Novel mRNA expression platform and uses thereof

The novel mRNA expression platform using virus-derived IRES, 5'-UTR, and 3'-UTR addresses stability and immune response issues in existing vaccines, ensuring efficient and safe antigen expression with balanced immune induction.

WO2025220897A1PCT designated stage Publication Date: 2025-10-23POSTECH ACADEMY INDUSTRY FOUNDATION +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/003712
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-18
Filing Date
2025-03-24
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

Existing mRNA vaccines require additional modifications such as 5' capping and substitution of uridine with 1-methyl-pseudouridine to enhance stability and expression, leading to complications in manufacturing, increased costs, and adverse immune responses due to lipid structures, necessitating multiple doses and potential frame-shifting.

Method used

A novel mRNA expression platform utilizing a virus-derived IRES, 5'-UTR, and 3'-UTR without 5' cap or modified nucleic acids, incorporating a 5'-UTR from poliovirus, 3'-UTR from poliovirus, and an IRES from encephalomyocarditis virus or coxsackievirus, enabling efficient protein expression and immune response induction.

Benefits of technology

The platform achieves stable and long-lasting antigen expression with a balanced immune response, reducing the need for multiple doses and minimizing adverse effects, while allowing for rapid and cost-effective production in small-scale facilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025003712_23102025_PF_FP_ABST
    Figure KR2025003712_23102025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a novel mRNA expression platform based on the internal ribosome entry site (IRES) of encephalomyocarditis virus (EMCV), and uses thereof. The novel mRNA expression platform of the present invention is an uncapped / unmodified mRNA expression system that does not use a 5'-Cap or m1Ψ modified uridine nucleic acid, and induces an immune response effectively along with excellent antigen expression. Accordingly, it is possible to provide a more natural and cell-friendly mRNA expression system that is cost-effective by eliminating the need for expensive 5'-cap and m¹Ψ, prevents protein translation errors caused by frame-shifting, which is a problem of conventional mRNA expression systems containing m¹Ψ, and utilizes a translation system evolutionarily developed by viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Novel mRNA expression platform and its uses

[0001] The present invention relates to a novel mRNA expression platform based on a virus-derived IRES (internal ribosome entry site), 5'-UTR and 3'-UTR, and uses thereof.

[0002] mRNA serves as an intermediary between the translation of DNA encoding protein information and the production of proteins by cytoplasmic ribosomes. Optimal in vitro transcription of mRNA for therapeutic purposes is produced from a linear DNA template using T7, T3, or Sp6 phage RNA polymerase. This RNA typically contains an open reading frame (ORF) encoding the protein of interest, an untranslated region, a 5'-cap, and a poly(A) tail.

[0003] mRNA vaccines based on these mRNAs have been extensively researched and developed during the global pandemic caused by the severe acute respiratory syndrome coronavirus (SARS-CoV). Existing commercially available mRNAs required additional modifications, such as 5'capping, a 3'poly-A tail, and substitution of uridine with 1-methyl-pseudouridine, to enhance stability and expression efficiency. However, these mRNA vaccines require two or more doses due to the relatively low stability and short duration of expression of the mRNA itself. Furthermore, serious hyperimmune responses and adverse effects due to excessive injections of mRNA vaccines containing lipid structures have been consistently observed. For example, Pfizer Inc. and Moderna Inc. The COVID-19 mRNA vaccine uses a modified nucleic acid that is 5'-capped and contains m1Ψ (pseudo-uridine). While this process can induce a high immune response, it complicates the manufacturing process, increases production costs, and is known to cause frame-shifting during ribosomal translation, leading to the generation of mutant antigens. Therefore, various attempts are being made to address the known problems of these existing mRNA vaccines.

[0004] Accordingly, the inventors of the present invention completed the present invention by developing a novel mRNA expression platform based on a novel virus-derived IRES (internal ribosome entry site), 5'-UTR, and 3'-UTR after much effort.

[0005] One object of the present invention is to provide an mRNA construct comprising, in 5' to 3' order, a 5'-UTR region; an IRES (internal ribosome entry site) regulatory element; a base sequence encoding a target peptide; a 3'-UTR region; and a poly(A) base sequence.

[0006] In addition, another object of the present invention is to provide a gene construct comprising a DNA base sequence corresponding to or complementary to the base sequence of the mRNA structure, and a vector comprising the gene construct.

[0007] In addition, another object of the present invention is to provide a pharmaceutical composition comprising the mRNA structure, gene construct, and / or vector.

[0008] In addition, another object of the present invention is to provide a vaccine composition comprising the mRNA structure, gene construct, and / or vector.

[0009] The technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0010] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.

[0011] In addition, the terminology used in the present invention is for the purpose of description only and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly indicates otherwise. It should be understood that the terms “comprise” or “have” in the present invention are intended to specify the presence of a feature, number, step, operation, component, part or combination thereof described in the specification, but do not exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts or combinations thereof.

[0012] Additionally, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0013] Furthermore, to avoid confusion due to overlapping content, the description of overlapping content has been omitted. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.

[0014] The term “homology” as used herein means a sequence that exhibits at least 80% homology (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%), more preferably 90% homology (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%), when the sequence of the present invention and any other sequence are aligned to the greatest extent possible and the aligned sequence is analyzed using an algorithm commonly used in the art. All integers greater than or equal to 80% and less than or equal to 100% and decimals therebetween are included within the scope of the present invention with respect to % homology.

[0015] The term “fragment” as used herein typically refers to a shorter portion of a full-length sequence, for example, of a nucleic acid sequence or an amino acid sequence, while still retaining its intended function. Thus, a fragment typically consists of a sequence identical to a corresponding stretch within the full-length sequence. Preferred fragments of a sequence in the context of the present invention are those consisting of nucleotides or amino acids corresponding to a contiguous stretch of an entity, e.g., a contiguous stretch of an entity within the molecule from which the fragment is derived, which represents at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% of the total (i.e., full-length) molecule from which the fragment is derived.

[0016] The term "variant" in relation to a nucleic acid sequence herein will be recognized and understood by one of ordinary skill in the art, and is intended to refer to a variant of a nucleic acid sequence derived, for example, from another nucleic acid sequence. For example, a variant of a nucleic acid sequence may exhibit one or more nucleotide deletions, insertions, additions, and / or substitutions compared to the nucleic acid sequence from which the variant is derived. A variant of a nucleic acid sequence may be at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the nucleic acid sequence from which the variant is derived. A variant is a functional variant in the sense that the variant retains at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more of the function of the sequence from which it is derived. In one embodiment, a “variant” of a nucleic acid sequence can have at least 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% nucleotide identity over a stretch of at least 10, 20, 30, 50, 75, or 100 nucleotides of such nucleic acid sequence.

[0017] The term “functional variant” in the present invention refers to a polypeptide variant or polynucleotide variant having at least one activity of a heat.

[0018]

[0019] The novel mRNA expression platform of the present invention is a novel uncapped / unmodified mRNA expression system that uses an internal ribosome entry site (IRES) derived from a virus, particularly from EMCV (encephalomyocarditis virus), and does not use 5'-Cap or modified nucleic acids, thereby effectively inducing an immune response with excellent antigen expression effect.

[0020]

[0021] Accordingly, the present invention provides an mRNA construct comprising, in order from 5' to 3', a 5'-UTR region; an IRES (internal ribosome entry site) regulatory element; an RNA sequence encoding a target peptide; a 3'-UTR region; and a poly(A) base sequence. In the present invention, the IRES (internal ribosome entry site) regulatory element is not a coding region to be translated and therefore belongs to the 5'-UTR region. However, in this patent, only the RNA sequence preceding the IRES, excluding the IRES, is referred to as the 5'-UTR region, and the IRES portion is referred to separately as IRES.

[0022]

[0023] An untranslated region, or "UTR," refers to a region that is transcribed but not translated into an amino acid sequence, or to a corresponding region within an RNA molecule, such as an mRNA molecule. A UTR can be upstream of the open reading frame, referred to as the 5'-UTR region. A UTR can also be downstream of the open reading frame encoding the chimeric protein, referred to as the 3'-UTR region.

[0024] The 5'-Untranslated Region (5'-UTR) refers to a non-coding region of mRNA located at the 5' end of the translation initiation sequence (AUG), and plays a role in assisting or regulating translation of the ribosome. Exemplary 5'-UTR regions according to the present invention may include the cloverleaf structure of poliovirus, the cloverleaf structure of rhinovirus, or the cloverleaf structure of coxsackievirus. Specifically, the cloverleaf structure of poliovirus (SEQ ID NO: 2), the cloverleaf structure of rhinovirus (SEQ ID NO: 8), and the cloverleaf structure of coxsackievirus (SEQ ID NO: 9) may be considered. Specifically, the 5'-UTR region may comprise any one of the nucleic acid sequences selected from SEQ ID NOs: 2, 8 and 9, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof or a functional variant thereof, and more preferably, may comprise the cloverleaf structure of the poliovirus of SEQ ID NO: 2, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof or a functional variant thereof. In one embodiment, the 5'-UTR according to the present invention is SEQ ID NO: 2, 8 or 9. Preferably, it may be SEQ ID NO: 2.

[0025] These 5'-UTRs of Poliovirus are known to increase the stability of poliovirus mRNA.

[0026] The 3'-UTR region refers to a region of an mRNA located 3' to the translation termination codon (i.e., stop codon) and is essential for targeting the transcript to specific cellular compartments, particularly for mRNA localization and protein synthesis in highly polarized or differentiated cells.

[0027] In the present invention, the 3'-UTR region may be a 3'-UTR of poliovirus, a 3'-UTR of rhinovirus, or a 3'-UTR of coxsackievirus, and exemplary 3'-UTRs may include a 3'-UTR of Poliovirus 1 (SEQ ID NO: 3), a 3'-UTR of coxsackievirus (SEQ ID NO: 10), a 3'-UTR of rhinovirus (SEQ ID NO: 11), etc. Specifically, the 3'-UTR region may comprise any one of the nucleic acid sequences selected from SEQ ID NOs: 3, 10 and 11, a sequence showing at least 80% homology thereto, a fragment thereof or a functional variant thereof, and more preferably, may comprise the 3'-UTR of the poliovirus of SEQ ID NO: 3, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof or a functional variant thereof. In one embodiment, the 3'-UTR is SEQ ID NO: 3, 10 or 11. Preferably, it may be SEQ ID NO: 3. Such a 3'-UTR has the advantage of increasing mRNA stability or increasing translation efficiency in certain environments.

[0028] Here, the 3'-UTR may be from the same virus as the 5'-UTR or from a different virus.

[0029] The IRES (internal ribosome entry site) regulatory element is a part that forms a three-dimensional structure consisting of a stem-loop structure on mRNA as an internal ribosome entry site or ribosome binding site, and induces the initiation of mRNA translation. It is linked to a coding region (CR) consisting of an open reading frame (ORF) that encodes a target peptide, thereby helping to express the target polypeptide. For example, the coding region (CR) is located 3' to the IRES sequence or the 5'-UTR containing the IRES sequence, and forms a target sequence (TS) that encodes the target peptide. The target nucleic acid molecule is RNA, and the coding region (CR) may be composed of a transcript sequence of an open reading frame that encodes the target peptide. In particular, the system according to the present invention is optimized for protein expression, and has the characteristic that translation occurs well even without a cap structure at the 5' end.

[0030] That is, the IRES (internal ribosome entry site) regulatory element according to the present invention means an IRES base sequence that is operably linked to a coding region (CR) inserted in the form of an open reading frame.

[0031] In the mRNA structure according to the present invention, the IRES is a region where a translational initiation complex binds during the translation process of a peptide and / or protein expressed from a coding region (CR), and the IRES is a cis-acting base sequence that induces translation of the coding region (CR) by forming complex secondary and tertiary structures.

[0032] These IRES components are derived from, but are not limited to, encephalomyocarditis virus (EMCV). For example, the IRES is a wild-type IRES from EMCV or has some mutations added. Such a sequence can be represented, for example, by SEQ ID NO: 1. Alternatively, the IRES component is derived from, but is not limited to, Coxsachie virus (CV) or Coxsachie virus B3 (CVB3). For example, the IRES is a wild-type IRES from CV or CVB3 or has some mutations added. Such a sequence can be represented, for example, by SEQ ID NO: 7. That is, the IRES component according to the present invention can be an IRES derived from encephalomyocarditis virus (EMCV) or an IRES derived from Coxsachie virus or Coxsachie virus B3 (CVB3). Additionally, the IRES component may comprise any one of the nucleic acid sequences selected from SEQ ID NO: 1 or 7, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof, preferably SEQ ID NO: 1 or SEQ ID NO: 7, and more preferably SEQ ID NO: 1.

[0033] The IRES according to the present invention promotes protein translation initiation. In particular, when using an EMCV-derived IRES or an IRES derived from CV or CVB3, a target gene can be expressed with high efficiency. If the target gene is associated with immune enhancement, it can effectively induce immune enhancement in the target tissue. In particular, the viral IRES described above has the advantage of inducing strong protein expression in various cell types and environments.

[0034] Optionally, a nucleic acid sequence that can increase the expression efficiency of the coding region (CR) linked in the form of an open reading frame (ORF) may be further inserted. That is, multiple adenosines or nucleotides that can be transcribed into multiple adenosines (multiple adenosines; MA) may be inserted adjacent to the IRES element. For example, multiple adenosines (MA) may be inserted at the 5' end of the expression control sequence (ECS) of the target peptide of the RNA transcript, but the positions where multiple adenosines (MA) can be inserted are not limited thereto. In this case, other bases may be added or omitted in addition to adenosines.

[0035] A number of adenosines (MA) that can be inserted adjacent to the IRES regulatory element represent the transcript form. In one exemplary embodiment, 20 to 400, preferably 30 to 300, more preferably 30 to 200, and most preferably 30 to 100 consecutive adenosines or nucleotides transcribable into adenosines can be inserted adjacent to an expression control sequence (ECS) having an IRES sequence.

[0036]

[0037] The above target polypeptide refers to a polypeptide that is the target to be produced, and refers to any polypeptide that can be expressed using a transcription or translation system. For example, the target polypeptide may be a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a receptor and a fragment of a receptor, an antigen and a fragment or analog of an antigen, an antibody and an antibody fragment, a monoclonal antibody, a structural protein, a toxin protein, or the like, or any combination thereof. Preferably, it may be an antigen or a fragment thereof. "Antigen" refers to a molecule or structure containing one or more epitopes that induce, trigger, enhance, or stimulate a cellular and / or humoral immune response. Antigens may include, for example, proteins and polypeptides from pathogens such as viruses, bacteria, fungi, protozoa, plants, or tumors.

[0038] The RNA sequence encoding the target polypeptide according to the present invention possesses superior efficacy compared to using nucleic acid molecules in DNA form due to its RNA form. In particular, mRNA synthesis is possible using in vitro transcription (IVT), which, compared to gene expression systems using conventional DNA, allows for faster protein expression and higher protein expression levels. Therefore, this method should be considered in contrast to DNA.

[0039] First, unlike DNA, RNA nucleic acid molecules do not need to enter the host cell nucleus for transcription into mRNA. Because RNA nucleic acid molecules can synthesize desired peptides or proteins within the cytoplasm, RNA nucleic acid molecules have an advantage over DNA in terms of expression within the human body. Specifically, RNA nucleic acid molecules are unlikely to integrate into the host chromosome within the nucleus. Furthermore, antibiotic resistance genes, which are selectable markers used for selective production in host cells, are unnecessary for RNA nucleic acid molecules. Furthermore, RNA has a shorter half-life than DNA, so it does not induce persistent genetic transformation. While conventional nucleic acid molecules are delivered into cells, activated for a short period to express target peptides / proteins, and are then enzymatically destroyed within a few days, a specific immune response to the initially expressed target peptides / proteins remains.

[0040] Second, nucleic acid molecules in the RNA form can induce a desired immune response in vivo even at relatively lower doses compared to DNA. As mentioned above, unlike DNA, RNA nucleic acid molecules do not need to enter the nucleus; they only need to pass through the cell membrane. Therefore, using RNA nucleic acid molecules allows for the expression of the same level of target peptide / protein as DNA, even at lower doses.

[0041] Third, because all manufacturing processes can be artificially controlled, vaccines can be safely produced in small-scale GMP (Good Manufacturing Practice) production facilities without the risk of biological contamination. In other words, nucleic acid molecules in the form of RNA require only small-scale GMP laboratory-level facilities, and because they do not require direct handling of infectious agents (viruses or pathogenic microorganisms), they can rapidly manufacture and produce a variety of vaccines.

[0042] Fourth, nucleic acid molecules in RNA form can induce a stronger immune response than naked DNA nucleic acid molecules. This is thought to be due to the cooperative interaction of the innate immune response induced by the stem-loop structure of RNA nucleic acid molecules and the inherent properties of RNA itself, and the adaptive immune response induced by target peptides / proteins expressed in immunized host cells.

[0043] Fifth, RNA nucleic acid molecules are easy to produce. As mentioned above, large quantities of RNA nucleic acid molecules can be produced solely through in vitro transcription (IVT). Recent improvements in IVT reagents, particularly DNA-dependent RNA polymerase, have enabled rapid production of large quantities of RNA within one to two weeks using a small amount of DNA template. Furthermore, multiple antigens intended to induce an immune response can be simultaneously produced, mixed, and then administered for immunization.

[0044] Against this backdrop, the mRNA structure according to the present invention has high utility in terms of the IVT mRNA expression system by including the above-mentioned components.

[0045] In particular, the mRNA construct according to the present invention may not include a 5' terminal cap structure. Furthermore, it may not include a modified nucleic acid. Such modified nucleic acid refers to any nucleic acid modification form, including, but not limited to, N1-methylpseudo uracil, 5-methyl cytosine, N1-methylpseudo uracil, 5-methyl cytosine, etc. Preferably, it does not include N1-methylpseudo uracil.

[0046] The above poly(A) base sequence refers to a base sequence in which multiple adenosine monophosphates are linked via phosphodiester bonds. The above poly(A) base sequence may have a length of 20 nt to 500 nt, for example, a length of 30 nt to 450 nt, 50 nt to 400 nt, or 100 nt to 350 nt.

[0047] The above poly(A) base sequence may be positioned downstream of the base sequence encoding the target peptide. The downstream refers to the portion following the 3'-terminus of the base sequence encoding the target peptide. Therefore, the poly(A) base sequence may be positioned following the 3'-terminus of the base sequence encoding the target peptide. At this time, the poly(A) base sequence may be connected immediately following the 3'-terminus of the base sequence encoding the target peptide, or an arbitrary base sequence may be inserted between the 3'-terminus of the base sequence encoding the target peptide and the poly(A) base sequence.

[0048] In the case of an mRNA structure in which a poly(A) base sequence is positioned downstream of a base sequence encoding the target peptide as described above, not only does it exhibit high structural stability even within the cytoplasm of a target cell after being introduced into the cell, but it can also actively induce expression of a target peptide with full functionality for a long period of time.

[0049]

[0050] In addition, the present invention provides a gene construct comprising a DNA base sequence corresponding to or complementary to the base sequence of the mRNA structure, and a vector comprising the gene construct.

[0051] The DNA base sequence corresponding to the base sequence of the mRNA structure refers to a DNA base sequence that is identical to the base sequence of the mRNA structure except that uracil (U) is changed to thymine (T). In addition, the DNA base sequence complementary to the mRNA structure refers to a DNA sequence that has an antisense base sequence to the DNA base sequence corresponding to the base sequence of the mRNA structure.

[0052] A gene construct containing a DNA base sequence corresponding to or complementary to the base sequence of the mRNA structure of the present invention can be used in a form included in a vector for storage or utilization.

[0053] For example, in one embodiment, the vector can be transformed into a cell by itself. In this case, the genetic construct is stably or permanently transformed, and the target peptide can be transcribed and translated from the vector using the transcription and translation systems of the transformant, thereby expressing the target protein or polypeptide.

[0054] Meanwhile, in another embodiment, mRNA can be produced through in vitro transcription using the vector as a template, and this can be transformed into a cell. In this case, the mRNA can be temporarily transformed, and the target protein or polypeptide can be translated using the translation system of the transformant to express the target protein or polypeptide. In the case of mRNA obtained through in vitro transcription using the vector as a template, since a poly(A) base sequence is included downstream of the base sequence encoding the target protein or peptide, even if introduced into a cell, it can exist very stably in the cytoplasm of the cell and express the target protein or polypeptide for a long time.

[0055] Accordingly, another aspect of the present invention provides a method for producing mRNA with improved stability, comprising a step of performing in vitro transcription using the vector as a template.

[0056] The above in vitro transcription refers to the process of synthesizing RNA in a test tube using RNA polymerase, its cofactors, substrate NTPs, and template DNA, and is widely known to those skilled in the art to which the present invention pertains. Therefore, those skilled in the art to which the present invention pertains can perform the above process using an appropriate method.

[0057] In particular, in the case of the mRNA production method of the present invention, since a base sequence corresponding to or complementary to a poly(A) base sequence is included in the gene construct included in the vector, only the in vitro transcription as described above needs to be performed, and poly(A) tailing may not be performed separately or additionally in vitro after the in vitro transcription.

[0058] That is, a gene construct comprising a DNA base sequence corresponding to or complementary to the base sequence of the mRNA structure of the present disclosure, and a vector comprising the gene construct, suitable production methods of which will be apparent to those skilled in the art and will be described herein.

[0059] In one example, it can be produced via plasmid DNA. Those skilled in the art will appreciate that plasmid DNA is relatively stable. Briefly, competent bacterial cells (e.g., Escherichia coli) are transformed with a DNA plasmid encoding the mRNA construct of the present disclosure. Individual bacterial colonies are isolated, and the resulting plasmid DNA is amplified in the E. coli culture. In one example, the plasmid DNA is isolated after fermentation. For example, the plasmid DNA is isolated using a commercially available kit (e.g., the Maxiprep DNA kit) or other routine methods known to those skilled in the art. After isolation, the plasmid DNA is linearized by restriction digestion (i.e., using a restriction enzyme). The restriction enzyme is removed using methods known in the art, such as phenol / chloroform extraction and ethanol precipitation.

[0060] In one example, mRNA is produced by in vitro transcription from a linearized DNA template using an RNA polymerase (e.g., T7 RNA polymerase). After in vitro transcription, the DNA template is removed by DNase digestion or another isolation method. The mRNA construct according to the present invention exhibits high stability without a capping process, thereby eliminating the need for additional processes such as production and enabling production without the use of modified nucleic acids. The mRNA is purified, and various methods for purifying mRNA will be apparent to those skilled in the art. For example, the mRNA is purified using lithium chloride (LiCl) precipitation. In another example, the mRNA is purified using tangential flow filtration (TFF). After purification, the mRNA is resuspended, for example, in nuclease-free water.

[0061]

[0062] The term "transcription control / regulation sequence" or "transcription control / regulation element" refers to a nucleic acid sequence that controls the transcription of a nucleic acid. Transcription control sequences include promoters such as constitutive promoters or inducible promoters, or enhancers. Additionally, the term "translation control / regulation sequence" or "translation control / regulation element" may be used for a nucleic acid sequence that controls the translation of a nucleic acid in transcript form into a protein or polypeptide. These expression control sequences / elements, transcription control sequences / elements, and / or translation control sequences / elements are operatively linked to a sequence to be expressed, for example, a nucleic acid sequence to be transcribed or translated (a target peptide sequence according to the present invention).

[0063] The term "operatively linked" in the present invention means a functional linkage between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, a ribosome binding site, a transcription termination sequence, etc.) and another nucleic acid sequence, whereby the regulatory sequence regulates transcription and / or translation of the other nucleic acid sequence.

[0064] To insert a coding region (CR) into a nucleic acid molecule, the nucleic acid molecule may comprise one or more cloning sites, preferably multiple cloning sites (MCS). The one or more cloning sites may comprise one or more restriction endonuclease recognition sequences and / or sequences that are cleaved by the restriction enzyme. The restriction enzyme may include natural restriction enzymes found in bacteria or archaea, as well as artificially manufactured restriction enzymes (e.g., restriction enzymes based on the DNA binding site of zinc finger nuclease or TAL effector, or PNA-based PNAzymes, etc.).

[0065] For example, naturally occurring restriction enzymes can be classified into 1) Type Ⅰ restriction enzymes (cuts away from the recognition site and requires ATP, S-adenoxyl-L-methionine, and magnesium ions), 2) Type Ⅱ restriction enzymes (cuts at a specific site within or slightly away from the recognition site and mostly requires magnesium ions), 3) Type Ⅲ restriction enzymes (cuts away from the recognition site and requires ATP but not ATP hydrolysis), 4) Type Ⅳ restriction enzymes (targets modified sites such as methylation, hydroxymethylation, or glucosyl-hydroxymethylation), and 5) Type Ⅴ restriction enzymes (CRISPRs cas9-gRNA complex).

[0066] For example, the following restriction enzyme recognition sites and / or restriction enzyme cleavage sites (restriction enzymes) may be used: 5'-ATCGAT-3'(AngⅠ), 5'-AGGCCT-3'(AatⅠ), 5'-TGATCA-3'(AbaⅠ), 5'-GGATCC-3'(BamHⅠ), 5'-GCAGC(N)8-3'(BbvⅠ), 5'-(N)10CGA(N)6TGC(N)12-3'(BcgⅠ), 5'-(N)8GAG(N)5CTC(N)13-3'(BplⅠ), 5'-GTCTC(N)-3'(BsmAI; Alw26Ⅰ), 5'-ACTGGN-3'(BsrⅠ), 5'-ATCGAT-3'(ClaⅠ), 5'-CTCTTCN-3'(EarⅠ), 5'-CTGAAG(N)16-3'(Eco57Ⅰ), 5'-GAATTC-3'(EcoRⅠ), 5'-CCWGG-3'(EcoRⅡ; W is A or T), 5'-GATATC-3'(EcoRⅤ), 5'-GGATG(N)9-3'(FokⅠ), 5'-GGCC-3'(HaeⅢ), 5'-AAGCTT-3'(HindⅢ), 5'-CCGG-3'(HpaⅢ), 5'-GGTGA(N)8-3'(HphⅠ), 5'-GGTACC-3'(KpnⅠ), 5'-GATC-3'(MboⅠ), 5'-ACGCGT-3'(MluⅠ), 5'-GCCGGC-3'(NaeⅠ), 5'-GATATG-3'(NdeⅡ), 5'-GCCGGC-3'(NgoMⅣ), 5'-CATG-3'(NlaⅢ), 5'-GCGGCCGC-3'(NotⅠ), 5'-ATGCAT-3'(NsiⅠ), 5'-TTAATTAA-3'(PacⅠ), 5'-CTGCAG-3'(PstⅠ), 5'-GAGCTC-3'(SacⅠ), 5'-CCGCGG-3'(SacⅡ), 5'-GTCGAC-3'(SalⅠ), 5'-GCATC(N)5-3'(SfaNⅠ), 5'-CCCGGG-3'(SmaⅠ), 5'-TCGA-3'(TaqⅠ), 5'-TCTAGA-3'(XbaⅠ), 5'-CTCGAG-3'(XhoⅠ), and combinations thereof.The coding region (CR), i.e., the sequence encoding the target polypeptide, is located between the 5'-UTR and the 3'-UTR, and the 3'-UTR, together with the 5'-UTR, plays an important role in improving the translation efficiency of the gene or its transcript forming the coding region (CR) and ensuring that the transcript, mRNA, is maintained stably without being destroyed within the cell.

[0067]

[0068] The mRNA expression construct may further include a transcription control sequence (TCS) adjacent to the 5'-UTR that promotes transcription of the polynucleotide. For example, the transcription control sequence (TCS) may be located on the 5' side of the 5'-UTR. Such a transcription control sequence (TCS) is not particularly limited.

[0069] The term "vector" of the present invention refers to a structure that is capable of being delivered to a host cell and preferably capable of expressing one or more target genes or sequences. Examples of vectors include viral vectors, DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors linked to cationic condensing agents (CCA), DNA or RNA expression vectors packaged as liposomes, certain eukaryotic cells such as producer cells, etc.

[0070] Meanwhile, constitutive or inducible promoters may be used in the present invention, depending on the specific circumstances, as can be determined by those skilled in the art. Numerous promoters recognized by various host cells are well known. A selected promoter can be operably linked to a nucleic acid molecule comprising a coding region (CR) comprising the open reading frame (ORF) of a gene or transcript encoding a target peptide by removing the promoter from the source nucleic acid molecule through restriction enzyme digestion and inserting the isolated promoter sequence into a selection vector.

[0071] For example, when the vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it is common to include a strong promoter capable of driving transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter, etc.). When E. coli is used as a host cell, E. The promoter and operator regions of the tryptophan biosynthetic pathway of B. coli (Yanofsky, C., J. Bacteriol., 158:1018-1024(1984)) and the left-hand promoter of phage λ (pLλ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14:399-445(1980)) can be used as regulatory regions.

[0072] Meanwhile, when the vector of the present invention is an expression vector and uses a eukaryotic cell as a host, a promoter derived from the genome of a mammalian cell (e.g., metallothionine promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) or a promoter derived from a bacteriophage (e.g., T7 promoter, T3 promoter, SM6 promoter) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0073] Additionally, if the recombinant vector of the present invention is a replicable expression vector, it may include a replication origin, which is a specific nucleic acid sequence at which replication is initiated.

[0074] Meanwhile, as an illustrative example, the recombinant plasmid vector may be one whose expression is controlled by an inducible promoter. For example, the inducible promoter may be any one selected from the group consisting of a T7 promoter, a tac promoter, a lac promoter, a lacUV5 promoter, an lpp promoter, a pLλ promoter, a pRλ promoter, a rac5 promoter, an amp promoter, a recA promoter, an SP6 promoter, and a trp promoter. Preferably, a T7 promoter may be used.

[0075] The mRNA expression construct of the present invention has an advantage in terms of safety in that it does not induce excessive T cell activation and thus has a low risk of adverse effects such as pericarditis that may be caused by excessive T cell induction. In addition, it has the advantage of evenly producing both type 1 and type 2 immune responses by producing not only IgG1 antibodies, a representative indicator of type 2 immune responses, but also IgG2a, an indicator of type 1 immune responses.

[0076] Type 1 immune response is an immune response originating from Th1 CD4 T cells, which secretes inflammatory cytokines such as IL-2 and IFN-r, thereby directly removing infected antigens and inducing IgG2 antibody production. Type 2 immune response is an immune response originating from Th2 CD4 T cells, which secretes cytokines such as IL-4, IL-10, and IL13, thereby inducing tissue recovery and strong IgG1a antibody production.

[0077] Type 1 immune response induces a strong inflammatory response to kill virus-infected cells and respond to the initial viral infection situation, while type 2 immune response repairs wound tissue created by inflammation and induces a long-term immune response through antibody production.

[0078] Therefore, in viral immunity, if one response is more dominant than the other, it can lead to side effects due to excessive immune response, or a weakened viral response due to an insufficient immune response. Therefore, a balanced occurrence of type 1 / type 2 immune responses is ideal for mRNA vaccine treatment. Therefore, the mRNA expression construct of the present invention is a novel vaccine model that can evenly generate both type 1 and type 2 immune responses.

[0079]

[0080] The present invention provides a pharmaceutical composition comprising the mRNA structure, gene construct, and / or vector.

[0081] Another aspect of the present invention provides a pharmaceutical composition comprising the mRNA structure, gene construct, and / or vector described above; and a pharmaceutically acceptable carrier.

[0082] The pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier, and may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. The most preferred form of the pharmaceutical composition is an injectable solution.

[0083] When the pharmaceutical composition of the present invention is formulated as a solid oral preparation, it includes tablets, pills, powders, granules, capsules, etc., and such solid preparations may include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., and include, but are not limited to, lubricants such as magnesium stearate and talc.

[0084] When the pharmaceutical composition of the present invention is formulated as an oral liquid, it includes a suspension, a solution, an emulsion, a syrup, etc., and includes, but is not limited to, a diluent such as water or liquid paraffin, a wetting agent, a sweetener, a fragrance, a preservative, etc.

[0085] When the pharmaceutical composition of the present invention is formulated for parenteral use, it includes a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, and a suppository. Non-aqueous solvents and suspensions include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Bases for suppositories include, but are not limited to, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin.

[0086] The pharmaceutical composition may be administered in single or multiple doses in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to prevent or treat a disease without compromising the efficacy of the therapeutic agent, particularly when administered in combination with a therapeutic agent, at a reasonable benefit / risk ratio applicable to medical immunostimulation. The effective dosage level may be determined according to factors including the severity of the disease, the activity of the drug, the patient's age, weight, health, and sex, the patient's sensitivity to the drug, the time of administration, route of administration, and excretion rate of the composition of the present invention used, the duration of treatment, drugs combined with or used concurrently with the composition of the present invention used, and other factors well known in the medical field.

[0087] The pharmaceutical composition according to the present invention can be administered to mammals such as rats, mice, livestock, and humans by various routes, for example, but not limited to, oral administration, intrathecal, intra-auricular, intraperitoneal or intravenous, intramuscular, subcutaneous, intrauterine, sublingual, or intracerebrovascular injection.

[0088] The pharmaceutical composition of the present invention may contain an mRNA structure, gene construct or vector in an amount of 0.01 to 95 wt%, preferably 1 to 80 wt%, based on the total weight of the composition.

[0089]

[0090] The mRNA constructs, gene constructs, and / or vectors of the present invention are designed to be introduced into mammalian cells and expressed therein. Such compositions may be particularly useful for the treatment and / or prevention of diseases. Numerous methods exist for expressing the mRNA constructs, gene constructs, and / or vectors in host cells, and any suitable method may be used.

[0091] For example, the mRNA constructs, gene constructs, and / or vectors according to the present invention can be inserted into viral vectors such as encephalomyocarditis virus (EMCV), adenovirus, adeno-associated virus, retrovirus, vaccinia, or other poxviruses (e.g., avian pox virus).

[0092] According to one exemplary embodiment, the mRNA construct described above can be inserted into a suitable vector and then transformed into a nucleic acid molecule in the form of RNA through in vitro transcription (IVT).

[0093] Many vectors available and known in the art can be used for the purposes of the present invention. The selection of an appropriate vector will primarily depend on the size of the nucleic acid molecule to be inserted into the vector and the particular host cell to be transformed with the vector.

[0094] The pharmaceutical composition further comprises lipid nanoparticles (LNPs), polymeric microparticles, and oil-in-water emulsions. For example, a polynucleotide, RNA, cRNA, or self-replicating RNA is encapsulated, bound to, or adsorbed in the LNPs, polymeric microparticles, and oil-in-water emulsions. In one example, the polynucleotide is encapsulated, bound to, or adsorbed in the LNPs, polymeric microparticles, and oil-in-water emulsions. In another example, the RNA is encapsulated, bound to, or adsorbed in the LNPs, polymeric microparticles, and oil-in-water emulsions.

[0095] In one example, the pharmaceutical composition further comprises an LNP. For example, an mRNA construct is encapsulated in the LNP. In another example, RNA is encapsulated in the LNP. In another example, RNA is adsorbed to the LNP.

[0096] In one example, the LNP comprises a PEG-lipid, a structural lipid, and / or a neutral lipid. For example, the LNP comprises a PEG-lipid, a structural lipid, and / or a neutral lipid. In another example, the LNP comprises a PEG-lipid, a structural lipid, and / or a neutral lipid. In one example, the LNP further comprises a cationic lipid. In another example, the LNP does not comprise a cationic lipid.

[0097] In one example, the pharmaceutical composition further comprises polymeric microparticles. For example, a polynucleotide is encapsulated in the polymeric microparticles. In another example, RNA is encapsulated in the polymeric microparticles. In another example, RNA is bound to the polymeric microparticles. In another example, RNA is adsorbed onto the polymeric microparticles.

[0098] In one example, the pharmaceutical composition further comprises an oil-in-water emulsion. For example, the polynucleotide is encapsulated in the oil-in-water emulsion. In another example, the RNA is encapsulated in the oil-in-water emulsion. For example, the RNA is bound to the oil-in-water emulsion.

[0099]

[0100] The present invention provides a method for preventing or treating a disease or condition in a subject, comprising administering a pharmaceutical composition of the present invention to a subject in need of administration.

[0101] The present invention provides the use of a pharmaceutical composition of the present invention in the manufacture of a medicament for preventing or treating a disease or condition in a subject in need thereof.

[0102] The present invention provides a method of inducing an immune response in a subject, comprising administering to the subject a pharmaceutical composition of the present invention.

[0103] The present invention also provides the use of a pharmaceutical composition of the present invention in the manufacture of a medicament for inducing an immune response in a subject in need thereof.

[0104] The term "subject" of the present invention includes an animal or human whose symptoms can be improved by administration of a pharmaceutical composition according to the present invention.

[0105] The term "administration" in the present invention refers to introducing a given substance into a human or animal by any suitable method. The pharmaceutical composition according to the present invention may be administered orally or parenterally via any common route, as long as it can reach the target tissue. Furthermore, the pharmaceutical composition according to the present invention may be administered by any device capable of transporting the active ingredient to target cells.

[0106]

[0107] The present invention also provides an immunogenic composition comprising the mRNA structure, gene construct, vector and / or pharmaceutical composition for use as a vaccine.

[0108] For example, administration of the composition induces a humoral and / or cell-mediated immune response. In one example, the composition induces a humoral immune response in the subject. For example, the humoral immune response is an antibody-mediated immune response. In another example, the composition induces a cell-mediated immune response. For example, the cell-mediated immune response induces antigen-specific cytotoxicity and activation of helper T cells.

[0109] Such immunogenic compositions may additionally comprise an immunostimulant.

[0110] The term "adjuvant" in the present invention generally refers to any substance that enhances the humoral or cellular immune response to an antigen. Adjuvants are used to achieve two purposes: slowing the release of antigen from the injection site and stimulating the immune system.

[0111] Immunostimulants include protamine, nucleolin, spermine, spermidine and cationic polysaccharides, stabilized cationic peptides or polypeptides, in particular chitosan, TDM, MDP, muramyl dipeptide, pluronic, alum solution, aluminum hydroxide, ADJUMER (polyphosphazene); aluminum phosphate gel; glucans of algae; algammulin; aluminum hydroxide gel (alum); high protein-adsorbing aluminum hydroxide gel; low viscosity aluminum hydroxide gel; AF or SPT (emulsion of squalane (5%), Tween-80 (0.2%), PLURONIC-L121 (1.25%), phosphate-buffered saline, pH 7.4); AVRIDINE (propanediamine); BAY R1005 ((N-(2-deoxy-2-L-leucylamino-bD-glucopyranosyl)-N-octadecyldodecanoyl-amide hydroacetate); CALCITRIOL (1α,25-dihydroxy-vitamin D3); calcium phosphate gel; CAPTM (calcium phosphate nanoparticles); cholera holotoxin, cholera-toxin-A1-protein-AD-fragment fusion protein, subunit B of cholera toxin; CRL 1005 (block copolymer P1205); cytokine-loaded liposome; DDA (dimethyldioctadecylammonium bromide); DHEA (dehydroepiandrosterone); DMPC (dimyristoyl phosphatidylcholine); DMPG (dimyristoyl phosphatidylglycerol); DOC / alum complex (deoxycholic acid sodium salt); Freund's complete adjuvant; Freund's incomplete adjuvant; gamma inulin; Gerbu's adjuvant (mixture of N-acetylglucosaminyl-(p1-4)-N-acetylmuramyl-L-alanyl-D-glutamine (GMDP), dimethyldioctadecylammonium chloride (DDA), and zinc-L-proline complex (ZnPro-8); GM-CSF); GMDP (N-acetylglucosaminyl-(b1-4)-N-acetylmuramyl-L-alanyl-D-isoglutamine); Miquimod (1-(2-methylpropyl)-1H-imidazo[4,5-c]quinolin-4-amine); ImmTher (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-glycerol dipalmitate); DRV (immunoliposomes prepared from dehydration-rehydration vesicles); interferon-gamma; interleukin-1beta; interleukin-2; interleukin-7; interleukin-12; ISCOMS ("Immunostimulating Complexes"); ISCOPREP 7.0.3.; liposomes; LOXORIBINE (7-allyl-8-oxoguanosine (guanine)); LT oral adjuvant (E.coli labile enterotoxin-protoxin); Microspheres and microparticles of composition; MF59; (squalene-water emulsion); MONTANIDE ISA 51 (purified incomplete Freund's adjuvant); MONTANIDE ISA 720 (metabolizable oil adjuvant); MPL (3-Q-desacyl-4'-monophosphoryl lipid A); MTP-PE and MTP-PE liposomes ((N-acetyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1,2-dipalmitoyl-sn-glycero-3-(hydroxyphosphoryloxy))-ethylamide, monosodium salt); MURAMETIDE (Nac-Mur-L-Ala-D-Gln-OCH3); MURAPALMITINE and D-MURAPALMITINE (Nac-Mur-L-Thr-D-isoGln-sn-glycerodipalmitoyl); NAGO (neuraminidase-galactose oxidase); nanospheres or nanoparticles of the composition; NISV (nonionic surfactant vehicle); PLEURAN (beta-glucan); PLGA, PGA and PLA (homopolymers and copolymers of lactic acid and glycolic acid; Microspheres / nanospheres); PLURONIC L121; PMMA (polymethyl methacrylate); PODDS (proteinoid microspheres); polyethylene carbamate derivatives; poly-rA: poly-rU (polyadenylic acid-polyuridylic acid complex); polysorbate 80 (Tween 80); protein cochleate (Avanti Polar Lipids, Inc., Alabaster, AL); STIMULON (QS-21); Quil-A (Quil-A saponin); S-28463 (4-amino-otec-dimethyl-2-ethoxymethyl-1H-imidazo[4,5-c]-quinoline-1-ethanol); SAF-1 ("Syntex adjuvant preparation"); Sendai proteoliposomes and Sendai-containing lipid matrices; Span-85 (sorbitan trioleate); Specol (emulsion of Marcol 52, Span 85, and Tween 85); Squalene or Robane (2,6,10,15,19,23-hexamethyltetracosane and 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexane); Stearyltyrosine (octadecyltyrosine hydrochloride); Theramid (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-dipalmitoxypropylamide); Threonyl-MDP (Termurtide or [thr-1]-MDP; N-acetylmuramyl-L-threonyl-D-isoglutamine); Ty particles (Ty-VLPs or virus-like particles); Walter-Reed liposomes (liposomes comprising lipid A adsorbed to aluminum hydroxide), and the like.

[0112]

[0113] The present invention provides a pharmaceutical composition for preventing or treating viral infection comprising the mRNA structure, gene construct, and / or vector.

[0114] For example, the viral infection may be related to influenza, rhinovirus, respiratory syncytial virus, coronavirus, coxsackievirus, echovirus, Nipah virus, dengue virus, norovirus, rotavirus, SFTS virus, etc. Accordingly, the RNA sequence encoding the target peptide may be a viral antigen. More specifically, it may be an RNA sequence encoding a peptide derived from an orthomyxovirus (e.g., influenza A, B, and C), a paramyxoviridae virus (pneumoviruses such as respiratory syncytial virus (RSV), bovine respiratory syncytial virus, pneumonia virus of mice, and turkey rhinotracheitis virus), a paramyxovirus (PIV) such as Nipah virus, and a metapneumovirus such as human metapneumovirus (hMPV) and avian metapneumovirus (aMPV)), a picornavirus (e.g., rhinovirus, echovirus, Coxsackievirus) and a coronavirus (e.g., severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV), SARS coronavirus 2 (SARS-CoV-2), Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV), avian infectious bronchitis virus (IBV), mouse hepatitis virus (MHV)).

[0115] Preferably, it may be an RNA sequence encoding a peptide derived from SARS coronavirus 2 (SARS-CoV-2). For example, it may be a sequence encoding the spike (S) protein and / or nucleocapsid (N) peptide of SARS coronavirus 2 (SARS-CoV-2) or a known mutant thereof. For example, it may be an alpha, beta, gamma, delta, lambda, or omicron mutant. According to one embodiment of the present invention, the RNA encoding the peptide derived from SARS coronavirus 2 (SARS-CoV-2) is an RNA encoding an omicron mutant antigen. An exemplary sequence of such is shown in SEQ ID NO: 4, and an antigen sequence prepared therefrom is shown in SEQ ID NO: 12.

[0116] The novel mRNA expression platform of the present invention is a novel uncapped / unmodified mRNA expression system that does not use 5'-Cap and m1Ψ-modified uridine nucleic acids, effectively inducing an immune response along with excellent antigen expression effects. This is economical because it does not use the existing expensive 5'-Cap / m1Ψ, and prevents protein translation errors due to frame-shifting, which is a problem of existing mRNA expression systems containing m1Ψ. In addition, it can provide a more natural and cell-friendly mRNA expression system by utilizing the translation system that viruses have evolved to develop.

[0117] In addition, the novel mRNA expression platform of the present invention has the effect of improving side effects compared to existing mRNA vaccines due to lower viral toxicity and administration substance toxicity.

[0118] In addition, the EMCV-IRES vaccine has a remarkable effect in that it not only produces IgG1 antibodies, which are representative indicators of type 2 immune responses, but also produces IgG2a, which is an indicator of type 1 immune responses, thereby enabling both type 1 and type 2 immune responses to occur evenly.

[0119] FIG. 1 is a diagram showing a vector configuration for an EMCV-IRES mRNA expression platform according to the present invention.

[0120] FIG. 2 is a drawing showing a vector configuration designed to express Omicron-spike on an EMCV-IRES mRNA expression platform according to the present invention.

[0121] Figure 3 shows the results of confirming the expression of the Omicron-spike protein manufactured according to the vector configuration of Figure 2.

[0122] Figure 4 shows the results of confirming the in vivo expression effect of the designed EMCV-IRES mRNA expression platform by administering it to mice after LNP encapsulation.

[0123] Figure 5 shows the results of confirming the formation of target antigen-specific antibodies after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to mice.

[0124] Figure 6 shows the results of confirming the formation of neutralizing antibodies after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to mice.

[0125] Figure 7 shows the results of confirming an increase in target antigen-specific T cell responses after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to mice.

[0126] Figure 8 shows the results of confirming the change in body weight after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to hACE2 transgenic mice.

[0127] Figure 9 shows the results of confirming the macroscopic pneumonia lesion improvement rate (%) after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to hACE2 transgenic mice.

[0128] Figure 10 shows the results of confirming the level of immune neutralizing antibody production after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to hACE2 transgenic mice.

[0129] Figure 11 shows the results of confirming the survival rate after administering the EMCV-IRES mRNA expression platform designed to express the Omicron-spike gene to hACE2 transgenic mice.

[0130] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0131] Example 1. Design of the EMCV-IRES mRNA expression system

[0132] To construct an expression system that can express mRNA well regardless of capping, a vector was designed using the following sequences. For this purpose, the EMCV-IRES and the 3'-UTR and 5'-UTR derived from Poliovirus were used. Specifically, as shown in Figure 1, the EMCV-IRES was positioned following the 5'-UTR, followed by the GOI (Gene of Interest) for expression. The vector was then constructed so that the 3'UTR and poly(A) could be connected.

[0133] 벡터 구성요소5'→3'EMCV-IRES(서열번호 1)tccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgctgataa5'UTR(서열번호 2)ttaaaacagctctggggttgtacccaccccagaggcccacgtggcggctagtactccggtattgcggtacccttgtacgcctgttttata3'UTR(서열번호 3)ccctacctcagtcgaattggattgggtcatactgttgtaggggtaaatttttctttaattcggag

[0134] As an example, a vector was constructed by including the spike of the SARS-CoV-2 omicron virus in the EMCV-IRES mRNA expression platform. The optimal spike protein sequence was predicted through structural analysis of the spike protein and is shown in SEQ ID NO: 4. This was used as the GOI mentioned above. For cloning into the EMCV-IRES mRNA vector, the GOI was cloned into a plasmid vector using restriction enzymes and DNA ligase, and the plasmid DNA was purified. Subsequently, IVT mRNA (in vitro transcribed mRNA) was synthesized using unmodified uridine, and an exemplary structure thereof is shown in Figure 2. The poly(A) included in the vector is shown in SEQ ID NO: 5, and the full-length vector sequence is shown in SEQ ID NO: 6.

[0135]

[0136] Example 2. Design of an IRES mRNA expression system

[0137] Similar to Example 1 above, in order to construct an expression system configuration that can express mRNA well regardless of whether capping is used, a vector was designed using the following sequences.

[0138] In place of the EMCV-IRES, 5'-UTR and 3'-UTR individually described in SEQ ID NOs: 1, 2 and 3 above, the sequences for additionally configurable IRES, 5'-UTR and 3'-UTR are described in Table 2 below.

[0139] 벡터 구성요소5'→3'CVB3-IRES(서열번호 7)aactgtaacttagaagtaacacacaccgatcaacagtcagcgtggcacaccagccacgttttgatcaagcacttctgttaccccggactgagtatcaatagactgctcacgcggttgaaggagaaagcgttcgttatccggccaactacttcgaaaaacctagtaacaccgtggaagttgcagagtgtttcgctcagcactaccccagtgtagatcaggtcgatgagtcaccgcattccccacgggcgaccgtggcggtggctgcgttggcggcctgcccatggggaaacccatgggacgctctaatacagacatggtgcgaagagtctattgagctagttggtagtcctccggcccctgaatgcggctaatcctaactgcggagcacacaccctcaagccagagggcagtgtgtcgtaacgggcaactctgcagcggaaccgactactttgggtgtccgtgtttcattttattcctatactggctgcttatggtgacaattgagagattgttaccatatagctattggattggccatccggtgaccaatagagctattatatatctctttgttgggtttataccacttagcttgaaagaggttaaaacattacaattcattgttaagttgaatacagcaaaatg5'UTR(서열번호 8)ttaaaactggatctgggttgttcccacccagatcacctacatggtgttgtacactattattacggtaatcttgtacgccagttttatactccctttccc5'UTR(서열번호 9)ttaaaacagcctgtgggttgatcccacccacagggcccattgggcgctagcactctggtatcacggtacctttgtgcgcctgttttataccccctccccc3'UTR(서열번호10)Tagattagagacaatttgaaataatttagattggcttaaccctactgtgctaaccgaaccagataacggtacagtaggggtaaattctccgcattcggtgcg3'UTR (SEQ ID NO: 11)atatagaattaataaatgaatagtttgttagttttat

[0140] An expression system was constructed by combining the IRES, 5'-UTR, and 3'-UTR mentioned similarly to Example 1 above.

[0141]

[0142] Example 3. Confirmation of target antigen expression (in cellulo) using the EMCV-IRES mRNA expression system.

[0143] The EMCV-IRES mRNA expression system containing the spike gene of SARS-CoV-2 omicron prepared in Example 1 was encapsulated with LNPs and transfected into Huh-7 cells. The expression efficiency of the spike antigen was analyzed by Western blot 48 hours later.

[0144] In particular, for comparison with the existing 5'Capped / m1Ψ mRNA expression system, mRNA containing 5'cap, m1Ψ, and beta-globin 5'UTR and expressing the omicron spike antigen was used as a control, and the expression efficiency was compared by encapsulating it with LNP.

[0145] The results are shown in Fig. 3.

[0146] As shown in Fig. 3, the expression of the target antigen (Omicron spike protein) expressed using the EMCV-IRES mRNA expression platform was confirmed to be higher than that of the control (5'Capped / m1Ψ) mRNA expression system. This confirmed that the expression system according to the present invention can stably express at a high yield in vivo without capping, compared to existing systems.

[0147]

[0148] Example 4. Target antigen expression (in vivo) by the EMCV-IRES mRNA expression system

[0149] To investigate in vivo protein expression through the EMCV-IRES mRNA expression system, the EMCV-IRES mRNA expression system containing the luciferase gene was LNP encapsulated into BALB / c mice and injected intramuscularly. The expression level of luciferase in the muscles was confirmed 24 hours later.

[0150] The EMCV-IRES mRNA expression system containing the luciferase gene was prepared using the following method: Specifically, the amount of mRNA encapsulated in the LNP-encapsulated EMCV-IRES mRNA expression system (mRNA vaccine) was accurately measured using the Ribogreen assay. The mRNA vaccine was then diluted with PBS to have 1 ug / 50 ul and 2.5 ug / 50 ul of encapsulated mRNA. The EMCV-IRES mRNA expression system at the corresponding concentrations was injected into the quadriceps of Balb / c mice using an insulin syringe. After 24 hours, the mice were injected intraperitoneally with D-luciferin (3 mg in 200 ul), and 10 minutes later, the amount of emitted fluorescence was measured for 60 seconds using BLI imaging equipment to measure the degree of luciferase expression due to mRNA vaccine administration in the muscle.

[0151] As a control, a standard mRNA expression system (β-globin / modified or β-globin / unmodified mRNA expression system) containing 5'-Cap and β-globin 5'UTR produced using m1Ψ modified or normal uridine was used by encapsulating it in the same LNP.

[0152] The results of the above experiment are shown in Fig. 4.

[0153] As shown in Fig. 4, it was confirmed that the expression amount of luciferase protein increased with increasing expression system capacity in all groups injected with mRNA-LNP (mRNA vaccine). Similar to previous reports, the β-globin / modified expression system showed higher protein expression efficiency in vivo, but the EMCV-IRES expression system according to the present invention also induced protein expression similarly to the β-globin / unmodified expression system, confirming its high potential for use as an mRNA expression system.

[0154]

[0155] Example 5. Production of target antigen-specific antibodies through administration of the EMCV-IRES mRNA expression system.

[0156] BALB / c mice were intramuscularly injected with 5 ug of the EMCV-IRES mRNA expression system or β-globin / modified mRNA expression system containing the omicron spike gene prepared in Example 1 twice at 3-week intervals. The amount of mRNA encapsulated in the LNP-encapsulated mRNA vaccine (EMCV-IRES, β-globin, modified) was accurately measured using the Ribogreen assay. The mRNA vaccine was diluted with PBS so that the amount of encapsulated mRNA was 5 ug / 50 ul. The mRNA vaccine at the corresponding concentration was injected twice at 3-week intervals into the quadriceps area of ​​BALB / c mice using an insulin syringe, and 2 weeks after the last administration, approximately 250 ul of blood was obtained through orbital extraction from the mouse. Blood was centrifuged at 13,300 rpm, 4°C, for 20 minutes, and approximately 150 μl of serum (supernatant) was collected. The serum was then analyzed for Omicron spike-specific IgG antibody titers using ELISA, and the results are shown in Figure 5.

[0157] The negative control group was administered PBS, and the positive control group was administered spike hexapro protein together with the vaccine adjuvant (Addavax).

[0158] As shown in Figure 5, the group administered the EMCV-IRES expression system exhibited higher levels of omicron spike protein-specific IgG antibodies than the group administered the β-globin / modified expression system. Furthermore, when IgG subtype responses were examined, the EMCV-IRES expression system group exhibited higher IgG1 and IgG2a titers, confirming its potential as an mRNA expression system.

[0159] The above results suggest that while a typical protein expression system only produces IgG1 antibodies, a type 2 response, the mRNA expression system according to the present invention can also produce IgG2a antibodies, a type 1 response that is effective in responding to viral infection.

[0160] In this regard, the Type 1 immune response induces a strong inflammatory response to kill virus-infected cells and respond to the initial viral infection situation, while the Type 2 immune response repairs the wound tissue created by inflammation and induces a long-term immune response through antibody production.

[0161] In viral immunity, if one reaction is more dominant, it can lead to side effects due to excessive immune response or weakened viral response ability due to insufficient immune response, so the most ideal effect is when the type 1 / type 2 immune response appears in a 1:1 ratio. In light of this, in the case of the mRNA expression system according to the present invention, not only is the production of IgG1 antibodies, which are representative indicators of type 2 immune response, but also IgG2a, which is an indicator of type 1 immune response, is produced simultaneously, so that both type 1 / type 2 immune responses occur evenly, and thus it is excellent as a vaccine system.

[0162]

[0163] Example 6. Production of neutralizing antibodies through administration of the EMCV-IRES mRNA expression system.

[0164] BALB / c mice were intramuscularly injected with 5 ug of the EMCV-IRES mRNA expression system or β-globin / modified mRNA expression system containing the omicron spike gene prepared in Example 1, twice at three-week intervals. Then, the level of omicron spike-specific neutralization antibody production in the serum was confirmed.

[0165] Neutralizing antibody efficacy was confirmed by measuring the inhibitory efficacy of antibodies produced by the expression system on the degree to which pseudovirus expressing the omicron spike protein infects Huh-7 cells. Specifically, PRNT50 was measured through the dilution value of the serum from mice injected with the expression system that inhibits pseudovirus infection by 50%.

[0166] The results are shown in Fig. 6. As can be seen in Fig. 6, it was confirmed that the serum of mice injected with the EMCV-IRES mRNA expression system had a better ability to inhibit pseudovirus infection (lower PRNT50 value) than the β-globin / modified expression system.

[0167]

[0168] Example 7. Generation of target antigen-specific T cell responses through administration of the EMCV-IRES mRNA expression system.

[0169] The EMCV-IRES expression system containing the omicron spike gene prepared in Example 1 was intramuscularly injected twice at 5 ug intervals into BALB / c mice at 3-week intervals. Then, T cells in the spleen were stimulated with the omicron spike peptide pool, and the cytokines IFN-γ+ / TNF-α+ produced by the T cells were measured using the intracellular cytokine staining (ICS) method to investigate the antigen-specific T cell response. Specifically, first, the amount of encapsulated mRNA in the mRNA vaccine (EMCV-IRES, β-globin, modified) encapsulated in LNP was accurately measured using the Ribogreen assay. Then, the mRNA vaccine was diluted with PBS so that the amount of encapsulated mRNA was 5 ug / 50 ul. The mRNA vaccine was injected twice at three-week intervals into the quadriceps of Balb / c mice using an insulin syringe. Two weeks after the last administration, the mice were dissected and the spleens were removed. The spleens were ground into single cells using a 70 μm strainer, and red blood cells were removed using RBC lysis buffer. Only immune cells in the spleen were obtained. The same amount of cells were plated, treated with the Omicron spike peptide pool, and cultured for 5 hours at 37°C and 5% CO2. Afterwards, to identify cells with Omicron antigen-specific reactivity, the inflammatory cytokines IFN-γ+ / TNF-α+ were stained with antibodies for 20 minutes. The proportion of stained T cells among all T cells was measured using a flow cytometer to determine the proportion of T cells showing Omicron-specific reactivity, and the results are shown in Figure 7.

[0170] As can be seen in Figure 7, IFN-γ was significantly increased in the mRNA expression system group compared to the negative control group, the PBS administration group. + / TNF-α + T cell responses were confirmed. This confirmed that the EMCV-IRES mRNA expression system of the present invention has high potential for use as a vaccine.

[0171]

[0172] Example 8. Efficacy evaluation of expression system candidate (EMCV-IRES) using SARS-CoV-2 hACE2 transgenic mouse infection model

[0173] To evaluate the efficacy of the EMCV-IRES expression system including the omicron spike gene manufactured in Example 1, the expression system was administered twice at three-week intervals, and then SARS-CoV-2 virus (Wuhan strain) was administered to hACE2 transgenic mice by nasal instillation (1.0 × 10) at week 7 from the start of the test. 4 After infection with 100 PFU / mL, the mice were necropsied on day 7 post-infection (PID7) to assess gross pneumonia lesions and measure neutralizing antibody titers against SARS-CoV-2.

[0174] Experimental animals were randomly selected from 34 female hACE2 transgenic mice (B6.Cg-Tg(K18-ACE2)2Prlmn / J, JAX #034860) (6 weeks old) and assigned to the planned number of experimental animals per group.

[0175] The allocation of experimental animal groups is described in Table 3 below.

[0176] Experimental group Number of vaccinations n Virus infection group (Virus control; VC) PBS vaccination, SARS-CoV-2 infection 10 Positive control group (Positive control; PC) β-globulin mRNA vaccine vaccination, SARS-CoV-2 infection 12 Expression system administration group (EMCV-IRES) EMCV-IRES mRNA vaccine vaccination, SARS-CoV-2 infection 12

[0177] The positive control (PC) and expression system administration group (EMCV-IRES) were administered 50 μL intramuscularly twice at 3-week intervals for the first vaccination on the same day as the start of the study, and the second vaccination 3 weeks after the first vaccination date. The animals were injected intramuscularly into the hind thigh muscles at 50 μL each time. Mortality and general symptoms were observed twice a week from the first vaccination date until the day of infection (Post-Infection Day0; PID0), and once a day from the day of infection (Post-Infection Day0; PID0) to post-infection day 7 (PID7). The body weights of the experimental animals were measured once a week from the day of the first vaccination date until the day of infection (Post-Infection Day0; PID0), and on days 0, 2, 4, and 7 after infection from the day of infection (Post-Infection Day0; PID0) to post-infection day 7 (PID7), respectively. All animals were necropsied to evaluate gross pneumonia lesions in the lungs, and serum samples were collected during necropsy to measure SARS-CoV-2 neutralizing antibody titers. Body weight changes in the test animals are shown in Figure 8. Specifically, all experimental groups showed a gradual increase in body weight from the start of the test (week 0) to the day of virus inoculation (week 7). Based on the body weight on the day of infection (post-infection Day 0; PID 0), the virus-infected group (VC) showed a body weight change of approximately -9.9% on post-infection day 7 (PID7; the day of necropsy). The positive control group (PC) showed a -11.2% body weight change, and the expression system administration group (EMCV-IRES) showed a -4.8% body weight change. In particular, administration based on the EMCV-IRES system showed a low body weight loss, suggesting that it may have fewer side effects compared to existing mRNA vaccine systems.Body weight loss is one of the representative indicators to be checked in measuring virus toxicity response and administered substance toxicity. The fact that the positive control group showed a higher level of body weight loss than the virus-infected group after infection suggests that in addition to the body weight loss due to virus infection, the positive control group itself is strong in toxicity, which causes additional body weight loss in mice. In contrast, the expression system administration group (EMCV-IRES) according to the present invention was measured to have a lower body weight loss rate than the virus-infected group. Through these results, it was confirmed that the EMCV-IRES mRNA expression system according to the present invention has a remarkable effect of improving side effects because it relatively inhibits the virus while the drug itself has low toxicity to mice.

[0178] On day 7 post-infection (PID7), an autopsy was performed to determine the macroscopic improvement rate of pneumonia lesions and macroscopic findings. The results are shown in Fig. 9. As can be seen in Fig. 9, macroscopic changes, including congestion / hemorrhage and edema, due to viral infection were observed in the lungs of all experimental groups. When the pneumonia lesion improvement rate of each experimental group was calculated based on the virus infection group (VC), the positive control group (PC) had an average of 50.9%, and the expression system administration group (EMCV-IRES) had an average of 53.6%, confirming that it exhibits superior efficacy compared to existing known mRNA expression systems.

[0179] The level of neutralizing antibody production was confirmed and shown in Fig. 10. As can be seen in Fig. 10, no neutralizing antibody titer was detected in the virus infection group (VC), and the average neutralizing antibody titer of IgG against SARS-CoV-2 spike RBD protein in the positive control group (PC) was measured at 209,586 ng / ml, and the average neutralizing antibody titer of IgG in the expression system administration group (EMCV-IRES) was measured at 246,533 ng / ml, confirming that it exhibits superior efficacy compared to existing known mRNA expression systems.

[0180] In addition, the results of the analysis regarding the survival rate of the test animals from the day of infection (Post-Infection Day0; PID0) to the 7th day after infection (PID7) are shown in Fig. 11. The expression system administration group (EMCV-IRES) according to the present invention showed a survival rate of 100%. In contrast, the virus infection group (VC) showed a survival rate of only 70% on the 7th day, and the positive control group (PC) also showed a survival rate of 75%, confirming that the mRNA expression system of the present invention showed a high survival rate.

Claims

An mRNA structure comprising, in order from 1.5' to 3', a 5'-UTR region; an IRES (internal ribosome entry site) regulatory element; an RNA sequence encoding a target peptide; a 3'-UTR region; and a poly(A) base sequence.

2. An mRNA structure according to claim 1, wherein the mRNA structure does not include a 5' terminal cap structure.

3. An mRNA structure according to claim 1, wherein the mRNA structure does not contain a modified nucleic acid.

4. An mRNA structure in the first paragraph, wherein the 5'-UTR region is a cloverleaf structure of poliovirus, a cloverleaf structure of rhinovirus, or a cloverleaf structure of coxsackievirus.

5. An mRNA structure according to claim 1, wherein the 5'-UTR region comprises any one of the nucleic acid sequences selected from SEQ ID NOs: 2, 8, and 9, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

6. In the first paragraph, the 5'-UTR region is an mRNA structure comprising a cloverleaf structure of poliovirus of sequence number 2, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

7. An mRNA structure in the first paragraph, wherein the 3'-UTR region is a 3'-UTR of poliovirus, a 3'-UTR of rhinovirus, or a 3'-UTR of coxsackievirus.

8. An mRNA structure according to claim 1, wherein the 3'-UTR region comprises any one of the nucleic acid sequences selected from SEQ ID NOs: 3, 10, and 11, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

9. In the first paragraph, the 3'-UTR region is an mRNA structure comprising a 3'-UTR of the poliovirus of sequence number 3, a nucleic acid sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

10. An mRNA structure in claim 1, wherein the IRES (internal ribosome entry site) regulatory element is an IRES derived from encephalomyocarditis virus or an IRES derived from coxsackievirus.

11. An mRNA construct according to claim 10, wherein the IRES regulatory element comprises any one of the nucleic acid sequences selected from SEQ ID NO: 1 or 7, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

12. An mRNA structure according to claim 1, wherein the 5'-UTR region comprises the nucleic acid sequence of SEQ ID NO: 2, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof, the IRES (internal ribosome entry site) regulatory element comprises the nucleic acid sequence of SEQ ID NO: 1, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof, and the 3'-UTR region comprises the nucleic acid sequence of SEQ ID NO: 3, a sequence showing at least 80% homology thereto, a fragment thereof, or a functional variant thereof.

13. In the first paragraph, the target peptide is an mRNA structure that is a hormone, a hormone analog, an enzyme, an enzyme inhibitor, a receptor and a fragment of a receptor, an antigen and a fragment or analog of an antigen, an antibody and an antibody fragment, a single antibody, a structural protein, or a toxin protein.

14. An mRNA structure according to claim 1, wherein the poly(A) base sequence has a length of 20 nt to 500 nt.

15. A genetic construct comprising a DNA base sequence corresponding to or complementary to the base sequence of the mRNA structure according to any one of claims 1 to 14.

16. A vector containing a genetic construct according to Article 15.

17. A method for producing mRNA with improved stability, comprising the step of performing in vitro transcription using the vector of Article 16 as a template.

18. A pharmaceutical composition for preventing or treating viral infection, comprising an mRNA structure according to any one of claims 1 to 14.

19. In paragraph 18, a pharmaceutical composition for preventing or treating a viral infection caused by a group of viruses consisting of influenza, rhinovirus, respiratory syncytial virus, coronavirus, coxsackievirus, echovirus, Nipah virus, dengue virus, norovirus, rotavirus, and SFTS virus.

20. A pharmaceutical composition for preventing or treating viral infection, wherein the RNA sequence encoding the target peptide of the mRNA structure in claim 18 comprises an RNA sequence encoding a peptide derived from SARS coronavirus 2 (SARS-CoV-2).

Citation Information

Patent Citations

  • Prediction Method and Apparatus for Chemical Cleaning of Membrane

    KR102178424B1

  • Systems and methods for producing RNA constructs with increased translation and stability

    US11492611B2

  • Technology platform of uncapped-linear mRNA with unmodified uridine

    US20240091343A1

  • Multicistronic expression units and their use

    US6060273A

  • RNA-based regulatory technologies for mirna sensors

    WO2020028612A1