Method for calculating relative ratio (SIJ) of reaction rate constant between trinucleotides, and method for producing nucleic acid library using sij

Abstract

The method includes the following steps.　(1) A step in which a mixture (b) containing two or more trinucleotides is reacted with a polynucleotide (a) to obtain a nucleotide chain (A) in which the polynucleotide contained in (a) is extended by any trinucleotide contained in (b). (2) A step for extending (A) to a predetermined chain length that includes repeating one or more times a procedure whereby a mixture (b') containing three or more trinucleotides is reacted with (A) obtained in (1) and the chain length of (A) is extended by any one trinucleotide contained in (b'). (3) A step for measuring the ratio of Tj connected to Ti in the region extended by (b) and / or (b') in (A) obtained in (2). (4) A step for calculating Sij from the ratio obtained in (3).

Description

Method for calculating relative ratio of reaction rate constants (Sij) between trinucleotides, and method for producing nucleic acid library using Sij

[0001] The present invention relates to the relative ratio of reaction rate constants between trinucleotides (S ｉｊ The present invention also relates to a method for calculating the S ｉｊ The present invention also relates to a method for producing a nucleic acid library using the method.

[0002] There is a demand for peptide libraries that can be used in the development of pharmaceuticals (Patent Document 1). One known process for preparing a library of nucleic acids encoding a wide variety of peptide compounds is to synthesize the nucleic acids by extending a nucleotide chain in units of trinucleotides (trimers) corresponding to codons (see Patent Documents 1 and 2). To date, the reactivity (reaction factor: RF) between various trinucleotides and four types of mononucleotides has been investigated (Non-Patent Documents 1 to 3 and Patent Document 3).

[0003] International Publication No. 2013 / 100132 U.S. Patent No. 6,436,675 International Publication No. 2022 / 161450

[0004] Nucleic Acids Res. , 2004, 32(4), pp. 1448-1459 Nucleic Acids Res. , 1996, 24(19), pp. 3748-3755 Nucleosides Nucleic Acids, 2007, 26(5), pp. 473-497

[0005] In the course of investigating methods for synthesizing nucleic acids by extending a nucleotide chain in trinucleotide units, the present inventors discovered that there are differences in reactivity between trinucleotides depending on the type of trinucleotide. The present inventors also discovered that nucleic acids obtained by extending a nucleotide chain in a system in which various trinucleotides are mixed at a uniform molar ratio exhibit bias in the frequency of appearance of various trinucleotides. The bias in the frequency of appearance of various trinucleotides means that there is a bias in the frequency of appearance of various amino acids in peptides encoded by the nucleic acids, which means that it is difficult to construct a library containing a wide variety of peptide compounds.

[0006] However, the reactivity and reaction rate between various trinucleotides have not been investigated to date, and it is not known whether bias in the frequency of occurrence of various trinucleotides in nucleic acids elongated using a trinucleotide mixture occurs depending on the reactivity and reaction rate between various trinucleotides.

[0007] An object of the present invention is to provide a method for calculating the relative ratio of reaction rate constants between trinucleotides. Another object of the present invention is to provide a method for producing a nucleic acid library using the calculated relative ratio of reaction rate constants.

[0008] The present disclosure encompasses, for example, the following inventions. Note that when any of [X] to [Y] is described, any subnumber within the range of X to Y is also included. [1] A method for determining the relative ratio of reaction rate constants (S ｉｊ) method: (1) a step of reacting a plurality of polynucleotides (a) with a trinucleotide mixture (b) containing two or more types of trinucleotides at a predetermined molar ratio, and elongating the polynucleotides contained in (a) with any one trinucleotide contained in the trinucleotide mixture (b), to obtain a plurality of types of nucleotide chains (A); (2) a step of further reacting the plurality of types of nucleotide chains (A) obtained in the step (1) with a trinucleotide mixture (b') containing three or more types of trinucleotides at a predetermined molar ratio, and elongating the chain lengths of the plurality of types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b'), the step comprising repeating this operation once or twice or more times; (3) a step of calculating the number of trinucleotide Ts in the region of the plurality of types of nucleotide chains (A) obtained in the step (2) that has been elongated in trinucleotide units using the trinucleotide mixture (b) and / or the trinucleotide mixture (b'). ｉ Trinucleotide T ｊ (4) determining the relative ratio of the reaction rate constants (S ｉｊ ) where S ｉｊ is the trinucleotide T ｉ and trinucleotide T ｊ is the relative ratio of the reaction rate constants when reacting trinucleotide T ｉ and trinucleotide T ｊ are the same or different types of trinucleotides, and are selected from the trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b'). [1-1] A method for determining the relative ratio of reaction rate constants (S ｉｊ(1') a step of preparing one or more types of synthesis initiators; (2') a step of reacting the one or more types of synthesis initiators with a trinucleotide mixture (b') containing two or more types of trinucleotides at a predetermined molar ratio, and extending the chain length of the nucleotide chain (A') to a predetermined chain length, the step comprising repeating once or twice or more times an operation of extending the chain length of the nucleotide chain (A') with any one trinucleotide contained in the trinucleotide mixture (b'); (3') a step of calculating the amount of trinucleotide T in the region of the nucleotide chain (A') obtained in the step (2') that has been extended in trinucleotide units using the trinucleotide mixture (b'). ｉ Trinucleotide T ｊ (4') determining the relative ratio of the reaction rate constants (S ｉｊ ) where S ｉｊ is the trinucleotide T ｉ and trinucleotide T ｊ is the relative ratio of the reaction rate constants when reacting trinucleotide T ｉ and trinucleotide T ｊ are the same or different types of trinucleotides and are selected from the trinucleotides contained in the trinucleotide mixture (b'). [2] A method for producing a nucleic acid library, comprising the following steps: (I) adding two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) according to [1] to a plurality of polynucleotides (a-2), respectively, to the S ｉｊ(II) reacting the polynucleotides contained in (a-2) with any one of the trinucleotides contained in the trinucleotide mixture (b-2) in a molar ratio calculated based on the above formula (I) to obtain multiple types of nucleotide chains (A-2), and (II) adding two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') described in [1] to the multiple types of nucleotide chains (A-2) obtained in the above step (I). ｉｊ and repeating once or twice or more times an operation of further extending the chain length of the plurality of types of nucleotide chains (A-2) with any one trinucleotide contained in the trinucleotide mixture (b-2'). [2-1] A method for producing a nucleotide chain, comprising the steps of: (II') reacting one or more types of synthesis initiators or polynucleotides (a-2) with the trinucleotide mixture (b) described in [1] or the trinucleotide mixture (b') described in [1-1], respectively, and ｉｊ and repeating the procedure of extending the synthesis initiator or the polynucleotide (a-2) with any one trinucleotide contained in the trinucleotide mixture (b'-2) once or twice or more times to extend the nucleotide chain (A'-2) to a predetermined chain length. [3] A method for producing a nucleic acid library containing a random region, comprising the following steps: (i) reacting two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') according to [1] or [1-1] with the S ｉｊ(ii) using the trinucleotide mixture (b-2') to extend the random region to a predetermined chain length in trinucleotide units, wherein the random region contains two or more trinucleotides. [4] A method for standardizing the frequency of appearance of codons in a random region contained in a nucleic acid library, comprising the steps of: (i) adding two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') according to [1] or [1-1] to the S trinucleotide mixture (b') according to [1] or [1-1]. ｉｊ (ii) using the trinucleotide mixture (b-2') to extend the random region to a predetermined chain length in trinucleotide units, wherein the random region contains two or more trinucleotides. [5] A method for controlling the frequency of appearance of a specific codon in a random region contained in a nucleic acid library, comprising the steps of: (i) adding two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') according to [1] or [1-1] to the S trinucleotide mixture (b-2') according to [1] or [1-1]. ｉｊand (ii) using the trinucleotide mixture (b-2') to extend the random region to a predetermined chain length in trinucleotide units, wherein the random region contains two or more trinucleotides. [6] The method according to any one of [3] to [5], wherein the nucleic acid library further contains a constant region. [7] The method according to [2] or [2-1], wherein the frequency of appearance of each trinucleotide contained in the region of the nucleotide chain (A-2) extended in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2'), or in the region of the nucleotide chain (A'-2) extended in trinucleotide units using the trinucleotide mixture (b'-2), is controlled to a predetermined value. [8] The method according to any one of [2], [2-1] and [7], wherein the molar ratio of each type of trinucleotide in all trinucleotides contained in the region of the nucleotide chain (A-2) elongated in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2'), or in the region of the nucleotide chain (A'-2) elongated in trinucleotide units using the trinucleotide mixture (b'-2), is controlled to a predetermined value. [9] A certain type of trinucleotide T' contained in the region of the nucleotide chain (A-2) elongated in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2'), or in the region of the nucleotide chain (A'-2) elongated in trinucleotide units using the trinucleotide mixture (b'-2), is controlled to a predetermined value. １The method according to any one of [2], [2-1], [7] and [8], wherein the ratio of the frequency of appearance of other types of trinucleotides to that of the other types of trinucleotides is adjusted to 1:1 or to be higher or lower than 1:1.

[10] The method according to any one of [2], [2-1], [7] and [8], wherein the ratio of the frequency of appearance of other types of trinucleotides to that of the other types of trinucleotides is adjusted to 1:1 or to be higher or lower than 1:1.

[11] The method according to any one of [2], [2-1], [7] and [8], wherein the ratio of the frequency of appearance of other types of trinucleotides to that of the other types of trinucleotides is adjusted to be 1:1 or to be higher or lower than 1:1. １The method of any one of [2], [2-1], and [7] to [9], wherein the ratio of the frequency of appearance of the specific codon to the frequency of other types of trinucleotides is adjusted to between 1:10 and 10:1, or between 1:5 and 5:1, or between 1:3 and 3:1, or between 1:2 and 2:1, or between 1:1.5 and 1.5:1, or between 1:1.2 and 1.2:1.

[11] The method of any one of [3] to [6], wherein the frequency of appearance of a specific codon in the random region is controlled to a predetermined value.

[12] The method of any one of [3] to [6] and

[11] , wherein the molar ratio of each type of trinucleotide in all trinucleotides contained in the random region is controlled to a predetermined value.

[13] The method of [5] or

[11] , wherein the ratio of the frequency of appearance of the specific codon to the frequency of other predetermined codons is adjusted to 1:1, or higher or lower than 1:1.

[14] The method according to [5] or

[11] , wherein the ratio of the frequency of occurrence of the specific codon to the frequency of other predetermined codons is adjusted to be between 1:10 and 10:1, or between 1:5 and 5:1, or between 1:3 and 3:1, or between 1:2 and 2:1, or between 1:1.5 and 1.5:1, or between 1:1.2 and 1.2:1.

[15] The method according to any one of [5],

[11] , and

[13] to

[14] , wherein the specific codon corresponds to a codon encoding an aromatic amino acid.

[16] The method according to

[15] , wherein the frequency of occurrence of the specific codon is adjusted to be lower than the frequency of other predetermined codons, more preferably, the ratio of the frequency of occurrence of the specific codon to the frequency of other predetermined codons is adjusted to 1 / 3 or less.

[17] A certain type of trinucleotide T contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is adjusted to be lower than the frequency of other predetermined codons, more preferably, to be lower than the frequency of other predetermined codons, so that the ratio is 1 / 3 or less. １

[18] The method according to any one of [1] to

[16] , wherein the molar ratio of the trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is equal to or greater than 1.0 and equal to or less than 2.0.

[19] The method according to any one of [2] to

[18] , further comprising an extension reaction using a specific trinucleotide instead of the trinucleotide mixture in step (II) and / or step (II') and / or step (ii).

[20] The method according to any one of [1] to

[19] , wherein the base moiety of the nucleotide chain (A) and / or the nucleotide chain (A') and / or the nucleotide chain (A-2) and / or the nucleotide chain (A'-2) and / or the random region is composed of a combination of four to eight types of bases, preferably a combination of four types of bases.

[21] The method according to

[20] , wherein the base comprises adenine (A), thymine (T), guanine (G), or cytosine (C), and optionally has a protecting group.

[22] The method according to any one of [1] to

[21] , wherein the trinucleotide is composed of DNA-like trinucleotides linked by phosphodiester bonds, and optionally has a protecting group.

[23] The method according to any one of [1] to

[22] , wherein at least one of the hydroxyl group, phosphate group, and amino group in the trinucleotide is protected with a protecting group.

[24] The method according to any one of [1] to

[23] , wherein the hydroxyl group at the 5'-position in the trinucleotide is protected with a 4,4'-dimethoxytrityl group (DMT) and / or the phosphate group is protected with a 2-chlorophenyl group.

[25] The trinucleotide comprises a base whose amino group is protected with a benzoyl group (Bz) or an isobutyl group (iBu), preferably and / or having an N,N'-diisopropylaminophosphoramidite group protected with a cyanoethyl group at the 3'-end.

[26] The method according to any one of [1] to

[25] , comprising performing a deprotection reaction after each trinucleotide extension and / or after completion of repeated extension reactions in trinucleotide units and / or after completion of extension reactions of the nucleotide chain (A) and / or the nucleotide chain (A') and / or the nucleotide chain (A-2) and / or the nucleotide chain (A'-2) and / or the nucleotide chain contained in the nucleic acid library.

[27] The method according to any one of [1], [2], and [6] to

[26] , wherein one end of the plurality of polynucleotides (a) and / or the plurality of polynucleotides (a-2) and / or one end of the constant region is supported on a carrier.

[28] The method according to

[27] , wherein the support is a solid phase, preferably a bead-shaped solid phase, more preferably magnetic beads, high molecular weight polymer beads, or glass beads, and even more preferably CPG (Controlled Pore Glass).

[29] The method according to any one of [1] to

[28] , wherein the nucleotide chain (A) and / or the nucleotide chain (A') and / or the nucleotide chain (A-2) and / or the nucleotide chain (A'-2) and / or the nucleotide chains contained in the nucleic acid library are synthesized in a solid phase by a phosphoramidite method.

[30] The method according to any one of [1] to

[26] , wherein the nucleotide chain (A) and / or the nucleotide chain (A') and / or the nucleotide chain (A-2) and / or the nucleotide chain (A'-2) and / or the nucleotide chains contained in the nucleic acid library are synthesized in a liquid phase.

[31] The method according to any one of [6] and

[11] to

[30] , wherein the constant region encodes a part of a predetermined polypeptide and / or a part or all of a primer, and the random region encodes a part or all of the predetermined polypeptide.

[32] The method according to any one of [1] to

[31] , wherein the nucleotide chain (A) and / or the nucleotide chain (A') and / or the nucleotide chain (A-2) and / or the nucleotide chain (A'-2) and / or the nucleotide chain contained in the nucleic acid library is extended from the 3' end to the 5' end.

[33] The method according to any one of [1] to

[32] , wherein in step (2) and / or the step (2') and / or the step (II) and / or the step (II') and / or the step (ii), the number of repetitions of the operation of further extending the chain length with the trinucleotide is from 1 to 30.

[34] The method according to any one of [1] to

[33] , wherein in step (2) and / or the step (2') and / or the step (II) and / or the step (II') and / or the step (ii), the number of repetitions of the operation of further extending the chain length with the trinucleotide is from 5 to 20.

[35] The method according to any one of [1] to

[34] , wherein in the step (2) and / or the step (2') and / or the step (II) and / or the step (II') and / or the step (ii), the number of repetitions of the operation of further extending the chain length with the trinucleotide is 6 to 15.

[36] The method according to any one of [1] to

[35] , wherein the measurement in the step (3) and / or the step (3') and / or the analysis of the frequency of appearance of various trinucleotides contained in the region extended in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') are performed by next-generation sequencer (NGS) analysis.

[37] The measurement in the step (3) and / or the step (3'), and / or the analysis of the frequency of appearance of various trinucleotides contained in the region extended in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2'), is carried out by transcribing the multiple types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the nucleotide chain (A-2), and / or the nucleotide chain (A'-2), and / or the nucleotide chain contained in the nucleic acid library to obtain multiple types of mRNA, The method according to any one of [1] to

[36] , wherein the step (4) and / or the step (4') of S is carried out by next-generation sequencer (NGS) analysis of cDNA obtained by reverse transcription of the mRNA, or the step (4') of S is carried out by transcribing the plurality of types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the nucleotide chain (A-2), and / or the nucleotide chain (A'-2), and / or the nucleotide chain contained in the nucleic acid library to obtain a plurality of types of mRNA, and then ligating the mRNA with a linker complex to obtain linker-linked mRNA, and then carrying out next-generation sequencer (NGS) analysis of cDNA obtained by reverse transcription of the plurality of types of mRNA. ｉｊ The number of types of trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is N, the number of extensions in trinucleotide units is M, and the various trinucleotides are represented by T ｉ (i = an integer from 1 to N), calculated by the following formula (1): [1] The method according to any one of [1] to

[37] . (In formula (1), n ​​is an integer of 2 or more and M or less, i and j are each independently an integer of 1 or more and N or less, and D ｉ，ｊ，ｎ，ｎ－１ indicates that the trinucleotide at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ and the trinucleotide at the nth position is T ｉ C represents the number of molecules of the nucleotide chain (A) or the nucleotide chain (A'),ｊ，ｎ－１ indicates that the trinucleotide molecule at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ(The number of molecules is indicated by the formula (39).

[39] The method according to any one of [1] to

[38] , wherein the number of bases in the plurality of polynucleotides (a) and / or the plurality of polynucleotides (a-2) and / or the constant region is 2 to 50.

[40] The method according to any one of [1] to

[39] , wherein the number of bases in the plurality of polynucleotides (a) and / or the plurality of polynucleotides (a-2) and / or the constant region is 5 to 30.

[41] The method according to any one of [1] to

[40] , wherein the number of bases in the plurality of polynucleotides (a) and / or the plurality of polynucleotides (a-2) and / or the constant region is 10 to 25.

[42] The method according to any one of [1] to

[41] , wherein the plurality of polynucleotides (a) and / or the plurality of polynucleotides (a-2) and / or the constant region is a single type.

[43] The method according to any one of [1] to

[42] , wherein the number of types of trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is 3 to 64.

[44] The method according to any one of [1] to

[43] , wherein the trinucleotide mixture (b) and / or the trinucleotide mixture (b') contains 3 to 47 types of trinucleotides.

[45] The method according to any one of [1] to

[44] , wherein the trinucleotide mixture (b) and / or the trinucleotide mixture (b') contains 10 to 64 types of trinucleotides.

[46] The method according to any one of [1] to

[45] , wherein the trinucleotide mixture (b) and / or the trinucleotide mixture (b') contains 21 to 50 types of trinucleotides.

[47] The method according to any one of [1] to

[46] , wherein the trinucleotide mixture (b) and / or the trinucleotide mixture (b') contains 21 to 47 types of trinucleotides.

[48] ​​The method according to any one of [1] to

[47] , wherein the trinucleotide mixture (b) and the trinucleotide mixture (b') are the same mixture, and / or the trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') are the same mixture.

[49] The method according to any one of [2] to

[48] , wherein the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') contains from 2 to 64 types of trinucleotides.

[50] The method according to any one of [2] to

[49] , wherein the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') contains from 10 to 64 types of trinucleotides.

[51] The method according to any one of [2] to

[50] , wherein the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') contains from 2 to 40 types of trinucleotides.

[52] The method according to any one of [2] to

[51] , wherein the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') contains 10 or more and 35 or less types of trinucleotides. ｉｊ The molar ratio (MR ｉ The method according to any one of [2] to

[52] , wherein the trinucleotide is determined by the following formulas (2) to (8): ｉ (i = 1...N), and the mixing ratio of various trinucleotides is expressed as MR ｉ And MR ｉ This is an equation in which the sum of (i = 1...N) is normalized to 1, Formula (3) represents a case where, in the first trinucleotide elongation reaction, one trinucleotide at the 3' end immediately before the first trinucleotide is T' ｘ When the 5'-terminal trinucleotide is immobilized on the nucleotide, the 5'-terminal trinucleotide becomes T' after the reaction. ｉ The proportion C ｉ，１ and Formula (4) shows that the immediately preceding 3'-terminal trinucleotide is of two types, T' ｘ , T' ｙ and the respective ratios are R ｘ , R ｙ(R ｘ +R ｙ = 1) ｉ，１ and Equation (5) is the C of equation (4) ｉ，１ The value of F is normalized ｉ，１ and Similarly, formula (6) indicates that after the jth (j=2...M) extension reaction, the trinucleotide at the 5' end is T' ｉ The proportion C ｉ，ｊ and Equation (7) is the C of equation (5) ｉ，ｊ The value of F is similarly normalized. ｉ，ｊ and F ｉ，ｊ is the 5' end of the trinucleotide T' after the jth reaction. ｉ and satisfies equation (8). (Here, w ｉ (i = an integer from 1 to N) is a coefficient for adjusting the frequency of occurrence of various trinucleotides, and constant is a constant. A simultaneous equation that simultaneously satisfies formula (2), formula (4), formula (5), formula (6), formula (7), and formula (8), or simultaneously satisfies formula (3), formula (4), formula (5), formula (6), formula (7), and formula (8), cannot be solved analytically, but can be solved by the Newton-Raphson method. ｉ，ｊ , F ｉ，ｊ , constant and MR ｉ A numerical solution can be obtained by providing an appropriate initial value to the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2'). １ The method according to any one of [2] to

[53] , wherein the molar ratio of a certain type of trinucleotide T' to the other type of trinucleotide is 1 or more and 10 or less.

[55] The method according to any one of [2] to

[53] , wherein the molar ratio of a certain type of trinucleotide T' contained in the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b'-2) and / or the trinucleotide mixture (b-2') is 1 or more and 10 or less. １The method according to any one of [2] to

[54] , wherein the molar ratio of a certain type of trinucleotide T' to the other type of trinucleotide is 1 or more and 7 or less.

[56] ... １

[57] The method according to any one of [1] to

[56] , wherein the number of bases in the nucleotide chains contained in the multiple types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the multiple types of nucleotide chains (A-2), and / or the nucleotide chain (A'-2), and / or the nucleic acid library is 20 to 300.

[58] The method according to any one of [1] to

[57] , wherein the number of bases in the nucleotide chains contained in the multiple types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the multiple types of nucleotide chains (A-2), and / or the nucleotide chain (A'-2), and / or the nucleic acid library is 20 to 200.

[59] The method according to any one of [1] to

[58] , wherein the number of bases in the nucleotide chains contained in the multiple types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the multiple types of nucleotide chains (A-2), and / or the nucleotide chain (A'-2), and / or the nucleic acid library is 40 to 100.

[60] The number of types of nucleotide chains contained in the multiple types of nucleotide chains (A), and / or the nucleotide chain (A'), and / or the multiple types of nucleotide chains (A-2), and / or the nucleotide chain (A'-2), and / or the nucleic acid library is 1 x 10 １０

[61] The method according to any one of [1] to

[59] , wherein the number of types of nucleotide chains contained in the multiple types of nucleotide chains (A), and / or the multiple types of nucleotide chains (A-2), and / or the multiple types of nucleotide chains (A'-2), and / or the nucleic acid library is 1 x 10 １２The method of any of [1] to

[60] , which is the above.

[62] The method of any of [1] to

[61] , which further comprises, in the step (2), or after the step (2) and before the step (3), a step of reacting a specific nucleotide (c) with the multiple types of nucleotide chains (A) to further extend the chain length of the multiple types of nucleotide chains (A). [62-1] The method of any of [1] to

[61] , which further comprises, in the step (2'), or after the step (2') and before the step (3'), a step of reacting a specific nucleotide (c) with the nucleotide chain (A') to further extend the chain length of the nucleotide chain (A').

[63] The method according to any one of [2], [7] to

[10] , and

[17] to

[61] , further comprising a step of reacting a specific nucleotide (c-2) with the multiple types of nucleotide chains (A-2) in or after the step (II) to further extend the chain length of the multiple types of nucleotide chains (A-2). [63-1] The method according to any one of [2], [7] to

[10] ,

[17] to

[61] , and

[63] , further comprising an extension reaction using a specific trinucleotide (c-2) instead of the trinucleotide mixture (b-2') in the step (II), wherein a specific position of each nucleotide chain included in the multiple types of nucleotide chains (A-2) is fixed with the specific trinucleotide (c-2). [63-2] The method according to any one of [2-1] to

[61] , further comprising, in the step (II') or after the step (II'), a step of reacting the nucleotide chain (A'-2) with a specific nucleotide (c-2) to further extend the chain length of the nucleotide chain (A'-2). [63-3] The method according to any one of [2-1] to

[62] and [63-2], further comprising, in the step (II'), an extension reaction using a specific trinucleotide (c-2) instead of the trinucleotide mixture (b'-2), wherein a specific position of each nucleotide chain included in the nucleotide chain (A'-2) is fixed with the specific trinucleotide (c-2).

[64] The method of any one of [3] to [6],

[11] to

[47] , and

[49] to

[61] , further comprising a step of reacting a specific nucleotide (c-2) with the random region in or after step (ii) to further extend the chain length of the random region and / or the chain length of the region other than the random region. [64-1] The method of any one of [3] to [6],

[11] to

[47] , and

[49] to

[61] , further comprising an extension reaction using a specific trinucleotide (c-2) instead of the trinucleotide mixture (b-2') in step (ii), wherein each nucleotide chain contained in the nucleic acid library has a random region fixed at a specific position by a specific trinucleotide.

[65] The method of any one of

[62] to

[64] , wherein the number of bases extended with the specific nucleotide (c) and / or the specific nucleotide (c-2) is 1 to 100.

[66] The method according to any one of

[62] to

[65] , wherein the number of bases extended with the specific nucleotide (c) and / or the specific nucleotide (c-2) is 1 to 50.

[67] The method according to any one of

[62] to

[66] , wherein the number of bases extended with the specific nucleotide (c) and / or the specific nucleotide (c-2) is 5 to 30.

[68] The method according to any one of

[62] to

[67] , wherein the specific nucleotide (c) and / or the specific nucleotide (c-2) is extended in mononucleotide units.

[69] The method according to any one of [2] to

[68] , wherein the occurrence frequency of each of a plurality of types of trinucleotides in the region in the nucleotide chain (A-2) extended in trinucleotide units using the trinucleotide mixture (b-2) and the trinucleotide mixture (b-2'), and / or the region in the nucleotide chain (A'-2) extended in trinucleotide units using the trinucleotide mixture (b'-2), and / or the random region, is within a difference of −11% to +18% from a set expected occurrence frequency value.

[70] The method according to any one of [1] to

[69] , wherein in the step (1), the trinucleotide mixture (b) contains trinucleotides having the base sequences TAG and ATG, and / or the step (2) comprises reacting with a trinucleotide having the base sequence ATG at the end of each of the repeated operations of extending the chain length with the trinucleotide mixture (b'), wherein the nucleotide chain (A) is extended from the 3' end to the 5' end, and preferably the number of bases in the polynucleotide (a) is 20 to 30.

[71] The method according to any one of [2], [7] to

[10] ,

[17] to

[63] , and

[65] to

[70] , wherein in the step (I), the trinucleotide mixture (b-2) contains trinucleotides having the base sequences of TAG and ATG, and / or the step (II) comprises reacting with a trinucleotide having the base sequence of ATG at the end of each of the repeated operations of extending the chain length with the trinucleotide mixture (b-2'), and optionally wherein a predetermined polypeptide is encoded in the region extended in chain length with the trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') and in one trinucleotide immediately following said region, wherein the nucleotide chain (A-2) is extended from the 3' end to the 5' end, and preferably the number of bases of the polynucleotide (a-2) is 20 to 30. [71-1] The method according to any one of [2-1] to

[70] , wherein a predetermined polypeptide is encoded in the region whose chain length has been extended with the trinucleotide mixture (b'-2) and in one trinucleotide immediately following said region, and wherein the nucleotide chain (A'-2) is extended from the 3' end to the 5' end.

[72] The method according to any one of [3] to [6],

[11] to

[47] , and

[49] to

[71] , wherein a trinucleotide having a TAG or ATG base sequence is present bound to the 3' end of the random region, and a trinucleotide having an ATG base sequence is present bound to the 5' end of the random region, and optionally a predetermined polypeptide is encoded in the random region and the trinucleotides bound to the 3' end and 5' end of the region, respectively.

[73] A method for producing an mRNA library, comprising the steps of: obtaining a library containing multiple types of messenger RNAs (mRNAs) by transcribing the multiple types of nucleotide chains (A), the multiple types of nucleotide chains (A'), the multiple types of nucleotide chains (A-2), or the multiple types of nucleotide chains (A'-2) obtained by the method described in any one of [1] to [2] or [7] to

[71] .

[74] A method for producing a linker-linked mRNA library, comprising the steps of: (a) obtaining multiple types of messenger RNAs (mRNAs) by transcribing the multiple types of nucleotide chains (A), the multiple types of nucleotide chains (A'), the multiple types of nucleotide chains (A-2), or the multiple types of nucleotide chains (A'-2) obtained by the method described in any one of [1] to [2] or [7] to

[71] , and (b) ligating the multiple types of mRNAs to a linker complex to obtain a library containing linker-linked mRNAs.

[75] A method for producing a library containing mRNA-polypeptide complexes, the method comprising the following steps: (a) obtaining multiple types of messenger RNAs (mRNAs) by transcribing the multiple types of nucleotide chains (A), the multiple types of nucleotide chains (A'), the multiple types of nucleotide chains (A-2), or the multiple types of nucleotide chains (A'-2) obtained by the method of any of [1] to [2] or [7] to

[71] , (b) ligating the multiple types of mRNAs to a linker complex to obtain a library containing linker-linked mRNAs, and (c) obtaining mRNA-polypeptide complexes in which multiple types of polypeptides obtained by translating the multiple types of mRNAs, respectively, are linked via linkers to mRNAs encoding each polypeptide.

[76] The method of

[37] ,

[74] , or

[75] , wherein the linker complex is a puromycin-linker complex.

[77] A method for screening for a polypeptide that binds to a target substance, comprising the steps of (a) and (b) below: (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of

[75] or

[76] , or a library containing said complex; and (b) selecting said complex that binds to said target substance.

[78] A method for producing a polypeptide, comprising the following steps (a) to (d): (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of

[75] or

[76] or a library containing the complex, (b) selecting the complex that binds to the target substance, (c) recovering the mRNA contained in the complex selected in step (b), and (d) preparing cDNA from the recovered mRNA and synthesizing a polypeptide from the cDNA.

[79] A method for producing a polypeptide, comprising the following steps (a) to (b) and (c') to (d'): (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of

[75] or

[76] or a library containing the complex, (b) selecting the complex that binds to the target substance, (c') determining the amino acid sequence of the polypeptide contained in the complex selected in step (b), and (d') synthesizing a polypeptide based on the amino acid sequence determined in step (c').

[80] The method according to any one of

[31] and

[75] to

[79] , wherein the polypeptide constitutes a part or all of a cyclic polypeptide having a cyclic portion.

[81] The method according to any one of

[31] and

[75] to

[80] , wherein the CLogP of the polypeptide is 25 or less.

[82] The method according to any one of

[31] and

[75] to

[81] , wherein the molecular weight of the polypeptide is 5000 g / mol or less.

[83] The method according to any one of

[31] and

[75] to

[82] , wherein the number of amino acid residues of the polypeptide is 3 to 30.

[84] The method according to any one of

[31] and

[75] to

[83] , wherein the polypeptide contains an unnatural amino acid residue.

[85] The method according to

[84] , wherein the unnatural amino acid residue is an unnatural N-substituted amino acid residue.

[86] A trinucleotide mixture (b-2') for extending a random region of a nucleic acid library in trinucleotide units, comprising the S according to [1], each of which is used to control the appearance ratio of two or more types of trinucleotides selected from the trinucleotide mixture (b') according to [1]. ｉｊ[86-1] A trinucleotide mixture (b'-2) for extending a random region of a nucleic acid library in trinucleotide units, wherein the trinucleotide mixture (b') according to [1-1] contains two or more trinucleotides selected from the trinucleotide mixture (b') according to [1-1] in a molar ratio calculated based on the above. ｉｊ

[87] A nucleic acid library produced by any of the methods of [2], [7] to

[10] ,

[17] to

[63] , and

[65] to

[70] .

[0009] According to the present invention, a method for calculating the relative ratio of reaction rate constants between trinucleotides can be provided. According to the present invention, a method for producing a nucleic acid library using the calculated relative ratio of reaction rate constants can also be provided. The method for producing a nucleic acid library according to the present invention can arbitrarily control the frequency of appearance of various trinucleotides in nucleic acids by utilizing the calculated relative ratio of reaction rate constants.

[0010] FIG. 1 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 1-1. FIG. 2 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 1-2. FIG. 3 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 1-3. FIG. 4 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 1-4. FIG. 5 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 2. FIG. 6 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 3. FIG. 7 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 4. FIG. 8 shows the frequency of occurrence of each trinucleotide (codon unit) in compound 5.

[0011] Hereinafter, embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments.

[0012] In this specification, the term "to" indicating a range includes both ends of the range. For example, "A to B" means a range that is equal to or greater than A and equal to or less than B.

[0013] In this specification, when "i = 1...N" is written, it means that i is any integer from 1 to N. Similarly, when "j = 2...M" is written, it means that j is any integer from 2 to M.

[0014] In the present invention, the meaning of the term "and / or" includes any combination of "and" and "or" appropriately combined. Specifically, for example, "A, B and / or C" includes the following seven variations: (i) A, (ii) B, (iii) C, (iv) A and B, (v) A and C, (vi) B and C, and (vii) A, B and C.

[0015] The use of the articles "a," "an," and "the," both in this specification and in the claims, shall be construed to encompass both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0016] [Relative ratio of reaction rate constants between trinucleotides (S ｉｊ ) of one embodiment] ｉｊThe method for calculating (hereinafter also referred to as "calculation method") includes the following steps. Step (1): A step of reacting a plurality of polynucleotides (a) with a trinucleotide mixture (b) containing two or more types of trinucleotides at a predetermined molar ratio, and elongating the polynucleotides contained in (a) with any one trinucleotide contained in the trinucleotide mixture (b), thereby obtaining a plurality of types of nucleotide chains (A); Step (2): A step of further reacting the plurality of types of nucleotide chains (A) obtained in step (1) with a trinucleotide mixture (b') containing two or more types of trinucleotides at a predetermined molar ratio, and elongating the chain lengths of the plurality of types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b'), the step comprising repeating this operation once or twice or more times; Step (3): A step of elongating the plurality of types of nucleotide chains (A) to a predetermined chain length, the step comprising repeating once or twice or more times the operation of further elongating the chain lengths of the plurality of types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b'), ... (3): A step of elongating the plurality of types of nucleotide chains (A) to a predetermined chain length, the step comprising repeating once or twice or more times the operation of further elongating the chain lengths of the plurality of types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b) ｉ Trinucleotide T ｊ Step (4): A step of measuring the ratio of the linked reaction rate constants (S ｉｊ ) calculation step

[0017] A calculation method according to another embodiment includes the following steps (hereinafter also referred to as "calculation method 2"). Step (1'): a step of preparing one or more types of synthesis initiators; Step (2'): a step of reacting a trinucleotide mixture (b') containing two or more types of trinucleotides at a predetermined molar ratio with the one or more types of synthesis initiators, and extending the chain length of the nucleotide chain (A') to a predetermined chain length, the step comprising repeating once or twice or more times an operation of extending the chain length of the nucleotide chain (A') with any one trinucleotide contained in the trinucleotide mixture (b'); Step (3'): a step of extending the chain length of the nucleotide chain (A') to a predetermined chain length by using the trinucleotide mixture (b') in the region of the nucleotide chain (A') obtained in the step (2') by trinucleotide units. ｉ Trinucleotide T ｊ Step (4'): A step of measuring the ratio of the linked reaction rate constants (S ｉｊ ) calculation step

[0018] As used herein, the term "trinucleotide" refers to a molecule in which three monomers selected from deoxyribonucleotides and deoxyribonucleotide derivatives having artificial bases are linked via phosphodiester bonds, and which may be protected by a protecting group (a DNA-like trinucleotide). Since three bases make up one codon, a trinucleotide can also be referred to as a codon unit or codon. When a trinucleotide has a base X, a base Y, and a base Z in this order from the 5'-end, XYZ is also referred to as the base sequence of the trinucleotide (X, Y, and Z each represent any base). In this specification, a trinucleotide having the base sequence XYZ is sometimes referred to as an XYZ unit.

[0019] The base contained in the monomer is selected from, for example, adenine (A), thymine (T), guanine (G), cytosine (C), and derivatives thereof (artificial bases). The derivative may be appropriately selected from derivatives known to those skilled in the art, and examples thereof include pyridine derivatives, purine derivatives, pyrimidine derivatives, pterin derivatives, and the like, in which the purine base or pyrimidine base is replaced with another heterocycle.

[0020] The types of bases contained in the trinucleotide may be, for example, 4 to 8 types, 4 to 7 types, 4 to 6 types, 4 to 5 types, or even 4 types. The bases contained in the trinucleotide may be, for example, four types: adenine (A), thymine (T), guanine (G), and cytosine (C). Depending on the number of types of bases contained in the trinucleotide, for example, the base portions of the nucleotide chain (A), nucleotide chain (A'), nucleotide chain (A-2), nucleotide chain (A'-2), and random region are composed of a combination of 4 to 8 types of bases, a combination of 4 to 7 types of bases, a combination of 4 to 6 types of bases, a combination of 4 to 5 types of bases, or a combination of 4 types of bases.

[0021] When the trinucleotide has a protecting group, the hydroxyl group, phosphate group and / or amino group in the trinucleotide may be protected by the protecting group.

[0022] Specific examples of the protecting group include a 4,4'-dimethoxytrityl group (DMT) that protects the 5'-hydroxyl group, an N,N'-diisopropylaminophosphoramidite group protected with a cyanoethyl group that protects the 3'-hydroxyl group, a 2-chlorophenyl group that protects a phosphate group, and a benzoyl group (Bz) or isobutyl group that protects the amino group of a base (e.g., adenine, guanine, cytosine). When the trinucleotide has a protecting group, it may contain one type of protecting group alone or two or more types of protecting groups in combination.

[0023] Specific examples of bases with protected amino groups include the following:

[0024] As used herein, the term "relative ratio of reaction rate constants (S ｉｊ ")" refers to the trinucleotide T ｉ and trinucleotide T ｊ The relative ratio of the reaction rate constants when reacting the trinucleotide T ｉ and T ｊ are abbreviations that respectively refer to specific trinucleotides, and specifically refer to trinucleotides having the base sequence ACG, etc. ｉ and T ｊ When N types of trinucleotides are used in the reaction, each of them is independently T １ , T ２ , ...T Ｎ It will be either of the following. ｉｊ Trinucleotide T in ｉ and trinucleotide T ｊ are of the same type (T ｉ =T ｊ ) or different types (T ｉ and T ｊ It is a trinucleotide of the formula (where T is different). ｉ and T ｊ If the types are different, T ｉ To T ｊ The relative ratio of the reaction rate constants and T ｊ To T i In the above calculation method, the relative ratio of the reaction rate constants for the trinucleotide T ｉ and T ｊ is selected from the trinucleotides contained in the trinucleotide mixture (b).

[0025] (Polynucleotide (a)) Polynucleotide (a) is a molecule in which two or more monomers selected from deoxyribonucleotides and deoxyribonucleotide derivatives having unnatural bases are linked via phosphodiester bonds. A nucleotide chain (A) is synthesized by linking any one trinucleotide contained in trinucleotide mixture (b) to the 5'-end or 3'-end of polynucleotide (a) and extending it.

[0026] The number of bases in polynucleotide (a) is not particularly limited, and may be, for example, 2 to 50. The number of bases in polynucleotide (a) may be, for example, 3 to 40, 4 to 35, 5 to 30, 10 to 25, or 20 to 30.

[0027] The base sequence of polynucleotide (a) is not particularly limited and may be any base sequence. For example, when polynucleotide (a) is extended from the 3'-end to the 5'-end, the base sequence of polynucleotide (a) from the 5'-end may be TAG or ATG (which may further include any base sequence at the 3'-end of the base sequence), but this is not limiting.

[0028] The polynucleotide (a) used in step (1) may be of a single type (i.e., molecules having the same base sequence and number of bases) or of multiple types (i.e., a combination of two or more molecules having different base sequences and / or different numbers of bases). ｉｊ From the viewpoint of obtaining accurate data for calculating the polynucleotide (a), it is preferable that the polynucleotide (a) used in step (1) is of a single type.

[0029] (Synthesis Initiator) In the present invention, a synthesis initiator can be used instead of the polynucleotide (a). The nucleotide chain (A') is synthesized by adding a trinucleotide to the synthesis initiator and then extending the trinucleotide. Examples of synthesis initiators include universal supports bound to solid-phase supports (e.g., Controlled Pore Glass (CPG), polystyrene resin, etc.), nucleoside-linked CPG, amino-modified synthesis initiators, thiol-modified synthesis initiators, biotin-modified synthesis initiators, and polyethylene glycol (PEG) spacer-attached initiators. These synthesis initiators function as a starting point for reaction with the trinucleotide mixture, and can be cleaved after synthesis under appropriate conditions (e.g., acid treatment, base treatment, reducing conditions, light irradiation, etc.) to release the target nucleotide chain from the support. These synthesis initiators may be used, particularly when performing solid-phase synthesis using the phosphoramidite method described below.

[0030] More specifically, the universal support is Universal Support III. ＴＭ , Q-Linker CPG, Glycerol-CPG, dSpacer CPG, Photocleavable Spacer CPG, UniSupport ＴＭ Commercially available products include: Nucleoside-linked CPGs include dA-CPG, dC-CPG, dG-CPG, dT-CPG, rA-CPG, rC-CPG, rG-CPG, and rU-CPG. Amino-modified synthesis initiators, thiol-modified synthesis initiators, and biotin-modified synthesis initiators are useful for introducing specific functional groups into the synthesized nucleotide chain. PEG-spaced synthesis initiators ensure an appropriate distance between the synthesized nucleotide chain and the solid support, reducing steric hindrance.

[0031] (Trinucleotide mixture (b) and trinucleotide mixture (b')) Trinucleotide mixture (b) contains two or more types of trinucleotides, and trinucleotide mixture (b') contains two or more or three or more types of trinucleotides at a predetermined molar ratio.

[0032] The types of trinucleotides contained in the trinucleotide mixtures (b) and (b') are S ｉｊ The molar ratio may be set based on the type of trinucleotide used when calculating the compounding ratio (molar ratio). The types of trinucleotides contained in trinucleotide mixtures (b) and (b') may be set based on, for example, the type of trinucleotides used in producing the library described below. While not limited thereto, the types of trinucleotides contained in trinucleotide mixture (b) may be, for example, 2 to 64 types, 3 to 47 types, 10 to 64 types, 21 to 50 types, or 21 to 47 types. Furthermore, trinucleotide mixture (b) may contain trinucleotides having a TAG or ATG base sequence from the 5' end to the 3' end. The types of trinucleotides contained in trinucleotide mixture (b') may be, for example, 3 to 64 types, 3 to 50 types, 3 to 47 types, 10 to 64 types, 21 to 50 types, or 21 to 47 types.

[0033] There is no particular limitation on the molar ratio of each trinucleotide contained in the trinucleotide mixtures (b) and (b'). ｉｊ From the viewpoint of obtaining more data for calculating １ It is preferable that the molar ratio of the other types of trinucleotides to the trinucleotides is 1.0 or more and 2.0 or less, and may be, for example, 1.0 or more and 1.2 or less, or 1.0 or more and 1.1 or less, but it is more preferable that the molar ratios of the various trinucleotides are equal.

[0034] Trinucleotide mixture (b) and trinucleotide mixture (b') may be the same mixture or different mixtures. The term "the same mixture" means that the types of trinucleotides contained in the mixture and the molar ratios of each trinucleotide are the same.

[0035] (Step (1)) In the calculation method according to this embodiment, step (1) is a step of obtaining multiple types of nucleotide chains (A), which includes reacting multiple polynucleotides (a) with a trinucleotide mixture (b) containing two or more types of trinucleotides at a predetermined molar ratio, and extending the polynucleotides contained in (a) with any one of the trinucleotides contained in the trinucleotide mixture (b).

[0036] A plurality of polynucleotides (a) are prepared, thereby obtaining a plurality of types of nucleotide chains (A) extended with various trinucleotides.

[0037] The polynucleotides (a) may be supported at one end on a carrier. The carrier may be a solid-phase carrier, or may be a bead-shaped solid-phase carrier. Examples of the carrier include magnetic beads, high molecular weight polymer beads, and glass beads, and preferably CPG (Controlled Pore Glass).

[0038] When the trinucleotide has a protecting group, a deprotection reaction may be carried out after completion of the elongation reaction in step (1).

[0039] (Step (1')) Step (1') is a step of preparing one or more synthesis initiators. Specific examples of the synthesis initiator include those described above.

[0040] (Step (2)) Step (2) is a step of extending the multiple types of nucleotide chains (A) to a predetermined chain length, which comprises further reacting the multiple types of nucleotide chains (A) obtained in step (1) with the trinucleotide mixture (b') and repeating this operation once or twice or more times to further extend the chain length of the multiple types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b').

[0041] In step (2), the number of repetitions of the operation of further extending the chain length with trinucleotides may be any number, as long as it is repeated until the chain length reaches a predetermined length. While not limited thereto, the number of repetitions of the operation of further extending the chain length with trinucleotides in step (2) may be, for example, 1 to 30, 3 to 25, 5 to 20, 6 to 15, or 7 to 10. Furthermore, the number of bases in the region extended in trinucleotide units using the trinucleotide mixture (b') may be 9 to 99, 12 to 75, 18 to 60, 21 to 45, 21 to 30, or 21, 24, 27, or 30.

[0042] The method may further include a step in step (2), or after step (2) and before step (3), of reacting a specific nucleotide (c) with the multiple types of nucleotide chains (A) to further extend the chain length of the multiple types of nucleotide chains (A).

[0043] That is, nucleotide (c) may be reacted during the repetition of the operation of further extending the chain length with a trinucleotide in step (2), or nucleotide (c) may be reacted after the extension in trinucleotide units in step (2) is completed.

[0044] When the nucleotide chain (A) is extended from the 3'-end to the 5'-end, a specific example of the nucleotide (c) is a nucleotide whose three-residue base sequence at the 3'-end is ATG (corresponding to the start codon) (note that the nucleotide (c) may further include a base sequence on the 5'-end of A, or may be a trinucleotide having the ATG base sequence). The nucleotide (c) may be reacted, for example, after the extension in trinucleotide units in step (2) is completed, or may be reacted at the end of the repeated operation of further extending the chain length with trinucleotides in step (2).

[0045] The number of bases to be extended with the specific nucleotide (c) may be, for example, 1 to 100, 1 to 50, 5 to 30, or 10 to 20.

[0046] The specific nucleotide (c) may be, for example, a primer binding sequence when preparing an mRNA library from the nucleotide chain (A), or a primer binding sequence when analyzing the base sequence of the nucleotide chain (A).

[0047] The specific nucleotide (c) may be extended in mononucleotide units so as to have a predetermined base sequence and number of bases.

[0048] The number of bases in the nucleotide chains contained in the obtained multiple types of nucleotide chains (A) may be, for example, 20 to 300, 20 to 200, 40 to 100, or 40 to 90.

[0049] The number of types of nucleotide chains contained in the obtained multiple types of nucleotide chains (A) is, for example, 1 × 10 １０ or more, and may be 1×10 １１ or more, and may be 1×10 １２ It may be more than that.

[0050] When the trinucleotide has a protecting group, a deprotection reaction may be carried out after each trinucleotide elongation, and / or after completion of repeated elongation reactions in trinucleotide units, and / or after completion of the elongation reaction of the nucleotide chain (A).

[0051] The extension reactions in steps (1) and (2) may extend the nucleotide chains contained in the polynucleotide (a) and the nucleotide chain (A) from the 5' end to the 3' end, or from the 3' end to the 5' end. The nucleotide chain (A) may be synthesized by solid phase synthesis or liquid phase synthesis.

[0052] The extension reactions in steps (1) and (2), i.e., the synthesis of the nucleotide chain (A), may be carried out by, for example, the phosphoramidite method. Note that, for the extension reaction of nucleic acids including DNA, a method commonly used in the art can be appropriately selected and used.

[0053] (Step (2')) Step (2') is a step of elongating the nucleotide chain (A') to a predetermined chain length, comprising reacting a trinucleotide mixture (b') containing two or more types of trinucleotides at a predetermined molar ratio with the one or more types of synthesis initiator, and repeating the procedure of elongating the chain length of the nucleotide chain (A') with any one trinucleotide contained in the trinucleotide mixture (b') once or twice or more times. Specific aspects of the nucleotide chain (A') may be the same as those of the nucleotide chain (A). Step (2') can be carried out in the same manner as step (2), except that trinucleotides are added to and / or elongated from the synthesis initiator.

[0054] (Step (3)) In step (3), in the region of the plurality of types of nucleotide chains (A) obtained in step (2) that has been extended in trinucleotide units using the trinucleotide mixture (b) and / or the trinucleotide mixture (b'), trinucleotide T ｉ Trinucleotide T ｊ This is a step of measuring the ratio of the two linked proteins.

[0055] Step (3) can be carried out, for example, by decoding the base sequence of a region extended in trinucleotide units using the trinucleotide mixture (b) and / or the trinucleotide mixture (b') in the plurality of types of nucleotide chains (A). ｉ Trinucleotide T ｊ The number of linked nucleotides, and the trinucleotide T ｉ Trinucleotide T ｊ The number of trinucleotides other than the trinucleotide T ｉ Trinucleotide T ｊ The ratio of connected

[0056] The measurement in step (3) is preferably carried out by next-generation sequencer (NGS) analysis, since it allows for a very large amount of data to be acquired and facilitates analysis.

[0057] Next-generation sequencer (NGS) analysis may be performed on multiple types of nucleotide chains (A), or, for example, on cDNA obtained by transcribing multiple types of nucleotide chains (A) to obtain multiple types of mRNA and then performing a reverse transcription reaction on the mRNA.Further, next-generation sequencer (NGS) analysis may be performed on cDNA obtained by transcribing multiple types of nucleotide chains (A) to obtain multiple types of mRNA and then performing a reverse transcription reaction on linker-linked mRNA obtained by ligating the mRNA and a linker complex.

[0058] (Step (3')) In step (3'), the trinucleotide T is introduced into the nucleotide chain (A') obtained in step (2') in a region extended in trinucleotide units using the trinucleotide mixture (b'). ｉ Trinucleotide T ｊ Step (3') can be carried out in the same manner as step (3) except that nucleotide chain (A') is used.

[0059] (Step (4)) In step (4), the relative ratio of the reaction rate constants (S ｉｊ ) is calculated.

[0060] S ｉｊ can be calculated, for example, as follows: When the number of types of trinucleotides contained in the trinucleotide mixture (b) and / or trinucleotide mixture (b') is N, and the number of extensions in trinucleotide units is M, the various trinucleotides are expressed as T ｉ (i = integer from 1 to N), S ｉｊ is calculated by the following formula (1). In formula (1), n ​​is an integer of 2 or more and M or less, i and j are each independently an integer of 1 or more and N or less, and D ｉ，ｊ，ｎ，ｎ－１indicates that the trinucleotide at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ and the trinucleotide at the nth position is T i represents the number of molecules of the nucleotide chain (A), and C ｊ，ｎ－１ indicates that the trinucleotide molecule at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ The number of molecules is shown.

[0061] The reactivity (Reaction Factor: RF) obtained by reacting various trinucleotides with four types of mononucleotides known in the past and the trinucleotide T of the present invention were compared. ｉ and trinucleotide T ｊ It has been confirmed that the tendency of the results obtained differs depending on the relative ratio of the reaction rate constants when reacting.

[0062] [S ｉｊ The relative ratio of reaction rate constants (S ｉｊ Based on this, the frequency of appearance of each trinucleotide in the elongated nucleotide chain can be controlled by controlling the molar ratio of each trinucleotide to be mixed in the trinucleotide mixture.

[0063] S ｉｊ Based on the molar ratio (MR ｉ ) can be calculated, for example, from the following formulas (2) to (8). The method of calculation from formulas (2) to (8) takes the case where a nucleotide chain is extended from the 3' end to the 5' end as an example. When a nucleotide chain is extended from the 5' end to the 3' end, the method can be carried out by replacing "5' end" with "3' end" and "3' end" with "5' end" in the following explanation.

[0064] In formula (2), the number of types of trinucleotides is N, the length of extension by trinucleotides is M, and the trinucleotide is T' ｉ (i = 1...N), and the mixing ratio of various trinucleotides is expressed as MR ｉ And MR ｉThis is an equation in which the sum of (i=1...N) is normalized to 1.

[0065] Formula (3) represents a case where, in the first trinucleotide elongation reaction, one trinucleotide at the 3' end immediately before the first trinucleotide is T' ｘ When the 5'-terminal trinucleotide is immobilized on the nucleotide, the 5'-terminal trinucleotide becomes T' after the reaction. ｉ The proportion C ｉ，１ and

[0066] Formula (4) shows that the immediately preceding 3'-terminal trinucleotide is of two types, T' ｘ , T' ｙ and the respective ratios are R ｘ , R ｙ (R ｘ +R ｙ = 1) ｉ，１ and

[0067] Equation (5) is the C of equation (4) ｉ，１ The value of F is normalized ｉ，１ and

[0068] Similarly, formula (6) indicates that after the jth (j=2...M) extension reaction, the trinucleotide at the 5' end is T' ｉ The proportion C ｉ，ｊ and

[0069] Equation (7) is the C of equation (5) ｉ，ｊ The value of F is similarly normalized. ｉ，ｊ and

[0070] F ｉ，ｊ is the 5' end of the trinucleotide T' after the jth reaction. ｉ and satisfies equation (8). Here, w ｉ (i=an integer from 1 to N) is a coefficient for adjusting the frequency of occurrence of various trinucleotides, and constant is a constant.

[0071] When controlling for equal representation of each trinucleotide, w ｉ The values ​​of w are all set to 1. When changing the frequency of an arbitrary trinucleotide,ｉ The value of is set to a value other than 1. For example, the w corresponding to the trinucleotide whose occurrence frequency is to be set to 1 / x is ｉ The value of is x (x is an arbitrary number).

[0072] Although simultaneous equations that simultaneously satisfy formula (2), formula (4), formula (5), formula (6), formula (7), and formula (8), or simultaneous equations that simultaneously satisfy formula (3), formula (4), formula (5), formula (6), formula (7), and formula (8) cannot be analytically solved, they can be calculated by a numerical solution method such as the Newton-Raphson method or the modified Powell method. ｉ，ｊ , F ｉ，ｊ , constant and MR ｉ A numerical solution can be obtained by providing an appropriate initial value for each trinucleotide, and the molar ratio MR ｉ The calculation method is not limited as long as it allows a person skilled in the art to obtain a numerical solution.

[0073] The calculation by the Newton-Raphson method can be performed using, for example, the mathematical processing system Mathematica ver. 12 (Wolfram Research). The initial values ​​are, for example, constant, C ｉ，ｊ and F ｉ，ｊ All elements of are set to 1, and MR ｉ can be a value when the reaction rate between each trinucleotide is constant.

[0074] (Step (4')) In step (4'), the relative ratio of the reaction rate constants (S ｉｊ Step (4') can be carried out in the same manner as step (4), except that the ratio measured in step (3') is used.

[0075] [Method for Producing a Nucleic Acid Library] The method for producing a nucleic acid library according to this embodiment includes the following steps: Step (I): For a plurality of polynucleotides (a-2), two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) used in the calculation method are used to calculate the S of each of the two or more types of trinucleotides, as calculated by the calculation method described above. ｉｊa trinucleotide mixture (b-2) containing the polynucleotides in (a-2) in a molar ratio calculated based on the above, and extending the polynucleotides in (a-2) with any one of the trinucleotides in the trinucleotide mixture (b-2), thereby obtaining multiple types of nucleotide chains (A-2); Step (II): Adding two or more types of trinucleotides selected from the trinucleotides in the trinucleotide mixture (b') used in the above calculation method to the multiple types of nucleotide chains (A-2) obtained in step (I), each of which has a molar ratio calculated by the above calculation method. ｉｊ and repeating the operation of further extending the chain length of the plurality of types of nucleotide chains (A-2) with any one trinucleotide contained in the trinucleotide mixture (b-2') once or twice or more times.

[0076] [Method for Producing Nucleotide Chain] The method for producing a nucleotide chain according to this embodiment comprises the following steps: (II') For one or more types of synthesis initiators or polynucleotides (a-2), two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) or trinucleotide mixture (b') used in the calculation method or calculation method 2 are used to calculate the S ｉｊ and repeating the procedure of reacting a synthesis initiator or polynucleotide (a-2) with any one trinucleotide contained in the trinucleotide mixture (b'-2) in a molar ratio calculated based on the above formula (1), once or twice or more times, to extend the nucleotide chain (A'-2) to a predetermined chain length.

[0077] The method for producing a nucleic acid library and the method for producing a nucleotide chain according to this embodiment are ｉｊSince the extension reaction is carried out using trinucleotide mixture (b-2) and trinucleotide mixture (b-2') containing each trinucleotide at a blending ratio (molar ratio) calculated based on the formula (a), it is possible to obtain nucleotide chains (A-2) and (A'-2) having each trinucleotide at a desired frequency of occurrence. That is, the method for producing a nucleic acid library and the method for producing a nucleotide chain according to this embodiment can control the frequency of occurrence of each trinucleotide contained in the region of the nucleotide chain (A-2) and the nucleotide chain (A'-2) to be elongated in trinucleotide units to a predetermined value, and can also control the molar ratio of each trinucleotide in all trinucleotides contained in the region of the nucleotide chain (A-2) and the nucleotide chain (A'-2) to be elongated in trinucleotide units to a predetermined value.

[0078] The frequency or molar ratio of occurrence can be controlled by controlling the occurrence of a certain type of trinucleotide T' contained in the region extended by a trinucleotide unit using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2') in the nucleotide chain (A-2) and / or the nucleotide chain (A'-2). １ The ratio of the frequency of occurrence of other types of trinucleotides to that of other types of trinucleotides may be adjusted to 1:1 or higher or lower than 1:1. The control of the frequency of occurrence or molar ratio may be, for example, by adjusting the ratio of the frequency of occurrence of a certain type of trinucleotide T' contained in a region extended by a trinucleotide unit using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2') in the nucleotide chain (A-2) and / or the nucleotide chain (A'-2). １The ratio of the frequency of occurrence of other types of trinucleotides to the frequency of occurrence of specific codons may be adjusted to between 1:10 and 10:1, between 1:5 and 5:1, between 1:3 and 3:1, between 1:2 and 2:1, between 1:1.5 and 1.5:1, or between 1:1.2 and 1.2:1. Furthermore, the method for producing a nucleic acid library and the method for producing a nucleotide chain according to this embodiment may include adjusting the frequency of occurrence of trinucleotides having a base sequence corresponding to a specific codon (hereinafter also simply referred to as a "specific codon") to be lower than the frequency of occurrence of trinucleotides having a base sequence corresponding to other predetermined codons (hereinafter also simply referred to as a "predetermined codon"). More preferably, the method may include adjusting the ratio of the frequency of occurrence of a specific codon to the frequency of predetermined codons other than the specific codon to be 1 / 3 or less. In this case, the specific codon may be, for example, a codon corresponding to an aromatic amino acid (e.g., phenylalanine, tryptophan, histidine, tyrosine).

[0079] (Polynucleotide (a-2)) Polynucleotide (a-2) is a molecule in which two or more monomers selected from deoxyribonucleotides and deoxyribonucleotide derivatives having unnatural bases are linked via phosphodiester bonds. A nucleotide chain (A-2) is synthesized by linking any one trinucleotide contained in trinucleotide mixture (b-2) to the 5'-end or 3'-end of polynucleotide (a-2) and extending the polynucleotide (a-2). Similarly, a nucleotide chain (A'-2) is synthesized by linking any one trinucleotide contained in trinucleotide mixture (b'-2) to the 5'-end or 3'-end of polynucleotide (a-2) and extending the polynucleotide (a-2).

[0080] The number of bases in the polynucleotide (a-2) is not particularly limited, and may be, for example, 2 to 50. The number of bases in the polynucleotide (a-2) may be, for example, 3 to 40, 4 to 35, 5 to 30, 10 to 25, or 20 to 30.

[0081] The base sequence of polynucleotide (a-2) is not particularly limited and may be any base sequence. For example, when polynucleotide (a-2) is extended from the 3'-end to the 5'-end, the base sequence of polynucleotide (a-2) from the 5'-end may be TAG or ATG (which may further include any base sequence at the 3'-end of the base sequence), but is not limited thereto.

[0082] The polynucleotide (a-2) used in step (I) may be of a single type (i.e., only molecules having the same base sequence and number of bases) or of multiple types (i.e., a combination of two or more molecules having different base sequences and / or different numbers of bases), but is preferably of a single type. This makes it easy to adjust the blending ratio (molar ratio) of various trinucleotides in the trinucleotide mixture (b-2), and since all nucleic acids contained in the nucleic acid library have a common base sequence corresponding to the polynucleotide (a-2), it can be used as a site to which a universal primer is bound, etc.

[0083] (Trinucleotide mixture (b-2) and trinucleotide mixture (b-2')) Trinucleotide mixture (b-2) and trinucleotide mixture (b-2') are mixtures of two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) used in the calculation method described above, each of which has a S calculated by the calculation method described above. ｉｊ The content is calculated based on the compounding ratio (molar ratio).

[0084] In addition, when the trinucleotide mixture (b) contains N types of trinucleotides, the S calculated from ｉｊ can be used not only to calculate the compounding ratio (molar ratio) in the trinucleotide mixture (b-2) or (b-2') containing the N types of trinucleotides, but also to calculate the compounding ratio (molar ratio) in the trinucleotide mixture (b-2) or (b-2') containing 2 to N-1 types of trinucleotides selected from the N types. This is because the reactions between individual trinucleotides are considered to be independent and do not affect other reactions. The method for calculating the compounding ratio (molar ratio) is as described above.

[0085] The types of trinucleotides contained in trinucleotide mixture (b-2) and trinucleotide mixture (b-2') are not particularly limited as long as they are selected from the trinucleotides contained in trinucleotide mixture (b) used in the calculation method above, and may be, for example, 2 to 64 types, 10 to 64 types, 2 to 40 types, 2 to 30 types, 5 to 40 types, 5 to 35 types, 5 to 30 types, 10 to 35 types, or 10 to 30 types. In addition, trinucleotide mixture (b-2') may contain trinucleotides having a base sequence of TAG or ATG from the 5' end to the 3' end.

[0086] The molar ratio of each trinucleotide contained in the trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') is set according to the expected occurrence frequency of each trinucleotide (S ｉｊ There is no particular limitation, but for example, a certain type of trinucleotide T' １ The molar ratio of other types of trinucleotides to the trinucleotides may be 1 or more and 10 or less, 1 or more and 9 or less, 1 or more and 8 or less, 1 or more and 7 or less, 1 or more and 6 or less, 1 or more and 5 or less, 1 or more and 4 or less, 1 or more and 3 or less, 1 or more and 2 or less, 1 or more and 1.5 or less, or 1 or more and 1.2 or less.

[0087] The trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') may be the same mixture or different mixtures. The term "the same mixture" means that the types of trinucleotides contained in the mixture and the molar ratios of each trinucleotide are the same.

[0088] The trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') may be, for example, S ｉｊThe mixture can be prepared by dissolving each trinucleotide in a solvent (e.g., acetonitrile) at a blending ratio (molar ratio) calculated based on the above formula.

[0089] (Step (I)) In step (I), two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) used in the calculation method are used for a plurality of polynucleotides (a-2), and the S calculated by the calculation method is ｉｊ and elongating the polynucleotides contained in (a-2) with any one of the trinucleotides contained in the trinucleotide mixture (b-2), thereby obtaining multiple types of nucleotide chains (A-2).

[0090] A plurality of polynucleotides (a-2) are prepared, thereby obtaining a plurality of types of nucleotide chains (A-2) extended with various trinucleotides.

[0091] The polynucleotides (a-2) may be supported at one end on a carrier. The carrier may be a solid-phase carrier, or may be a bead-shaped solid-phase carrier. Examples of the carrier include magnetic beads, high molecular weight polymer beads, and glass beads, and preferably CPG (Controlled Pore Glass).

[0092] When the trinucleotide has a protecting group, a deprotection reaction may be carried out after completion of the elongation reaction in step (I).

[0093] (Step (II)) In step (II), two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the calculation method are added to the plurality of types of nucleotide chains (A-2) obtained in step (I) to obtain the S calculated by the calculation method. ｉｊand repeating the procedure of further extending the chain length of the plurality of types of nucleotide chains (A-2) with any one trinucleotide contained in the trinucleotide mixture (b-2') once or twice or more times.

[0094] In step (II), the number of repetitions of the operation of further extending the chain length with trinucleotides is arbitrary, and may be repeated until the nucleotide chain (A-2) is extended to a predetermined chain length. While not limited thereto, the number of repetitions of the operation of further extending the chain length with trinucleotides in step (II) may be, for example, 1 to 30, 3 to 25, 5 to 20, 6 to 15, or 7 to 10. Furthermore, the number of bases in the region extended in trinucleotide units using trinucleotide mixture (b-2') may be 9 to 99, 12 to 75, 18 to 60, 21 to 45, 21 to 30, or 21, 24, 27, or 30.

[0095] Step (II) may further include an extension reaction using a specific trinucleotide instead of the trinucleotide mixture (b-2'). This results in a specific position of each nucleotide chain contained in the nucleotide chain (A-2) being fixed with the specific trinucleotide, thereby obtaining a nucleic acid library in which codons at specific positions are fixed.

[0096] When an extension reaction using a specific trinucleotide is performed, the reaction may be performed once or multiple times. When the reaction is performed multiple times, the specific trinucleotide may be the same or different.

[0097] In step (II) or after step (II), the method may further include a step of reacting a specific nucleotide (c-2) with the multiple types of nucleotide chains (A-2) to further extend the chain length of the multiple types of nucleotide chains (A-2).

[0098] That is, the nucleotide (c-2) may be reacted during the repetition of the operation of further extending the chain length with a trinucleotide in step (II), or the nucleotide (c-2) may be reacted after the extension in trinucleotide units in step (II) is completed.

[0099] When the nucleotide chain (A-2) is extended from the 3'-end to the 5'-end, a specific example of the nucleotide (c-2) is a nucleotide whose three-residue base sequence at the 3'-end is ATG (corresponding to the start codon) (note that the nucleotide may further include a base sequence on the 5'-end of A, or may be a trinucleotide having the ATG base sequence). This allows an start codon to be positioned adjacent to the region extended in trinucleotide units, making it possible to translate the region adjacent to the start codon into a polypeptide. The nucleotide (c-2) may be reacted, for example, after the extension in trinucleotide units has been completed in step (II), or may be reacted at the end of the repeated operation of further extending the chain length in step (II).

[0100] The number of bases to be extended with the specific nucleotide (c-2) may be, for example, 1 to 100, 1 to 50, 5 to 30, or 10 to 20.

[0101] The specific nucleotide (c-2) may be, for example, a primer binding sequence when preparing an mRNA library or a library containing mRNA-polypeptide complexes from the nucleotide chain (A-2).

[0102] The specific nucleotide (c-2) may be extended in mononucleotide units to achieve a predetermined base sequence and number of bases.

[0103] The number of bases in the nucleotide chains contained in the multiple types of nucleotide chains (A-2) extended to a predetermined chain length may be, for example, 20 to 300, 20 to 200, 40 to 100, or 40 to 90.

[0104] The number of types of nucleotide chains contained in the multiple types of nucleotide chains (A-2) elongated to a predetermined chain length is, for example, 1 × 10 １０ or more, and may be 1×10 １１ or more, and may be 1×10 １２ It may be more than that.

[0105] When the trinucleotide has a protecting group, a deprotection reaction may be carried out after each trinucleotide elongation, and / or after completion of the repeated elongation reaction in trinucleotide units, and / or after completion of the elongation reaction of the nucleotide chain (A-2).

[0106] The extension reactions in steps (I) and (II) may extend the nucleotide chains contained in the polynucleotide (a-2) and the nucleotide chain (A-2) from the 5' end to the 3' end, or from the 3' end to the 5' end. The nucleotide chain (A-2) may be synthesized by solid phase synthesis or liquid phase synthesis.

[0107] The extension reaction in step (I) and step (II), i.e., the synthesis of the nucleotide chain (A-2), may be carried out by, for example, the phosphoramidite method. Note that, for the DNA extension reaction, a conventional method in this technical field can be appropriately selected and used.

[0108] In the method for producing a nucleic acid library according to this embodiment, the S calculated by the above-mentioned calculation method is ｉｊSince the extension reaction is carried out using trinucleotide mixture (b-2) and trinucleotide mixture (b-2') containing each trinucleotide at a blending ratio (molar ratio) calculated based on the formula (a), a nucleotide chain (A-2) can be obtained that contains each trinucleotide at a desired frequency of occurrence. Specifically, the frequency of occurrence of each of multiple types of trinucleotides in the region of nucleotide chain (A-2) that is extended in trinucleotide units can be kept within a difference of -11% to +18% from the expected, set frequency of occurrence. In other words, the present invention allows for highly accurate control of the frequency of occurrence.

[0109] (Step (II')) In step (II'), two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the calculation method 2 are used for one or more types of synthesis initiators or polynucleotides (a-2), and the S calculated by the calculation method 2 is used. ｉｊ The trinucleotide mixture (b'-2) is a process for elongating a nucleotide chain (A'-2) to a predetermined chain length, which comprises reacting the polynucleotide (a-2) with a trinucleotide mixture (b'-2) containing the trinucleotide in a molar ratio calculated based on the above, and repeating the procedure of elongating the synthesis initiator or the polynucleotide (a-2) with any one trinucleotide contained in the trinucleotide mixture (b'-2) once or twice or more times. The trinucleotide mixture (b'-2) contains two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) used in the calculation method described above, each of which is calculated by the calculation method described above. ｉｊ The molar ratio may be calculated based on the above formula.

[0110] The specific embodiment of the nucleotide chain (A'-2) is the same as that of the nucleotide chain (A-2).

[0111] Step (II') comprises using a nucleotide chain (A'-2), ｉｊ S calculated by the above-mentioned calculation method 2 ｉｊ A specific embodiment of the trinucleotide mixture (b'-2) can be carried out in the same manner as in step (II), except that the trinucleotide mixture (b'-2) is prepared by using the S calculated by the above-mentioned calculation method 2. ｉｊThe same embodiment as that of the trinucleotide mixture (b-2') can be exemplified, except that the following is used:

[0112] [Method for producing a nucleic acid library containing a random region] The method for producing a nucleic acid library containing a random region according to this embodiment comprises the following steps. Here, the random region contains two or more trinucleotides. Step (i): Two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the calculation method are subjected to S calculation by the calculation method described above. ｉｊ or a step of preparing a trinucleotide mixture (b-2') containing two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the calculation method 2, in a molar ratio calculated based on the S calculated by the calculation method 2. ｉｊ Step (ii): Using the trinucleotide mixture (b-2'), a random region is extended to a predetermined chain length in trinucleotide units.

[0113] The method for producing a nucleic acid library containing a random region according to this embodiment is to calculate the S calculated by the above-mentioned calculation method or calculation method 2. ｉｊSince the extension reaction of the random region is carried out using a trinucleotide mixture (b-2') containing each trinucleotide at a blending ratio (molar ratio) calculated based on the formula (b-2), a random region having each trinucleotide at a desired frequency of occurrence can be generated. Therefore, the method for producing a nucleic acid library containing a random region according to this embodiment can be regarded as a method for standardizing the frequency of codons in a random region, or as a method for controlling the frequency of a specific codon in a random region. Here, "standardizing the frequency of codons" means that the frequency of other codons is 80% to 100%, preferably 85% to 100%, more preferably 90% to 100%, even more preferably 95% to 100%, and particularly preferably 98% to 100%, compared to the most frequently occurring codon. The nucleic acid library produced by the production method according to this embodiment can be, for example, one in which bias in the frequency of occurrence of various amino acids encoded by various codons is suppressed and further controlled so that specific types of amino acids appear at a desired frequency.

[0114] (Trinucleotide mixture (b-2')) Trinucleotide mixture (b-2') is a mixture of two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the calculation method or calculation method 2, each of which is calculated by the calculation method or calculation method 2. ｉｊ The content is calculated based on the compounding ratio (molar ratio).

[0115] In order to unify the appearance ratio of two or more types of trinucleotides selected from the trinucleotide mixture (b'), the trinucleotide mixture (b-2') is calculated by the above calculation method or calculation method 2. ｉｊ Since the trinucleotide mixture (b-2') contains the trinucleotides at a blending ratio (molar ratio) calculated based on the above, it can be suitably used for extending a random region of a nucleic acid library in trinucleotide units. For the above reasons, the trinucleotide mixture (b-2') can also be suitably used for controlling the appearance ratio of each trinucleotide when extending a random region of a nucleic acid library in trinucleotide units.

[0116] In addition, when the trinucleotide mixture (b') contains N types of trinucleotides, S calculated from it ｉｊ can be used not only to calculate the compounding ratio (molar ratio) in a trinucleotide mixture (b-2) containing the N types of trinucleotides, but also to calculate the compounding ratio (molar ratio) in a trinucleotide mixture (b-2) containing 2 to N-1 types of trinucleotides selected from the N types of trinucleotides. This is because the reactions between individual trinucleotides are considered to be independent and do not affect other reactions. The method for calculating the compounding ratio (molar ratio) is as described above.

[0117] The types of trinucleotides contained in trinucleotide mixture (b-2') are not particularly limited, as long as they are selected from the trinucleotides contained in trinucleotide mixture (b') used in the calculation method described above, and may be, for example, 2 to 64 types, 10 to 64 types, 2 to 40 types, 2 to 30 types, 5 to 40 types, 5 to 35 types, 5 to 30 types, 10 to 35 types, or 10 to 30 types.

[0118] The molar ratio of each trinucleotide contained in the trinucleotide mixture (b-2′) is set according to the expected occurrence frequency of each trinucleotide (S ｉｊ There is no particular limitation, but for example, a certain type of trinucleotide T' １ The molar ratio of other types of trinucleotides to the trinucleotides may be 1 or more and 10 or less, 1 or more and 9 or less, 1 or more and 8 or less, 1 or more and 7 or less, 1 or more and 6 or less, 1 or more and 5 or less, 1 or more and 4 or less, 1 or more and 3 or less, 1 or more and 2 or less, 1 or more and 1.5 or less, or 1 or more and 1.2 or less.

[0119] (Step (i)) In step (i), two or more trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b') used in the above calculation method or calculation method 2 are used, and the S calculated by the above calculation method or calculation method 2 is used. ｉｊ This is a step of preparing a trinucleotide mixture (b-2') containing the trinucleotides in a molar ratio calculated based on the above.

[0120] The trinucleotide mixture (b-2') may be, for example, S ｉｊ The mixture can be prepared by dissolving each trinucleotide in a solvent (e.g., acetonitrile) at a blending ratio (molar ratio) calculated based on the above formula.

[0121] (Step (ii)) Step (ii) is a step of extending the random region to a predetermined chain length in trinucleotide units using the trinucleotide mixture (b-2').

[0122] Step (ii) can also be said to be a step of extending the random region to a predetermined chain length, which includes repeating the operation of extending the random region with any one trinucleotide contained in the trinucleotide mixture (b-2') once or twice or more times.

[0123] In step (ii), the number of repetitions of the operation of extending the random region with any one trinucleotide is arbitrary, and may be repeated until the random region is extended to a predetermined chain length. While not limited thereto, the number of repetitions of the operation of extending the random region with any one trinucleotide in step (ii) may be, for example, 1 to 30, 3 to 25, 5 to 20, 6 to 15, or 7 to 10. Furthermore, the number of bases in the region extended in trinucleotide units using trinucleotide mixture (b-2') may be 9 to 99, 12 to 75, 18 to 60, 21 to 45, 21 to 30, or 21, 24, 27, or 30.

[0124] Step (ii) may further include an extension reaction using a specific trinucleotide instead of the trinucleotide mixture (b-2'), so that each nucleotide strand contained in the nucleic acid library has a random region fixed at a specific position by a specific trinucleotide.

[0125] In step (ii) or after step (ii), the method may further include a step of reacting a specific nucleotide (c-2) with the random region to further extend the chain length of the random region and / or the chain length of a region other than the random region, for example, a region having a predetermined specific sequence.

[0126] That is, the nucleotide (c-2) may be reacted during the operation of extending the random region in trinucleotide units in step (ii), or the nucleotide (c-2) may be reacted after the extension of the random region in trinucleotide units in step (ii) is completed.

[0127] The number of bases to be extended with the specific nucleotide (c-2) may be, for example, 1 to 100, 1 to 50, 5 to 30, or 10 to 20.

[0128] The specific nucleotide (c-2) may be, for example, a primer binding sequence when preparing an mRNA library or a library containing mRNA-polypeptide complexes from a nucleic acid library containing a random region.

[0129] The specific nucleotide (c-2) may be extended in mononucleotide units to achieve a predetermined base sequence and number of bases.

[0130] When the trinucleotide has a protecting group, a deprotection reaction may be carried out after each trinucleotide elongation, and / or after completion of repeated elongation reactions in trinucleotide units, and / or after completion of all elongation reactions.

[0131] The extension reaction in step (ii) may extend the nucleotide chain from the 5' end to the 3' end, or from the 3' end to the 5' end. The nucleotide chain contained in the nucleic acid library may be synthesized by solid phase synthesis or liquid phase synthesis.

[0132] The extension reaction in step (ii) may be carried out by, for example, the phosphoramidite method. Note that, for the extension reaction of nucleic acids including DNA, a method commonly used in the art can be appropriately selected and used.

[0133] The nucleic acid library obtained by the method for producing a nucleic acid library containing a random region according to this embodiment may further contain a constant region in addition to the random region. The constant region is a region that is shared by all nucleotide chains contained in the nucleic acid library and has the same base sequence.

[0134] The constant region can be formed by reacting a single type of polypeptide (i.e., only molecules having the same base sequence and number of bases) with a trinucleotide mixture (b-2'), and repeating the procedure of extending the polypeptide with any one trinucleotide contained in the trinucleotide mixture (b-2') once or twice or more times to extend the random region to a predetermined chain length. In this case, one end of the single type of polypeptide may be supported on a carrier. The carrier may be a solid-phase carrier, or may be a bead-shaped solid-phase carrier. Examples of carriers include magnetic beads, high molecular weight polymer beads, and glass beads, with CPG (Controlled Pore Glass) being preferred.

[0135] The constant region can also be formed by repeating the extension reaction using a specific trinucleotide instead of the trinucleotide mixture (b-2') a predetermined number of times in step (ii). The constant region may also be a region other than the random region, for example, a region having a predetermined specific sequence, or may be formed by the specific nucleotide (c-2) as described above.

[0136] When the nucleic acid library obtained by the method for producing a nucleic acid library containing a random region according to this embodiment contains a random region and a constant region, each nucleotide chain contained in the nucleic acid library may be, for example, such that a part of a predetermined polypeptide and / or a part or all of a primer is encoded in the constant region, and a part or all of a polypeptide is encoded in the random region.

[0137] The method for producing a nucleic acid library containing a random region according to this embodiment is to calculate the S calculated by the above-mentioned calculation method or calculation method 2. ｉｊ Since the extension reaction is carried out using a trinucleotide mixture (b-2') containing each trinucleotide at a blending ratio (molar ratio) calculated based on the formula (b-2'), it is possible to obtain a nucleic acid library containing a random region having each trinucleotide at a desired frequency. Specifically, the frequency of occurrence of each of the plurality of trinucleotides in the random region can be set to within a difference of −11% to +18% from the expected, set frequency of occurrence.

[0138] From the above viewpoint, the method for producing a nucleic acid library containing a random region according to this embodiment may include, for example, controlling the molar ratio of each type of trinucleotide among all trinucleotides contained in the random region to a predetermined value.

[0139] Similarly, from the above perspective, the method for producing a nucleic acid library containing a random region according to this embodiment may include, for example, controlling the frequency of occurrence of a trinucleotide having a base sequence corresponding to a specific codon (hereinafter also simply referred to as a "specific codon") in the random region to a predetermined value. Specifically, for example, the ratio of the frequency of occurrence of the specific codon to the frequency of other specific codons may be adjusted to 1:1, or higher or lower than 1:1. The ratio of the frequency of occurrence of the specific codon to the frequency of other specific codons may be adjusted to between 1:10 and 10:1, between 1:5 and 5:1, between 1:3 and 3:1, between 1:2 and 2:1, between 1:1.5 and 1.5:1, or between 1:1.2 and 1.2:1. The method for producing a nucleic acid library containing a random region according to this embodiment may preferably include adjusting the frequency of a specific codon to be lower than the frequency of other predetermined codons, and more preferably may include adjusting the ratio of the frequency of the specific codon to the frequency of other predetermined codons to 1 / 3 or less. In this case, the specific codon may be, for example, a codon corresponding to an aromatic amino acid (e.g., phenylalanine, tryptophan, histidine, or tyrosine).

[0140] [Method for Producing an mRNA Library] The nucleic acid library described above can be used to produce, for example, an mRNA library, a linker-ligated mRNA library, and a library containing an mRNA-polypeptide complex.

[0141] The method for producing a library of multiple types of mRNA according to this embodiment includes the following steps: Step (A): A step of transcribing multiple types of nucleotide chains (A) obtained by the calculation method described above, multiple types of nucleotide chains (A') obtained by calculation method 2 described above, multiple types of nucleotide chains (A-2) obtained by the method for producing a nucleic acid library described above, or multiple types of nucleotide chains (A'-2) obtained by method for producing a nucleic acid library 2 described above to obtain a library containing multiple types of mRNA.

[0142] The method for producing a library of multiple types of linker-linked mRNA according to this embodiment includes the following steps: Step (A): obtaining multiple types of mRNA by transcribing multiple types of nucleotide chains (A) obtained by the calculation method described above, multiple types of nucleotide chains (A') obtained by calculation method 2 described above, multiple types of nucleotide chains (A-2) obtained by the method for producing a nucleic acid library described above, or multiple types of nucleotide chains (A'-2) obtained by method for producing a nucleic acid library 2 described above; and Step (B): obtaining a library containing linker-linked mRNA by ligating the multiple types of mRNA with a linker complex.

[0143] The method for producing a library containing multiple types of mRNA-polypeptide complexes according to this embodiment includes the following steps: Step (A): obtaining multiple types of messenger RNAs (mRNAs) by transcribing multiple types of nucleotide chains (A) obtained by the calculation method described above, multiple types of nucleotide chains (A') obtained by the calculation method 2 described above, multiple types of nucleotide chains (A-2) obtained by the method for producing a nucleic acid library described above, or multiple types of nucleotide chains (A'-2) obtained by the method for producing a nucleic acid library 2 described above; Step (B): obtaining a library containing linker-linked mRNAs by ligating the multiple types of mRNAs with a linker complex; Step (C): obtaining mRNA-polypeptide complexes in which multiple types of polypeptides obtained by translating the multiple types of mRNAs respectively and mRNAs encoding each polypeptide are linked via linkers.

[0144] Step (a) is a step of transcribing multiple types of nucleotide chains (A), multiple types of nucleotide chains (A'), multiple types of nucleotide chains (A-2), or multiple types of nucleotide chains (A'-2) to obtain multiple types of mRNA. Step (a) may include, for example, a step of hybridizing multiple types of nucleotide chains (A) or nucleotide chains (A') further extended with a specific nucleotide (c) with a nucleotide complementary to the specific nucleotide (c), and then synthesizing a complementary strand using a DNA polymerase to synthesize multiple types of double-stranded DNAs, and a step of synthesizing multiple types of mRNAs using an in vitro transcription system with the multiple types of double-stranded DNAs synthesized in the step as templates. Step (a) may also include, for example, a step of hybridizing multiple types of nucleotide chains (A-2) or nucleotide chains (A'-2) further elongated with a specific nucleotide (c-2) with a nucleotide complementary to the specific nucleotide (c-2), followed by synthesizing complementary strands using a DNA polymerase to synthesize multiple types of double-stranded DNAs, and a step of synthesizing multiple types of mRNAs using an in vitro transcription system with the multiple types of double-stranded DNAs synthesized in the step as templates. A commercially available in vitro transcription system may be used.

[0145] Step (b) is a step of ligating the multiple types of mRNA obtained in step (a) with a linker complex to obtain a library containing linker-linked mRNA. Examples of linker complexes include complexes in which a compound that is incorporated into peptides during translation by ribosomes, such as puromycin and its derivatives, is bound to a linker formed of RNA, DNA, a polymer of hexaethylene glycol (spc18) (e.g., a five-polymer), or the like. As the linker complex, a puromycin-linker complex is preferred because it facilitates the production of mRNA-polypeptide complexes.

[0146] Step (c) is a step of obtaining an mRNA-polypeptide complex in which multiple types of polypeptides obtained by translating multiple types of mRNAs are linked to mRNA encoding each polypeptide via a linker. For example, when mRNA linked with a puromycin-linker complex (linker-linked mRNA) is translated in a cell-free translation system, the mRNA is translated and the mRNA and the peptide encoded thereby are linked via puromycin. Methods utilizing the nonspecific binding of the antibiotic puromycin, an aminoacyl-tRNA analog, to proteins during mRNA translation elongation by ribosomes have been reported as mRNA display (Proc Natl Acad Sci USA. 1997;94:12297-302. RNA-peptide fusions for the in vitro selection of peptides and proteins. Roberts RW, Szostak JW.) or in vitro virus (FEBS Lett. 1997;414:405-8. In vitro virus: bonding of mRNA bearing puromycin at the 3'-terminal end to the C-terminal end of its encoded protein on the ribosome in vitro. Nemoto N, Miyamoto-Sato E, Husimi Y, Yanagawa H.).

[0147] The mRNA library and the library containing mRNA-polypeptide complexes according to this embodiment are produced from multiple types of nucleotide chains (A) obtained by the calculation method described above, multiple types of nucleotide chains (A') obtained by the calculation method 2 described above, multiple types of nucleotide chains (A-2) obtained by the method for producing a nucleic acid library described above, or multiple types of nucleotide chains (A'-2) obtained by the method for producing a nucleic acid library 2 described above. Therefore, the frequency of appearance of codons is controlled, and the library can be, for example, a library with excellent diversity.

[0148] Furthermore, the frequency of occurrence of various trinucleotides contained in the region extended in trinucleotide units may be analyzed by next-generation sequencer (NGS) analysis of cDNA obtained by reverse transcription of the mRNA library according to this embodiment.

[0149] [Method for screening for polypeptides that bind to a target substance, and method for producing the polypeptide] The library containing the above-mentioned mRNA-polypeptide complexes is useful as a display library because of its excellent polypeptide diversity. Therefore, it can be used, for example, in screening for polypeptides that bind to a target substance, and in methods for producing polypeptides selected by the screening method.

[0150] The method for screening for polypeptides that bind to a target substance according to this embodiment comprises the following steps: Step (a): contacting a target substance with mRNA-polypeptide complexes obtained by the above-described method for producing a library containing multiple types of mRNA-polypeptide complexes, or a library containing the complexes; and Step (b): selecting the complexes that bind to the target substance.

[0151] The method for producing a polypeptide according to this embodiment comprises the following steps: Step (a): contacting a target substance with an mRNA-polypeptide complex obtained by the above-described method for producing a library containing multiple types of mRNA-polypeptide complexes, or with a library containing the complex; Step (b): selecting the complex that binds to the target substance; Step (c): recovering the mRNA contained in the complex selected in step (b); and Step (d): preparing cDNA from the recovered mRNA and synthesizing a polypeptide from the cDNA.

[0152] Furthermore, the method for producing a polypeptide according to this embodiment may include the following steps: Step (a): contacting a target substance with an mRNA-polypeptide complex obtained by the above-described method for producing a library containing multiple types of mRNA-polypeptide complexes, or with a library containing the complex; Step (b): selecting the complex that binds to the target substance; Step (c'): determining the amino acid sequence of the polypeptide contained in the complex selected in step (b); and Step (d'): synthesizing a polypeptide based on the amino acid sequence determined in step (c').

[0153] Step (a) is a step of contacting a target substance with mRNA-polypeptide complexes obtained by the above-mentioned method for producing a library containing multiple types of mRNA-polypeptide complexes, or with a library containing the complexes.

[0154] In step (a), the target substance or the mRNA-polypeptide complex may be immobilized on a solid support. The shape of the solid support is not particularly limited, and may be, for example, a bead, a plate, a chip, or the like.

[0155] Step (a) may include a step of mixing multiple types of mRNA-polypeptide complexes with a target substance.

[0156] A specific example of step (a) is a method in which a library containing multiple types of mRNA-polypeptide complexes is added to a liquid containing a target substance, mixed, and then incubated. The conditions for contacting the target substance with the library containing multiple types of mRNA-polypeptide complexes (e.g., incubation time and incubation temperature) can be appropriately selected depending on the type of target substance, the type of library containing multiple types of mRNA-polypeptide complexes, etc.

[0157] Step (b) is a step of selecting the complex that binds to the target substance.

[0158] Step (b) can be carried out by removing mRNA-polypeptide complexes that did not bind to the target substance in step (a) and / or recovering mRNA-polypeptide complexes that bound to the target substance in step (a), etc. For example, when the target substance is immobilized on a solid phase carrier and multiple types of mRNA-polypeptide complexes are mixed with the target substance, the solid phase carrier is recovered after step (a), and the mRNA-polypeptide complexes that did not bind to the target substance are removed by washing the solid phase carrier as needed, thereby recovering the mRNA-polypeptide complexes that bound to the target substance.

[0159] Step (c) is a step of recovering the mRNA contained in the complex selected in step (b).

[0160] The recovery of mRNA can be carried out, for example, by cleaving the bond between the mRNA and the polypeptide in the mRNA-polypeptide complex. The cleavage of the bond can be carried out, for example, by one or more methods selected from the group consisting of a method using an enzyme, a method using light, and a method using heat. The cleavage of the bond is preferably carried out by a method using an enzyme.

[0161] Cleavage of a bond using an enzyme can be achieved, for example, by incorporating a substrate that is specifically recognized and cleaved by an enzyme into the bond between the mRNA and the polypeptide. The bond is cleaved by allowing the enzyme to act on an mRNA-polypeptide complex containing the substrate. Specific examples of combinations of enzymes and substrates include a combination of a protease such as TEV protease or 3C protease with a peptide containing an amino acid sequence that is specifically recognized and cleaved by the protease, and a combination of a DNase such as a restriction enzyme with DNA containing a base sequence that is specifically recognized and cleaved by the DNase.

[0162] Cleavage of the bond using light can be achieved, for example, by incorporating a structure that causes photochemical decomposition at the bond between the mRNA and the polypeptide. The bond is cleaved by irradiating an mRNA-polypeptide complex containing such a structure with light of an appropriate wavelength. Specific examples of structures that cause photochemical decomposition include a 6-nitroveratryloxycarbonyl (NVOC) structure and a coumarin structure.

[0163] Cleavage of the bond by a method using heat can be achieved, for example, by forming an affinity bond between the mRNA and the polypeptide (e.g., the bond between biotin and a biotin-binding protein). The bond is cleaved by applying heat (e.g., at 95°C for 10 minutes) to the mRNA-polypeptide complex having the bond.

[0164] Step (d) is a step of preparing cDNA from the recovered mRNA and synthesizing a polypeptide from the cDNA.

[0165] To prepare cDNA from mRNA, for example, first-strand cDNA is synthesized by reverse transcription using a primer that binds to the constant region contained in the 3' end of the mRNA, and then double-stranded cDNA can be synthesized by extension using a primer that binds to the constant region contained in the 3' end of the first-strand cDNA. A sequence necessary for translation is added to the synthesized double-stranded cDNA (for example, by adding the sequence to the 5' end of the primer, or by introducing the synthesized double-stranded cDNA into an expression vector). The target polypeptide can then be synthesized by reacting in an appropriate translation system (for example, a cell-free translation system).

[0166] Step (c') is a step of determining the amino acid sequence of the polypeptide contained in the complex selected in step (b). Step (c') involves determining the amino acid sequence of the polypeptide by a method known to those skilled in the art.

[0167] Step (d') is a step of synthesizing a polypeptide based on the amino acid sequence determined in step (c'). Step (d') involves chemically synthesizing the polypeptide based on the determined amino acid sequence. For example, if the polypeptide is an active ingredient of a pharmaceutical, a chemical synthesis method that is efficient and / or suitable for large-scale synthesis may be established.

[0168] The polypeptide according to this embodiment is not particularly limited as long as it is a peptide formed by amide bonds or ester bonds between natural amino acids and / or unnatural amino acids.

[0169] Naturally occurring amino acids refer to glycine (Gly), L-alanine (Ala), L-serine (Ser), L-threonine (Thr), L-valine (Val), L-leucine (Leu), L-isoleucine (Ile), L-phenylalanine (Phe), L-tyrosine (Tyr), L-tryptophan (Trp), L-histidine (His), L-glutamic acid (Glu), L-aspartic acid (Asp), L-glutamine (Gln), L-asparagine (Asn), L-cysteine ​​(Cys), L-methionine (Met), L-lysine (Lys), L-arginine (Arg), and L-proline (Pro).

[0170] Examples of unnatural amino acids (amino acid derivatives) include, but are not limited to, β-amino acids, D-amino acids, N-substituted amino acids (excluding Pro), α,α-disubstituted amino acids, amino acids whose side chains differ from those of natural amino acids, hydroxycarboxylic acids, etc. As used herein, unnatural N-substituted amino acids refer to N-substituted amino acids other than Pro.

[0171] As used herein, amino acids are permitted to have any steric configuration. The side chain of an amino acid is not particularly limited, and in addition to a hydrogen atom, it can be freely selected from, for example, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, heteroaryl groups, aralkyl groups, heteroaralkyl groups, cycloalkyl groups, and spiro-linked cycloalkyl groups. Each of these groups may be substituted, and the substituents are not limited. For example, one or more may be independently selected from any substituent containing a halogen atom, an O atom, a S atom, a N atom, a B atom, a Si atom, or a P atom. Examples of such substituents include optionally substituted alkyl groups, alkoxy groups, alkenyl groups, alkynyl groups, aryl groups, heteroaryl groups, aralkyl groups, cycloalkyl groups, etc., as well as oxo, aminocarbonyl, and halogen atoms. An amino acid according to one embodiment may be a compound having a carboxy group and an amino group in the same molecule (even in this case, proline, hydroxyproline, azetidine-2-carboxylic acid, etc., in which the nitrogen atom of the amino group and any atom of the side chain together form a ring, are also included in the amino acid).

[0172] Halogen-derived substituents include fluoro (-F), chloro (-Cl), bromo (-Br), iodo (-I), and the like.

[0173] Substituents derived from O atoms include hydroxy (-OH), oxy (-OR), carbonyl (-C(=O)-R), carboxy (-CO ２ H), oxycarbonyl (-C(=O)-OR), carbonyloxy (-O-C(=O)-R), thiocarbonyl (-C(=O)-SR), carbonylthio group (-S-C(=O)-R), aminocarbonyl (-C(=O)-NHR), carbonylamino (-NH-C(=O)-R), oxycarbonylamino (-NH-C(=O)-OR), sulfonylamino (-NH-SO ２ -R), aminosulfonyl (-SO ２ -NHR), sulfamoylamino (-NH-SO ２ -NHR), thiocarboxy (-C(=O)-SH), carboxycarbonyl (-C(=O)-CO ２ H).

[0174] Examples of oxy (—OR) include alkoxy, cycloalkoxy, alkenyloxy, alkynyloxy, aryloxy, heteroaryloxy, aralkyloxy, and the like.

[0175] Examples of carbonyl (-C(=O)-R) include formyl (-C(=O)-H), alkylcarbonyl, cycloalkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, arylcarbonyl, heteroarylcarbonyl, aralkylcarbonyl, and the like.

[0176] Examples of oxycarbonyl (-C(=O)-OR) include alkyloxycarbonyl, cycloalkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, aralkyloxycarbonyl, and the like.

[0177] Examples of carbonyloxy (—O—C(═O)—R) include alkylcarbonyloxy, cycloalkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy, arylcarbonyloxy, heteroarylcarbonyloxy, aralkylcarbonyloxy, and the like.

[0178] Examples of thiocarbonyl (-C(=O)-SR) include alkylthiocarbonyl, cycloalkylthiocarbonyl, alkenylthiocarbonyl, alkynylthiocarbonyl, arylthiocarbonyl, heteroarylthiocarbonyl, aralkylthiocarbonyl, and the like.

[0179] Examples of carbonylthio (-S-C(=O)-R) include alkylcarbonylthio, cycloalkylcarbonylthio, alkenylcarbonylthio, alkynylcarbonylthio, arylcarbonylthio, heteroarylcarbonylthio, aralkylcarbonylthio, and the like.

[0180] Examples of aminocarbonyl (-C(=O)-NHR) include alkylaminocarbonyl, cycloalkylaminocarbonyl, alkenylaminocarbonyl, alkynylaminocarbonyl, arylaminocarbonyl, heteroarylaminocarbonyl, aralkylaminocarbonyl, etc. In addition to these, compounds in which the H atom bonded to the N atom in -C(=O)-NHR is further substituted with an alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0181] Examples of carbonylamino (-NH-C(=O)-R) include alkylcarbonylamino, cycloalkylcarbonylamino, alkenylcarbonylamino, alkynylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino, aralkylcarbonylamino, etc. In addition to these, compounds in which the H atom bonded to the N atom in -NH-C(=O)-R is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl are also included.

[0182] Examples of oxycarbonylamino (-NH-C(=O)-OR) include alkoxycarbonylamino, cycloalkoxycarbonylamino, alkenyloxycarbonylamino, alkynyloxycarbonylamino, aryloxycarbonylamino, heteroaryloxycarbonylamino, aralkyloxycarbonylamino, etc. In addition to these, examples include compounds in which the H atom bonded to the N atom in -NH-C(=O)-OR is further substituted with an alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl.

[0183] Sulfonylamino (-NH-SO ２ Examples of —R) include alkylsulfonylamino, cycloalkylsulfonylamino, alkenylsulfonylamino, alkynylsulfonylamino, arylsulfonylamino, heteroarylsulfonylamino, aralkylsulfonylamino, etc. In addition to these, —NH—SO ２Examples include compounds in which the H atom bonded to the N atom in —R is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl.

[0184] Aminosulfonyl (-SO ２ Examples of —NHR) include alkylaminosulfonyl, cycloalkylaminosulfonyl, alkenylaminosulfonyl, alkynylaminosulfonyl, arylaminosulfonyl, heteroarylaminosulfonyl, aralkylaminosulfonyl, and the like. ２ Examples include compounds in which the H atom bonded to the N atom in —NHR is further substituted with alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, or aralkyl.

[0185] Sulfamoylamino (-NH-SO ２ Examples of —NHR) include alkylsulfamoylamino, cycloalkylsulfamoylamino, alkenylsulfamoylamino, alkynylsulfamoylamino, arylsulfamoylamino, heteroarylsulfamoylamino, and aralkylsulfamoylamino. ２ The two H atoms bonded to the N atom in —NHR may be substituted with substituents independently selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, and these two substituents may form a ring.

[0186] Substituents derived from S atoms include thiol (-SH), thio (-S-R), sulfinyl (-S(=O)-R), sulfonyl (-S(O) ２ -R), sulfo (-SO ３ H), pentafluorosulfanyl (-SF ５ ) etc.

[0187] Examples of thio (-S-R) include alkylthio, cycloalkylthio, alkenylthio, alkynylthio, arylthio, heteroarylthio, aralkylthio, and the like.

[0188] Examples of sulfinyl (-S(=O)-R) include alkylsulfinyl, cycloalkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, arylsulfinyl, heteroarylsulfinyl, aralkylsulfinyl, and the like.

[0189] Sulfonyl (-S(O) ２ Examples of —R) include alkylsulfonyl, cycloalkylsulfonyl, alkenylsulfonyl, alkynylsulfonyl, arylsulfonyl, heteroarylsulfonyl, aralkylsulfonyl, and the like.

[0190] As a substituent derived from the N atom, azide (-N ３ , also called "azido group"), cyano (-CN), primary amino (-NH ２ ), secondary amino (—NH—R), tertiary amino (—NR(R′)), amidino (—C(═NH)—NH ２ ), substituted amidino (—C(═NR)—NR′R″), guanidino (—NH—C(═NH)—NH ２ ), substituted guanidino (—NR—C(═NR′″)—NR′R″), aminocarbonylamino (—NR—CO—NR′R″), and the like.

[0191] Examples of secondary amino (-NH-R) include alkylamino, cycloalkylamino, alkenylamino, alkynylamino, arylamino, heteroarylamino, and aralkylamino.

[0192] Examples of tertiary amino (—NR(R′)) include an amino group having any two substituents independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, etc., such as alkyl(aralkyl)amino, and these two substituents may form a ring.

[0193] Examples of substituted amidino (-C(=NR)-NR'R'') include groups in which the three substituents R, R', and R'' on the N atom are each independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, such as alkyl(aralkyl)(aryl)amidino.

[0194] Examples of substituted guanidino (-NR-C(=NR'")-NR'R") include groups in which R, R', R", and R'" are each independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, and groups in which these groups form a ring.

[0195] Examples of aminocarbonylamino (—NR—CO—NR′R″) include groups in which R, R′, and R″ are each independently selected from a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl, and groups in which these groups form a ring.

[0196] Examples of the substituent derived from the B atom include boryl (-BR(R')) and dioxyboryl (-B(OR)(OR')). These two substituents R and R' may be groups independently selected from alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, etc., or may be a group in which these groups form a ring. Specific examples include cyclic boryl groups, and more specific examples include pinacolatoboryl groups, neopentanediolateboryl groups, and catecholateboryl groups.

[0197] The main chain amino group of the amino acid is unsubstituted (-NH ２ ) or may be substituted (i.e., —NHR, where R represents, for example, an alkyl group, alkenyl group, alkynyl group, aryl group, heteroaryl group, aralkyl group, cycloalkyl group, or the like, which may have a substituent, and the carbon chain bonded to the N atom and the carbon atom at the α-position may form a ring, as in proline).

[0198] In the present specification, an amino acid residue in which the main chain amino group is substituted is referred to as an "N-substituted amino acid residue." Examples of the "N-substituted amino acid residue" in the present specification include an N-alkyl amino acid residue, an N-C １ -C ６ Alkyl amino acid residue, N-C １ -C ５ Alkyl amino acid residue, N-C １ -C ４ Alkyl amino acid residue, N-C １ -C ３ Alkyl amino acid residue, N-ethyl amino acid residue, N-methyl amino acid residue, N-C ７ -C １４ It may be an aralkyl amino acid residue, an N-benzyl amino acid residue, or an N-phenethyl amino acid residue.

[0199] Specific examples of the substituent on the nitrogen atom of the N-substituted amino acid residue herein (R in the above-mentioned —NHR) include alkyl groups (preferably C １ -C ６ alkyl group, more preferably C １ -C ４ alkyl group, more preferably C １ -C ３ an alkyl group, more preferably an ethyl group or a methyl group), C ７ -C １４ Examples of the substituent on the nitrogen atom of the N-substituted amino acid include an aralkyl group, a benzyl group, and a phenethyl group. １ -C ６ It may be an alkyl group, preferably C １ -C ３ It is an alkyl group, more preferably an ethyl group or a methyl group, and most preferably a methyl group (i.e., the most preferred N-substituted amino acid is an N-methyl amino acid).

[0200] As used herein, "amino acid" includes all corresponding isotopes. An isotope of an "amino acid" is one in which at least one atom has been replaced with an atom having the same atomic number (number of protons) but a different mass number (sum of the number of protons and neutrons). Examples of isotopes included in "amino acids" as used herein include hydrogen atoms, carbon atoms, nitrogen atoms, oxygen atoms, phosphorus atoms, sulfur atoms, fluorine atoms, and chlorine atoms, each of which is ２ H. ３ H. １３ C. １４ C. １５ N. １７ O. １８ O. ３２ P. ３５ S. １８ F. ３６ Cl and the like are included.

[0201] The number of N-substituted amino acid residues contained in the polypeptide of this embodiment is not particularly limited, but is, for example, 1 or more, preferably 3 or more, more preferably 4 or more, and most preferably 5 or more.

[0202] The molecular weight of the polypeptide according to this embodiment is not particularly limited, and may be, for example, 500 g / mol or more, 550 g / mol or more, 600 g / mol or more, 650 g / mol or more, 700 g / mol or more, 750 g / mol or more, 800 g / mol or more, 850 g / mol or more, 900 g / mol or more, 950 g / mol or more, 1,000 g / mol or more, 1,100 g / mol or more, 1,200 g / mol or more, 1,300 g / mol or more, 1,400 g / mol or more, 1,500 g / mol or more, 1,600 g / mol or more, 1,700 g / mol or more, 1,800 g / mol or more, 1,900 g / mol or more, 2,000 g / mol or more, 2,100 g / mol or more, 2,200 g / mol or more, 2,300 g / mol or more, 3,400 g / mol or more, 3,500 g / mol or more, 4,500 g / mol or more, 5,600 g / mol or more, 6,700 g / mol or more, 7,800 g / mol or more, 8,900 g / mol or more, 9,950 g / mol or more, 1,000 g / mol or more, 1,100 g / mol or more, 1,200 g / mol or more, 1,300 g / mol or more, 1,400 g / mol or more, 1,500 g / mol or more, 1,600 g / mol or more, 1,700 g / mol or more, 1,800 g / mol or more, 1,900 g / mol or more, 1,95 The molecular weight may be 200 g / mol or more, 1,300 g / mol or more, or 1,400 g / mol or more, or 5,000 g / mol or less, 4,000 g / mol or less, 3,000 g / mol or less, 2,500 g / mol or less, 2,000 g / mol or less, 1,900 g / mol or less, 1,800 g / mol or less, 1,700 g / mol or less, or 1,600 g / mol or less. In this specification, the "molecular weight of a polypeptide" refers to the sum of the atomic weights of the atoms constituting the polypeptide molecule (unit: "g / mol"), and is obtained by calculating the sum of the atomic weights of the atoms contained in the molecular formula. In this specification, the molecular weight unit may be omitted.

[0203] The number of amino acid residues constituting the polypeptide according to this embodiment is not particularly limited, and may be, for example, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 11 or more, or may be 30 or less, 25 or less, 20 or less, 17 or less, 15 or less, 14 or less, 13 or less, 12 or less, or 11 or less. As used herein, the term "number of amino acid residues" refers to the number of amino acid residues (amino acid units) constituting the polypeptide, and refers to the number of amino acid units generated when the amide bond, ester bond, and bond at the cyclization portion that link the amino acids are cleaved.

[0204] The polypeptide according to this embodiment may constitute a part or all of a cyclic polypeptide having a cyclic portion. As used herein, a "cyclic polypeptide" refers to a polypeptide having a cyclic structure composed of four or more amino acid residues. Cyclic polypeptides may be cyclized in any manner, including cyclization via a carbon-nitrogen bond such as an amide bond, cyclization via a carbon-oxygen bond such as an ester bond or an ether bond, cyclization via a carbon-sulfur bond such as a thioether bond, cyclization via a carbon-carbon bond, or cyclization via a heterocyclic ring structure. A linear polypeptide can be converted into a cyclic polypeptide by an intramolecular bond-forming reaction using a method such as those described in "Comprehensive Organic Transformations, A Guide to Functional Group Preparations, 3rd Edition" (by R.C. Larock) or "March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 7th Edition" (by M.B. Smith, J. March). Optionally, a predetermined polypeptide may be encoded in the region whose chain length has been extended with the trinucleotide mixture (b-2) and the trinucleotide mixture (b-2') and in the trinucleotide immediately following the region, and this polypeptide may constitute a cyclic polypeptide having a cyclic portion. Alternatively, a predetermined polypeptide may be encoded in the random region and in the trinucleotides bound to the 3'-end and 5'-end of the region, respectively, and this polypeptide may constitute a cyclic polypeptide having a cyclic portion, or the predetermined polypeptide may be a linear polypeptide in which the cyclic polypeptide is bound to another cyclic polypeptide, such as a linker peptide.

[0205] The number of amino acid residues constituting the cyclic portion of the cyclic polypeptide is not particularly limited, and may be, for example, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 11 or more, or 15 or less, 14 or less, 13 or less, 12 or less, or 11 or less.

[0206] The CLogP of the polypeptide according to this embodiment is not particularly limited, and may be, for example, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, or 9 or more, or 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, or 20 or less. CLogP is a partition coefficient calculated by a computer, and can be determined in accordance with the principles described in "CLOGP Reference Manual Daylight Version 4.9 (Release Date: August 1, 2011, https: / / www.daylight.com / dayhtml / doc / clogp / )." An example of a method for calculating ClogP is the CLOGP Reference Manual published by Daylight Chemical Information Systems, Inc. Examples of calculations include using Daylight Version 4.95 (release date: August 1, 2011, ClogP algorithm version 5.4, database version 28, https: / / www.daylight.com / dayhtml / doc / release_notes / index.html) by Yahoo!

[0207] The relative ratio of reaction rate constants between the trinucleotides of the present invention (S ｉｊ The method for calculating the nucleotide sequence (SEQ ID NO: 1) and the method for producing a nucleotide chain using the method can be applied not only to the production of a nucleic acid library but also to various other applications. For example, the method of the present invention can be used to produce a nucleic acid probe having a specific sequence with high accuracy, and can provide a nucleic acid probe with excellent specificity and sensitivity in diagnostic fields such as genetic diagnosis, gene expression analysis, and pathogen detection.

[0208] The present invention is further illustrated by, but not limited to, the following examples.

[0209] Unless otherwise specified, reagents were purchased from Sigma-Aldrich Japan LLC, Fujifilm Wako Pure Chemical Industries, Ltd., Tokyo Chemical Industry Co., Ltd., or Nacalai Tesque, Inc.

[0210] In the examples, the following abbreviations are used.

[0211] Example 1: Method for calculating the reaction rate constant between trinucleotides. Forty-seven types of trinucleotides (shown in Table 2) consisting of combinations of four types of bases (A, T, G, C) were calculated using the T １ , T ２ , T ３ , T ４ , ..., T ｋ , ..., T ４６ , T ４７ When a trinucleotide consisting of a combination of four types of bases is used, the number of types of trinucleotides is 64 at most.

[0212] Compound 1 was designed as follows: 5'-GAAGGAGATATACATATG (PPP) ８ (QQQ)CCGACCGGCACCGGCACCGGC-3' (SEQ ID NO: 1)

[0213] In the base sequence of Compound 1, the portion indicated as (PPP) corresponds to the portion elongated with a trinucleotide mixture containing 47 types of trinucleotides mixed at the mixing ratio shown in Table 2, and contains any of the trinucleotides shown in Table 2. (PPP) ８ means that any trinucleotide is bonded 8 times. In other words, it does not mean that only a specific trinucleotide (e.g., ATT) is bonded 8 times, but for example, when selected from 47 types of trinucleotides, 47 ８ The figure shows a schematic diagram of the diversity generated by synthesizing Compound 1 using 47 types of trinucleotides to generate a nucleic acid library.

[0214] In the base sequence of Compound 1, the portion indicated as (QQQ) corresponds to a portion elongated with a trinucleotide mixture prepared by mixing two types of trinucleotides in the mixing ratio shown in Table 3, and contains any of the trinucleotides shown in Table 3. (QQQ) means that any QQQ is bonded once.

[0215] Compound 1: 8-fold random region (PPP) ８ At the n-th position from the 3' end (right side), a trinucleotide is T ｋThe number of molecules (number of molecules analyzed by next-generation sequencer (NGS)) is C ｋ，ｎ and the trinucleotide at the n-1 position is T. ｉ and the trinucleotide at the nth position is T ｊ The number of molecules (number of molecules analyzed by NGS) is D ｉ，ｊ，ｎ，ｎ－１ is expressed as trinucleotide T ｊ at the 5' end of the trinucleotide T ｉ The relative ratio of reaction rate constants when reacting the 3' end of the molecule (hereinafter referred to as "S ｉｊ ") can be calculated using equation (1) by averaging at each position (n=2, 3, 4, 5, 6, 7, 8). Here, i and j are each independently an integer from 1 to 47. In addition, it is assumed that only the type and concentration of the three bases (trinucleotides) at the 5' end of Compound 1 affect the reaction rate, and that the reactions between individual trinucleotides are independent and do not affect other reactions.

[0216] Example 2: Relative ratio of reaction rate constants between trinucleotides (S ｉｊ ) Calculation method for compounding ratio (molar ratio) using the formula: The compounding ratio of trinucleotides injected into the synthesizer is always constant without changing the compounding ratio during the synthesis of each random region, and in order to synthesize a nucleic acid having a desired trinucleotide occurrence frequency (codon occurrence frequency), the compounding ratio (molar ratio) of each trinucleotide was calculated using the following calculation method. Here, the number of types of trinucleotides in the random region is N, and the length of the random region is M. The maximum value of N is 64 for a trinucleotide consisting of four types of bases. There is no limit to the length of the random region, but it should be approximately 20 at most.

[0217] Trinucleotide to T' ｉ (i = 1...N). The molar ratio of each trinucleotide is MR ｉ And MR ｉ The sum of (i=1...N) is normalized to 1 (equation (2)).

[0218] In the first reaction of the random region, 1) one trinucleotide at the 3' end just before the random region is T' ｘWhen the codon at the 5' end is fixed to T' after the reaction, ｉ The proportion C ｉ，１ is expressed by equation (3).

[0219] 2) There are two types of trinucleotides at the 3' end just before the random region: T' ｘ , T' ｙ and the respective ratios are R ｘ , R ｙ (R ｘ +R ｙ = 1), the trinucleotide at the 5' end after the reaction is T' ｉ The proportion C ｉ，１ is expressed by equation (4).

[0220] C ｉ，１ is normalized by equation (5), and F ｉ，１ Let's say.

[0221] Similarly, after the jth reaction (j=2...M), the 5'-terminal trinucleotide becomes T' ｉ The proportion C ｉ，ｊ is expressed by equation (6). Here, F ｉ，ｊ is set to a normalized value (equation (7)) in the same way as in equation (5).

[0222] F ｉ，ｊ is the 5' end of the trinucleotide T after the jth reaction. ｉ and satisfies equation (8).

[0223] w ｉ (i = 1...N) is a coefficient that adjusts the occurrence frequency of each trinucleotide, and constant is a constant. When controlling that all trinucleotides appear equally at the 5' end after each reaction, w ｉ The values ​​of are all set to 1. On the other hand, in a library in which the occurrence frequency of an arbitrary trinucleotide is changed, a coefficient other than 1 is given. For example, the w corresponding to the trinucleotide whose occurrence frequency is to be reduced to one-third is ｉ The value of is set to 3.

[0224] Although simultaneous equations that simultaneously satisfy Equation (2), Equation (4), Equation (5), Equation (6), Equation (7), and Equation (8), or simultaneous equations that simultaneously satisfy Equation (3), Equation (4), Equation (5), Equation (6), Equation (7), and Equation (8) cannot be analytically solved, they can be solved by the Newton-Raphson method. ｉ，ｊ , F ｉ，ｊ , constant and MR ｉ A numerical solution can be obtained by providing an appropriate initial value for each trinucleotide, and the molar ratio MR ｉ can be obtained.

[0225] Example 3: S ｉｊ Synthesis of Nucleotide Chain (A) Library for Obtaining Calculation Data Compounds 1-1, 1-2, 1-3, and 1-4, which have the same structure as Compound 1, were synthesized as follows.

[0226] The trinucleotide (codon unit) used in the synthesis of each compound was synthesized in accordance with the method described in WO 2013 / 100132. The synthesized trinucleotide (codon unit) has a hydroxyl group at the 5' position protected with a 4,4'-dimethoxytrityl group (DMT), a phosphate group protected with a 2-chlorophenyl group, and, as shown in the following formula, has consecutive amino-protected nucleic acid bases (C(Bz), A(Bz), G(iBu)) or Ts from the 5' side, and has an N,N'-diisopropylaminophosphoramidite group protected with a cyanoethyl group at the 3' end.

[0227] Random DNA synthesis was performed by the phosphoramidite method using a DNA / RNA synthesizer (NTS H-6, manufactured by Nippon Techno Service Co., Ltd.). Dehydrated acetonitrile was purchased from Fujifilm Wako Pure Chemical Industries, Ltd. Deblocking Mix (3 w / v% trichloroacetic acid in dichloromethane), phosphoramidite reagent (dA, dC, dG, dT-CE phosphoramidite), Cap Mix A (THF / Pyridine / Acetic anhydride), Cap Mix B (16% 1-Me-Imidazole / THF), Oxidizing Solution (0.02 M I in THF / Pyridine / H ２ 0), and activator (5-Benzylthio-1H-tetrazole in MeCN) were purchased from Glen Research Co. Each trinucleotide used was synthesized as described above.

[0228] Here, the random region 1 is a region in the sequence of compound 1 where (PPP) ８ and random region 2 is the portion in the sequence of compound 1 indicated as (QQQ).

[0229] Detailed operating procedures were as per the manual attached to the synthesizer.

[0230] A reaction vessel equipped with a filter was filled with GlenUnySupport CPG (1000 Å, 32 μmol / g, 6.2 mg, 0.198 μmol) and set in a synthesizer for solid-phase DNA synthesis. The 5'-terminal hydroxyl protecting group (DMT: 4,4'-dimethoxytrityl group) was not deprotected, and the elongation reaction was terminated by the synthesizer.

[0231] After the extension reaction was completed, the solid support was transferred to a glass tube with a screw cap. 29% aqueous ammonia (0.4 ml) was added and the mixture was stirred at 60°C for 6 hours to excise and deprotect the DNA from the CPG, yielding a reaction mixture. The reaction mixture was purified by preparative HPLC (analysis conditions LC02 listed in Table 7). The residue obtained by lyophilization of the HPLC fraction was dissolved in water (0.6 ml), to which acetic acid (3 ml) was added. The mixture was stirred at room temperature for 10 minutes to deprotect the DMT group at the 5'-terminal hydroxyl group. The reaction mixture was diluted with water (10 ml) and extracted five times with ethyl acetate (10 ml). The resulting aqueous layer was lyophilized to obtain the desired randomized DNA (compound 1-1) (0.0291 μmol, 14.6%). The yield was calculated from the absorbance at 260 nm. Retention time: 6.546 minutes (analysis conditions LC01 listed in Table 7).

[0232] Compounds 1-2, 1-3, and 1-4, which have the same structure as Compound 1-1, were synthesized in the same manner. Compound 1-2: 0.0217 μmol (10.4%), Retention time: 6.533 minutes (Analysis conditions LC01 listed in Table 7). Compound 1-3: 0.0166 μmol (8.4%), Retention time: 6.536 minutes (Analysis conditions LC01 listed in Table 7). Compound 1-4: 0.0324 μmol (16.3%), Retention time: 6.518 minutes (Analysis conditions LC01 listed in Table 7).

[0233] Example 4: Analysis of trinucleotide occurrence frequency and calculation of reaction rate constants for Compounds 1-1, 1-2, 1-3, and 1-4 Example 4-1: Preparation of puromycin-linked mRNA library A puromycin-linked mRNA library was obtained using Compound 1-1 as a starting material according to a protocol similar to that described in a non-patent document (J. Am. Chem. Soc. 2023, 145, 24035.). The specific protocol is briefly described below.

[0234] Using PrimeSTAR HS DNA Polymerase (purchased from TaKaRa Bio), 400 μL of reaction solution containing 0.05 μM compound 1-1 and 0.05 μM PM01 (SEQ ID NO: 2) was prepared according to the manufacturer's recommended protocol. 1st extension was performed by treating at 94°C for 70 seconds, 55°C for 5 seconds, and 72°C for 75 seconds. Next, 20 μL of an aqueous solution containing 10 μM PM01 (SEQ ID NO: 2) and PM02 (SEQ ID NO: 3) was added to the reaction solution, and 2nd extension was performed by treating at 94°C for 70 seconds, 55°C for 5 seconds, and 72°C for 75 seconds. After the second extension, the aqueous solution was purified using a QIAquick PCR Purification Kit (purchased from Qiagen) to obtain an aqueous solution of a nucleic acid (DNA) library (SEQ ID NO: 4).

[0235] PM01 (SEQ ID NO: 2) 5'-TTTTTTTGCCGGTGCCGGTGCCGGTCGG-3'

[0236] PM02 (SEQ ID NO: 3) 5'-GTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATG-3'

[0237] DNA library (SEQ ID NO: 4) 5'-GTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATATG (PPP) ８ (QQQ)CCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0238] A 70 μL reaction solution containing the DNA library was prepared using a T7 RiboMAX Express Large Scale RNA Production System (purchased from Promega) according to the manufacturer's recommended protocol. After incubation at 37°C for 1 hour to carry out the transcription reaction, DNase I solution was added and incubated at 37°C for 15 minutes. After the reaction, the solution was purified using an RNeasy MinElute Kit (purchased from Qiagen) to obtain an mRNA library solution (SEQ ID NO: 5).

[0239] mRNA library (SEQ ID NO: 5) 5'-GGGUUAACUUUAAGAAGGAGAUAUACAUAUG (PPP) ８ (QQQ)CCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0240] A puromycin linker ligation reaction was carried out between the above mRNA library and PM03. Specifically, 15 μL of a reaction solution containing 50 mM HEPES-KOH (pH 8.3), 10 mM magnesium chloride, 2.7 mM DTT, 0.67 mM ATP, 13 μM mRNA library, 257.5 μM PM03, 50% PEG8000 (to a final concentration of 10%), and 2.0 U / μL T4 RNA Ligase (purchased from New England Biolabs) was prepared and incubated at 37°C for 1 hour. After the reaction, the aqueous solution was purified using the RNeasy MinElute Kit to obtain a puromycin-linked mRNA library solution.

[0241] PM03 [P]TTT[Spacer18][Spacer18][Spacer18][Spacer18][Spacer18]CC[puromycin] (Note 1) [P] means 5' phosphorylation. (Note 2) [Spacer18] means 18 atoms of hexaethylene glycol. (Note 3) [puromycin] means 3' puromycination.

[0242] Three additional aqueous solutions of puromycin-linked mRNA libraries with the same sequence were obtained using Compound 1-2, Compound 1-3, or Compound 1-4 according to the same protocol.

[0243] Example 4-2: FASTQ Data Acquisition Using a Next-Generation Sequencer Reverse transcription was performed on the puromycin-linked mRNA library. Specifically, 20 μL of reaction solution containing 20% ​​by volume of M-MLV RT 5x reaction buffer (purchased from Promega), 0.5 mM of each dNTP, 5.0 μM PM01 (SEQ ID NO: 2), 8.0 U / μL M-MLV Reverse transcriptase (H-) (purchased from Promega), and 1 μM puromycin-linked mRNA library was prepared and incubated at 42°C for 1 hour. After reverse transcription, the solution was purified using a QIAquick PCR Purification Kit (purchased from Qiagen) to obtain a cDNA library solution.

[0244] The cDNA library was analyzed using a next-generation sequencer according to a protocol similar to that described in a non-patent document (J. Am. Chem. Soc. 2023, 145, 24035.), to obtain a FASTQ file for use in trinucleotide (codon unit) frequency analysis. Specifically, the cDNA was amplified by PCR and then sequenced using a MiSeq system (purchased from Illumina), to obtain the desired FASTQ file.

[0245] Three additional FASTQ files were obtained from aqueous mRNA libraries of the same sequence obtained from Compound 1-2, Compound 1-3, or Compound 1-4 according to the same protocol.

[0246] Example 4-3: Calculation of trinucleotide (codon unit) occurrence frequency The total number of each trinucleotide (codon unit) in random region 1 was calculated from the read sequence contained in the acquired FASTQ file. The occurrence frequency of each trinucleotide (codon unit) was as shown in Figures 1 to 4. Figure 1 shows the occurrence frequency of each trinucleotide (codon unit) in compound 1-1. Figure 2 shows the occurrence frequency of each trinucleotide (codon unit) in compound 1-2. Figure 3 shows the occurrence frequency of each trinucleotide (codon unit) in compound 1-3. Figure 4 shows the occurrence frequency of each trinucleotide (codon unit) in compound 1-4.

[0247] Furthermore, the total number of each trinucleotide (codon unit) pair was calculated. Here, a trinucleotide (codon unit) pair is defined as a trinucleotide T ｉ and trinucleotide T ｊ But, T ｉ T ｊ (i and j are each an integer from 1 to 47). Next, the relative ratios of the reaction rate constants of all pairs were calculated as the average of four experiments according to Example 1. An example of the relative ratios of the reaction rate constants is shown in the table below.

[0248] Example 5-1: Calculation of initial concentrations during synthesis of Compound 2 and Compound 3 The following DNA libraries were designed (Compound 2, Compound 3) in which the occurrence frequencies of each trinucleotide (codon unit) are as shown in Column A of Table 5 and Column A of Table 6. ９ , or (RRR) ８ The portion indicated by (SSS) in the sequences of Compound 2 and Compound 3 is designated as random region 4.

[0249] Compound 2 5'-TAAGGAGATATAAATATG (RRR) ９ (SSS)CCGACCGGCACCGGCACCGGC-3' (SEQ ID NO: 6)

[0250] Compound 3 5'-TAAGGAGATATAAATATG (RRR) ８ (SSS)CCGACCGGCACCGGCACCGGC-3' (SEQ ID NO: 7)

[0251] (RRR) in Compound 2 ９ means that any trinucleotide selected from the trinucleotides shown in Table 5 is bonded 9 times. In other words, it does not mean that only a specific trinucleotide (e.g., ATT) is bonded 9 times, but for example, when selected from 23 types of trinucleotides, 23 ９ This is a schematic diagram showing the diversity of (RRR) in compound 3. ８The same applies to (SSS) in Compound 2 and Compound 3. (SSS) means that any trinucleotide selected from the trinucleotides shown in Table 6 is bonded once.

[0252] For the 23 types of trinucleotides shown in Table 5, the initial mixing ratio of each trinucleotide was calculated according to Example 2 so as to achieve the expected trinucleotide appearance frequency ratio (column A of Table 5) in the designed DNA library. The calculation was performed using the mathematical processing system Mathematica ver. 12 (Wolfram Research).

[0253] The initial value is C ｉ，ｊ and F ｉ，ｊ All elements of are set to 1, and MR ｉ was applied to Compound 2, whose length of the random region 3 was 9, and Compound 3, whose length of the random region 3 was 8. ｉ There was no significant difference when the measurement was carried out. ｉ The average values ​​(column B of Table 5) were used for the synthesis of Compound 2 and Compound 3.

[0254]

[0255] The codon ratio of ATG to TAG in (SSS) shown in Table 6 was determined from the reaction rate of the 5' end of CCG with the 3' end of ATG and the 3' end of CCG, in order to react with the 5' end of the immediately preceding CCG.

[0256]

[0257] Example 5-2: Calculation of initial concentrations during synthesis of Compound 4 and Compound 5 A DNA library was designed in which the occurrence frequency of each trinucleotide (codon unit) was as shown in column A of Table 6 (Compounds 4 and 5). ９ , or (VVV) ８ The area indicated by is a random area 5.

[0258] Compound 4 5'-TAAGGAGATATAAAATATG (VVV)９ TAGCCGACCGGCACCGGCACCGGC-3' (SEQ ID NO: 8)

[0259] Compound 5 5'-TAAGGAGATATAAAATATG (VVV) ８ TAGCCGACCGGCACCGGCACCGGC-3' (SEQ ID NO: 9)

[0260] (VVV) in Compound 4 ９ means that any trinucleotide selected from the trinucleotides shown in Table 7 is bound 9 times. In other words, it does not mean that only a specific trinucleotide (e.g., ATT) is bound 9 times, but for example, when selected from 26 types of trinucleotides, 26 ９ This is a schematic diagram showing the diversity of (VVV) in compound 5. ８ The same is true for .

[0261] For the 26 types of trinucleotides shown in Table 7, the initial mixing ratio of each trinucleotide was calculated according to Example 2 so as to achieve the expected trinucleotide appearance frequency ratio (column A in Table 7) in the designed DNA library. The calculation was performed using the mathematical processing system Mathematica ver. 12 (Wolfram Research).

[0262] The initial value is C ｉ，ｊ and F ｉ，ｊ All elements of are set to 1, and MR ｉ was applied to compound 4, whose length of the random region 5 was 9, and compound 5, whose length was 8. The MR ｉ There was no significant difference when the measurement was carried out. ｉ The average values ​​(column B of Table 7) were used in the synthesis of Compounds 4 and 5.

[0263]

[0264] Example 6-1: Synthesis 1 of a DNA library having a random region in which the frequency of occurrence of each trinucleotide is controlled. Using a trinucleotide mixture prepared by mixing the trinucleotides shown in Table 5 at the mixing ratio (molar ratio) shown in column B of Table 5, and a trinucleotide mixture prepared by mixing the trinucleotides shown in Table 6 at the mixing ratio (molar ratio) shown in column B of Table 6, compound 2 and compound 3 were synthesized as follows.

[0265] Synthesis of Compound 2 Solid-phase synthesis, excision, and deprotection reactions were carried out using GlenUnySupport CPG (1000 Å, 32 μmol / g, 6.2 mg, 0.198 μmol) in the same manner as for Compound 1, to obtain a reaction mixture. The resulting reaction mixture was lyophilized, and the resulting residue was dissolved in water. The resulting aqueous solution was purified by HPLC (analysis conditions LC03 listed in Table 7). Subsequent treatments were carried out in the same manner as for Compound 1-1, to obtain a DNA library (compound 2) (0.0028 μmol, 1.4%) having the desired random region. Retention time: 6.676 minutes (analysis conditions LC01 listed in Table 8).

[0266] Synthesis of Compound 3 Solid-phase synthesis, excision, and deprotection reactions were carried out using GlenUnySupport CPG (1000 Å, 32 μmol / g, 6.2 mg, 0.198 μmol) in the same manner as for Compound 1, to obtain a reaction mixture. The resulting reaction mixture was lyophilized, and the resulting residue was dissolved in water, and the resulting aqueous solution was purified by HPLC (analysis conditions LC02 listed in Table 7). Subsequently, subsequent treatments were carried out in the same manner as for Compound 1-1, to obtain a DNA library (compound 3) (0.0023 μmol, 1.2%) having the desired random region. Retention time: 6.602 minutes (analysis conditions LC01 listed in Table 8).

[0267] Example 6-2: Synthesis 2 of a DNA library having a random region in which the occurrence frequency of each trinucleotide was controlled. Compound 4 and Compound 5 were synthesized as follows using a trinucleotide mixture prepared by mixing the trinucleotides shown in Table 7 at the mixing ratio (molar ratio) shown in column B of Table 7.

[0268] Synthesis of Compound 4 A DNA library (Compound 4) (0.0089 μmol, 4.5%) having the desired random region was obtained in the same manner as for Compound 1-1 using GlenUnySupport CPG (1000 Å, 32 μmol / g, 6.2 mg, 0.198 μmol). Retention time: 6.592 minutes (analysis condition LC01 listed in Table 8).

[0269] Synthesis of Compound 5 A DNA library (Compound 5) (0.0074 μmol, 3.7%) having the desired random region was obtained using GlenUnySupport CPG (1000 Å, 32 μmol / g, 6.3 mg, 0.201 μmol) in the same manner as for Compound 1-1. Retention time: 6.596 minutes (analysis condition LC01 listed in Table 8).

[0270]

[0271] Example 7: Analysis of trinucleotide occurrence frequency of compounds 2 to 5 Example 7-1: Preparation of puromycin-linked mRNA library Starting materials were compounds 2 to 5, and corresponding mRNA library aqueous solutions were obtained. The protocol was the same as that shown in Example 4-1, except for the following points. Specifically, PM04 (SEQ ID NO: 10) was used instead of PM02 (SEQ ID NO: 3), the 55°C treatment for the first extension was 15 seconds, the reaction scale was changed (for Compounds 2 and 4, the reaction using PrimeSTAR was 9 times longer, and the reaction using T7 RiboMAX was 4.3 times longer; for Compounds 3 and 5, the reaction using T7 RiboMAX was 1.4 times longer), the reaction using the T7 RiboMAX Express Large Scale RNA Production System was performed for 120 minutes, and for Compounds 2 and 4, the RNeasy MiniElute Kit was used for mRNA purification.

[0272] A puromycin linker ligation reaction was carried out between the mRNA library and PM03. Specifically, a reaction solution containing 50 mM HEPES-KOH (pH 8.3), 10 mM magnesium chloride, 2.7 mM DTT, 0.67 mM ATP, 0.001% BSA, 8.3% DMSO, 1.7 U / μL RNacin plus Ribonuclease Inhibitor (purchased from Promega), 50% PEG8000 (to a final concentration of 10%), 190 μM PM03, 11 μM mRNA library, and 1.7 U / μL T4 RNA Ligase was prepared and incubated overnight at 16°C. The total volume of the aqueous solution was 1,400 μL for the mRNA library derived from compound 2 and the mRNA library derived from compound 4, and 130 μL for the mRNA library derived from compound 3 and the mRNA library derived from compound 5. After the reaction, the aqueous solution was purified using an RNeasy MinElute Kit to obtain an aqueous solution of a puromycin-linked mRNA library.

[0273] PM04 (SEQ ID NO: 10) 5'-GTAATACGACTCACTATAGGGTTAACTTTAATAAGGAGATATAAATATG-3'

[0274] mRNA library (SEQ ID NO: 11); derived from compound 2 5'-GGGUUAACUUUAAUAAGGAGAUAUAAAUAUG (RRR) ９ (SSS) CCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0275] mRNA library (SEQ ID NO: 12); derived from compound 3 5'-GGGUUAACUUUAAUAAGGAGAUAUAAAUAUG (RRR) ８ (SSS) CCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0276] mRNA library (SEQ ID NO: 13); derived from compound 4 5'-GGGUUAACUUUAAUAAGGAGAUAUAAAUAUG (VVV) ９ UAGCCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0277] mRNA library (SEQ ID NO: 14); derived from compound 5 5'-GGGUUAACUUUAAUAAGGAGAUAUAAAUAUG (VVV) ８ UAGCCGACCGGCACCGGCACCGGCAAAAAAAA-3'

[0278] Example 7-2: Acquisition of FASTQ data using a next-generation sequencer The puromycin-linked mRNA library was subjected to a reverse transcription reaction to obtain an aqueous cDNA library solution. The protocol was the same as that shown in Example 4-2. The cDNA library was analyzed using a next-generation sequencer using the same protocol as in Example 4-2 to obtain a FASTQ file to be used for trinucleotide frequency analysis.

[0279] Example 7-3: Calculation of trinucleotide (codon unit) occurrence frequency The total number of each trinucleotide (codon unit) was determined in the same manner as in Example 4-3. The occurrence frequency of each trinucleotide (codon unit) was as shown in Figures 5 to 8. Figure 5 shows the occurrence frequency of each trinucleotide (codon unit) in Compound 2. Figure 6 shows the occurrence frequency of each trinucleotide (codon unit) in Compound 3. Figure 7 shows the occurrence frequency of each trinucleotide (codon unit) in Compound 4. Figure 8 shows the occurrence frequency of each trinucleotide (codon unit) in Compound 5.

[0280] The occurrence frequency of each trinucleotide (codon unit) determined from the results of NGS analysis of random region 1 of Compound 1, which was synthesized using a trinucleotide mixture in which all trinucleotides (codon units) were mixed in equimolar ratios, was not 1:1, which is the mixing ratio of each trinucleotide (codon unit), but was a variable value as shown in Figures 1 to 4. The difference from the expected occurrence frequency value was in the range of -41.2 to +53.6%.

[0281] Based on the expected frequency ratio of each trinucleotide in the designed DNA library, the optimal mixture ratio of each trinucleotide (codon unit) is determined as S ｉｊThe occurrence frequencies of each trinucleotide (codon unit) calculated from the NGS analysis results of random region 3 of synthesized compounds 2 and 3 are as shown in Figures 5 and 6, and the differences from the expected occurrence frequency values ​​can be within -6.3 to +16.7% and -11.0 to +11.8%, respectively. Furthermore, the occurrence frequencies of each trinucleotide (codon unit) in random region 5 of compounds 4 and 5 are as shown in Figures 7 and 8, and the differences from the expected occurrence frequency values ​​can be within -10.1 to +17.8% and -8.4 to +14.7%, respectively.

[0282] When a trinucleotide mixture is used, the reaction of one trinucleotide is theoretically considered not to affect the reaction of other trinucleotides. In other words, each trinucleotide reacts independently, and the reaction of one trinucleotide does not affect the reaction of other trinucleotides. Meanwhile, in an actual reaction, the reaction efficiency and selectivity may change depending on factors such as the reaction time and reaction temperature in addition to the trinucleotide concentration. However, in this experimental system, the reaction conditions (reaction temperature, reaction time, etc.) are the same. Furthermore, considering that the substrates at the reaction sites of each trinucleotide in this reaction are all the same substrate and that the substrates of each trinucleotide do not react with each other, it can be assumed that even if the number of types of trinucleotide mixtures is different, the reactions do not affect each other and the reactions proceed only depending on the individual concentrations and reaction rate constants. Then, the S obtained using a mixture of 47 types of trinucleotides (Example 1) ｉｊ In addition to the above-mentioned examples, it has been fully confirmed that the frequency of appearance of each trinucleotide can be controlled in a DNA library having a random region synthesized using a trinucleotide mixture in which the trinucleotide mixing ratio (molar ratio) is adjusted based on the above.

Claims

1. A method for determining the relative ratio of reaction rate constants (S) between trinucleotides, comprising the steps of: ｉｊ ) method: (1) a step of reacting a plurality of polynucleotides (a) with a trinucleotide mixture (b) containing two or more types of trinucleotides at a predetermined molar ratio, and elongating the polynucleotides contained in (a) with any one trinucleotide contained in the trinucleotide mixture (b), to obtain a plurality of types of nucleotide chains (A); (2) a step of further reacting the plurality of types of nucleotide chains (A) obtained in the step (1) with a trinucleotide mixture (b') containing three or more types of trinucleotides at a predetermined molar ratio, and elongating the chain lengths of the plurality of types of nucleotide chains (A) with any one trinucleotide contained in the trinucleotide mixture (b'), the step comprising repeating this operation once or twice or more times; (3) a step of calculating the number of trinucleotide Ts in the region of the plurality of types of nucleotide chains (A) obtained in the step (2) that has been elongated in trinucleotide units using the trinucleotide mixture (b) and / or the trinucleotide mixture (b'). ｉ Trinucleotide T ｊ (4) determining the relative ratio of the reaction rate constants (S ｉｊ ) where S ｉｊ is the trinucleotide T ｉ and trinucleotide T ｊ is the relative ratio of the reaction rate constants when reacting trinucleotide T ｉ and trinucleotide T ｊ are the same or different types of trinucleotides and are selected from the trinucleotides contained in trinucleotide mixture (b) and / or trinucleotide mixture (b').

2. A method for producing a nucleic acid library, comprising the following steps: (I) adding two or more types of trinucleotides selected from the trinucleotides contained in the trinucleotide mixture (b) according to claim 1 to a plurality of polynucleotides (a-2), respectively, to the S ｉｊ (II) reacting a trinucleotide mixture (b-2) containing the polynucleotides contained in (a-2) in a molar ratio calculated based on the above formula (I) with any one of the trinucleotides contained in the trinucleotide mixture (b-2) to obtain multiple types of nucleotide chains (A-2), and (II) reacting the polynucleotides contained in (a-2 ...') according to the above formula (I) with the multiple types of nucleotide chains (A-2) obtained in the above formula (I) with any one of the trinucleotides contained in the trinucleotide mixture (b') according to the above formula (I) ｉｊ and repeating the operation of further extending the chain length of the plurality of types of nucleotide chains (A-2) with any one trinucleotide contained in the trinucleotide mixture (b-2') once or twice or more times.

3. A certain type of trinucleotide T' contained in a region of the nucleotide chain (A-2) extended in trinucleotide units using the trinucleotide mixture (b-2) and / or the trinucleotide mixture (b-2'). １ The method of claim 2, wherein the ratio of the frequency of occurrence of other types of trinucleotides to that of other types of trinucleotides is adjusted to 1:1, or higher or lower than 1:

1.

4. The method according to any one of claims 1 to 3, wherein the molar ratio of the various trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is equal.

5. The method according to any one of claims 1 to 4, wherein in step (2) and / or step (II), the operation of further extending the chain length with the trinucleotide is repeated 1 to 30 times.

6. The method according to any one of claims 1 to 5, wherein the measurement in step (3) and / or the analysis of the frequency of appearance of various trinucleotides contained in the region extended in trinucleotide units using the trinucleotide mixture (b-2) and / or trinucleotide mixture (b-2') is performed by transcribing the multiple types of nucleotide chains (A) and / or the nucleotide chain (A-2) and / or the nucleotide chains contained in the nucleic acid library to obtain multiple types of mRNA, and then performing a reverse transcription reaction on the mRNA to obtain cDNA using a next-generation sequencer (NGS), or by transcribing the multiple types of nucleotide chains (A) and / or the nucleotide chain (A-2) and / or the nucleotide chains contained in the nucleic acid library to obtain multiple types of mRNA, and then performing a reverse transcription reaction on the linker-linked mRNA to obtain the mRNA, and then performing a next-generation sequencer (NGS) on the cDNA to obtain the linker-linked mRNA.

7. S in step (4) ｉｊ The number of types of trinucleotides contained in the trinucleotide mixture (b) and / or the trinucleotide mixture (b') is N, the number of extensions in trinucleotide units is M, and the various trinucleotides are represented by T ｉ (i = an integer from 1 to N), the method according to any one of claims 1 to 6, wherein the value is calculated by the following formula (1): (In formula (1), n ​​is an integer of 2 or more and M or less, i and j are each independently an integer of 1 or more and N or less, and D ｉ，ｊ，ｎ，ｎ－１ indicates that the trinucleotide at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ and the trinucleotide at the nth position is T ｉ represents the number of molecules of the nucleotide chain (A), and C ｊ，ｎ－１ indicates that the trinucleotide molecule at the n-1th position from the 3' end of the region extended in trinucleotide units is T. ｊ indicates the number of molecules.) 8. The above S ｉｊ The molar ratio (MR ｉ The method according to any one of claims 2 to 7, wherein the trinucleotide is determined by the following formulas (2) to (8): Formula (2) is a method in which the number of types of trinucleotides is N, the length of extension by trinucleotides is M, and the trinucleotide is T' ｉ (i = 1...N), and the mixing ratio of various trinucleotides is expressed as MR ｉ Toshi, MR ｉ This is an equation in which the sum of (i = 1...N) is normalized to 1, Formula (3) represents a case where, in the first trinucleotide elongation reaction, one trinucleotide at the 3' end immediately before the first trinucleotide is T' ｘ When the 5'-terminal trinucleotide is immobilized on the nucleotide, the 5'-terminal trinucleotide becomes T' after the reaction. ｉ The proportion C ｉ，１ and Formula (4) shows that the immediately preceding 3'-terminal trinucleotide is of two types, T' ｘ , T' ｙ and the respective ratios are R ｘ , R ｙ (R ｘ +R ｙ = 1) ｉ，１ and Equation (5) is the C of equation (4) ｉ，１ The value of F is normalized ｉ，１ and Similarly, formula (6) indicates that after the jth (j=2...M) extension reaction, the trinucleotide at the 5' end is T' ｉ The proportion C ｉ，ｊ and Equation (7) is the C of equation (5) ｉ，ｊ The value of F is similarly normalized. ｉ，ｊ and F ｉ，ｊ is the 5' end of the trinucleotide T' after the jth reaction. ｉ and satisfies equation (8). (Here, w ｉ (i = an integer from 1 to N) is a coefficient for adjusting the frequency of occurrence of various trinucleotides, and constant is a constant. A simultaneous equation that simultaneously satisfies formula (2), formula (4), formula (5), formula (6), formula (7), and formula (8), or simultaneously satisfies formula (3), formula (4), formula (5), formula (6), formula (7), and formula (8), cannot be solved analytically, but can be solved by the Newton-Raphson method. ｉ，ｊ , F ｉ，ｊ , constant and MR ｉ A numerical solution can be obtained by giving appropriate initial values ​​to .) 9. A method for producing an mRNA library, comprising the steps of: ： 　 A step of transcribing the multiple types of nucleotide chains (A) or the multiple types of nucleotide chains (A-2) obtained by the method according to any one of claims 1 to 8 to obtain a library containing multiple types of messenger RNA (mRNA).

10. A method for producing a linker-linked mRNA library, comprising the following steps: (a) a step of transcribing the multiple types of nucleotide chains (A) or the multiple types of nucleotide chains (A-2) obtained by the method according to any one of claims 1 to 8 to obtain multiple types of messenger RNA (mRNA); and (b) a step of ligating the multiple types of mRNA with a linker complex to obtain a library containing linker-linked mRNA.

11. A method for producing a library containing mRNA-polypeptide complexes, comprising the following steps: (a) a step of transcribing the multiple types of nucleotide chains (A) or the multiple types of nucleotide chains (A-2) obtained by the method according to any one of claims 1 to 8 to obtain multiple types of messenger RNA (mRNA); (b) a step of ligating the multiple types of mRNAs with a linker complex to obtain a library containing linker-linked mRNA; and (c) a step of obtaining mRNA-polypeptide complexes in which multiple types of polypeptides obtained by translating the multiple types of mRNAs respectively and mRNA encoding each polypeptide are linked via linkers.

12. The method of claim 6, 10, or 11, wherein the linker conjugate is a puromycin-linker conjugate.

13. A method for screening for a polypeptide that binds to a target substance, comprising the steps of (a) and (b) below: (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of claim 11 or 12, or a library containing said complex; and (b) selecting said complex that binds to said target substance.

14. A method for producing a polypeptide, comprising the following steps (a) to (d): (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of claim 11 or 12, or a library containing said complex; (b) selecting said complex that binds to said target substance; (c) recovering mRNA contained in said complex selected in step (b); and (d) preparing cDNA from the recovered mRNA and synthesizing a polypeptide from said cDNA.

15. A method for producing a polypeptide, comprising the following steps (a) to (b) and (c') to (d'): (a) contacting a target substance with an mRNA-polypeptide complex obtained by the method of claim 11 or 12, or a library containing said complex; (b) selecting said complex that binds to said target substance; (c') determining the amino acid sequence of a polypeptide contained in said complex selected in step (b); and (d') synthesizing a polypeptide based on the amino acid sequence determined in step (c').

Images