res 1976, 37, 1449-1453.17. Decaro, N.; Mari, V.; Lanave, G.; Lorusso, E.; Lucente, M.S.; Desario, C.; Colaianni, M.L.; Elia, G.; Ferringo, F.; Alfano, F.; et al. Mutation Analysis of the Spike Protein in Italian Feline Infectious Peritonitis Virus and Feline Enteric Coronavirus Sequences. Res Vet Sci 2021 , 135, 15-19.18. Borschensky, C.; Science, M.R.-R. in V.; 2014, undefined Mutations in the 3c and 7b Genes of Feline Coronavirus in Spontaneously Affected FIP Cats. Elsevier.19. Pedersen, N.; Liu, H.; Dodd, K.; Viruses, P.P.-; 2009, undefined Significance of Coronavirus Mutants in Feces and Diseased Tissues of Cats Suffering from Feline Infectious Peritonitis, mdpi.com 2009, 1 , 166-184.20. Scott, F.W. Evaluation of Risks and Benefits Associated with Vaccination against Coronavirus Infections in Cats. Adv Vet Med 1999, 41 , 347.21 . Reeves, N.C.; Pollock, R. V.; Thurber, E.T. Long-Term Follow-up Study of Cats Vaccinated with a Temperature-Sensitive Feline Infectious Peritonitis Vaccine. Cornell Vet 1992, 82, 117-123.22. Pedersen, N.C. An Update on Feline Infectious Peritonitis: Virology and Immunopathogenesis. The Veterinary Journal 2014, 201 , 123-132.23. Dewerchin, H.L.; Cornelissen, E.; Nauwynck, H.J. Replication of Feline Coronaviruses in Peripheral Blood Monocytes. Arch Virol 2005, 150, 2483-2500.24. Hohdatsu, T.; Yamato, H.; Ohkawa, T.; Kaneko, M.; Motokawa, K.; Kusuhara, H.; Kaneshima, T.; Arai, S.; Koyama, H. Vaccine Efficacy of a Cell Lysate with Recombinant Baculovirus-Expressed Feline Infectious Peritonitis (FIP) Virus Nucleocapsid Protein against Progression of FIP. Vet Microbiol 2003, 97, 31-44.25. Wasmoen, T.L.; Kadakia, N.P.; Unfer, R.C.; Fickbohm, B.L.; Cook, C.P.; Chu -, H.J.; Acree, W.M. Protection of Cats from Infectious Peritonitis by Vaccination with a Recombinant Raccoon Poxvirus Expressing the Nucleocapsid Gene of Feline Infectious Peritonitis Virus. Adv Exp Med Biol 1995, 380, 221-228.26. Mustaffa-Kamal, F.; Liu, H.; Pedersen, N.C.; Sparger, E.E. Characterization of Antiviral T Cell Responses during Primary and Secondary Challenge of Laboratory Cats with Feline Infectious Peritonitis Virus (FIPV). 2019, 15.27. Kim, S.C.; Sekhon, S.S.; Shin, W.R.; Ahn, G.; Cho, B.K.; Ahn, J.Y.; Kim, Y.H. Modifications of MRNA Vaccine Structural Elements for Improving MRNA Stability and Translation Efficiency. 2022, 18, 1.28. Asrani, K.H.; Farelli, J.D.; Stahley, M.R.; Miller, R.L.; Cheng, C.J.; Subramanian, R.R.; Brown, J.M. Optimization of MRNA Untranslated Regions for Improved Expression of Therapeutic MRNA. https: / / doi.org / 10.1080 / 15476286.2018.1450054 2018, 15, 756-762.29. Eyler, D.E.; Franco, M.K.; Batool, Z.; Wu, M.Z.; Dubuke, M.L.; Dobosz-Bartoszek, M.; Jones, J.D.; Polikanov, Y.S.; Roy, B.; Koutmou, K.S. Pseudouridinylation of MRNA Coding Sequences Alters Translation. Proc Natl Acad Sci U S A 2019, 116, 23068-23074.30. Baiersdbrfer, M.; Boros, G.; Muramatsu, H.; Mahiny, A.; Vlatkovic, I.; Sahin, U.; Kariko, K. A Facile Method for the Removal of DsRNA Contaminant from In Vitro-Transcribed MRNA. Mol Ther Nucleic Acids 2019, 15, 26.31 . Frey, A.; Di Canzio, J.; Zurakowski, D. A Statistically Defined Endpoint Titer Determination Method for Immunoassays. J Immunol Methods 1998, 221 , 35-41.

[0232] EXAMPLE II: Safety and Tolerability of the LNP-encapsulated mRNA vaccine against FCoV of Example I in Cats

[0233] In a placebo-controlled trial, 9 healthy, female cats, from multiple litters, 6-7 months of age at the time of the first dose, were randomly assigned in a 1 :1 :1 ratio (3 cats per group) to receive two doses, 28 days apart, of one of a placebo (PBS), 10 pg per dose of the vaccine candidate, or 25 pg per dose of the vaccine candidate (Table 3). The cats were communally housed.

[0234] Immune responses were assayed by looking at FCoV nucleocapsid protein-specific humoral responses. In all populations, serum samples were collected before vaccination (day 0) and after vaccination (at days 14 and 42) and tested for IgG-Specific Nucleoprotein Antigenantibodies by ELISA. Seven cats had positive antibody titers at study inception, indicating prior FCoV exposure (Results not shown).

[0235] Adverse event parameters examined during the study period included:• Eye discharge (right and left eyes recorded separately);• “Left forelimb edema” (swelling at the vaccine site);• Body temperature;• Body weight gain;• “Cage side observation” (anything overtly wrong with the cats’ behavior or physical condition); and• “left forelimb erythema” (redness at the vaccine site).

[0236] Abnormalities noted:• Eye discharge: 2 animals, both in the 25pg dose group, both eyes, clear discharge (this finding is not abnormal for these cats at this age);• Body temperature: Elevated in 3 cats total, “normal” goes up to 39.2°C: a. Cat 1502 (PBS) of the placebo group had an elevated temperature of 39.3°C the day after intial “vaccine” (Mock group, PBS only) that returned to normal the day after; b. Cat 3501 (25pg, high dose group) had an elevated temperature of 39.5°C then 39.6°C on days 2 and 3 following the 2ndvaccine, respectively; c. Cat 3502 (25pg, high dose group) had an (25pg) had an elevated temperature of 39.3°C the day after the 2ndvaccine which resolved the following day.

[0237] Taken together, these observations provide support for the safety and tolerability of the LNP-encapsulated mRNA vaccine in cats at the tested doses, including cats with prior FCoV exposure or active FCoV infection.

[0238] EXAMPLE III: Immunogenicity of the LNP-encapsulated mRNA vaccine against FCoV in Cats

[0239] As part of a placebo-controlled trial, 9 healthy, female cats, from multiple litters, 6-7 months of age at the time of the first dose, and having no prior exposure to FCoV are randomlyassigned in a 1 :1 :1 ratio (3 cats per group) to receive two doses, 28 days apart, of one of a placebo (PBS), 10 pg per dose of the vaccine candidate, or 30 pg per dose of the vaccine candidate.

[0240] Serum is collected from each cat at time 0, and after vaccination (at days 14 and 42) and assessed for humoral immune responses and assayed for IgG-Specific NucleoproteinAntigen-antibodies by ELISA. The results demonstrate whether the vaccine is capable of eliciting an immune response and likely to provide protection against FCoV in the cat.

[0241] Peripheral mononuclear cells (PMBC) are harvested from each cat at time 0, and after vaccination to assess cell-mediated immune responses including CD4+ and / or CD8+ T- cells against FCoV (e.g., using proliferation assays, cytotoxic-T-lymphocyte assays, tetramer staining, intracellular cytokine staining, and / or cytokine enzyme-linked immunospot (ELISPOT) assay). The results may further demonstrate the vaccine-mediated protection is multifactorial, and includes both a humoral and a cell-mediated immune response.

[0242] Further studies will assess the duration of protection induced against FCoV.

Claims

WHAT IS CLAIMED IS:

1. An in vitro-transcribed (IVT) RNA molecule comprising a polynucleotide encoding a Feline Coronavirus (FCoV) nucleocapsid (N) protein antigen.

2. The IVT RNA molecule of claim 1 , wherein the polynucleotide encoding the FCoV N protein antigen has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 4, or an immunogenic fragment thereof.

3. The IVT RNA molecule of claim 1 or 2, wherein the polynucleotide encoding the FCoV N protein antigen comprises a codon-optimized sequence.

4. The IVT RNA molecule of any one of claims 1 to 3, wherein the polynucleotide encoding the FCoV N protein antigen comprises an increased G / C content as compared to a wild type FCoV nucleocapsid nucleotide sequence or immunogenic fragment thereof, optionally wherein the nucleotide sequence encoding the FCoV N protein antigen has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 2.

5. The IVT RNA molecule of any one of claims 1 to 4, wherein the polynucleotide encoding the FCoV N protein antigen comprises a 5' end and a 3' end and the IVT RNA molecule further comprises a 5'-cap, 5'-untranslated region (UTR), 3'-UTR, and poly(A) sequence.

6. The IVT RNA molecule of claim 5, wherein the 5'-cap comprises a chemical structure selected from the group consisting of m7GpppG, m7G(5')ppp(5')G, m7GpppA, m7GpppC, GpppG, m2,7GpppG, m7G(5’)ppp(5’)(2’OmeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3’OmeG)(5’)ppp(5’)(2’OmeA)pG, m2,2,7GpppG, and m7Gpppm7G, and is located at the 5'- end of the polynucleotide.

7. The IVT RNA molecule of claim 5 or 6, wherein the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, optionally further comprising a Kozak consensus sequence.

8. The IVT RNA molecule of any one of claims 5 to 7, wherein the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA and a 12S ribosomal RNA and wherein the 3'-UTR is positioned at the 3'-end of the polynucleotide.

9. The IVT RNA molecule of any one of claims 5 to 8, wherein the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3'-UTR.

10. The IVT RNA molecule of claim 9, wherein the two stretches include a first stretch of 30 adenosine nucleotides and a second stretch of 70 adenosine nucleotides.11 . The IVT RNA molecule of any one of claims 5 to 10, wherein the polynucleotide encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

12. The IVT RNA molecule of claim 11 , wherein at least one modified nucleoside is an N1- methyl-pseudouridine (m1qj).

13. The IVT RNA molecule of claim 1 , comprising:(i) a polynucleotide encoding the FCoV N protein antigen comprising a 5' end and a 3' end;(ii) the polynucleotide comprises a nucleotide sequence encoding the FCoV N protein antigen having at least 85% identity to SEQ ID NO: 4, or an immunogenic fragment thereof;(iii) a 5'-cap;(iv) a 5'-untranslated region (UTR) positioned between the 5'-end of the nucleotide sequence and the 5'-cap;(v) a 3-UTR, and(vi) a poly(A) sequence.

14. The IVT RNA molecule of claim 13, wherein the 5'-cap comprises a m7G(5')ppp(5')(2'OMeA)pG 5’ cap, the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, and the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA.

15. The IVT RNA molecule of claim 14, wherein the nucleotide sequence encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

16. The IVT RNA molecule of claim 15, wherein the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3'-UTR.

17. A lipid nanoparticle (LNP) formulation comprising loaded LNPs comprising the IVT RNA molecule according to any one of claims 1 to 16.

18. The LNP formulation of claim 17, wherein the loaded LNPs comprise a ratio of lipid to mRNA (N / P) of about 3 to about 7.

19. The LNP formulation of claim 17 or 18, wherein the loaded LNPs have a mean diameter of at least 50 nm.

20. The LNP formulation of any one of claims 17 to 19, wherein the loaded LNPs have a polydispersity index within a range of from about 0.05 to about 0.2.21 . The LNP formulation of any one of claims 17 to 20, wherein the loaded LNPs have a Z- average particle size within a range of from about 80 nm to about 125 nm.

22. The LNP formulation of any one of claims 17 to 21 , wherein the loaded LNPs comprise an ionizable cationic lipid, non-cationic lipid, a structural lipid, sterol and / or a PEGylated lipid.

23. The LNP formulation of claim 22, wherein the loaded LNPs comprise 20-60 mol % ionizable cationic lipid, optionally wherein the ionizable cationic lipid is selected from the group consisting of DLin-DMA, (6Z,9Z,28Z,31Z)-heptatriacont-6,9,28,31-tetraene-19-yl 4- (dimethylamino)butanoate (DLin-MC3-DMA), 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-l-yl)- 1 ,3- dioxolan-4-yl)-N,N-dimethylethan-l-amine (DLin-KC2-DMA), l,2-dioleyloxy-3- dimethylaminopropan (DODMA), Bis[2-(4-{2-[4-(cis-9- octadecenoyloxy)phenylacetoxy]ethyl}piperidinyl)ethyl] disulfide (SS-OP), methylpyridiyl-dialkyl acid (MPDACA), palmitoyl-oleoyl-nor- arginine (PONA), guanidino-dialkyl acid (GUADACA), 1 ,2-di-O- octadecenyl- 3 -trimethylammonium propane (DOTMA), 1 ,2-dioleoyl-3- trimethylammonium- propane (DOTAP), Bis{2-[N-methyl-N-(a-D- tocopherolhemisuccinatepropyl)amino]ethyl} disulfide (SS-33 / 3APO5), Bis {2-[4-(a-D- tocopherolhemisuccinateethyl)piperidyl] ethyl} disulfide (SS33 / 4PE15), Bis{2-[4-(cis-9- octadecenoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE16), Bis{2-[4-(cis,cis-9,12- octadecadienoateethyl)-l-piperidinyl]ethyl} disulfide (SS18 / 4PE13), [3-(dimethylamino)-2-[(Z)- octadec-9-enoyl]oxypropyl] (Z)-octadec-9-enoate (DODAP), Di-octadecyl-amido-glycyl- spermine (DOGS), {2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1- propanaminium trifluoroacetate} (DOSPA), 3P[N-(N',N'-dimethylaminoethane)-carbamoyl] cholesterol (DC-Chol), N4-Cholesteryl-Spermine (GL-67), bis(guanidinium)-tris(2- aminoethyl)amine-cholesterol (BGTC), Dimethyldioctadecylammonium (DDAB), 2,3-bis[(Z)- octadec-9-enoxy]propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DORIE), 2,3- di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium;bromide (DMRIE), N-(3-aminopro-pyl)- N,N-dimethyl-2,3-bis(dodecyloxy)-l-propanammonium bromide (GAP-DLRIE), N-t-butyl-N'- tetradecyl-3-tetradecylaminopropionamidine (diC14-amidine), di((Z)-non-2-en-l-yl) 9-((4- (dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 1 ,1'-((2-(4-(2-((2-(Bis(2- hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1- yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), OF-02, N1 ,N3,N5-tris(2- aminoethyl)benzene- 1 ,3,5-tricarboxamide (TT3), and 3-[2-[3-[2-[bis[2-[bis(2-hydroxydecyl)amino]ethyl]amino]ethyl-(2- hydroxydecyl)amino]propanoylamino]ethyl-dimethylazaniumyl]propane-1 -sulfonate (ZA3-Ep10).

24. The LNP formulation of claim 22 or 23, wherein loaded LNPs comprise 5-25 mol % structural lipid or non-cationic lipid, optionally wherein the structural lipid or non-cationic lipid is selected from the group consisting of 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1 ,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1 ,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), 1 ,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1 ,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), 1 ,2-di-0-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl- sn-glycero-3-phosphocholine (C16 Lyso PC), 1 ,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1 ,2- diarachidonoyl-sn-glycero-3-phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3- phosphocholine, 1 ,2-diphytanoyl-sn-glycero phosphoethanolamine (ME 16.0 PE), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1 ,2-dilinolenoyl-sn-glycerophosphoethanolamine, 1 ,2-diarachidonoyl-sn- glycero-3-phosphoethanolamine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dioleoyl-sn-glycero-3-phospho-rac-(1 -glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

25. The LNP formulation of any one of claims 22-24, wherein the loaded LNPs comprise 25- 55 mol % sterol, optionally wherein the sterol is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

26. The LNP formulation of any one of claims 22-25, wherein the loaded LNPs comprise 0.5- 15 mol % PEG-modified lipid, optionally wherein the PEG-modified lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG- modified dialkylglycerol, and mixtures thereof.

27. The LNP formulation of any one of claims 22-27, wherein the loaded LNPs comprise a mixture of at least one ionizable cationic lipid, at least one structural lipid, at least one sterol, and at least one polyethylene glycol (PEG)-modified lipid in a ratio of 5-25 mol % structural lipid:25-55 mol % sterol:20-60 mol % ionizable cationic lipid:0.5-15 mol % PEG-modified lipid.

28. The LNP formulation of claim 27, wherein the mixture of non-cationic lipid, sterol, at least one ionizable cationic lipid, and at least one PEG modified lipid a ratio of about 1-20 mol %:25- 45 mol %:30-60 mol %: 1 -10 mol %, about 5-15 mol %:30-40 mol %:40-55 mol %:1-5 mol %, or about 8-12 mol %:35-39 mol %:48-52 mol %:2-4 mol %.

29. A Feline Infectious Peritonitis (FIP) vaccine composition comprising:(a) the IVT RNA molecule according to any one of claims 1-16; or(b) the LNP formulation of any one of claims 17-28.

30. A method for eliciting an immune response in an individual in need thereof comprising administering an amount of the FIP vaccine composition of claim 29 effective for eliciting an immune response to the individual.31 . The method of claim 30, wherein the amount of the FIP vaccine composition is a dose within the range of about 0.5-100 pg.

32. The method of claim 31 , wherein the dose is within the range of about 15-20 pg, about 20-25 pg, about 25-30 pg, about 30-35 pg, about 35-40 pg, about 40-45 pg, or about 45-50 pg.

33. The method of claim 32, wherein the amount of the FIP vaccine provides about 10 ng to about 10 mg FCoV N protein antigen to the individual.

34. The method of any one of claims 30-33, wherein the individual has been exposed to FCoV.

35. The method of claim 34, wherein the individual exhibits signs of an FCoV infection.

36. The method of any one of claims 30-33, wherein the individual has no prior FCoV exposure.

37. The method of any one of claims 30-36, wherein the individual is about 6 months of age or older.

38. The method of any one of claims 30-37, wherein the method further comprises administering a first dose and a second dose of the FIP vaccine composition.

39. The method of claim 38, wherein the second dose is administered about 3-5 weeks after administration of the first dose.

40. The method of claim 39, wherein the FIP vaccine composition comprises loaded lipid nanoparticles (LNPs) comprising an IVT RNA molecule, wherein the IVT RNA molecule comprises:(i) a polynucleotide encoding the FCoV N protein antigen comprising a 5' end and a 3' end;(ii) the polynucleotide comprises a nucleotide sequence encoding the FCoV N protein antigen having at least 80% identity to SEQ ID NO: 4, or an immunogenic fragment thereofand / or the polynucleotide encoding the FCoV N protein antigen comprises an increased G / C content as compared to a wild type FCoV nucleocapsid nucleotide sequence or immunogenic fragment thereof;(iii) a 5'-cap;(iv) a 5'-untranslated region (UTR) positioned between the 5'-end of the nucleotide sequence and the 5'-cap;(v) a 3-UTR, and(vi) a poly(A) sequence.41 . The method of claim 40, wherein the loaded LNPs comprise a mixture of at least one ionizable cationic lipid, at least one structural lipid, at least one sterol, and at least one polyethylene glycol (PEG)-modified lipid in a ratio of 5-25 mol % structural lipid:25-55 mol % sterol:20-60 mol % ionizable cationic lipid:0.5-15 mol % PEG-modified lipid.

42. The method of claim 40 or 41 , wherein the 5'-cap comprises a m7G(5')ppp(5')(2'OMeA)pG 5’ cap, the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, and the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA.

43. The method of any one of claims 40-42, wherein the nucleotide sequence encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

44. The method of any one of claims 40-43, wherein the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3 -UTR.

45. The method of any one of claims 40-44, wherein the amount of the FIP vaccine sufficient to elicit an immune response is safe and tolerable.

46. The IVT RNA molecule of claim 1 , wherein the polynucleotide encoding the FCoV N protein antigen comprises an increased G / C content as compared to a wild type FCoV nucleocapsid nucleotide sequence or immunogenic fragment thereof, optionally wherein thenucleotide sequence encoding the FCoV N protein antigen has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 2.

47. The IVT RNA molecule of claim 1 , wherein the polynucleotide encoding the FCoV N protein antigen comprises a 5' end and a 3' end and the IVT RNA molecule further comprises a 5'-cap, 5'-untranslated region (UTR), 3'-UTR, and poly(A) sequence.

48. The IVT RNA molecule of claim 47, wherein the 5'-cap comprises a chemical structure selected from the group consisting of m7GpppG, m7G(5')ppp(5')G, m7GpppA, m7GpppC, GpppG, m2,7GpppG, m7G(5’)ppp(5’)(2’OmeA)pG, m7G(5')ppp(5')(2'OMeG)pG, m7(3’OmeG)(5’)ppp(5’)(2’OmeA)pG, m2,2,7GpppG, and m7Gpppm7G, and is located at the 5'- end of the polynucleotide.

49. The IVT RNA molecule of claim 47, wherein the 5'-UTR comprises a nucleotide sequence of a feline alpha-globin mRNA UTR between the 5'-end of the nucleotide sequence and the 5'-cap, optionally further comprising a Kozak consensus sequence.

50. The IVT RNA molecule of claim 47, wherein the 3'-UTR comprises a nucleotide sequence of a feline amino terminal enhancer of split (AES) mRNA and a 12S ribosomal RNA and wherein the 3'-UTR is positioned at the 3'-end of the polynucleotide.51 . The IVT RNA molecule of claim 47, wherein the poly(A) sequence comprises two stretches of adenosine nucleotides joined by a nucleotide linker sequence positioned at the 3' end of the 3 -UTR.

52. The IVT RNA molecule of claim 51 , wherein the two stretches include a first stretch of 30 adenosine nucleotides and a second stretch of 70 adenosine nucleotides.

53. The IVT RNA molecule of claim 47, wherein the polynucleotide encoding the FCoV N protein antigen comprises a modified nucleoside in place of at least one uridine.

54. The IVT RNA molecule of claim 53, wherein at least one modified nucleoside is an N1- methyl-pseudouridine (m1qj).

Citation Information

Patent Citations

  • Feline infectious peritonitis vaccine

    US20120107390A1

  • RNA combinations and compositions with decreased immunostimulatory properties

    WO2021028439A1

  • Coronavirus vaccine

    WO2023066496A1

  • Nucleic acid-based universal vaccine and methods of use thereof

    WO2024064965A2

  • Method for constructing mRNA and vaccine targeting m and n antigens of feline fipv

    WO2024234756A1