Combinations, inhibitors, viral vectors, methods, and uses for in VIVO gene therapy and gene editing
An immuno-therapeutic regimen using IFNaR1 and co-stimulation blockade inhibitors addresses immune challenges in gene therapy, ensuring stable transgene expression and enabling redosing of viral vectors for effective genetic disease treatment.
Patent Information
- Application Number
- PCT/EP2025/060655
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-19
- Filing Date
- 2025-04-17
- Publication Date
- 2025-10-23
AI Technical Summary
Existing gene therapy and gene editing methods face challenges due to immune responses against transgene products and viral vector particles, limiting therapeutic outcomes and preventing redosing.
An immuno-therapeutic regimen involving inhibitors of interferon alpha and beta receptor subunit 1 (IFNaR1) signaling, CD154/CD40-CD40L signaling, and/or CD80/CD86-CD28 signaling is administered to modulate the immune response, allowing stable transgene expression and enabling viral vector redosing.
The regimen reduces immune responses, enabling durable transgene expression and allows for successful therapeutic gene addition, including the possibility of redosing viral vectors, thereby treating genetic diseases effectively.
Smart Images

Figure 00000047_0000 
Figure 00000047_0001 
Figure 00000047_0002
Abstract
Description
[0001] COMBINATIONS, INHIBITORS, VIRAL VECTORS, METHODS, AND USES FOR IN VIVO GENE THERAPY AND GENE EDITING
[0002] BACKGROUND OF THE INVENTION
[0003] Gene therapy and gene editing is attractive for its potential applicability to permanently correct genetic diseases. Lentiviral vector (LV)-based in vivo gene therapy (GT) is one of the most promising approaches to date. However, other viral vector systems may in certain situations also be viable, e.g., vectors based on adeno-associated viruses (AAV) or adenovirus (AdV) vectors, or virus-like particle (VLP)-based vectors.
[0004] Although transgene expression has been achieved in mice, dogs, and non-human primates, immunity towards the transgene product and the vector particles may limit the therapeutic outcome and prevent LV redosing.
[0005] Multiple factors might contribute to transgene immunogenicity, such as the protein structure, the proportion of genetically modified target cells, and the translation rate. Immune-modulatory regimens could abrogate possible immune responses, which are more likely to occur when secreted transgene products (such as clotting factors or lysosomal enzymes) are expressed by cells targeted by the viral vector.
[0006] There is a need in the art for combinations, inhibitors, and methods to reduce or abrogate adaptive immune responses to the vector particles, vector-encoded transgene product, and in vivo engineered cells.
[0007] DESCRIPTION OF THE INVENTION
[0008] The present invention provides combinations, signaling inhibitors, and methods, for an immuno-therapeutic regimen capable of overcoming immune-mediated hurdles that allows achieving stable and therapeutically relevant transgene expression levels by viral vector in vivo gene therapy or gene editing. Moreover, the immune-modulatory regimen of the present invention allows for viral vector redosing by preventing the formation of antibodies against viral proteins, e.g., envelope proteins, upon viral vector administration. The present invention provides, inter alia, the following embodiments / items.
[0009] 1. A combination, comprising:
[0010] I) a first component A, comprising an inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling,
[0011] II) a second component C, comprising: an inhibitor of CD154 / CD40-CD40L signaling; and / or an inhibitor of CD80 / CD86-CD28 signaling.
[0012] 2. The combination of item 1, wherein component C comprises an inhibitor of CD154 / CD40-CD40L signaling.
[0013] 3. The combination of any one of items 1-2, wherein component C comprises an inhibitor of CD80 / CD86-CD28 signaling.
[0014] 4. The combination of any one of items 1-3, wherein component C comprises an inhibitor of CD154 / CD40-CD40L signaling and an inhibitor of CD80 / CD86-CD28 signaling.
[0015] 5. The combination of any one of items 1-4, further comprising, as component B, a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein.
[0016] 6. The combination as defined in any one of items 1-5 for use in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as component C, the combination to the subject. wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder.
[0017] 7. An inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling for use in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, wherein the method comprises: step a) administering, as component A, the IFNaRl signaling inhibitor to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as component C, an inhibitor of CD154 / CD40-CD40L signaling to the subject, and / or an inhibitor of CD80 / CD86-CD28 signaling to the subject, wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. An inhibitor of CD154 / CD40-CD40L signaling for use in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as a component C, the inhibitor of CD154 / CD40-CD40L signaling to the subject, wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. An inhibitor of CD80 / 86-CD28 signaling for use in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as component C, the inhibitor of CD80 / CD86-CD28 signaling to the subject wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. The inhibitor for use of item 8, wherein component C comprises an inhibitor of CD80 / CD86-CD28 signaling. The inhibitor for use of item 9, wherein component C comprises an inhibitor of CD154 / CD40-CD40L signaling. The inhibitor for use of items 10 or 11, wherein component C comprises an inhibitor of CD80 / CD86-CD28 signaling and an inhibitor of CD154 / CD40-CD40L signaling. A therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein for use in a method of treating, preventing, or alleviating symptoms of, a disease or disorder in a subject by administering the therapeutic viral vector to the subject, thereby treating the subject, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as component C, an inhibitor of CD154 / CD40-CD40L signaling to the subject, and / or an inhibitor of CD80 / CD86-CD28 signaling to the subject, wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. The viral vector of item 13, wherein component C comprises an inhibitor of CD154 / CD40-CD40L signaling. The viral vector of item 13, wherein component C comprises an inhibitor of CD80 / CD86-CD28 signaling. The viral vector of items 14 or 15, wherein component C comprises an inhibitor of CD80 / CD86-CD28 signaling and an inhibitor of CD154 / CD40-CD40L signaling. A method of treating a subject by gene therapy using a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, wherein the method comprises: step a) administering component A: an inhibitor of IFNaRl signaling to the subject, step b) administering, as component B, the therapeutic viral vector to the subject, step c) administering, as component C, an inhibitor of CD154 / CD40-CD40L signaling to the subject, and / or an inhibitor of CD80 / CD86-CD28 signaling to the subject wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. The method of item 17, wherein component C comprises both an inhibitor of CD154 / CD40-CD40L signaling and an inhibitor of CD80 / CD86-CD28 signaling. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling is capable of specifically binding to IFNaRl and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the IFNaRl signaling inhibitor is an antibody or fragment thereof that is capable of specifically binding to IFNaRl and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the IFNaRl signaling inhibitor is anifrolumab or a fragment thereof. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the IFNaRl signaling inhibitor is a small molecule. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40- CD40L signaling is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40L signaling is an antibody or fragment thereof that is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40- CD40L signaling is ruplizumab or a fragment thereof or. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40- CD40L signaling is a small molecule. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / 86-CD28 signaling is capable of specifically binding to CD28 and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / 86-CD28 signaling is an antibody or fragment thereof that is capable of specifically binding CD28 and preventing ligand / receptor binding. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is a CD28 antagonist. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 or a fragment thereof and an Immunoglobulin or fragment thereof. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 and a Fc domain of an Immunoglobulin. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is CTLA4-lg. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is a small molecule. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40- CD40L signaling and the inhibitor of CD80 / CD86-CD28 signaling are formulated together. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the viral vector is selected from the group consisting of:
[0018] I) a retroviral vector;
[0019] II) an adeno-associated virus (AAV) vector;
[0020] III) an adenovirus (AdV) vector; and
[0021] IV) a VLP-based vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of item 35, wherein the therapeutic viral vector is a retroviral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of item 36, wherein the retroviral vector is a lentiviral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of item 35, wherein the therapeutic viral vector is an adenoviral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of item 35, wherein the therapeutic viral vector is an adeno- associated viral vector. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling is administered prior to administration of the CD154 / CD40L-CD40 signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling is administered prior to administration of the CD80 / CD86-CD28 signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling is administered prior to administration of the CD80 / CD86-CD28 signaling inhibitor and prior to the administration of the CD154 / CD40L-CD40 signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the IFNaRl signaling inhibitor is administered prior to administration of the therapeutic viral vector. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40-CD40L signaling is administered after administration of the IFNaRl signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is administered after administration of the IFNaRl signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling and the inhibitor of CD154 / CD40-CD40L signaling are administered after administration of the IFNaRl signaling inhibitor.
[0022] M . The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD154 / CD40-CD40L signaling is administered after administration of the viral vector.
[0023] 48. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling is administered after administration of the viral vector.
[0024] 49. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling and the inhibitor of CD154 / CD40-CD40L signaling are administered after administration of the viral vector.
[0025] 50. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the subject is administered, at different time points, in the following temporal order:
[0026] 1) an inhibitor of IFNaRl signaling;
[0027] 2) a therapeutic viral vector;
[0028] 3) an inhibitor of CD154 / CD40-CD40L signaling and / or an inhibitor of CD80 / CD86-CD28 signaling.
[0029] 51. The combination for use, inhibitor for use, viral vector for use, or method of any one of item 50, wherein the inhibitor of IFNaRl signaling inhibitor, the therapeutic viral vector, the inhibitor of CD154 / CD40-CD40L signaling, and the inhibitor CD80 / CD86- CD28 signaling are as defined in any one of items 1-49.
[0030] 52. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling inhibitor is administered once, the therapeutic viral vector is administered once, and the inhibitor of CD154 / CD40-CD40L signaling and / or the inhibitor CD80 / CD86-CD28 signaling are administered more than once at different time points.
[0031] 53. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of IFNaRl signaling inhibitor is administered once, the therapeutic viral vector is administered once, and the inhibitor of CD154 / CD40-CD40L signaling and / or the inhibitor CD80 / CD86-CD28 signaling are administered two times, three times, four times, five times, or more than five times at different time points. The combination for use, inhibitor for use, viral vector for use, or method of item 53, wherein the inhibitor of IFNaRl signaling inhibitor is administered once, the therapeutic viral vector is administered once, and the inhibitor of CD154 / CD40-CD40L signaling and / or the inhibitor CD80 / CD86-CD28 signaling are administered five times at different time points. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein administration of the inhibitor IFNaRl signaling inhibitor and the administration of the CD80 / CD86-CD28 signaling inhibitor are at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours apart from each other. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein administration of the inhibitor IFNaRl signaling inhibitor is carried out at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours prior to administration of the CD80 / CD86-CD28 signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein administration of the inhibitor IFNaRl signaling inhibitor is carried out at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours prior to administration of the CD154 / CD40-CD40L signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein administration of the inhibitor IFNaRl signaling inhibitor is carried out at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours prior to administration of the CD154 / CD40-CD40L signaling inhibitor and at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours prior to administration of the CD80 / CD86-CD28 signaling inhibitor. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein administration of the inhibitor IFNaRl signaling and administration of the CD154 / CD40-CD40L signaling inhibitor are at least 1 hour, 2 hours, 3, hours, 4 hours, or 5 hours apart from each other. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor IFNaRl signaling is administered once. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40-CD40L signaling are administered multiple times, wherein each administration is at different time points. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40-CD40L signaling are administered two times, three times, four times, five times, or more than five times, wherein each administration is at different time points. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40-CD40L signaling are administered two times, three times, four times, five times, or more than five times, wherein each administration is at different time points. The combination for use, inhibitor for use, viral vector for use, or method of item 63, wherein the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40-CD40L signaling are administered five times, wherein each administration is at different time points. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the subject is administered the therapeutic viral vector a second time, wherein the second administration of the viral vector is after administration of the CD154 / CD40-CD40L signaling inhibitor and / or after administration of the CD80-CD86 / CD28 signaling inhibitor, optionally wherein the second administration comprises administering a VLP. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the subject is administered the therapeutic viral vector a second time, wherein the second administration of the viral vector is after multiple administrations of the CD154 / CD40-CD40L signaling inhibitor and / or after multiple administration of the CD80-CD86 / CD28 signaling inhibitor, optionally wherein the second administration comprises administering a VLP. The combination for use, inhibitor for use, viral vector for use, or method of item 66, wherein the multiple administrations are two, three, four, five, or more than five administrations. The combination for use, inhibitor for use, viral vector for use, or method of item 67, wherein the multiple administrations are five administrations. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the method or use comprises redosing of the viral vector. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the payload comprised by the therapeutic viral vector encodes as target protein human factor VIII (hFVIll) or human Alpha-L- Iduronidase (hIDUA). The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the payload comprised by the therapeutic viral vector encodes as target protein human factor VIII (hFVIll) and the disease or disorder to be treated is hemophilia A. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the payload comprised by the therapeutic viral vector encodes as target protein human Alpha-L-lduronidase (hIDUA) and the disease or disorder to be treated is mucopolysaccharidosis type 1. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the payload is delivered to a target tissue and the encoded target protein is expressed in the target tissue. The combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the target tissue of the viral vector is liver tissue. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the target tissue of the viral vector comprises hepatocytes. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the payload comprises one or more microRNA binding sites. The combination, combination for use, inhibitor for use, viral vector for use, or method of item 76, wherein the one or more microRNA binding sites comprise a binding site for microRNA-142. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 76-77, wherein the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in off-target tissue. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 76-78, wherein the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in hematopoietic cells and / or in immune cells. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 76-79, wherein the one or more microRNA binding sites are binding sites for microRNAs that are expressed in off-target tissue. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 76-80, wherein the one or more microRNA binding sites are binding sites for microRNAs that are not expressed in the target tissue. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response to the target protein encoded by the transgene comprised by the payload of the therapeutic viral vector is reduced when compared to the immune response to the same target protein encoded by the same transgene comprised by the same payload of the same therapeutic viral vector without administration of the one or more signaling inhibitors. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response to a viral protein comprised by the viral particle is reduced when compared to the immune response to the same viral protein without administration of one or more of the signaling inhibitors. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response to the subject's cells that comprise the viral vector and / or express the target protein encoded by the transgene comprised by the payload comprised by the viral vector is reduced when compared to the immune response to cells comprising the same viral protein and / or expressing the same target protein encoded by the same transgene comprised by the same viral vector without administration of the one or more signaling inhibitors. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 82-84, wherein the immune response is reduced by at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%. The combination, combination for use, inhibitor for use, viral vector for use, or method of item 85, wherein the immune response to the target protein encoded by the transgene comprised by the payload of the therapeutic viral vector and / or the immune response to the viral protein comprised by the viral particle is measured by ELISA. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of items 85-86, wherein the immune response to the subject's cells is measured by ELISPOT on CD8+ T cells. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response is an immune response to the target protein encoded by the transgene comprised by the payload comprised by the viral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response is an immune response to a viral protein comprised by the viral vector particle. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response is an immune response to the target protein encoded by the transgene comprised by the payload comprised by the viral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response is an immune response to the subject's cells that comprise the viral vector and / or express the target protein encoded by the transgene comprised by the payload comprised by the viral vector. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the immune response is:
[0032] I) an immune response to a viral protein comprised by the viral vector particle; and / or
[0033] II) an immune response to the target protein encoded by the transgene comprised by the payload comprised by the viral vector; and / or
[0034] III) an immune response to the subject's cells that comprise the viral vector and / or express the target protein encoded by the transgene comprised by the payload comprised by the viral vector. The combination of any one of items 1-5 for use in an immunotherapeutic method to prevent or reduce an immune response caused by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein. The combination for use of item 93, wherein the method, the immune response, the gene therapy, and / or the therapeutic viral vector are as defined in any one of items 1-92. The combination, combination for use, inhibitor for use, viral vector for use, or method of any one of the preceding items, wherein the transgene encoding the target protein is comprised by a VLP that is delivered to the subject. An inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling for use in a method of treating a subject by gene editing, wherein the method comprises: step a) administering, as component A, the IFNaRl signaling inhibitor to the subject, step b) administering, as component B, an effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing and / or a VLP or lipid nanoparticle (LNP) comprising the effector vector or mRNA, and a donor vector comprising a transgene encoding a target protein to the subject, step c) administering, as component C, an inhibitor of CD154 / CD40-CD40L signaling to the subject, and / or an inhibitor of CD80 / CD86-CD28 signaling to the subject, wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. An inhibitor of CD154 / CD40-CD40L signaling for use in a method of treating a subject by gene editing, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, an effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing and / or a VLP or LNP comprising the effector vector or mRNA, and a donor vector comprising a transgene encoding a target protein to the subject, step c) administering, as a component C, the inhibitor of CD154 / CD40-CD40L signaling to the subject, wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder. 98. An inhibitor of CD80 / 86-CD28 signaling for use in a method of treating a subject by gene editing, wherein the method comprises: step a) administering, as component A, an IFNaRl signaling inhibitor to the subject, step b) administering, as component B, an effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing and / or a VLP or LNP comprising the effector vector or mRNA, and a donor vector comprising a transgene encoding a target protein to the subject, step c) administering, as component C, the inhibitor of CD80 / CD86-CD28 signaling to the subject wherein expression of the target protein in the subject treats, prevents, or alleviates symptoms of the disease or disorder.
[0035] 99. The inhibitor or inhibitor for use of any one of items 96-98, wherein one or more effector protein(s) comprise a CRISPR / Cas protein.
[0036] 100. The inhibitor or inhibitor for use of item 99, wherein the CRISPR / Cas protein is a Cas9 protein, a Casl3 protein, a Casl2 protein, or a Casl2a protein.
[0037] 101. The inhibitor or inhibitor for use of any one of items 96-100, wherein the inhibitors are as defined in any one of the preceding items, the administration of each component is as defined in any one of the preceding items, the target protein is as defined in any one of the preceding items, and / or the disease or disorder is as defined in any one of the preceding items.
[0038] BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1. Immuno-therapeutic regimen allows to achieve stable therapeutic levels of hFVIll in hemophilia A mice after in vivo gene therapy (GT). (A) The immuno-therapeutic regimen comprised a single intravenous (i.v.) administration of interferon-a receptor 1 (IFNaR)- blocking monoclonal antibody (mAb) (1 mg / mouse) 3 hours before the injection of the LV encoding for hFVIll, followed by 5 intra-peritoneal (i.p.) injections of anti-CD154 Ab (0.5mg / mouse) and CTLA-4.lg (Abatacept, 0.5mg / mouse) (co-stimulation blockade, CoB). (B, C) Mean and standard error of the mean (SEM) of the plasmatic hFVIll concentration (B) or activity (C) at the indicated time points. (D-F) Anti-FVIll immune responses were evaluated by measuring plasmatic concentration of a nti-h FVI 11 IgG (D), and by enumerating interferon-y (IFNg)-releasing circulating T cells (E) and splenic CD8 T cells (F) in response to FVIII stimulation at the end of follow-up. (G) Vector copies per diploid genome (vector copy number, VCN) were quantified on liver biopsies.
[0040] Figure 2. Immuno-therapeutic regimen allows to achieve stable therapeutic levels of hFVIll after in vivo GT and hFVIll-specific immune tolerance in hemophilia A mice. (A) The immuno-therapeutic regimen comprised a single intravenous (i.v.) administration of interferon-a receptor 1 (IFNaR)-blocking monoclonal antibody (mAb) (1 mg / mouse) 3 hours before the injection of the LV encoding for hFVIll, followed by 5 intra-peritoneal (i.p.) injections of anti-CD154 Ab (0.5mg / mouse) and CTLA-4.lg (Abatacept, 0.5mg / mouse) (costimulation blockade, CoB). Twelve weeks post GT, 10 units of hFVIll protein were i.v. administered four times weekly to anti-IFNaR / CoB / LV.hFVIll-treated and naive control mice to verify the induction of FVI Il-specific active mechanism of immune tolerance. (B, C) Mean and standard error of the mean (SEM) of the plasmatic hFVIll concentration (B) or activity (C) at the indicated time points. (D-F) Anti-FVIll immune responses were evaluated by measuring plasmatic concentration of anti-hFVIll IgG (D), and by enumerating interferon-y (IFNg)-releasing circulating T cells (E) and splenic CD8 T cells (F) in response to FVIII stimulation. (G) Vector copies per diploid genome (vector copy number, VCN) were quantified on liver biopsies at the end of follow-up at 12 weeks.
[0041] Figure 3. IFNaR / CoB regimen allows stable therapeutic levels of hIDUA in MPS-I mice after in vivo GT. (A) The immuno-therapeutic regimen (IFNaR / CoB) comprised a single i.v. administration of IFNaR-blocking mAb (lmg / mouse) 3 hours before the injection of the LV encoding for hIDUA, followed by 5 i.p. injections of anti-CD154 Ab (0.5 mg / mouse) and CTLA- 4.1g (Abatacept, 0.5mg / mouse). (B, C) Single values with mean and SEM of hIDUA transgene expression (B) or activity (C) measured in the liver parenchyma at the indicated time points. (D-F) Anti-hlDUA immune responses were evaluated by measuring plasmatic concentration of anti-hlDUA IgG (D), and by enumerating IFNg-releasing circulating T cells (E) and splenic CD8 T cells (F) in response to IDUA stimulation at the end of follow-up. (G) VCN were quantified on liver biopsies.
[0042] Figure 4. IFNaR / CoB regimen prevents anti-VSV.G specific humoral response after LV in vivo GT allowing a second vector infusion. (A) The immuno-therapeutic regimen (IFNaR / CoB) comprised a single i.v. administration of IFNaR-blocking mAb (1 mg / mouse) 3 hours before the injection of the LV encoding for GFP, followed by 5 i.p. injections of anti- CD154 Ab (0.5 mg / mouse) and CTLA-4.lg (Abatacept, 0.5 mg / mouse). LV encoding for human factor IX (hFIX) was administered 10 weeks after the first LV dose. (B, C) The presence of anti-VSV.G IgG was evaluated 8 weeks after the first LV injection (B), while plasmatic concentration of hFIX was measured to test mouse permissiveness to a second systemic LV administration (C).
[0043] Figure 5. IFNaR / CoB regimen prevents anti-capsid specific humoral response after AAV in vivo GT allowing a second vector infusion. (A) The immuno-therapeutic regimen (IFNaR / CoB) comprised a single i.v. administration of IFNaR-blocking mAb (1 mg / mouse) 3 hours before the injection of the AAV8 encoding for GFP, followed by 5 i.p. injections of anti- CD154 Ab (0.5 mg / mouse) and CTLA-4.lg (Abatacept, 0.5 mg / mouse). AAV8 encoding for hFIX was administered 10 weeks after the first AAV8 dose. (B, C) The presence of anti-capsid IgG was evaluated 8 weeks after the first AAV injection (B), while plasmatic concentration of hFIX was measured to test mouse permissiveness to a second systemic AAV8 administration (C).
[0044] DETAILED DESCRIPTION OF THE INVENTION
[0045] The inventors have observed that administration of a therapeutic viral vector comprising a payload comprising a transgene encoding a target protein to a subject results in the induction of a strong humoral and cellular immune response to the target protein expressed from the transgene, quickly leading to clearance of gene therapy corrected cells and preventing detection of the circulating transgene product.
[0046] Moreover, limited engineering of the cellular mass (i.e., few target cells producing high amounts of transgene per cell vs many target cells producing lower amounts of transgene per cell) resulted in increased immune responses against the transgene product.
[0047] Therefore, the inventors developed an immune-therapeutic regimen to enhance transduction efficiency, interfere with interferon-a (IFNa)-dependent innate responses, and avoid priming / activation of anti-transgene T cell-mediated adaptive immunity.
[0048] The inventors developed an immunomodulatory / immune-therapeutic treatment regimen to solve the problem of unwanted immune responses to the transgene product, viral proteins comprised by the therapeutic vector, and CD8+ T cells targeting the transgene product. The regimen that the inventors developed comprises the administration of an inhibitor of IFNa receptor 1 (IFNaR) signaling before administration of the viral vector and / or an effector vector or mRNA encoding effector protein(s) capable of mediating gene editing, combined with a co-stimulation blockade regimen consisting of multiple doses of a CD154 / CD40-CD40L signaling inhibitor and / or administration of a CD80 / CD86-CD28 signaling inhibitor (a costimulation blockade, CoB) administered after administration of the viral vector and / or the effector vector or mRNA.
[0049] The inventors found that this IFNaR / CoB regimen of the invention allowed stable transgene expression and activity. This immune-therapeutic regimen reduces or abrogates the induction of anti-transgene antibodies and transgene-specific CD8+ T cells, allowing the persistence of transgene-modified target cells releasing the transgene product in the absence of antibody-mediated neutralization. The invention provides a highly efficient immunomodulatory / immune-therapeutic regimen to enhance transduction efficiency, interfere with IFNa-dependent innate responses, and control priming / activation towards anti-transgene T cell-mediated adaptive immunity.
[0050] This allows effective transgene production by corrected target cells for the treatment of diseases or disorders.
[0051] Furthermore, subjects treated with in vivo gene therapy by administration of a therapeutic viral vector combined with the IFNaR / CoB regimen of the invention did not develop any neutralizing antibodies to viral proteins comprised by the viral particle, or to effector protein(s) encoded by the effector vector or mRNA. For example, in the case of lentiviral gene therapy, no anti-envelope (vesicular stomatitis virus glycoprotein, VSV.G) humoral response was observed, contrary to subjects injected with the lentiviral vector alone.
[0052] The inventors further analyzed the permissiveness of these subjects to a second administration of the viral vector. The inventors found that IFNaR / CoB administration allowed durable transgene expression in subjects previously treated with a viral vector, at levels comparable to those established in naive viral vector-treated subjects.
[0053] The IFNaR / CoB regimen of the invention can be applied to reduce or abrogate adaptive immune responses to the vector particles, vector-encoded transgene product, and in vivo engineered cells, leading to successful therapeutic gene addition for the treatment of genetic diseases and allowing for vector redosing for in vivo gene therapy approaches.
[0054] Embodiments
[0055] Provided is a combination, comprising a first component (component A) and a second component (component C). The first component comprises an inhibitor of interferon alpha or beta receptor subunit 1 (IFNaRl) signaling. In one embodiment, the second component comprises an inhibitor of CD154 / CD40-CD40L signaling. In another embodiment, the second component comprises an inhibitor of CD80 / CD86-CD28 signaling. In a preferred embodiment, the second component comprises both an inhibitor of CD154 / CD40-CD40L signaling and an inhibitor of CD80 / CD86-CD28 signaling.
[0056] In one embodiment, the combination of the invention, further comprises a third component (component B). The third component comprises (i) a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, (ii) an effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing, and / or (iii) a virus-like particle (VLP) or lipid nanoparticle (LNP) comprising the effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing. As further detailed herein, the one or more effector protein(s) capable of mediating gene editing encoded by the effector vector or mRNA are selected from the group of zinc finger nucleases (ZFNs), zinc finger proteins (ZFPs), transcription activator-like effector nucleases (TALENs), or CRISPR / Cas proteins. In a preferred embodiment, the one or more effector protein(s) capable of mediating gene editing are CRISPR / Cas proteins, more preferably Cas9, Casl3, Casl2, Casl2a protein, base editors or prime editors.
[0057] In one embodiment, the combination of the invention can be used in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, or by gene editing.
[0058] In one embodiment, the method in which the combination of the invention can be used comprises three steps of administering three separate components. In a first step (step a), an IFNaRl signaling inhibitor (component A) is administered to the subject. This administration step may herein also be referred to as "IFNaR regimen". In a second step (step b), a therapeutic viral vector or effector vector or mRNA is administered to the subject. This administration step is one of treatment by gene therapy or gene editing. In a third step (step c), the combination of the invention (component C) is administered to the subject. This administration step may herein also be referred to as "CoB regimen". Step a and step c in combination may herein also be referred to as "IFNaR / COB regimen."
[0059] Step a, step b, and step c are temporally separated. Step a is carried out first, step b is carried out after step a, and step c is carried out after step b. The steps are all carried out at separate timepoints. "Separate timepoints" does not encompass, e.g., a first administration directly followed by a second administration (e.g., two injections that are administered in direct succession). The therapeutic viral vector comprises a payload that comprises a transgene encoding a target protein. The "target protein" refers to the transgene product that is expressed from the same. The target protein or transgene product treats, prevents, or alleviates symptoms of a disease or disorder. In one embodiment, the disease or disorder is a monogenic disease or disorder. In this embodiment, the transgene replaces a defective endogenous gene, thereby treating the monogenic disease or disorder. In a preferred embodiment, replacement of the defective endogenous gene by a transgene is mediated by gene editing. Gene editing can be effected by administering a vector or mRNA to the subject that encodes for one or more effector protein(s) capable of mediating gene editing. In a preferred embodiment, gene editing involves replacement of the defective gene by a corrected version of that gene which is delivered in the form of a donor vector to the target cells.
[0060] Provided is an inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling. Also provided is an inhibitor of CD154 / CD40-CD40L signaling. Also provided is an inhibitor of CD80 / 86-CD28 signaling. Also provided is a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein. Provided is a method of treating a subject by gene therapy using a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein or by gene editing.
[0061] The inhibitors, viral vectors, and effector vectors or mRNAs of the invention can be used in the method of treating a subject by gene therapy or gene editing of the invention, i.e., involving the "IFNaR / CoB regimen" of the invention. In the first method step (step a), an IFNaRl signaling inhibitor is administered to the subject. In the second method step (step b), a therapeutic viral vector or an effector vector mRNA is administered to the subject. In a third method step (step c), in one embodiment, an inhibitor of CD154 / CD40-CD40L signaling is administered to the subject. In a third method step (step c), in one embodiment, an inhibitor of CD80 / 86-CD28 signaling is administered to the subject. In a third method step (step c), in a preferred embodiment, both an inhibitor of CD154 / CD40-CD40L signaling and an inhibitor of CD80 / 86-CD28 signaling are administered to the subject. The steps are carried out at separate timepoints.
[0062] In one embodiment, the inhibitor of IFNaRl signaling is sifalimumab, rontalizumab, anifrolumab, QX006N, brepocitinib, baricitinib, upadacitinib, filgotinib, WD-890, ropsacitinib, deurefacitinib, arctigenin, and / or tofacitinib.
[0063] In one embodiment, the inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling is capable of specifically binding to IFNaRl and preventing ligand / receptor binding. In a preferred embodiment, the inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling is an antibody or fragment thereof that is capable of specifically binding to IFNaRl and preventing ligand / receptor binding. In a preferred embodiment, the inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling is anifrolumab or a fragment thereof.
[0064] In one embodiment, the inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling is a small molecule. A "small molecule" as used herein refers to compounds with a molecular mass of no more than 1 kDa.
[0065] In one embodiment, the inhibitor of CD154 / CD40-CD40L signaling is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding. In a preferred embodiment, the inhibitor of CD154 / CD40L signaling is an antibody or fragment thereof that is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding. In a preferred embodiment, the inhibitor of CD154 / CD40-CD40L signaling is ruplizumab or a fragment thereof.
[0066] In one embodiment, the inhibitor of CD154 / CD40-CD40L signaling is a small molecule. A "small molecule" as used herein refers to compounds with a molecular mass of no more than 1 kDa.
[0067] In one embodiment, inhibitor of CD80 / 86-CD28 signaling is capable of specifically binding to CD28 and preventing ligand / receptor binding. In one embodiment, the inhibitor of CD80 / 86- CD28 signaling is an antibody or fragment thereof that is capable of specifically binding CD28 and preventing ligand / receptor binding.
[0068] In a preferred embodiment, the inhibitor of CD80 / CD86-CD28 signaling is a CD28 antagonist. In a preferred embodiment, the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 or a fragment thereof and an Immunoglobulin or fragment thereof. In a more preferred embodiment, the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 and a Fc domain of an Immunoglobulin. In a yet more preferred embodiment, the inhibitor of CD80 / CD86-CD28 signaling is CTLA4-lg.
[0069] In one embodiment, the inhibitor of CD80 / CD86-CD28 signaling is a small molecule. A "small molecule" as used herein refers to compounds with a molecular mass of no more than 1 kDa.
[0070] In one embodiment, the inhibitor of CD154 / CD40-CD40L signaling and the inhibitor of CD80 / CD86-CD28 signaling are formulated together.
[0071] In one embodiment, the viral vector is selected from the group consisting of a retroviral vector, an adeno-associated virus (AAV) vector, an adenovirus (AdV) vector, and a VLP-based vector. In a preferred embodiment, the therapeutic viral vector is a retroviral vector. In a preferred embodiment, the retroviral vector is a lentiviral vector. In one embodiment, the therapeutic viral vector is an adenoviral vector. In one embodiment, the therapeutic viral vector is an adeno-associated viral vector.
[0072] In one embodiment, the effector protein(s) capable of mediating gene editing are selected from the group of zinc finger nucleases (ZFNs), zinc finger proteins (ZFPs), transcription activator-like effector nucleases (TALENs), or CRISPR / Cas proteins. In a preferred embodiment, the CRISPR / Cas protein is a Cas9, Casl3, CaslZ, or CaslZa protein. In another embodiment, the effector protein(s) capable of mediating gene editing are base editors and / or primer editors.
[0073] In the "IFNaR / CoB regimen" of the invention, the "IFNaR regimen" as disclosed herein is carried out first, i.e., the treatment is initiated by administration of an inhibitor of IFNaRl signaling as disclosed herein. In a preferred embodiment, the "IFNaR regimen" consists of a single administration of the inhibitor of IFNaRl signaling. In a preferred embodiment, the "IFNaR regimen" and the "CoB regimen" are at least 1 hour, 2 hours, 3 hours, 4 hours, or 5 hours apart from each other.
[0074] The "IFNaR regimen" step is followed by administration of a therapeutic viral vector as disclosed herein or by administration of an effector vector or mRNA as disclosed herein (i.e., treatment by gene therapy or by gene editing).
[0075] The administration of a therapeutic viral vector or effector vector or mRNA is followed by the "CoB regimen" of the invention, i.e., followed by administration of a CD80 / CD86-CD28 signaling inhibitor and / or a CD154 / CD40-CD40L signaling inhibitor. In a preferred embodiment, the "CoB regimen" comprises multiple separate administrations. In a preferred embodiment, the "CoB regimen" comprises two, three, four, five, or more than five separate administrations. In an even more preferred embodiment, the "CoB regimen" comprises five separate administrations. In a preferred embodiment, the time between the separate administrations is the same for all of the multiple separate administrations.
[0076] In a preferred embodiment, the three steps of the treatment by gene therapy or gene editing and of the "IFNaR / CoB regimen" of the invention are followed by a fourth step. In the fourth step, the same therapeutic viral vector or effector vector or mRNA as administered in the second step is administered once more to the subject. This may also be referred to as "redosing". Thus, provided herein are methods and uses of treatment by gene therapy that comprise a redosing step.
[0077] In a preferred embodiment, the payload comprised by the therapeutic viral vector comprises a transgene that encodes human factor VIII (hFVIll) or human Alpha-L-lduronidase (hIDUA).
[0078] In a preferred embodiment, the payload comprised by the therapeutic viral vector comprises a transgene that encodes human factor VIII (hFVIll) and the disease or disorder to be treated is hemophilia A. In a preferred embodiment, the payload comprised by the therapeutic viral vector comprises a transgene that encodes human Alpha-L-lduronidase (hIDUA) and the disease or disorder to be treated is mucopolysaccharidosis type 1.
[0079] In the present invention, the payload, transgene, and target protein comprised by the therapeutic viral vector are delivered to a target tissue. The target tissue is the tissue in which the gene replacement or gene editing is desired. In a preferred embodiment, the target tissue is liver tissue. In a preferred embodiment, the target tissue comprises hepatocytes.
[0080] In a preferred embodiment, the payload comprises one or more microRNA binding sites. In a preferred embodiment, the one or more microRNA binding sites comprise a binding site for microRNA-142. In a preferred embodiment, the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in off-target tissue. Off-target tissue is tissue other than the target tissue, i.e., tissue in which gene replacement or gene editing and transgene expression is not desired. In a preferred embodiment, the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in hematopoietic cells and / or in immune cells. In a preferred embodiment, the one or more microRNA binding sites are binding sites for microRNAs that are expressed in off- target tissue. In a preferred embodiment, the one or more microRNA binding sites are binding sites for microRNAs that are not expressed in the target tissue.
[0081] In an even more preferred embodiment, the payload comprises more than one of the microRNA binding sites disclosed herein, i.e., a combination of at least two microRNA binding sites selected from:
[0082] • a microRNA binding site comprising a binding site for microRNA-142;
[0083] • a microRNA binding site that causes selective downregulation of expression of the target protein in off-target tissue, as defined above;
[0084] • a microRNA binding site that causes selective downregulation of expression of the target protein in hematopoietic cells and / or in immune cells;
[0085] • a microRNA binding site that is a binding site for microRNAs that are expressed in off- target tissue; and / or
[0086] • a microRNA binding site that is a binding site for microRNAs that are not expressed in the target tissue.
[0087] For example, in a preferred embodiment the payload comprises both of (i) microRNA binding sites that are binding sites for microRNAs that are expressed in off-target tissue and (ii) microRNA binding sites that are binding sites for microRNAs that are not expressed in the target tissue. The microRNA binding sites comprised by the payload reduce or avoid expression of target protein in off-target tissue and therefore improve the desired selective expression of the target protein in the target tissue.
[0088] In the present invention, the immune response to a target protein encoded by the transgene comprised by the payload comprised by the viral vector is reduced when compared to the immune response to the same target protein encoded by the same transgene comprised by the same payload of the same therapeutic viral vector without administration of the one or more signaling inhibitors.
[0089] In the present invention, the immune response to a viral protein comprised by the viral particle is reduced when compared to the immune response to the same viral protein without administration of one or more of the signaling inhibitors. In a preferred embodiment, the therapeutic viral vector is a lentiviral vector and the immune response that is reduced is an immune response against VSV.G.
[0090] In the present invention, the immune response to the subject's cells that comprise the viral vector and / or express the target protein encoded by the transgene comprised by the payload comprised by the viral vector is reduced when compared to the immune response to the same viral protein and / or target protein without administration of the one or more signaling inhibitors. In a preferred embodiment, the immune response is reduced by at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%.
[0091] The immune response to the target protein encoded by the transgene comprised by the payload of the therapeutic viral vector and / or the immune response to the viral protein comprised by the viral particle can be measured by ELISA. The immune response to the subject's cells can be measured by ELISPOT on CD8+ T cells.
[0092] The combinations and inhibitors of the invention can be used in an immunotherapeutic method to prevent or reduce an immune response caused by gene therapy or gene editing with a therapeutic viral vector comprising a payload comprising a transgene encoding a target protein, as disclosed herein.
[0093] EXAMPLES
[0094] The present invention is further illustrated by the following examples. These examples are included for illustrative purposes only and in no way limit the invention.
[0095] MATERIALS AND METHODS
[0096] The general methods described below provide exemplary means for obtaining the data provided in the examples and shown in the drawings. These exemplary means are included for illustrative purposes only and in no way limit the invention. The person skilled in the art knows, from their common general knowledge, how to identify and perform suitable alternative methods, and how to obtain suitable alternative materials from different suppliers, for obtaining data from methods comparable to those provided in the examples and shown in the drawings.
[0097] Vector production
[0098] Lab-grade VSV.G-pseudotyped third-generation self-inactivating (SIN) LV were produced by calcium phosphate transient transfection into human embryonic kindey (HEK) 293T cells, or by LV stable producer cell lines 26. HEK 293T cells were transfected with a solution containing a mix of the selected LV genome transfer plasmid (as further defined below), the packaging plasmids pMDLg / pRRE and pCMV.REV, pMD2.G and pAdvantage, as previously described (Milani et al., Genome editing for scalable production of alloantigen-free lentiviral vectors for in vivo gene therapy, EMBO Mol Med 9(11), 1558-1573 (2017)). The packaging plasmids pMDLg / pRRE and pCMV.REV, pMD2.G and pAdvantage are exemplary commercially available packaging plasmids. The plasmid pMDLg / pRRE is an exemplary 3rdgeneration lentiviral packaging plasmid comprising Gag and Pol. The plasmid pCMV.Rev is an exemplary plasmid allowing expression of the Rev protein. The plasmid pMD2.G is an exemplary plasmid expressing VSV-G envelope. The plasmid pAdvantage is an exemplary plasmid enhancing protein expression in mammalian cells by increasing translation initiation when cotransfected with other expression vectors. The skilled person knows, from their common general knowledge, how to identify and obtain suitable alternative packaging plasmids encoding the corresponding components. Medium was changed 14-16 hours after transfection and supernatant was collected 30 hours after medium change. Alternatively, LV production was induced when LV producer cells were in a sub-confluent state, by replacing the culture medium with medium containing doxycycline (Sigma) 1 pg / mL and supernatant was collected 3 days after induction. LV-containing supernatants were sterilized through a 0.22 pm filter (Millipore) and, when needed, transferred into sterile polyallomer tubes (Beckman) and centrifuged at 20,000 g for 120 min at 20° C (Beckman Optima XL-100K Ultracentrifuge). LV pellet was dissolved in the appropriate volume of PBS to allow 500- 1000X concentration. Suitable vectors are disclosed in WO2014 / 127215 and WO2017 / 136358, which are hereby also incorporated by reference. ET.142T expression cassette coding for GFP and hFIX were cloned in an adeno-associated virus (AAV) backbone plasmid to produce corresponding AAV vectors. AAV8.GFP and AAV8.hFIX vectors were produced and titrated by a commercial provider (Innovavector). Using the information provided herein and their common general knowledge, the skilled person can produce and obtain these vectors and similar vectors having corresponding features.
[0099] More specifically, the following vectors were produced for use in the Examples set out herein: LV.ET.hFVIII.142T, LV.ET.hlDUA.142T, LV.ET.GFP.142T, LV.ET.hFIX.142T,
[0100] AAV8.ET.GFP.142T and AAV8.ET.hFIX.142T. Administration regimens of these vectors as used in the examples are shown in the figures. LV.ET.hFVIII.142T is an exemplary lentiviral vector comprising an Enhanced Transthyretin (ET) promoter / enhancer element, a gene encoding human factor VIII (hFVIll), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of hFVIll.
[0101] LV.ET.hlDUA.142T is an exemplary lentiviral vector comprising an ET promoter / enhancer element, a gene encoding human Alpha-L-lduronidase (hIDUA), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of hIDUA.
[0102] LV.ET.GFP.142T is an exemplary lentiviral vector comprising an ET promoter / enhancer element, a gene encoding green fluorescent protein (GFP), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of GFP.
[0103] LV.ET.hFIX.142T is an exemplary lentiviral vector comprising an ET promoter / enhancer element, a gene encoding green human factor IX (hFIX), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of hFIX.
[0104] AAV8.ET.GFP.142T is an exemplary AAV vector comprising an ET promoter / enhancer element, a gene encoding green fluorescent protein (GFP), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of GFP.
[0105] AAV8.ET.hFIX.142T is an exemplary AAV vector comprising an ET promoter / enhancer element, a gene encoding green human factor IX (hFIX), and target sites for microRNA 142 (142T), and thereby enables hepatocyte-specific expression of hFIX.
[0106] The exemplary lentiviral vectors LV.ET.hFVIII.142T, LV.ET.hlDUA.142T, LV.ET.GFP.142T and LV.ET.hFIX.142T each comprise U3 deletion element, RU5, primer binding site (PBS), Gag del, Env del 1, Rev response element (RRE), Env del 2, central polypurine tract (cPPT), mutated Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), and Nef del, each respectively with the sequences as set forth below:
[0107] U3 deletion element (U3 del) with the following sequence: tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtact (SEQ ID NO: 15),
[0108] RU5 with the following sequence: gggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttg agtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctag cag
[0109] (SEQ ID NO: 16),
[0110] Primer binding site (PBS) with the following sequence: gggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttg agtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctag cag
[0111] (SEQ ID NO: 17),
[0112] Packaging signal Gag del with the following sequence: atgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaa aatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggc tgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctc tattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagacc accgcacagcaagcggccgctgat
[0113] (SEQ ID NO: 18),
[0114] Env del 1 with the following sequence: cttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggag tagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaata
[0115] (SEQ ID NO: 19),
[0116] Rev response element (RRE) with the following sequence: ggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcctcaatgacgctgacggtacaggccagacaatta ttgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatca agcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggattt
[0117] (SEQ ID NO: 20),
[0118] Env del 2 with the following sequence: gggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcaca cgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaa aagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaa ttattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattca ccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagac agagacagatccattcgattagtgaacggatc
[0119] (SEQ ID NO: 21),
[0120] Central polypurine tract (cPPT) with the following sequence: aacttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaa agaattacaaaaacaaattacaaaaattcaaaattttatc
[0121] (SEQ ID NO: 22),
[0122] Mutated Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) with the following sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0123] (SEQ ID NO: 23),
[0124] Nef del with the following sequence: cccgggtcgagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggac (SEQ ID NO: 24).
[0125] In addition to the above sequence elements set forth in SEQ ID NOs: 15-24, LV.ET.hlDUA.142T further comprises BGH polyA signal (reverse), 4xl42T (miR142T) (reverse), hIDUA, and ET promoter / enhancer (reverse), each respectively with the sequences as set forth below:
[0126] BGH polyA signal (reverse) with the following sequence: ccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaata gaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaagggcagtgggagtggcaccttccagggtcaaggaa ggcacgggggaggggcaaacaacagatggctggcaactagaaggcacag
[0127] (SEQ ID NO: 25),
[0128] 4xl42T (miR142T) (reverse) with the following sequence: ccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaata gaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaagggcagtgggagtggcaccttccagggtcaaggaa ggcacgggggaggggcaaacaacagatggctggcaactagaaggcacag
[0129] (SEQ ID NO: 26), hIDUA with the following sequence: tcatggattgcccggggatgggggccctcttggcacagggacctccaggtacggcacagggtccgagaaggggcctggtcgggccc agtagtccagggctcgaactcggtaggagccagagacagcacctgtgtctgggctgaacacaaagaggttgaaggtcgatggcttc ctgctgaccggggtgtacgccttaccgtcctgagagaactggatctcgtatgtccacaggcacttggagcccacgtgttcatccgacc agaccagaaccagctgcccttgggtcaggggcagggcgcggagccgcgtgacctgcccgggcggcttctcggggcgcgcacacac gtgcaccagcaaaagcgacggcagccgcagcgcggggcgcagggtcaggcggccgccggcgggtaaggggcggggcgccgcgg ccaccgggtcctcagccgcgcgcatgcgccggaactgctctgccgtggggaagacgggccggcccaggcgccgccactcgccgtcg gggctgcagagcccgttgtccaggtagcgcgtgacgtagaccaggcccgggccggggggcaccccgcgcagccgcagggtcaccg cgacgctgcggttggggtgggcgcgggtgtcgtcgctcgcgtagatcagcaccgcggcgcgccaggcgtcggccgggccctggggg cggtgggcgctggccaggacgcccaccgtgtggttgctgtccaggacggtcccggcctgcgacacttcggcccagagctgctcctca tccagcagcgccagcagccccatggccgtgagcaccggcttgcgcaacagctgcacgtgcggcgggcgggtgttgttgacctggaa gcgcgcggtgagcgtgcgctgcgcgaaggggtgcgggtggtagctcaggaaggcattgtcgttgctcaggagcgcgtaggggaag gcggaggtggtgttggccagtagcaggttctgatgctgcgcgatgaccttcaccaccatggccgcgtaggtcacgtccgccctccacg gctgtggcagggaccagcccaccagcgggtccgcctcgtcgttgtaaatgggggtgtccgcgaacttggggaagagctgccggatct gctgcgcgacgaccttctcctgctccaggatggagatggagctgcgcgcacccttcctgtggagggagatgtagtccagccgcacgc ccgcctccccagtgaagaagttggtaccgtcgtggcagtggcgcaggaggccccagctcagcggggatcgcggtggggtgtggaag gagtcgccggggcctcccagccgcagggcggggctggcggcgcgcagaccctccgagcaggcatcgtagtagttcaggaagccttg catggtcatggagacgttgtcaaagtcgtggtggtctggctcattccacgtctcgaagttccacttggaaacatgcgccagtccgtacc taccgatgtatctcctggccaggctggagaccaagtccttccactcaaacacctgctgcttgtcctcaaagtcagtgaagtggcccga ggcgctgcccatcagctcaaaccctgggaggagctggttctccctgagaaggtccaagtacccgtccaggtgggtgaagttgtagct caggccccgtccagtggaccccctggtggtgacaagctccagcagccagtgggtccggacctgcttgatgccgcggtgagggacgg cgcccacataggcgaggttgagctgctggtcccagctgaggacgtactggtcagcctggctgtgtggcagcggggggcagaagcct gtgctcctccagaagcgccgcaggggccacagcgcgcgggccgcgtccacatgcaccaggtgcggggcctcggccggggccaccg ggggcgcggccaggagcgaggccaggagcgccagcagcgcggcgcgggggcgcaggggacgcat
[0130] (SEQ ID NO: 27),
[0131] ET promoter / enhancer (reverse) with the following sequence: caggagcttgtggatctgtgtgacggcttctcctggtgaaggggcttttataccccctccttccaacccaggctgctgatccctgccaa gctgactccaaacctgctgattctgattattgacttagtcaacaaaaggagaataagtaacctacacaaatatgaaccttgcctaggg agattagagtatcggaacactcgctctacgaaatgtgcagacagacggggatcctctagagctacctgctgatcgcccggcccctgt tcaaacatgtcctaatactctgtctctgcaagggtcatcagtagttttccatcttactcaacatcctcccagtgccctcgacctgcagcc caagctcctaagcttatcgataccgtccggggcggggcgaacgcgcgctgggcaaaggtcacctgcccctcgcgattgcggcaatcg cggcctcgaatcaatattcgcgaggttaataattaccagcgcgcgctgggcaaacgtcacctgcccctcgcggattatttatttggccc gcgctggtaattattaactcgcg
[0132] (SEQ ID NO: 28).
[0133] In addition to the above sequence elements set forth in SEQ ID NOs 15-24, LV.ET.hFVIII.142T further comprises ET promoter / enhancer, BDD-FVIII codon optimized 6, and 4xl42T (miR142T), each respectively with the sequences as set forth below:
[0134] ET promoter / enhancer with the following sequence: cgcgagttaataattaccagcgcgggccaaataaataatccgcgaggggcaggtgacgtttgcccagcgcgcgctggtaattattaa cctcgcgaatattgattcgaggccgcgattgccgcaatcgcgaggggcaggtgacctttgcccagcgcgcgttcgccccgccccgga cggtatcgataagcttaggagcttgggctgcaggtcgagggcactgggaggatgttgagtaagatggaaaactactgatgacccttg cagagacagagtattaggacatgtttgaacaggggccgggcgatcagcaggtagctctagaggatccccgtctgtctgcacatttcg tagagcgagtgttccgatactctaatctccctaggcaaggttcatatttgtgtaggttacttattctccttttgttgactaagtcaataat cagaatcagcaggtttggagtcagcttggcagggatcagcagcctgggttggaaggagggggtataaaagccccttcaccaggag aagccgtcacacagatccacaagctcctg
[0135] (SEQ ID NO: 29),
[0136] BDD-FVIII codon optimized 6 with the following sequence: atgcagattgagctgtccacttgtttcttcctgtgcctcctgcgcttctgtttctccgccactcgccggtactaccttggagccgtggagc tttcatgggactacatgcagagcgacctgggcgaactccccgtggatgccagattccccccccgcgtgccaaagtccttcccctttaa cacctccgtggtgtacaagaaaaccctctttgtcgagttcactgaccacctgttcaacatcgccaagccgcgcccaccttggatgggc ctcctgggaccgaccattcaagctgaagtgtacgacaccgtggtgatcaccctgaagaacatggcgtcccaccccgtgtccctgcat gcggtcggagtgtcctactggaaggcctccgaaggagctgagtacgacgaccagactagccagcgggaaaaggaggacgataaa gtgttcccgggcggctcgcatacttacgtgtggcaagtcctgaaggaaaacggacctatggcatccgatcctctgtgcctgacttact cctacctttcccatgtggacctcgtgaaggacctgaacagcgggctgattggtgcacttctcgtgtgccgcgaaggttcgctcgctaag gaaaagacccagaccctccataagttcatccttttgttcgctgtgttcgatgaaggaaagtcatggcattccgaaactaagaactcgc tgatgcaggaccgggatgccgcctcagcccgcgcctggcctaaaatgcatacagtcaacggatacgtgaatcggtcactgcccggg ctcatcggttgtcacagaaagtccgtgtactggcacgtcatcggcatgggcactacgcctgaagtgcactccatcttcctggaagggc acaccttcctcgtgcgcaaccaccgccaggcctctctggaaatctccccgattacctttctgaccgcccagactctgctcatggacctg gggcagttccttctcttctgccacatctccagccatcagcacgacggaatggaggcctacgtgaaggtggactcatgcccggaagaa cctcagttgcggatgaagaacaacgaggaggccgaggactatgacgacgatttgactgactccgagatggacgtcgtgcggttcga tgacgacaacagccccagcttcatccagattcgcagcgtggccaagaagcaccccaaaacctgggtgcactacatcgcggccgagg aagaagattgggactacgccccgttggtgctggcacccgatgaccggtcgtacaagtcccagtatctgaacaatggtccgcagcgg attggcagaaagtacaagaaagtgcggttcatggcgtacactgacgaaacgtttaagacccgggaggccattcaacatgagagcg gcattctgggaccactgctgtacggagaggtcggcgataccctgctcatcatcttcaaaaaccaggcctcccggccttacaacatcta ccctcacggaatcaccgacgtgcggccactctactcgcggcgcctgccgaagggcgtcaagcacctgaaagacttccctatcctgcc gggcgaaatcttcaagtataagtggaccgtcaccgtggaggacgggcccaccaagagcgatcctaggtgtctgactcggtactactc cagcttcgtgaacatggaacgggacctggcatcgggactcattggaccgctgctgatctgctacaaagagtcggtggatcaacgcgg caaccagatcatgtccgacaagcgcaacgtgatcctgttctccgtgtttgatgaaaacagatcctggtacctcactgaaaacatccag aggttcctcccaaaccccgcaggagtgcaactggaggaccctgagtttcaggcctcgaatatcatgcactcgattaacggttacgtgt tcgactcgctgcagctgagcgtgtgcctccatgaagtcgcttactggtacattctgtccatcggcgcccagactgacttcctgagcgtg ttcttttccggttacacctttaagcacaagatggtgtacgaagataccctgaccctgttccctttctccggcgaaacggtgttcatgtcg atggagaacccgggtctgtggattctgggatgccacaacagcgactttcggaaccgcggaatgactgccctgctgaaggtgtcctca tgcgacaagaacaccggagactactacgaggactcctacgaggatatctcagcctacctcctgtccaagaacaacgcgatcgagcc gcgcagcttcagccagaacccgcctgtgctgaagaggcaccagcgagaaattacccggaccaccctccaatcggatcaggaggaa atcgactacgacgacaccatctcggtggaaatgaagaaggaagatttcgatatctacgacgaggacgaaaatcagtcccctcgctc attccaaaagaaaactagacactactttatcgccgcggtggaaagactgtgggactatggaatgtcatccagccctcacgtccttcg gaaccgggcccagagcggatcggtgcctcagttcaagaaagtggtgttccaggagttcaccgacggcagcttcacccagccgctgt accggggagaactgaacgaacacctgggcctgctcggtccctacatccgcgcggaagtggaggataacatcatggtgaccttccgt aaccaagcatccagaccttactccttctattcctccctgatctcatacgaggaggaccagcgccaaggcgccgagccccgcaagaac ttcgtcaagcccaacgagactaagacctacttctggaaggtccaacaccatatggccccgaccaaggatgagtttgactgcaaggcc tgggcctacttctccgacgtggaccttgagaaggatgtccattccggcctgatcgggccgctgctcgtgtgtcacaccaacaccctga acccagcgcatggacgccaggtcaccgtccaggagtttgctctgttcttcaccatttttgacgaaactaagtcctggtacttcaccgag aatatggagcgaaactgtagagcgccctgcaatatccagatggaagatccgactttcaaggagaactatagattccacgccatcaa cgggtacatcatggatactctgccggggctggtcatggcccaggatcagaggattcggtggtacttgctgtcaatgggatcgaacga aaacattcactccattcacttctccggtcacgtgttcactgtgcgcaagaaggaggagtacaagatggcgctgtacaatctgtacccc ggggtgttcgaaactgtggagatgctgccgtccaaggccggcatctggagagtggagtgcctgatcggagagcacctccacgcggg gatgtccaccctcttcctggtgtactcgaataagtgccagaccccgctgggcatggcctcgggccacatcagagacttccagatcaca gcaagcggacaatacggccaatgggcgccgaagctggcccgcttgcactactccggatcgatcaacgcatggtccaccaaggaacc gttctcgtggattaaggtggacctcctggcccctatgattatccacggaattaagacccagggcgccaggcagaagttctcctccctg tacatctcgcaattcatcatcatgtacagcctggacgggaagaagtggcagacttacaggggaaactccaccggcaccctgatggtc tttttcggcaacgtggattcctccggcattaagcacaacatcttcaacccaccgatcatagccagatatattaggctccaccccactca ctactcaatccgctcaactcttcggatggaactcatggggtgcgacctgaactcctgctccatgccgttggggatggaatcaaaggct attagcgacgcccagatcaccgcgagctcctacttcactaacatgttcgccacctggagcccctccaaggccaggctgcacttgcag ggacggtcaaatgcctggcggccgcaagtgaacaatccgaaggaatggcttcaagtggatttccaaaagaccatgaaagtgaccg gagtcaccacccagggagtgaagtcccttctgacctcgatgtatgtgaaggagttcctgattagcagcagccaggacgggcaccagt ggaccctgttcttccaaaacggaaaggtcaaggtgttccaggggaaccaggactcgttcacacccgtggtgaactccctggaccccc cactgctgacgcggtacttgaggattcatcctcagtcctgggtccatcagattgcattgcgaatggaagtcctgggctgcgaggccca ggacctgtac
[0137] (SEQ ID NO: 30),
[0138] 4xl42T (miR142T) with the following sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0139] (SEQ ID NO: 31).
[0140] In addition to the above sequence elements set forth in SEQ ID NOs 15-24, LV.ET.hFIX.142T further comprises ET promoter / enhancer, human FIX padua, and 4xl42T (miR142T), each respectively with the sequences as set forth below:
[0141] ET promoter / enhancer with the following sequence: cgcgagttaataattaccagcgcgggccaaataaataatccgcgaggggcaggtgacgtttgcccagcgcgcgctggtaattattaa cctcgcgaatattgattcgaggccgcgattgccgcaatcgcgaggggcaggtgacctttgcccagcgcgcgttcgccccgccccgga cggtatcgataagcttaggagcttgggctgcaggtcgagggcactgggaggatgttgagtaagatggaaaactactgatgacccttg cagagacagagtattaggacatgtttgaacaggggccgggcgatcagcaggtagctctagaggatccccgtctgtctgcacatttcg tagagcgagtgttccgatactctaatctccctaggcaaggttcatatttgtgtaggttacttattctccttttgttgactaagtcaataat cagaatcagcaggtttggagtcagcttggcagggatcagcagcctgggttggaaggagggggtataaaagccccttcaccaggag aagccgtcacacagatccacaagctcctg
[0142] (SEQ ID NO: 29), human FIX padua with the following sequence: atgcagagagtcaacatgattatggctgagtcacctgggctgattactatttgcctgctgggctacctgctgtccgccgagtgtaccgt gttcctggaccatgagaacgcaaataagatcctgaacaggcccaaaagatacaatagtgggaagctggaggaatttgtgcagggc aacctggagagagaatgcatggaggaaaagtgtagcttcgaggaagcccgcgaggtgtttgaaaatacagagcgaaccacagag ttctggaagcagtatgtggacggcgatcagtgcgagagcaacccctgtctgaatggcggaagttgcaaagacgatatcaactcata cgaatgctggtgtcctttcgggtttgaaggcaaaaattgcgagctggacgtgacatgtaacattaagaatggacggtgcgagcagtt ttgtaaaaactctgccgataataaggtggtgtgcagctgtactgaaggatatcgcctggctgagaaccagaagtcctgcgaaccagc agtgcccttcccttgtgggagggtgagcgtctcccagacttcaaaactgaccagagcagagacagtgtttcccgacgtggattacgtc aacagcactgaggccgaaaccatcctggacaacattactcagtctacccagagtttcaatgactttactcgggtggtcgggggcgag gatgctaaaccaggccagttcccctggcaggtggtcctgaacggaaaggtggatgcattttgcggagggtctatcgtgaatgagaaa tggattgtcaccgccgctcactgcgtggaaaccggagtcaagatcacagtggtcgctggggagcacaacattgaggaaacagaaca tactgagcagaagcggaatgtgatccgcatcattcctcaccataactacaatgcagccatcaacaaatacaatcatgacattgccct gctggaactggatgagcctctggtgctgaacagctacgtcactccaatctgcattgctgacaaagagtataccaatatcttcctgaag tttggatcagggtacgtgagcggctggggaagagtcttccacaagggcaggagcgccctggtgctccagtatctgcgagtgcctctg gtcgatcgagctacctgtctgctctctaccaagtttacaatctacaacaacatgttctgcgctgggtttcacgagggaggacgagactc ctgtcagggcgattctgggggcccacatgtgacagaggtcgaaggcaccagcttcctgactggcatcatttcctggggagaggaatg tgcaatgaagggaaaatacgggatctacaccaaagtgagccgctatgtgaactggatcaaggaaaaaaccaaactgacctaa (SEQ ID NO: 32),
[0143] 4xl42T (miR142T) with the following sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0144] (SEQ ID NO: 31).
[0145] In addition to the above sequence elements set forth in SEQ ID NOs 15-24, LV.ET.GFP.142T further comprises ET promoter / enhancer, a gene encoding GFP, and 4xl42T (miR142T), each respectively with the sequences as set forth below.
[0146] ET promoter / enhancer with the following sequence: cgcgagttaataattaccagcgcgggccaaataaataatccgcgaggggcaggtgacgtttgcccagcgcgcgctggtaattattaa cctcgcgaatattgattcgaggccgcgattgccgcaatcgcgaggggcaggtgacctttgcccagcgcgcgttcgccccgccccgga cggtatcgataagcttaggagcttgggctgcaggtcgagggcactgggaggatgttgagtaagatggaaaactactgatgacccttg cagagacagagtattaggacatgtttgaacaggggccgggcgatcagcaggtagctctagaggatccccgtctgtctgcacatttcg tagagcgagtgttccgatactctaatctccctaggcaaggttcatatttgtgtaggttacttattctccttttgttgactaagtcaataat cagaatcagcaggtttggagtcagcttggcagggatcagcagcctgggttggaaggagggggtataaaagccccttcaccaggag aagccgtcacacagatccacaagctcctg
[0147] (SEQ ID NO: 29),
[0148] GFP: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcag cgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccct ggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttc gagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacat cgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccact acctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccggg atcactctcggcatggacgagctgtacaagtaa
[0149] (SEQ ID NO: 33), 4xl42T (miR142T) with the following sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0150] (SEQ ID NO: 31).
[0151] The AAV vectors AAV8.ET.GFP.142T and AAV8.ET.hFIX.142T each comprise the sequence elements 5' Inverted Terminal Repeat (5'ITR), ET promoter / enhancer, mutated WPRE, 4xl42T (miR142T) and 3' Inverted Terminal Repeat (3'ITR), each respectively with the sequences as set forth below:
[0152] 5' Inverted Terminal Repeat (5'ITR) with the sequence: cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcga gcgcgcagagagggagtggccaactccatcact
[0153] (SEQ ID NO: 34),
[0154] ET promoter / enhancer with the sequence: cgcgagttaataattaccagcgcgggccaaataaataatccgcgaggggcaggtgacgtttgcccagcgcgcgctggtaattattaa cctcgcgaatattgattcgaggccgcgattgccgcaatcgcgaggggcaggtgacctttgcccagcgcgcgttcgccccgccccgga cggtatcgataagcttaggagcttgggctgcaggtcgagggcactgggaggatgttgagtaagatggaaaactactgatgacccttg cagagacagagtattaggacatgtttgaacaggggccgggcgatcagcaggtagctctagaggatccccgtctgtctgcacatttcg tagagcgagtgttccgatactctaatctccctaggcaaggttcatatttgtgtaggttacttattctccttttgttgactaagtcaataat cagaatcagcaggtttggagtcagcttggcagggatcagcagcctgggttggaaggagggggtataaaagccccttcaccaggag aagccgtcacacagatccacaagctcctg
[0155] (SEQ ID NO: 29),
[0156] Mutated WPRE with the sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0157] (SEQ ID NO: 23),
[0158] 4xl42T (miR142T) with the sequence: tcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctg ctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagtt gtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcgg ctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgc
[0159] (SEQ ID NO: 31), and
[0160] 3' Inverted Terminal Repeat (3'ITR) with the sequence: agtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcc cgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg
[0161] (SEQ ID NO: 35).
[0162] In addition to the above sequence elements of the AAV vectors set forth in SEQ ID NOs 34, 29, 23, 31 and 35, AAV8.ET.GFP.142T further comprises a gene encoding GFP with the sequence as set forth below:
[0163] GFP: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcag cgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccct ggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttc gagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacat cgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccact acctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccggg atcactctcggcatggacgagctgtacaagtaa
[0164] (SEQ ID NO: 33 = GFP).
[0165] In addition to the above sequence elements of the AAV vectors set forth in SEQ ID NOs 34, 29, 23, 31 and 35, AAV8.ET.hFIX.142T further comprises a gene encoding hFIX with the sequence as set forth below: human FIX padua: atgcagagagtcaacatgattatggctgagtcacctgggctgattactatttgcctgctgggctacctgctgtccgccgagtgtaccgt gttcctggaccatgagaacgcaaataagatcctgaacaggcccaaaagatacaatagtgggaagctggaggaatttgtgcagggc aacctggagagagaatgcatggaggaaaagtgtagcttcgaggaagcccgcgaggtgtttgaaaatacagagcgaaccacagag ttctggaagcagtatgtggacggcgatcagtgcgagagcaacccctgtctgaatggcggaagttgcaaagacgatatcaactcata cgaatgctggtgtcctttcgggtttgaaggcaaaaattgcgagctggacgtgacatgtaacattaagaatggacggtgcgagcagtt ttgtaaaaactctgccgataataaggtggtgtgcagctgtactgaaggatatcgcctggctgagaaccagaagtcctgcgaaccagc agtgcccttcccttgtgggagggtgagcgtctcccagacttcaaaactgaccagagcagagacagtgtttcccgacgtggattacgtc aacagcactgaggccgaaaccatcctggacaacattactcagtctacccagagtttcaatgactttactcgggtggtcgggggcgag gatgctaaaccaggccagttcccctggcaggtggtcctgaacggaaaggtggatgcattttgcggagggtctatcgtgaatgagaaa tggattgtcaccgccgctcactgcgtggaaaccggagtcaagatcacagtggtcgctggggagcacaacattgaggaaacagaaca tactgagcagaagcggaatgtgatccgcatcattcctcaccataactacaatgcagccatcaacaaatacaatcatgacattgccct gctggaactggatgagcctctggtgctgaacagctacgtcactccaatctgcattgctgacaaagagtataccaatatcttcctgaag tttggatcagggtacgtgagcggctggggaagagtcttccacaagggcaggagcgccctggtgctccagtatctgcgagtgcctctg gtcgatcgagctacctgtctgctctctaccaagtttacaatctacaacaacatgttctgcgctgggtttcacgagggaggacgagactc ctgtcagggcgattctgggggcccacatgtgacagaggtcgaaggcaccagcttcctgactggcatcatttcctggggagaggaatg tgcaatgaagggaaaatacgggatctacaccaaagtgagccgctatgtgaactggatcaaggaaaaaaccaaactgacctaa (SEQ ID NO: 32).
[0166] LV titration
[0167] For LV titration, lxlO5HEK 293T cells were transduced with serial LV dilutions in the presence of polybrene (8 pg / ml). For LV-GFP, cells were analyzed by flow cytometry 3-7 days after transduction and infectious titer, expressed as transducing units 293T (TU) / mL, was calculated using the formula TU / mL = ((% GFP+ cells / 100)xl00,000x(l / dilution factor)). For all other LV, genomic DNA (gDNA) was extracted 14 days after transduction, using Maxwell 16 Cell DNA Purification Kit (Promega), following manufacturer's instructions. Vector copy number (VCN) was determined by quantitative PCR (qPCR) starting from 100 ng of template gDNA using primers (HIV fw: 5'-TACTGACGCTCTCGCACC-3' (SEQ ID NO: 1); HIV rv: 5'- TCTCGACGCAGGACTCG-3' (SEQ ID NO: 2)) and a probe (FAM 5'-ATCTCTCTCCTTCTAGCCTC-3' (SEQ ID NO: 3)) designed on the primer binding site region of LV. The amount of endogenous DNA was quantified by a primers / probe set designed on the human telomerase gene (Telo fw: 5'-GGCACACGTGGCTTTTCG-3' (SEQ ID NO: 4); Telo rv: 5'-
[0168] GGTGAACCTCGTAAGTTTATGCAA-3' (SEQ ID NO: 5); Telo probe: VIC 5'- TCAGGACGTCGAGTGGACACGGTG-3' (SEQ ID NO: 6)TAMRA) or the human GAPDH gene (control primers / probe obtainable from, e.g., Applied Biosystems HS00483111_cm) VCN was calculated by the formula = (ng LV / ng endogenous DNA)xVCN of sample used for the standard curve. The standard curve was generated, by using a CEM cell line stably carrying 1 vector integrant, which was previously determined by Southern blot and fluorescent in situ hybridization (FISH). All reactions were carried out in duplicate or triplicate in a Viia7 Real Time PCR thermal cycler (Applied Biosystems). Each qPCR run carried an internal control generated by using a CEM cell line stably carrying 4 vector integrants, which were previously determined by Southern blot and FISH analysis. Infectious titer, expressed as TU / mL, was calculated using the formula TU / mL = (VCNxl00,000x(l / dilution factor). LV physical particles were measured by HIV-1 Gag p24 antigen immunocapture assay (Perkin Elmer) following manufacturer's instructions. LV specific infectivity was calculated as the ratio between infectious titer and physical particles.
[0169] Mice experiments
[0170] Founder B6;129S-F8tmlKaz / J mice (referred to as HemoA or F8 KO, Bi L et al., Nat Genet 1995) (stock #004424) and C57BL / 6NCrl were obtained from The Jackson Laboratories. MPS-I mice (a-ldua- / - mice in C57BL / 6 background, Ohmi K et al., PNAS 2003) were bred in our animal facility. For mice genotyping, DNA was extracted from tail biopsies using Maxwell 16 Mouse Tail DNA Purification Kit (Promega), following manufacturer's instructions. Briefly, to extract DNA from mouse tail biopsies, tissue from a mouse tail snip was homogenised, lysed with a lysis buffer and subjected to DNA purification. The skilled person knows how to extract DNA from mouse tail biopsies using this method or any other suitable alternative method known in the art. The genotype was then assessed following the protocols available on The Jackson Laboratory website. All mice were maintained in specific pathogen-free conditions.
[0171] Vector administration was carried out in males and females adult (7-10-week-old) mice by tail-vein injection (250-500 pL / mouse). Mice were bled from the retro-orbital plexus using capillary tubes and blood was collected into 0.38% sodium citrate buffer, pH 7.4. Mice were deeply anesthetized with tribromoethanol (Avertin) and euthanized by CO2 inhalation at the scheduled times. All animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee.
[0172] IFNAR / CoB preparation and administration
[0173] Anti-mouse IFNaRl (lmg / mouse, MAR1-5A3, bioxcell) was administered intravenously 3 hours before LV injection. Anti-mouse CD154 (0,5mg / mouse / dose, bioxcell) and CTLA4.lg (0,5mg / mouse7 / dose, orencia) were administered immediately after LV for 5 times 72hrs apart intraperitoneally.
[0174] All animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee.
[0175] FVIII assays
[0176] The concentration of human FVIII was determined in mouse plasma by an enzyme-linked immunosorbent assay (ELISA) specific for human FVIII antigen. Microtiter plates were coated with anti-hFVIll binding Ab (Green Mountain Antibodies #GMA8016, 0.2 pg / well in 0.1 M carbonate buffer, pH 9.6) over night at 4°C and then blocked 1 hour at room temperature with blocking buffer (PBS 0.05% Tween-20, IM NaCI, 10% heat inactivated horse serum, Gibco). Plasma samples are diluted as needed starting from 1:10 in blocking buffer, added to wells (100 pL / well) and incubated 2 hours at 37°C. hFVIll was detected by adding detection Ab (Affinity Biologicals, F8C-EIC-D) 1 hour at 37°C, followed by 5-10 minutes incubation with 100 pL / well of TMB substrate (Surmodics). Reaction was blocked with HCI IN (50 pL / well) and absorbance of each sample was determined spectrophotometrically at 450nm, using a Multiskan GO microplate reader (Thermo Fisher Scientific) and normalized to antigen standard curve (ReFACTO, Pfizer, from 25 ng / mL to 0.39 ng / mL serially diluted 1:2 in blocking buffer; dilution was corrected with 10% HemoA murine plasma). hFVIll activity in mouse plasma was measured using a chromogenic assay kit for in vitro diagnostic photometric determination of factor VIII activity. Although any suitable assay for determining hFVIll activity known in the art may be used, in these examples, Coatest SP FVIII (Chromogenix) was used by following the manufacturer's instructions. Briefly, the rationale behind this assay is that, in the presence of calcium and phospholipids, factor X is activated to factor Xa by factor IXa. This generation is greatly stimulated by factor VIII, which may be considered as a cofactor in this reaction. By using optimal amounts of Ca2+ and phospholipids and an excess of factors IXa and X, the rate of activation of factor X is solely dependent on the amount of factor VIII. Factor Xa hydrolyses the chromogenic substrate S- 2765™ thus liberating the chromophoric group, pNA. The color is then read photometrically at 405 nm. The generated factor Xa and thus the intensity of color is proportional to the factor VIII activity in the sample. Any other assay suitable for determining hFVIll activity may be used. The skilled person knows how to identify and perform such assays that are known in the art.
[0177] Anti-hFVIll Abs were measured in mouse plasma by ELISA. Microtiter plates were coated with ReFACTO (Pfizer, 0.1 pg / well in 0.1 M carbonate buffer, pH 9.6) over night at 4°C and then blocked 1 hour at room temperature with blocking buffer (PBS 0.05% Tween-20, 10% heat inactivated horse serum, Gibco). Samples are heat inactivated for 30 minutes at 56°C, diluted as needed starting from 1:100 in blocking buffer, added to wells (100 pL / well) and incubated 2 hours at 37°C on orbital shaker. Anti-hFVIll Abs were detected by adding detection Ab (goat anti-mouse IgG-HRP, here obtained from Sigma, 1:10,000 in blocking buffer) 1 hour at 37°C on orbital shaker, followed by 5-10 minutes incubation with 100 pL / well of TMB substrate (Surmodics). Reaction was blocked with HCI IN (50 pL / well) and absorbance of each sample was determined spectrophotometrically at 450nm, using a Multiskan GO microplate reader (Thermo Fisher Scientific) and normalized to standard curve. The standard curve is a pool of 7 different commercial anti-human FVIII Abs raised against different FVIII domains (here obtained from Green Mountain Antibodies WGMA8002, WGMA8005, WGMA8008, #GMA8011, WGMA8015, WGMA8016, WQED10104) serially diluted 1:2 from lOOng / mL to 0.78ng / mL in blocking buffer; dilution was corrected with 1% HemoA murine plasma. Any other FVIII raised against different FVIII that are suitable for making a standard curve may be used instead. The skilled person knows how to identify such alternative antibodies that are known in the art, and how to make a corresponding standard curve.
[0178] IDUA assays hIDUA Transgene expression was determined by ddPCR. The skilled person knows how to perform ddPCR. The ddPCR method used to obtain the data shown herein comprised the following steps. RNA was extracted using Maxwell 16 LEV simplyRNA Tissue Kit (Promega), according to manufacturer's instructions and reverse transcribed using the Superscript IV VILO kit (11766050; ThermoFisher Scientific). LV gene expression was assessed by ddPCR starting from 25-50 ng of template cDNA using a primers / probe set designed on the WPRE region of LV (WPRE: primer fw 5'-GGCTGTTGGGCACTGACAAT-3' (SEQ ID NO: 7); primer rv 5'- ACGTCCCGCGCAGAATC-3' (SEQ ID NO: 8); probe FAM 5'-TTTCCTTGGCTGCTCGCCTGTGT-3' NGB (SEQ ID NO: 9)). The PCR reaction was performed with each primer (900 nM) and the probe (250 nM) following manufacturer's instructions (Biorad), read with QX200 reader and analyzed with QuantaSoft software (Biorad). The skilled person knows, from their common general knowledge, how to perform such a PCR reaction. hIDUA Enzymatic Activity was measured fluorometrically61 following the incubation of 10 pL serum or 10 pg of liver protein extract for 1 h at 37°C with 10 mL substrate (2 mM 4- methylumbelliferyl a-L-iduronide, Glycosynth) in 0.1 M Na formate buffer (pH 3.2). Fluorescence of the 4-methylumbelliferone released was measured after the addition of 1 mL 0.5 M carbonate buffer (pH 10.7). Fluorescence was read by Omega fluorometer (BMG- Labtech). rhIDUA (0.2 pg Aldurazyme, Genzyme) was coated onto the wells of a 96-well microtiter plate (Thermo Fisher Scientific). After 12-16 h of incubation at 4°C, the plate was blocked for 2 h at room temperature (RT) with PBS-5% BSA (Roche), and diluted plasma samples were plated. After an additional 2 h at RT, biotinylated anti-human immunoglobulin (Thermo Fisher Scientific) was added to the plate for 2 h at RT, followed by 45-min incubation with Streptavidin horseradish peroxidase (HRP) conjugate. A substrate solution containing o- Phenylenediamine dihydrochloride (OPD) was prepared according to the manufacturer's instructions (Sigma-Aldrich, P4664), and the colorimetric reaction was stopped after 6-10 min by the addition of sulfuric acid (stop solution, R&D Systems). Absorbance was read at 492-nm wavelength using SkaltRE for Multiskan go version 3.2 (Thermo Scientific). IgG concentration was determined by comparison to a serial dilution of a known-concentration solution of mouse IgGs (Sigma-Aldrich).
[0179] VSV.G assay
[0180] Anti VSV.G IgG were measured in plasma derived from experimental and control mice, coating wells of a 96-well microtiter plate (here, obtained from Thermo Fisher Scientific) with rVSV.G-lndiana (0.2 pg) and proceeding as described for anti-IDUA IgG enzyme-linked immunosorbent assay (ELISA) test.
[0181] FIX assay
[0182] The concentration of human FIX was determined in mouse plasma by an enzyme-linked immunosorbent assay (ELISA) specific for human FIX antigen (obtainable, e.g., as Asserachrom IX:Ag, Stago) following manufacturer's instructions. Absorbance of each sample was determined spectrophotometrically, using a Multiskan GO microplate reader (Thermo Fisher Scientific) and normalized to antigen standard curves.
[0183] VCN determination
[0184] DNA was extracted from whole liver samples using Maxwell 16 Tissue DNA Purification Kit (Promega), DNA was extracted from fractionated / sorted liver cells using DNeasy Blood & Tissue Kit (Qiagen) or QIAamp DNA Micro Kit (Qiagen), according to cell number. VCN was determined using an ad hoc ddPCR (QX200 EvaGreen Digital PCR Supermix, Bio-Rad), which selectively amplifies the reverse transcribed vector genome (both integrated and nonintegrated) discriminating it from plasmid carried over from the transient transfection (RT- LV; AU3 fw: 5'-TCACTCCCAACGAAGACAAGATC-3' (SEQ ID NO: 10), gag rv: 5'- GAGTCCTGCGTCGAGAGAG-3' (SEQ ID NO: 11)) (Matrai et al., Hepathology 2011). The amount of endogenous murine DNA was quantified by a primers / probe set designed on the murine sema3a gene (Sema3A fw: 5'-ACCGATTCCAGATGATTGGC-3' (SEQ ID NO: 12); Sema3A rv: 5'-TCCATATTAATGCAGTGCTTGC-3' (SEQ ID NO: 13); Sema3A probe: HEX 5'- AGAGGCCTGTCCTGCAGCTCATGG-3' BHQ1 (SEQ ID NO: 14)). The PCR reaction was performed with each primer (900 nM, 150nM for RT-LV primers) and the probe (250 nM) following manufacturer's instructions (Biorad), read with QX200 reader and analyzed with QuantaSoft software (Biorad).
[0185] Elispot Assay
[0186] Peripheral blood mononuclear cells (PBMCS) were isolated from blood or CD8+ T cells were magnetically isolated from the spleen of experimental mice (Miltenyi Biotec, 130-104-075). 105PBMCS or CD8+ T cells were plated in triplicate in ELISPOT plates (Millipore, Bedford, MA) pre-coated with anti-IFN-g capture mAb (2.5 mg / mL; BD Pharmingen, R46A2) in the presence of IL-2 (50 U / mL; BD Pharmingen) and 105irradiated (6,000 rad) untransduced, LVFVIII or LV.IDUA-transduced autologous EL-4 cells. After 42 h of incubation at 37°C and 5% CO2, plates were washed and IFN-g-producing cells were detected by biotin-conjugated anti- IFN-g mAb (0.5 mg / mL; BD Pharmingen, XMG 1.2). Streptavidin-HRP conjugate (Roche) was added. Spots were counted by ImmunoSpot reader (Cellular Technology).
[0187] Example 1
[0188] The inventors observed that intravenous (i.v.) administration of human factor VIII (FVIII)- expressing LV (LV-hFVIll) to adult HA mice results in the induction of a strong anti-FVIll humoral and cellular immune response, quickly leading to clearance of LV-corrected hepatocytes and preventing detection of circulating FVIII . In this LV design, FVIII expression was driven by a previously described hepatocyte-specific cassette made by the Enhanced Transthyretin promoter (ET) and comprising target sites for microRNA 142 (ET.142T)(Milani Nat Commun 2022). This is mainly due to the high immunogenicity of FVIII and, indeed, even normal individuals may develop non-neutralizing anti-FVIll antibodies (Algiman PNAS 1992 PMID: 1570298; Meunier Blood Adv 2017 PMID: 29296830). Moreover, limited engineering of the hepatic mass (i.e., few hepatocytes producing high amounts of transgene per cell vs many hepatocytes producing lower amounts of transgene per cell) resulted in increased immune responses against the transgene product. Therefore, the inventors designed an immune-therapeutic regimen to enhance transduction efficiency, interfere with interferon-a (IFNa)-dependent innate responses, and avoid priming / activation of anti-transgene T cell- mediated adaptive immunity. The inventors found that the administration of a monoclonal antibody anti-IFNa receptor 1 (IFNaR) 3 hours before LV-hFVIll injection (2xl010TU / kg), combined with a co-stimulation blockade regimen consisting of 5 doses 72 hours apart of anti-CD154 / CTLA4.lg (IFNaR / CoB) (Fig. 1A and Fig. 2A), allowed stable hFVIll expression and activity, reaching ~100% of normal in adult HA mice (Fig. IB and 1C and Fig. 2B and 2C). This immune-therapeutic regimen abrogated the induction of anti-hFVIll Abs (Fig. ID and Fig. 2D) and hFVI Il-specific CD8 T cells (Fig. IE and IF and Fig. 2E and 2F), allowing the persistence of LV-modified hepatocytes (Fig. IF and Fig. 2F), releasing hFVIll in the absence of Ab-mediated neutralization, largely beyond the time of IFNaR / CoB administration.
[0189] IFNaR / CoB / LV-hFVIll treated mice stably expressing hFVIll at 12 week post GT (n=4) and control naive hemoA mice were re-challenged by 4 weekly injection of recombinant hFVIll protein (4X10UI i.v.) to verify the establishment of active tolerance to hFVIll. One week after the re-challenge protocol at week 16, 3 / 3 control mice were serum-converted, developing hFVIl l-specific IgG mediated response. Conversely, from week 20, only 1 / 4 of IFNaR / CoB / LV- hFVIll treated mice displayed the serum-conversion, and 3 / 4 remained antibodies negative and stably maintained therapeutic levels of hFVIll in the plasma, thus demonstrating the active maintaining of immunological tolerance to hFVIll GT product (Fig. 2B-D).
[0190] Example 2
[0191] Similarly, in vivo GT in adult MPS-I mice by i.v. administration of human IDUA-expressing LV (LV.hlDUA) results is the induction of a strong anti-hlDUA humoral and cellular immune response, that quickly leads to clearance of LV-corrected hepatocytes. Therefore, the inventors tested the efficacy of the IFNaR / CoB regimen to enhance transduction efficiency, interfere with IFNa-dependent innate responses, and control priming / activation towards anti-IDUA T cell-mediated adaptive immunity to allow effective hIDUA enzyme production by corrected hepatocytes for the treatment of MPS-I lysosomal disorder. The inventors found that IFNaR / CoB administration allowed durable hIDUA expression and activity in the liver in adult MPS-I mice at 2xlO10TU / kg LV dose (Fig. 3 A-C). This immune-therapeutic regimen abrogated the induction of anti-hlDUA Abs (Fig. 3 D) and hIDUA-specific CD8 T cells (Fig. 3 E, F) allowing the persistence of LV-modified hepatocytes (Fig. 3 G) releasing IDUA in the absence of Ab-mediated neutralization, beyond the time of IFNaR / CoB administration.
[0192] Example 3
[0193] Furthermore, mice treated with in vivo GT by systemic administration of GFP-expressing LV (LV.GFP) combined with the IFNaR / CoB regimen did not develop any neutralizing antienvelope (vesicular stomatitis virus glycoprotein, VSV.G) humoral response (Fig. 4 A, B), contrarily to mice injected with LV.GFP alone. Therefore, the inventors tested the permissiveness of these mice to a second LV infusion, by administering systemically a human factor IX (hFIX)-expressing LV (LV.hFIX). The inventors found that IFNaR / CoB administration allowed durable hFIX expression in mice previously treated with a LV.GFP at levels comparable to those established in naive LV.hFIX-treated mice (Fig. 4 C).
[0194] Example 4 Similarly, mice treated with in vivo GT by systemic administration of GFP-expressing AAV8 (AAV8.GFP) combined with the IFNaR / CoB regimen did not develop any neutralizing anticapsid (AAV8) humoral response (Fig. 5 A, B), contrarily to mice injected with AAV.GFP alone. Therefore, we tested the permissiveness of these mice to a second AAV8 infusion, by administering systemically a human factor IX (hFIX)-expressing AAV8 (AAV8.hFIX). We found that IFNaR / CoB administration allowed durable hFIX expression in mice previously treated with a AAV8.GFP (Fig. 5 C).
[0195] Conclusions
[0196] Overall, these data show that IFNaR / CoB regimen can be applied to abrogate adaptive immune responses to the vector particles, vector-encoded transgene product, and in vivo engineered cells, leading to successful therapeutic gene addition for the treatment of genetic diseases and allowing for vector redosing for in vivo GT approaches.
[0197] INDUSTRIAL APPLICABILITY
[0198] The combinations, inhibitors, viral vectors according to the present invention may be industrially manufactured and sold as products for the methods and uses of the invention (e.g., for gene therapy treatments), in accordance with known standards for the manufacture of pharmaceutical products. Accordingly, the present invention is industrially applicable.
Claims
CLAIMS1. A combination for use in a method of treating a subject by gene therapy with a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein or for use in a method of treating a subject by gene editing, the combination comprising:I) a first component A, comprising an inhibitor of interferon alpha and beta receptor subunit 1 (IFNaRl) signaling, andII) a second component C, comprising: an inhibitor of CD154 / CD40-CD40L signaling; and / or an inhibitor of CD80 / CD86-CD28 signaling, wherein the method comprises three steps of administering three separate components: step a) administering, as component A, the inhibitor of IFNaRl signaling to the subject, step b) administering, as component B, a therapeutic viral vector or effector vector or mRNA to the subject, wherein component B comprises (i) the therapeutic viral vector comprising the payload that comprises the transgene encoding the target protein, or (ii) the effector vector or mRNA that encodes one or more effector protein(s) capable of mediating gene editing, wherein this administration step b) is a step of treatment by gene therapy or gene editing; and step c) administering, as component C, the inhibitor of CD154 / CD40-CD40L signaling and / or the inhibitor of CD80 / CD86-CD28 signaling to the subject, wherein the target protein or transgene product treats, prevents, or alleviates symptoms of a disease or disorder.
2. The combination for use of claim 1, wherein the second component C comprises both an inhibitor of CD154 / CD40-CD40L signaling and an inhibitor of CD80 / CD86-CD28 signaling.
3. The combination for use of any one of the preceding claims, wherein:A) the inhibitor of IFNaRl signaling is capable of specifically binding to IFNaRl and preventing ligand / receptor binding, optionally wherein: i) the inhibitor of IFNaRl signaling is an antibody or fragment thereof that is capable of specifically binding to IFNaRl and preventingligand / receptor binding, optionally wherein the inhibitor of IFNaRl signaling is anifrolumab or a fragment thereof; or ii) the IFNaRl signaling inhibitor is a small molecule; and / orB) the inhibitor of CD154 / CD40-CD40L signaling is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding, optionally wherein: i) the inhibitor of CD154 / CD40L signaling is an antibody or fragment thereof that is capable of specifically binding to CD154 / CD40L and preventing ligand / receptor binding, optionally wherein the inhibitor of CD154 / CD40- CD40L signaling is ruplizumab or a fragment thereof; or ii) the inhibitor of CD154 / CD40-CD40L signaling is a small molecule; and / orC) the inhibitor of CD80 / CD86-CD28 signaling is capable of specifically binding to CD28 and preventing ligand / receptor binding, optionally wherein: i) the inhibitor of CD80 / CD86-CD28 signaling is an antibody or fragment thereof that is capable of specifically binding CD28 and preventing ligand / receptor binding, optionally wherein the inhibitor of CD80 / CD86-CD28 signaling is a CD28 antagonist, or optionally wherein the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 or a fragment thereof and an Immunoglobulin or fragment thereof, preferably wherein the inhibitor of CD80 / CD86-CD28 signaling is a fusion protein of CTLA4 and a Fc domain of an Immunoglobulin, more preferably wherein the inhibitor of CD80 / CD86-CD28 signaling is CTLA4-lg; or ii) the inhibitor of CD80 / CD86-CD28 signaling is a small molecule.
4. The combination for use of any one of the preceding claims, wherein:A) the inhibitor of CD154 / CD40-CD40L signaling and the inhibitor of CD80 / CD86- CD28 signaling are formulated together; and / orB) the viral vector is selected from the group consisting of: i) a retroviral vector; ii) an adeno-associated virus (AAV) vector; iii) an adenovirus (AdV) vector; and iv) a virus-like particle (VLP)-based vector;5. The combination for use of any one of the preceding claims, wherein the effector protein(s) capable of mediating gene editing are selected from the group of zinc finger nucleases (ZFNs), zinc finger proteins (ZFPs), transcription activator-like effector nucleases (TALENs), or CRISPR / Cas proteins, optionally wherein, when the effector protein(s) capable of mediating gene editing are CRISPR / Cas proteins, the CRISPR / Cas proteins are Cas9, Casl3, Casl2, or Casl2a proteins.
6. The combination for use of any of the preceding claims, wherein step 1) the method of treating a subject is initiated by administration of the inhibitor of IFNaR signaling, optionally wherein the administration of the inhibitor of IFNaRl signaling consists of a single administration of the inhibitor of IFNaRl signaling; step 2) the step of administration of the inhibitor of IFNaRl signaling is followed by administration of the therapeutic viral vector comprising the payload that comprises the transgene encoding a target protein, or by administration of the effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing; and step 3) the step of administration of the therapeutical viral vector or effector vector or mRNA is followed by administration of the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40-CD40L signaling.
7. The combination for use of claim 6, wherein the administration of the inhibitor of IFNaRl signaling and the administration of the inhibitor of CD80 / CD86-CD28 signaling and / or the inhibitor of CD154 / CD40- CD40L signaling are at least 1 hour, 2 hours, 3 hours, 4 hours, or 5 hours apart from each other; and optionally wherein the three steps 1) - 3) are followed by a fourth step, step 4) of redosing, i.e., of administration of the same therapeutic viral vector or effector vector or mRNA as administered in step 2) once more to the subject.
8. The combination for use of any one of the preceding claims, wherein:A) the payload comprised by the therapeutic viral vector comprises a transgene that encodes human factor VIII (hFVIll) and the disease or disorder to be treated is hemophilia A; orB) the payload comprised by the therapeutic viral vector comprises a transgene that encodes human Alpha-L-lduronidase (hIDUA) and the disease or disorder to be treated is mucopolysaccharidosis type 1.
9. The combination for use of any one of the preceding claims, wherein the payload, transgene, and target protein comprised by the therapeutic viral vector are delivered to a target tissue, wherein the target tissue is the tissue in which the gene replacement or gene editing is desired, optionally wherein the target tissue is liver tissue, further optionally wherein the target tissue comprises hepatocytes.
10. The combination for use of any of the preceding claims, wherein the payload comprises one or more microRNA binding sites, optionally whereini) the one or more microRNA binding sites comprise a binding site for microRNA-142; ii) the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in off-target tissue; iii) the one or more microRNA binding sites cause(s) selective downregulation of expression of the target protein in hematopoietic cells and / or in immune cells; iv) the one or more microRNA binding sites are binding sites for microRNAs that are expressed in off-target tissue; and / or v) the one or more microRNA binding sites are binding sites for microRNAs that are not expressed in the target tissue.
11. The combination for use of any one of the preceding claims, wherein:A) the immune response to the target protein encoded by the transgene comprised by the payload comprised by the therapeutic viral vector is reduced when compared to the immune response to the same target protein encoded by the same transgene comprised by the same payload of the same therapeutic viral vector without administration of the one or more inhibitors of signaling;B) the immune response to a viral protein comprised by a viral particle is reduced when compared to the immune response to the same viral protein without administration of the one or more inhibitors of signaling; orC) the immune response to the subject's cells that comprise the viral vector and / or express the target protein encoded by the transgene comprised by the payload comprised by the therapeutic viral vector is reduced when compared to the immune response to the same viral protein and / or target protein encoded by the same transgene comprised by the same therapeutic viral vector without administration of the one or more inhibitors of signaling.
12. The combination for use of any of the preceding claims, wherein the use of the combination comprising the first component A and the second component C reduces or abrogates adaptive immune responses to vector particles, the transgene product encoded by the viral vector and / or in vivo engineered cells.
13. A combination, comprising:I) a first component A, comprising an inhibitor of IFNaRl signaling, andII) a second component C, comprising: an inhibitor of CD154 / CD40-CD40L signaling; and / or an inhibitor of CD80 / CD86-CD28 signaling.
14. The combination of claim 13, optionally wherein the combination further comprises a third component B that comprisesi) a therapeutic viral vector comprising a payload that comprises a transgene encoding a target protein, or ii) an effector vector or mRNA encoding one or more effector protein(s) capable of mediating gene editing.
15. The combination of any of claims 13-14, wherein the viral vector is selected from the group consisting of: i) a retroviral vector; ii) an adeno-associated virus (AAV) vector; iii) an adenovirus (AdV) vector; and iv) a virus-like particle (VLP)-based vector.
Citation Information
Patent Citations
Optimized factor viii gene
WO2014127215A1
Optimized factor viii genes
WO2017136358A1