Chimeric vesiculoviruses and methods of use

Abstract

This document relates to methods and materials for treating cancer. For example, this document provides chimeric vesiculoviruses (e.g., chimeric vesicular stomatitis viruses (VSVs)) and methods for using such chimeric vesiculoviruses as an oncolytic agent (e.g., to treat cancer).

Description

[0001]Attorney Docket No.07039-2326WO1 / 2024-129 CHIMERIC VESICULOVIRUSES AND METHODS OF USE CROSS-REFERENCETORELATEDAPPLICATIONSThis application claims the benefit of U.S. Patent Application Serial No. 63 / 635,877,filed on April 18, 2024. The disclosure of the prior application is considered part of, and is incorporated by reference in, the disclosure of this application. STATEMENT REGARDING FEDERAL FUNDING This invention was made with government support under CA195764 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCELISTINGThis application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2326WO1_SL.xml.” The XML file, created on April 11, 2025, is 28,881 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD This document relates to methods and materials for treating cancer. For example, this document provides chimeric vesiculoviruses (e.g., chimeric vesicular stomatitis viruses (VSVs)) and methods for using such chimeric vesiculoviruses as an oncolytic agent (e.g., to treat cancer). BACKGROUNDVSV has been utilized as an oncolytic virus, vaccine vector, and a gene therapy vector, and has become a highly valuable tool in the clinical advancement of cell and genetherapies (see, e.g., Altar et al., Exp. Opin. Biol. Ther., 20:1187–1201 (2020); Anahita et al,Hum. Vacc. Immunother., 15:2269–85 (2019); and “Current FDA Approved Cell & Gene Therapies – Mirus Bio,” December 27, 2023, mirusbio.com / fda-approved-gene-cell- therapies / ). However, a current, critical limitation to virotherapies is the ability to give repeat doses intravenously due to host generated neutralizing antibodies. There are also concerns surrounding potential neurotoxicity and hepatotoxicity with high dose viral therapies. Attorney Docket No.07039-2326WO1 / 2024-129 SUMMARY VSV is a negative-sense RNA Vesiculovirus of the family Rhabdoviridae with broadmammalian cellular tropism, fast lytic cycle, and high sensitivity to host IFN associatedantiviral active immunity (Bishnoi et al., Viruses 10, doi:10.3390 / v10020090 (2018); andSharif-Askari et al., Virology 365:20-33 (2007)). Wild type VSV (VSVwt) can cause lethalneurotoxicity and liver toxicity in laboratory rodents (Ahmed et al., J Virol 77(8):4646-4657(2003); Muik et al., Cancer Res 74:3567-3578 (2014); Naik et al., Cancer Gene Ther19:443-450 (2012); Johnson et al., Virology 360:36-49 (2007); and Zhang et al., Hum GeneTher Clin Dev 27:111-122 (2016)). In addition, there are reported cases of VSV-inducedencephalitis in humans (Quiroz et al., Am J Trop Med Hyg 39:312-314 (1988)). As describedherein, chimeric vesiculoviruses can be used as a platform for safe and effective oncolytic virotherapy. This document provides methods and materials for treating cancer. For example, this document provides chimeric vesiculoviruses (e.g., chimeric VSVs) having oncolytic anti- cancer activity. In some cases, one or more chimeric vesiculoviruses provided herein (e.g., one or more chimeric vesiculoviruses each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be used as an oncolytic agent (e.g., to treat cancer). For example, one or more chimeric vesiculoviruses provided herein can be administered to a mammal (e.g., a human) having cancer to treat that mammal. In some cases, a chimeric vesiculovirus (e.g., a chimeric VSV) expressing (e.g., designed to express) a glycoprotein (G) polypeptide that is heterologous to the vesiculovirus can be used to treat cancer. For example, a chimeric vesiculovirus can be designed to have a genome from a first vesiculovirus species that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a G polypeptide of a second vesiculovirus species that is different from the first vesiculovirus species (e.g., such that the chimeric vesiculovirus expresses a G polypeptide heterologous to the first vesiculovirus species) and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species (e.g., such that the chimeric vesiculovirus expresses a reduced or eliminated level of a G polypeptide endogenous to the first Attorney Docket No.07039-2326WO1 / 2024-129 vesiculovirus species), and can be administered to a mammal (e.g., a human) having cancer to treat the mammal. As described herein, a chimeric vesiculovirus (e.g., a chimeric VSV) having (e.g., engineered to have) a genome from a first vesiculovirus species that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a glycoprotein (G) polypeptide of a second vesiculovirus species that is different from the first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species can be used to treat cancer. For example, a chimeric vesiculovirus provided herein can escape antibody cross neutralization within a mammal (e.g., a human) (e.g., can escape neutralization by antibodies targeting wild type VSV and / or by antibodies targeting a different chimeric vesiculovirus.) and can thus be used in a multi-dosing treatment regimen. In some cases, a chimeric vesiculovirus provided herein can have (e.g., can be engineered to have) a genome from a VSV that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a G polypeptide of a vesiculovirus species other than VSV and (b) lacks at least a portion of an endogenous VSV nucleic acid sequence that encodes a G polypeptide of the VSV (a VSV-G polypeptide). For example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Morreton virus (MORV). Such a chimeric VSV can be referred to herein as VSV-MORV-G. For example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Jurona virus (JURV). Such a chimeric VSV can be referred to herein as VSV-JURV-G. In another example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Malpais Springs virus (MSPV). Such a chimeric VSV can be referred to herein as VSV-MSPV-G. In yet another example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Isfahan virus (ISFV). Such a chimeric VSV can be referred to herein as VSV-ISFV-G. In still Attorney Docket No.07039-2326WO1 / 2024-129 another example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Radi virus (RADV). Such a chimeric VSV can be referred to herein as VSV-RADV-G. In another example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Perinet virus (PERV). Such a chimeric VSV can be referred to herein as VSV-PERV-G. In yet another example, a chimeric VSV provided herein can have a genome where at least a portion of an endogenous nucleic acid encoding a VSV-G polypeptide is replaced with heterologous nucleic acid encoding a G polypeptide from a Carajas virus (CARV). Such a chimeric VSV can be referred to herein as VSV-CARV-G. Also as described herein, chimeric vesiculoviruses provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be resistant to vesiculovirus-neutralizing antibodies and can induce oncolysis in cancer cells. For example, administering one or more genetically diverse vesiculovirus species (e.g., one or more chimeric vesiculovirus provided herein such as chimeric VSVs provided herein) can provide antigenically distinct vesiculoviruses that can escape cross antibody neutralization and can be used in repeat dosing strategies. Accordingly, chimeric vesiculoviruses provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be used as anticancer agents to reduce the number of cancer cells within a mammal (e.g., a human). In general, one aspect of this document features methods for treating cancer where the methods can include, or consist essentially of, administering a chimeric vesiculovirus to a mammal having cancer, where said mammal is a mammal that was previously administered an oncolytic vesiculovirus virus different from said chimeric vesiculovirus, wherein said chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises a nucleic acid sequence encoding a G polypeptide of a second vesiculovirus species different Attorney Docket No.07039-2326WO1 / 2024-129 from said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species. The mammal can be a human. The cancer can be hepatocellular carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, urothelial carcinoma, gastric adenocarcinoma, small cell lung cancer, non-small cell lung cancer, breast ductal adenocarcinoma, head and neck cancer, colorectal adenocarcinoma, melanoma, basal cell carcinoma, renal cell carcinoma, osteosarcoma, myeloma, lymphoma, or leukemia. The administering can include intratumoral injection. The one or more codons of the nucleic acid sequence encoding said G polypeptide can be optimized for translation in a human. The first vesiculovirus species can be a VSV. The second vesiculovirus species can be a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, or a CARV. The method can include administering, to said mammal, a second chimeric vesiculovirus, wherein a genome of said second chimeric vesiculovirus comprises a genome of a second vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, and wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The method can include administering, to said mammal, a third chimeric vesiculovirus, wherein a genome of said third chimeric vesiculovirus comprises a genome of a third vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said third vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said third vesiculovirus species, wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The method can include administering, to said mammal, a fourth chimeric vesiculovirus, wherein a genome of said fourth chimeric vesiculovirus comprises a genome of a fourth vesiculovirus species that (a) Attorney Docket No.07039-2326WO1 / 2024-129 comprises nucleic acid encoding a G polypeptide heterologous to said fourth vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said fourth vesiculovirus species, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. In another aspect, this document features methods for treating cancer where the methods can include, or consist essentially of, (a) administering a first chimeric vesiculovirus to a mammal having cancer, wherein a genome of said first chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said first vesiculovirus species, and (b) at least about 3 days after said step (a), administering a second chimeric vesiculovirus to said mammal, wherein a genome of said second chimeric vesiculovirus comprises a genome of a second vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The mammal can be a human. The cancer can be hepatocellular carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, urothelial carcinoma, gastric adenocarcinoma, small cell lung cancer, non-small cell lung cancer, breast ductal adenocarcinoma, head and neck cancer, colorectal adenocarcinoma, melanoma, basal cell carcinoma, renal cell carcinoma, osteosarcoma, myeloma, lymphoma, or leukemia. The one or more codons of said nucleic acid sequence encoding said G polypeptide can be optimized Attorney Docket No.07039-2326WO1 / 2024-129 for translation in a human. The first vesiculovirus species can be the same species as said second vesiculovirus species. The first vesiculovirus species can be VSV and said second vesiculovirus species can be VSV. In another aspect, this document features chimeric vesiculoviruses, wherein a chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises a nucleic acid sequence encoding a glycoprotein (G) polypeptide of a second vesiculovirus species different from said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species, wherein one or more codons of said nucleic acid sequence encoding said G polypeptide are optimized for translation in a human. The first vesiculovirus species can be a VSV. The second vesiculovirus species can be a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, or a CARV. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:1. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:2. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:3. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:4. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:5. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:6. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:7. In another aspect, this document features vectors including nucleic acid encoding a chimeric vesiculovirus having a genome of a first vesiculovirus species that (a) comprises a nucleic acid sequence encoding a glycoprotein (G) polypeptide of a second vesiculovirus species different from said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species, wherein one or more codons of said nucleic acid sequence encoding said G polypeptide are optimized for translation in a human. The first vesiculovirus species can be a VSV. The second vesiculovirus species can be a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, or a CARV. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:1. The nucleic acid sequence encoding Attorney Docket No.07039-2326WO1 / 2024-129 said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:2. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:3. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:4. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:5. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:6. The nucleic acid sequence encoding said G polypeptide can include a nucleotide sequence set forth in SEQ ID NO:7. In another aspect, this document features panels of chimeric vesiculoviruses, wherein a panel includes: (a) a first chimeric vesiculovirus comprising a genome of a first vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said first vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said first vesiculovirus species, and (b) a second chimeric vesiculovirus comprising a genome of a second vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The panel can include: (c) a third chimeric vesiculovirus comprising a genome of a third vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said third vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said third vesiculovirus species, wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The panel can include: (d) a fourth chimeric vesiculovirus comprising a genome of a fourth vesiculovirus species that (i) comprises nucleic acid encoding a G Attorney Docket No.07039-2326WO1 / 2024-129 polypeptide heterologous to said fourth vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said fourth vesiculovirus species, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus. The first, second, third, or fourth vesiculovirus species can be a VSV. The G polypeptide heterologous to said first, second, third, or fourth vesiculovirus species can be a G polypeptide of a virus selected from the group consisting of a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, and a CARV. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-1C. Schematics of a vesiculovirus structure. Vesiculoviruses are membersof the Rhabdoviridae family, order Mononegavirales, that have a non-segmented, singlestranded, negative sense RNA genome with a bullet shaped envelope (Figure 1A) around a helical nucleocapsid (Figure 1B). Vesiculoviruses have a genome organization with five (5) Attorney Docket No.07039-2326WO1 / 2024-129 major polypeptides: a nucleocapsid (N) polypeptide, a phosphoprotein (P) polypeptide, a matrix (M) polypeptide, and a glycoprotein (G) polypeptide, and a RNA-dependent RNA polymerase large (L) polypeptide (Figure 1C). Figures 2A-2B. Screenshots of exemplary RNA sequencing results used to align polypeptide sequences and confirm pseudotyping various G polypeptides. Figure 2A) A screenshot of RNA sequence of a portion of a recombinant nucleic acid encoding a G polypeptide from a CARV (a CARV-G polypeptide) as compared to an endogenous nucleic acid encoding a CARV-G polypeptide. Sequences shown include a fragment of a CARV-G polypeptide (SEQ ID NO:8), an endogenous nucleic acid encoding a fragment of a CARV-G polypeptide (SEQ ID NO:9), and a recombinant nucleic acid encoding a fragment of a CARV-G polypeptide (SEQ ID NO:10). Figure 2B) A screenshot of RNA sequence of a portion of a recombinant nucleic acid encoding a G polypeptide from a MORV (a MORV-G polypeptide) as compared to an endogenous nucleic acid encoding a MORV-G polypeptide. Sequences shown include a fragment of a MORV-G polypeptide (SEQ ID NO:11), an endogenous nucleic acid encoding a fragment of a MORV-G polypeptide (SEQ ID NO:12), and a recombinant nucleic acid encoding a fragment of a MORV-G polypeptide (SEQ ID NO:13). Figure 3. Images of plaque assays showing that chimeric VSVs provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) demonstrated efficient viral budding from a host cell. Figure 4. A graph of TCID50 / mL of chimeric VSV provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) showing high titer production (2x107to 4x1010TCID50 / mL) within 24-hours of viral infection. Figures 5A-5H. Graphs of percent cell viability showing that chimeric VSVs provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that Attorney Docket No.07039-2326WO1 / 2024-129 encodes a G polypeptide) demonstrated oncolytic ability in both blood cancers and in cancers having solid tumors. Cytotoxicity of VSV (Figure 5A), VSV-MSPV-G (Figure 5B), VSV- MORV-G (Figure 5C), VSV-JURV-G (Figure 5D), VSV-ISFV-G (Figure 5E), VSV-PERV- G (Figure 5F), VSV-CARV-G (Figure 5G), and VSV-RADV-G (Figure 5H) are shown. Figure 6. Graphs of cell viability showing that chimeric VSVs provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) escaped neutralization by commercially available anti-VSV-G antibodies. Results are shown from anti-VSV-G antibody clone 1E9F9 (top) and anti-VSV-G antibody clone 8G5F11 (bottom). Figure 7. A graph of cell viability showing that chimeric VSVs provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) escaped neutralization by serum obtained from a patient that was previously administeredrecombinant VSV expressing interferon beta (VSV-IFN ).Figures 8A-8E: Generation of Novel Vesiculovirus Library for Oncolytic Therapy. Figure 8A) Phylogenetic tree of vesiculovirus genus using glycoprotein amino acid sequences to identify evolutionary branching based on viral proteins associated with neutralizing antibodies. Muscle alignment to bootstrap maximum likelihood tree was performed in MEGA11 software. Figure 8B) Generation of chimeric vesiculovirus library by replacing VSV Indiana glycoprotein with novel vesiculovirus glycoprotein sequence. Chimeric viruses maintained the VSV Indiana nucleocapsid (N), phosphoprotein (P), matrix protein (M), polymerase protein (L) and intergenic regions. Figure 8C) Replication kinetics of vesiculovirus library on BHK-21 producer cell line. Following 1-hour infection with MOI 0.1 cell culture supernatants were titered by TCID50 / mL at respective time points (N=3). Figure 8D) Generation of plaque size by wild-type versus chimeric vesiculovirus constructs on Vero-E6 cells. Plaque size was calculated by ViralPlaque macro for ImageJ software (N=3). Significance values were determined by ordinary one-way ANOVA with Sidaks’s multiple comparisons test. Figure 8E) Cell line panel for oncolytic killing by vesiculovirus Attorney Docket No.07039-2326WO1 / 2024-129 library (MOI 10). Oncolytic susceptibility was determined using MTS assay and less than 50% cell viability following 72-hour infection (N=9). Outliers were removed from data set using ROUT method. Tumor cell lines: Hepatocellular carcinoma (HCC), Cholangiocarcinoma (CCA), Sarcoma (SARC), Pancreatic (PANC), Acute Myeloid Leukemia (AML), Renal Cell Carcinoma (RCC), Prostate Cancer (PC), Glioblastoma (GBM). Figures 9A-9B: Novel Vesiculovirus Library Evaded Antibody Cross Neutralization from VSV antibodies. Figure 9A) Neutralization assay using commercially available monoclonal antibodies 8G5F11 and 1E9F9. Virus (500TCID50units) and antibody were mixed in equal volumes and incubated for 1 hour at 37oC before plating on BHK-21 cells. Cell viability was read at 72-hours with MTS reagent (N=3). Sigmoidal curve fit with Four- Parameter Logistic Model. Figure 9B) Neutralization assay with patient serum from VSV-IFN clinical study NCT01628640. Patient serum was first heat inactivated for 30-minutes at37 . Virus and patient serum dilutions were treated as stated in panel A (N=2).Figures 10A-10F: Intravenous Delivery of Second Dose Oncolytic VesiculovirusImproved Tumor Survival. Figure 10A) In vivo study design for oncolytic vesiculoviruslibrary. Mice were vaccinated with novel vesiculovirus vector and confirmed for seroconversion before tumor implantation. Tumor model (B16-OVA-IFNAR- / -) was treated with three intravenous doses of VSV-OVA. One day post treatment cohort mice were examined for toxicity and viral delivery (N=3). Seven days post treatment cohort mice were examined for toxicity, viral delivery, and immune microenvironment changes (N=4). Remaining cohort mice had tumor burden measured until end of study (N=7). Figure 10B) Group table for defining vaccination versus treatment virus. Figure 10C) Kaplan-Meier survival curve of mice implanted with B16-OVA-IFNAR- / -tumor model. Statistical significance determined by Mantel-Cox test. Figure 10D) Tumor burdens of mice implanted with B16-OVA-IFNAR- / -in their respective treatment groups compared to control. Figure 10E) Plaque assay of tumors one day post final viral injection. Tumor samples were manually disrupted, and lysate underwent 1:10 serial dilutions plated on BHK-21 cells for plaque formation. Plaques indicated live, replication competent virus was present in tumor microenvironment. Figure 10F) qPCR of viral genomes present in tumor microenvironment Attorney Docket No.07039-2326WO1 / 2024-129 one day and seven days post final viral injection. Presence of viral genomes was more stable than plaque assay and identified delivery of virus to the tumor microenvironment. Figures 11A-11C: Novel Vesiculovirus Generated Unique Antibody Populations without Cross Reactivity. Figure 11A) Seroconversion of mice vaccinated with oncolytic vesiculovirus. Two weeks post vaccination plasma isolated from cheek bleed was serially diluted and mixed 1:1 with respective vaccination virus (500 TCID50units). MTS assay readout for cell viability at 72-hours post infection on BHK-21 cells determined antibody titer generated by vaccination (N=4). Figure 11B) Cross neutralization of vaccination generated antibodies against VSV vector for treatment post tumor implant. Plasma isolated from cheek bleed indicated in panel A was assessed against VSV vector for potential cross neutralization which would inhibit delivery in tail vein injection of VSV-OVA post tumor implant (N=4). Figure 11C) End of study antibody populations were assessed with plasma collected during survival cohort euthanasia. Individual mice per group were assessed against full vesiculovirus library for antibody titers against specific vesiculovirus species glycoproteins (N=4). Sigmoidal curves fit with Four-Parameter Logistic Model. Figures 12A-12D: Enhanced Tumor Microenvironment Immunomodulation in Repeat Dosing with Novel Oncolytic Vesiculovirus Vectors. Figure 12A) Flow cytometry quantification of immune cell infiltration in the tumor. Figure 12B) Flow cytometry quantification of activation markers expressed on CD8 and CD4 T cell populations. Median fluorescent intensity (MFI) quantified for each activation marker to assess overall protein expression levels as an indicator of T cell exhaustion. Figure 12C) Anti-viral and anti-tumor T cells quantified in two separate experiments utilizing antigen peptides for OVA257-2640 (SIINFEKL; SEQ ID NO:14) and VSV-N52-59(RGYVYQGL; SEQ ID NO:15). External staining was performed with CD8 specific fluorescently labeled MHC tetramers. Intracellular stain was performed with Golgi plug and peptide stimulation before antibody staining. Figure 12D) Immune cell memory populations defined by CD44 and CCR7 / CD62L co-expression. Total tumor infiltrating CD8 T-cell populations were further categorized by positive tetramer staining against anti-viral or anti-tumor antigen. Statistical significance was determined by Kruskal-Wallis test with Dunn’s correction. P values as indicated: ns P > 0.05; * P 0.05; ** P 0.01; *** P 0.001. Attorney Docket No.07039-2326WO1 / 2024-129 Figures 13A-13B: Murine Inflammatory Cytokine Release Following Repeat Dosing of Oncolytic Vesiculovirus. Figure 13A) Eve Technologies Mouse IFN-alpha-beta-2 plex discovery assay using EDTA plasma harvested on respective days for quantification of IFN cytokines in murine blood samples. Figure 13B) Eve technologies Mouse High Sensitivity 18 plex discovery assay using EDTA plasma harvested on respective days for quantification of inflammatory cytokines expressed in murine blood samples. Blood cytokine levels used to identify potential toxicity of therapy. A transient effect was seen in repeated dosing with VSV-VSV but lack of toxicity was seen in use with the vesiculovirus library repeat dosing strategy. Statistical significance was determined by Mixed-Effects model with Dunnett’s multiple comparison test. P values as indicated: ns P > 0.05; * P 0.05; ** P 0.01; *** P 0.001; **** P 0.0001. Figure 14: Serum Complement Protein Interaction with Vesiculovirus Library. Neutralization assays were performed by mixing complement intact human serum (Innovative Research cat# ICSER10ML) 1:1 with respective virus (500 TCID50 units). Virusand serum were incubated for 1 hour at 37 before plating on BHK-21 cells. MTS assay forcell viability was read at 72-hours post infection. Neutralization assay with anti-IgM antibody (Bethyl Labs cat# A80-100) was performed by incubating serum with 12.5 µg ofantibody for 30-minutes at 37 before viral incubation N=3). Sigmoidal curve fit with Four-Parameter Logistic Model. Figure 15: IFN Release Induced by Novel Vesiculovirus Library. LEGENDplex™ Human Type 1 / 2 / 3 Interferon Panel (5-plex) (cat740350) was used to assess cytokine release by previously determined susceptible and resistance cancer cell lines to viral oncolysis as shown in Figure 8E. Respective cell lines were infected with an MOI 1 for 24 hours before clarifying supernatant and following LegendPlex protocol for analysis of IFN cytokines. Use of LegendPlex data analysis software suite to generate flow cytometry results to pg / mL quantities. Data indicates elevated IFN release by VSV-CARV-G virus despite prior evidence of VSV-CARV-G inducing cell death in selected resistant cell lines. IFN levels were also induced in murine model by VSV-CARV-G. Attorney Docket No.07039-2326WO1 / 2024-129 DETAILED DESCRIPTION This document provides methods and materials for treating cancer. For example, this document provides chimeric vesiculovirus (e.g., chimeric VSVs) expressing (e.g., designed to express) a G polypeptide that is heterologous to the vesiculovirus can be used to treat cancer. In some cases, a chimeric vesiculovirus provided herein can have (e.g., can be designed to have) a genome from a first vesiculovirus species that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a G polypeptide of a second vesiculovirus species that is different from the first vesiculovirus species (e.g., such that the chimeric vesiculovirus expresses a G polypeptide heterologous to the first vesiculovirus species) and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species (e.g., such that the chimeric vesiculovirus expresses a reduced or eliminated level of a G polypeptide endogenous to the first vesiculovirus species). Also provided herein are methods for using chimeric vesiculovirus provided herein as an oncolytic virotherapy to treat cancer. For example, one or more chimeric vesiculovirus provided herein can be administered to a mammal (e.g., a human) having cancer to treat the mammal (e.g., to reduce the number of cancer cells present in the mammal). In some cases, a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be replication competent, can infect dividing cells, can be non-pathogenic (e.g., to a mammal being treated as described herein), can be non-neurotropic (e.g., to a mammal being treated as described herein), can bud through the cell membrane, or any combination thereof. For example, a chimeric vesiculovirus provided herein can be replication competent, can infect dividing cells, can be non-pathogenic (e.g., to a mammal being treated as described herein), can be non-neurotropic (e.g., to a mammal being treated as described herein), and can bud through the cell membrane. In some cases, a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at Attorney Docket No.07039-2326WO1 / 2024-129 least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can bind to a cellular receptor (e.g., to facilitate viral entry to a cell). For example, a chimeric vesiculovirus described herein can bind to a low-density lipoprotein (LDL) receptor. In some cases, a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can have reduced or eliminated neurotoxicity (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein), can have reduced or eliminated hepatotoxicity (e.g., as compared to a vesiculovirus that not engineered to be a chimeric vesiculovirus as described herein), can have an increased oncolytic anti-cancer activity efficacy (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein), or any combination thereof. For example, a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein can have reduced or eliminated neurotoxicity (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein), can have reduced or eliminated hepatotoxicity (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein), and can have an increased oncolytic anti-cancer activity efficacy (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein). In some cases, a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) may not be recognized (e.g., recognized and inactivated) by a vesiculovirus neutralizing antibody (e.g., as compared to a vesiculovirus that is not engineered to be a chimeric vesiculovirus as described herein). For example, a chimeric vesiculovirus (e.g., chimeric VSVs) provided herein may not be neutralized by a VSV neutralizing antibody present in a mammal having a pre-existing adaptive immunity to VSV. Any appropriate one or more vesiculoviruses can be used to create a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) Attorney Docket No.07039-2326WO1 / 2024-129 encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). For example, a VSV genome can be obtained and modified to include a nucleic acid sequence from a vesiculovirus that is different from VSV (e.g., MORV) for use in forming a chimeric vesiculovirus provided herein. In such an example, the VSV nucleic acid sequence encoding a VSV G polypeptide can be replaced with MORV nucleic acid encoding a MORV-G polypeptide. Examples of different types of vesiculoviruses that can be used to make chimeric vesiculoviruses provided herein include, without limitation, MORVs, JURVs, MSPVs, ISFVs, RADVs, PERVs, and CARVs. In some cases, a genome of a first strain of one type of vesiculovirus can be obtained and modified to include a nucleic acid sequence from a second strain of the same type that is different from the first strain for use in forming a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). For example, a VSV genome of a first VSV strain can be obtained and modified to include a nucleic acid sequence from a second VSV strain that is different from the first VSV strain for use in forming a chimeric vesiculovirus. In such an example, a nucleic acid sequence encoding a G polypeptide in the genome (e.g., an endogenous nucleic acid sequence) of a first VSV strain (e.g., VSV strain Indiana) can be replaced with nucleic acid encoding a G polypeptide of a second VSV strain (e.g., VSV strain New Jersey or VSV strain Alogoas). In some cases, a genome of a first species of vesiculovirus can be obtained and modified to include a nucleic acid sequence from a second species of vesiculovirus that is different from the first species of vesiculovirus for use in forming a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). For example, a VSV genome can be obtained and modified to include a nucleic acid sequence from a second species of vesiculovirus that is different from VSV for use in forming a chimeric vesiculovirus. In such an example, a Attorney Docket No.07039-2326WO1 / 2024-129 nucleic acid sequence encoding a G polypeptide in the genome (e.g., an endogenous nucleic acid sequence) of a first species of vesiculovirus (e.g., a VSV such as a VSV strain Indiana) can be replaced with nucleic acid encoding a G polypeptide of a second species of vesiculovirus (e.g., a second species of vesiculovirus that is different from VSV such as MORV, JURV, MSPV, ISFVs RADVs PERV, or CARV). Examples of different types of VSV strains that can be used to make chimeric vesiculoviruses (e.g., chimeric VSVs) provided herein include, without limitation, VSV strain Indiana, VSV strain New Jersey, and VSV strain Alogoas. In some cases, a VSV that can be used to make chimeric vesiculoviruses (e.g., chimeric VSVs) provided herein can be as set forth in the National Center for Biotechnology Information (NCBI) databases in, for example, Accession No. J02428.1. Any appropriate nucleic acid sequence encoding a G polypeptide can be used to create a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). In some cases, a nucleic acid sequence encoding a G polypeptide can be a recombinant nucleic acid sequence. In some cases, a nucleic acid sequence encoding a G polypeptide can be a synthetic nucleic acid sequence. In some cases, a nucleic acid sequence encoding a G polypeptide can include one or more nucleotide sequences that do not naturally occur in a vesiculovirus. Nucleotide sequences that do not naturally occur in a vesiculovirus that can be engineered into a vesiculovirus can be from any appropriate source. In some cases, a nucleotide sequence that does not naturally occur in a vesiculovirus can be from a non-viral organism. In some cases, a nucleotide sequence that does not naturally occur in a vesiculovirus can be from a virus other than a vesiculovirus. Examples of nucleic acid sequences encoding a G polypeptide that can be included in a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein include, without limitation, VSV-G polypeptides, MORV-G polypeptides, JURV-G polypeptides, MSPV-G polypeptides, ISFV-G polypeptides, RADV-G polypeptides, PERV-G polypeptides, and CARV-G polypeptides. In some cases, a nucleic acid sequence encoding a G polypeptide that can be included in a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein can be as set forth in any one of SEQ ID NOs:1-7 (see, e.g., Example 3). Attorney Docket No.07039-2326WO1 / 2024-129 In some cases, at least one codon of a nucleic acid sequence encoding a G polypeptide can be optimized (e.g., for translation in a human). For example, from about 1 codon to about 557 codons (e.g., from about 1 to about 500, from about 1 to about 450, from about 1 to about 400, from about 1 to about 350, from about 1 to about 300, from about 1 to about 250, from about 1 to about 200, from about 1 to about 150, from about 1 to about 100, from about 1 to about 75, from about 1 to about 50, from about 1 to about 25, from about 50 to about 557, from about 100 to about 557, from about 150 to about 557, from about 200 to about 557, from about 250 to about 557, from about 300 to about 557, from about 350 to about 557, from about 400 to about 557, from about 450 to about 557, from about 500 to about 557, from about 50 to about 500, from about 100 to about 450, from about 150 to about 350, from about 200 to about 300, from about 50 to about 150, from about 100 to about 200, from about 150 to about 250, from about 200 to about 300, from about 250 to about 350, from about 300 to about 400, from about 350 to about 450, or from about 400 to about 500 codons) of a nucleic acid sequence encoding a G polypeptide can be optimized (e.g., for translation in a human). A nucleic acid sequence encoding a G polypeptide can be used to create a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can encode any appropriate G polypeptide. In some cases, a G polypeptide that can be encoded by a chimeric vesiculovirus provided herein can be heterologous to the vesiculovirus used to make chimeric the vesiculovirus. For example, when a chimeric vesiculovirus is a chimeric VSV, a G polypeptide encoded by the chimeric VSV can be heterologous to the VSV used to make the chimeric VSV. Examples of G polypeptides that can be encoded by a nucleic acid sequence encoding a G polypeptide can be used to create a chimeric vesiculovirus provided herein can be as set forth in the NCBI databases in, for example, Accession No. AAA48370.1, Accession No. YP_009094177.1, Accession No. YP_009362085.1, Accession No. YP_007641385.1, Accession No. YP_009505530.1, Accession No. YP_009094387.1, Accession No. YP_009505540.1, and Accession No. _YP_009513006.1. Attorney Docket No.07039-2326WO1 / 2024-129 A chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can have (e.g., can be designed to have) a genome that lacks at least a portion of an endogenous (e.g., a genomic) nucleic acid sequence that can encode a G polypeptide (e.g., a VSV-G polypeptide). In some cases, a chimeric vesiculovirus provided herein can have (e.g., can be designed to have) a genome that lacks all of a nucleic acid sequence that is endogenous to the vesiculovirus used to create the chimeric vesiculovirus. When a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) lacks at least a portion of an endogenous nucleic acid sequence that can encode a G polypeptide, the chimeric vesiculovirus can have reduced or eliminated expression of an endogenous G polypeptide encoded by that nucleic acid sequence. In cases where a VSV is used to create a chimeric VSV provided herein, the chimeric VSV can have reduced or eliminated expression of an endogenous VSV-G polypeptide. Any appropriate method can be used to remove at least a portion of an endogenous (e.g., a genomic) nucleic acid sequence that can encode a G polypeptide from the genome of a vesiculovirus to produce a chimeric vesiculovirus provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). In some cases, a nucleic acid (e.g., a recombinant nucleic acid) that can encode a G polypeptide can be located in any appropriate location within the genome of a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). In some cases, nucleic acid that can encode a G polypeptide present within a genome of a chimeric vesiculovirus provided herein Attorney Docket No.07039-2326WO1 / 2024-129 can be located where the portion of an endogenous nucleic acid sequence that can encode an endogenous G polypeptide was removed from. Also provided herein are vectors (e.g., expression vectors) containing nucleic acid encoding a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). Vectors can carry nucleic acid encoding a chimeric vesiculovirus provided herein into another cell (e.g., a cancer cell), where it can be replicated and / or expressed. An expression vector, also commonly referred to as an expression construct, is typically a plasmid or vector having an enhancer / promoter region controlling expression of a specific nucleotide sequence. When introduced into a cell, the expression vector can use cellular protein synthesis machinery to produce the virus in the cell. A vector containing nucleic acid encoding a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be any appropriate type of expression vector. In some cases, a vector can be a non-viral vector. In some cases, a vector can be a viral vector. In some cases, a vector containing nucleic acid encoding a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein (e.g., a chimeric vesiculovirus having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) also can include one or more regulatory elements operably linked to the nucleic acid encoding the chimeric vesiculovirus. For example, a promoter can be included in a vector containing nucleic acid encoding a chimeric vesiculovirus provided herein to facilitate production of the chimeric vesiculovirus. A promoter can be a naturally occurring promoter or a recombinant promoter (e.g., a chimeric promoter). A promoter can be ubiquitous or inducible and can affect the expression of a nucleic acid encoding a chimeric vesiculovirus provided herein in a general or tissue-specific manner. Attorney Docket No.07039-2326WO1 / 2024-129 In some cases, one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be formulated into a composition (e.g., a pharmaceutical composition) for administration to a mammal (e.g., a mammal having cancer). For example, one or more chimeric vesiculoviruses provided herein and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be formulated into a pharmaceutically acceptable composition for administration to a mammal having cancer. In some cases, one or more chimeric vesiculoviruses provided herein and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be formulated together with one or more pharmaceutically acceptable carriers (additives), excipients, and / or diluents. Examples of pharmaceutically acceptable carriers, excipients, and diluents that can be used in a composition described herein include, without limitation, sucrose, lactose, starch (e.g., starch glycolate), cellulose, cellulose derivatives (e.g., modified celluloses such as microcrystalline cellulose and cellulose ethers like hydroxypropyl cellulose (HPC) and cellulose ether hydroxypropyl methylcellulose (HPMC)), xylitol, sorbitol, mannitol, gelatin, polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), crosslinked polyvinylpyrrolidone (crospovidone), carboxymethyl cellulose, polyethylene-polyoxypropylene-block polymers, and crosslinked sodium carboxymethyl cellulose (croscarmellose sodium)), titanium oxide, azo dyes, silica gel, fumed silica, talc, magnesium carbonate, magnesium chloride, vegetable stearin, magnesium stearate, aluminum stearate, stearic acid, antioxidants (e.g., vitamin A, vitamin E, vitamin C, retinyl palmitate, and selenium), citric acid, sodium citrate, parabens (e.g., methyl paraben and propyl paraben), petrolatum, dimethyl sulfoxide, mineral oil, serum proteins (e.g., human serum albumin), glycine, sorbic acid, potassium sorbate, water, salts or electrolytes (e.g., saline such as phosphate-buffered saline (PBS), protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, and zinc salts), colloidal silica, magnesium trisilicate, polyacrylates, waxes, wool fat, and lecithin. In some cases, a composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one Attorney Docket No.07039-2326WO1 / 2024-129 or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can include a population of a single chimeric vesiculovirus provided herein and / or nucleic acid encoding that chimeric vesiculovirus. A composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be formulated into any appropriate dosage form. Examples of dosage forms can include, without limitation, suppositories, liquids, enemas, suspensions, solutions (e.g., sterile solutions), sustained- release formulations, and delayed-release formulations. In some cases, one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be packaged with one or more delivery vehicles. For example, one or more chimeric vesiculoviruses provided herein and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be conjugated to delivery vehicle. For example, one or more chimeric vesiculoviruses provided herein and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be encapsulated within a delivery vehicle. Delivery vehicles that can be formulated for administering one or more chimeric vesiculoviruses provided herein and / or nucleic acid encoding a chimeric vesiculovirus provided herein to a mammal (e.g., a human) having cancer include, without limitation, cells (e.g., mesenchymal stem cells such as human mesenchymal stem cells and peripheral blood mononuclear cells (PBMCs) such as human PBMCs) and nanoparticles (e.g., lipid nanoparticles). Attorney Docket No.07039-2326WO1 / 2024-129 A composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be formulated for local or systemic administration. A composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and / or nucleic acid encoding a chimeric vesiculovirus provided herein can be designed for oral or parenteral (including subcutaneous, intratumoral, intramuscular, intravenous, topical, and intradermal) administration. Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. This document also provides methods and materials for using one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). In some cases, one or more chimeric vesiculovirsues provided herein can be used for treating a mammal (e.g., a human) having cancer. For example, one or more vesiculoviruses provided herein can be administered to a mammal having cancer to treat the mammal. Attorney Docket No.07039-2326WO1 / 2024-129 In some cases, the materials and methods provided herein can be used to reduce the size of a cancer in a mammal (e.g., a human). For example, a mammal having cancer (e.g., a human having cancer) in need of treatment thereof can be administered one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) to reduce the size of the cancer in the mammal. In some cases, a mammal (e.g., a human) having cancer can be administered one or more chimeric vesiculoviruses provided herein to reduce the number of cancer cells in the mammal by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, a mammal (e.g., a human) having cancer can be administered one or more chimeric vesiculoviruses provided herein to reduce the volume of one or more tumors in the mammal by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the materials and methods provided herein can be used to improve survival (e.g., recurrence-free survival (RFS), event-free survival (EFS), and / or overall survival (OS)) of a mammal (e.g., a human) having cancer. For example, a mammal having cancer (e.g., a human having cancer) in need of treatment thereof can be administered one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) to improve survival of the mammal. For example, a mammal (e.g., a human) having cancer can be administered one or more chimeric vesiculoviruses provided herein to improve the survival of a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, a mammal (e.g., a human) having cancer can be administered one or more chimeric vesiculoviruses provided herein to improve the survival of a mammal having cancer by, for example, at least 6 months (e.g., about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, about 3 years, about 4 years, about 5 years, or more). Attorney Docket No.07039-2326WO1 / 2024-129 Any appropriate mammal having cancer can be treated as described herein. Examples of mammals that can have cancer and can be treated as described herein (e.g., by administering one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide)) include, without limitation, humans, non-human primates such as monkeys, horses, bovine species, porcine species, dogs, cats, mice, and rats. In some cases, a human having cancer can be treated as described herein. A mammal having any type of cancer can be treated as described herein (e.g., by administering one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide)). In some cases, a cancer treated as described herein can include one or more solid tumors. In some cases, a cancer treated as described herein can be a hematologic cancer (e.g., a blood cancer). Examples of cancers that can be treated as described herein include, without limitation, hepatocellular carcinomas, cholangiocarcinomas, pancreatic adenocarcinomas, urothelial carcinomas, gastric adenocarcinomas, small cell lung cancers, non-small cell lung cancers, breast ductal adenocarcinomas, head and neck cancers, colorectal adenocarcinomas, melanomas, basal cell carcinomas, renal cell carcinomas, osteosarcomas, myelomas, lymphomas, and leukemias. In some cases, a mammal (e.g., a human) having cancer can be given a single administration of a composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). In some cases, a mammal (e.g., a human) having cancer can be given two or more (e.g., two, three, four, or more) times administration of a composition (e.g., a pharmaceutical Attorney Docket No.07039-2326WO1 / 2024-129 composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). When a mammal is given two or more administrations of a composition containing one or more chimeric vesiculoviruses provided herein, each administration can include the same composition or a different composition. In some cases, a mammal having cancer can be given a first administration of a composition containing a population of a first chimeric vesiculovirus provided herein and can be given a second administration of a composition containing a population of a second chimeric vesiculovirus provided herein where the first chimeric vesiculovirus expresses a G polypeptide from a first vesiculovirus (e.g., a MORV-G polypeptide) and the second chimeric vesiculovirus expresses a G polypeptide from a second vesiculovirus (e.g., a JURV-G polypeptide). When a mammal is administered a composition containing a chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and one or more (e.g., one, two, three, four, or more) subsequent treatments each containing a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein are needed or desired, then the mammal can be administered a different chimeric vesiculovirus provided herein (and / or nucleic acid encoding that chimeric vesiculovirus provided herein) as each subsequent administration. For example, a mammal (e.g., a human) having cancer can be given a first administration of a composition containing a first chimeric vesiculovirus provided herein and can subsequently be given a second administration of a composition containing a second chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus. For example, a mammal (e.g., a human) having cancer can be given a first administration of a composition containing a first chimeric vesiculovirus provided herein and can subsequently be given a second administration of a composition containing a second chimeric vesiculovirus that expresses a G polypeptide that is different Attorney Docket No.07039-2326WO1 / 2024-129 from the G polypeptide of the first chimeric vesiculovirus, and can subsequently be given a third administration of a composition containing a third chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus and is different from the G polypeptide of the second chimeric vesiculovirus. For example, a mammal (e.g., a human) having cancer can be given a first administration of a composition containing a first chimeric vesiculovirus provided herein and can subsequently be given a second administration of a composition containing a second chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus, can subsequently be given a third administration of a composition containing a third chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus and is different from the G polypeptide of the second chimeric vesiculovirus, and can subsequently be given a fourth administration of a composition containing a fourth chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus, is different from the G polypeptide of the second chimeric vesiculovirus, and is different from the G polypeptide of the third chimeric vesiculovirus. When a mammal is administered a composition containing a chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and is administered one or more (e.g., one, two, three, four, or more) subsequent treatments each containing a chimeric vesiculoviruses (e.g., a chimeric VSV) provided herein, each subsequent treatment can be given anytime after the mammal has fully recovered from any transient toxicities experienced following the first dose. For example, a composition containing a chimeric vesiculovirus (e.g., a first chimeric vesiculovirus) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) can be administered to a mammal (e.g., a human) having cancer, and a composition containing a different chimeric vesiculovirus (e.g., a second chimeric vesiculovirus where the second chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus) provided herein (and / or nucleic acid encoding a different chimeric vesiculovirus provided Attorney Docket No.07039-2326WO1 / 2024-129 herein) can be administered at least about 3 days following the previous administration. For example, a composition containing a chimeric vesiculovirus (e.g., a first chimeric vesiculovirus) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) can be administered to a mammal (e.g., a human) having cancer, and a composition containing a different chimeric vesiculovirus (e.g., a second chimeric vesiculovirus where the second chimeric vesiculovirus that expresses a G polypeptide that is different from the G polypeptide of the first chimeric vesiculovirus) provided herein (and / or nucleic acid encoding a different chimeric vesiculovirus provided herein) can be administered from about 3 days to about 3 months (e.g., from about 3 days to about 2.5 months, from about 3 days to about 2 months, from about 3 days to about 6 weeks, from about 3 days to about 4 weeks, from about 3 days to about 14 days, from about 3 days to about 10 days, from about 3 days to about 7 days, from about 7 days to about 3 months, from about 10 days to about 3 months, from about 14 days to about 3 months, from about 4 weeks to about 3 months, from about 6 weeks to about 3 months, from about 2 months to about 3 months, from about 7 days to about 2 months, from about 10 days to about 6 week, from about 14 days to about 4 weeks, from about 7 days to about 14 days, from about 4 weeks to about 6 weeks, or from about 6 weeks to about 2 months) following the previous administration. In some cases, the methods described herein also can include identifying a mammal as having cancer. Examples of methods for identifying a mammal as having cancer include, without limitation, physical examination, laboratory tests (e.g., blood and / or urine), biopsy, imaging tests (e.g., X-ray, PET / CT, MRI, and / or ultrasound), nuclear medicine scans (e.g., bone scans), endoscopy, and / or genetic tests (e.g., for tumor markers). A mammal identified as having cancer can be administered or instructed to self-administer one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide). One or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G Attorney Docket No.07039-2326WO1 / 2024-129 polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be administered by any appropriate route (e.g., intratumoral, intraperitoneal, intravenous, intramuscular, subcutaneous, oral, and transdermal) to a mammal. In some cases, one or more chimeric vesiculoviruses provided herein can be administered intratumorally to a mammal (e.g., a human). An effective amount of a composition (e.g., a pharmaceutical composition) containing one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) can be any amount that can treat the cancer without producing significant toxicity to the mammal. An effective amount of one or more chimeric vesiculoviruses provided herein can be any appropriate amount. In some cases, an effective amount of one or more chimeric vesiculoviruses (e.g., one or more chimeric VSVs) provided herein can be from about 5e950% Tissue Culture Infectious Dose (TCID50) units to about 1.7e11 TCID50units. The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, when a mammal (e.g., a human) having cancer is administered a composition containing a first chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) and displays no dose limiting toxicity along with a lack of neutralizing antibody titers and lack of anti-tumor activity, the mammal can be administered a second dose of a composition containing an increased amount of a second chimeric vesiculovirus (e.g., a second chimeric VSV) provided herein (and / or nucleic acid encoding a second chimeric vesiculovirus provided herein). For example, when a mammal (e.g., a human) having cancer is administered a composition containing a first chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) and displays a dose limiting toxicity and at least some anti-tumor response, the mammal can be administered a second dose of a composition containing a decreased amount of a second chimeric vesiculovirus (e.g., a second chimeric VSV) provided herein (and / or nucleic acid encoding a Attorney Docket No.07039-2326WO1 / 2024-129 second chimeric vesiculovirus provided herein). For example, when a mammal (e.g., a human) having cancer is administered a composition containing a first chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) and displays little to no dose limiting toxicities, strong neutralizing antibody responses, and anti-tumor response, the mammal can be administered a second dose of a composition containing the same amount of a second chimeric vesiculovirus (e.g., a second chimeric VSV) provided herein (and / or nucleic acid encoding a second chimeric vesiculovirus provided herein). In some cases, administering a composition containing a chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and, optionally, administering one or more (e.g., one, two, three, four, or more) subsequent treatments each containing a chimeric vesiculoviruses (e.g., a chimeric VSV) provided herein can be used as the sole active method for treating a mammal (e.g., a human) having cancer. In some cases, administering a composition containing a chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (e.g., one or more chimeric vesiculovirus each having a genome that (a) includes a nucleic acid sequence (e.g., a recombinant nucleic acid sequence) encoding a heterologous G polypeptide and (b) lacks at least a portion of an endogenous nucleic acid sequence that encodes a G polypeptide) and, optionally, administering one or more (e.g., one, two, three, four, or more) subsequent treatments each containing a chimeric vesiculoviruses (e.g., a chimeric VSV) provided herein can be used together with one or more (e.g., one, two, three, four, five or more) additional agents and / or therapies as a method for treating a mammal (e.g., a human) having cancer. Examples of additional anti-cancer agents that can be used in combination with one or more chimeric vesiculoviruses provided herein include, without limitation, chemotherapeutic agents, targeted therapies, cytotoxic agents, immune checkpoint inhibitors (e.g., anti-PD-1 antibodies and anti-CTLA-4 antibodies), antibody-drug conjugates, and any combinations thereof. In cases where one or more chimeric vesiculoviruses provided herein are used in combination with additional agents used to treat cancer, the one or more additional agents can be Attorney Docket No.07039-2326WO1 / 2024-129 administered at the same time (e.g., in a single composition containing both one or more chimeric vesiculoviruses provided herein and containing the one or more additional agents) or independently. For example, one or more chimeric vesiculoviruses provided herein can be administered first, and the one or more additional agents administered second, or vice versa. Examples of therapies that can be used to treat cancer include, without limitation, surgery, radiation therapies, and adoptive cell transfer therapies. In cases where one or more chimeric vesiculoviruses provided herein are used in combination with one or more additional therapies used to treat cancer, the one or more additional therapies can be performed at the same time or independently of the administration of one or more chimeric vesiculoviruses provided herein. For example, the one or more chimeric vesiculoviruses provided herein can be administered before, during, and / or after the one or more additional therapies are performed. In some cases, the size of the cancer (e.g., the number of cancer cells and / or the volume of one or more tumors) present within a mammal and / or the severity of one or more symptoms of the cancer being treated can be monitored. Any appropriate method can be used to determine whether or not the size of the cancer present within a mammal is reduced. For example, imaging techniques can be used to assess the size of the cancer present within a mammal. In some cases, when a mammal (e.g., a human) having cancer is administered a composition containing a first chimeric vesiculovirus (e.g., a first chimeric VSV) provided herein (and / or nucleic acid encoding a first chimeric vesiculovirus provided herein) and the size of the cancer present within the mammal is not reduced, the mammal can be administered one or more (e.g., one, two, three, four, or more) subsequent treatments each containing a chimeric vesiculovirus (e.g., a chimeric VSV) provided herein. The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES Example 1: Chimeric Oncolytic VSVs This Examples describes the design and characterization of chimeric VSVs that can be used for oncolytic anti-cancer virotherapies. Attorney Docket No.07039-2326WO1 / 2024-129 A library of pseudotyped vesiculoviruses was developed to engineer chimeric vesiculoviruses that are serotypically unique and can be used in repeat dosing treatment regimens. Methods Plasmid pVSV-XN2 underwent laboratory cloning methods to remove VSV-G gene and replace with respective, codon optimized, vesiculovirus G gene (Genscript, USA). To rescue infectious chimeric vesiculoviruses, BHK-21 cells stably expressing T7 RNA polymerase were transfected with full length vesiculovirus genome plasmid and individual helper plasmids expressing VSV-N, VSV-P, and VSV-L. Supernatant from P0rescue underwent plaque purification, amplification on BHK-21 cells, sucrose gradient purification, and sequence validation. Plaque assays were performed by incubation of 10-fold dilutions of viral stock in 1 mL OptiMEM media on 60 mm plates containing confluent BHK-21 cells for 1 hour at 37oC. Infection media was removed and replaced with 2% agar overlay.48hours post infection agar overlay was removed and plaques were visualized by 0.5% crystal violet stain. Chimeric vesiculovirus kinetics was performed by seeding 5e5 BHK-21 cells in 6- well plates overnight. The following day cells were infected with an MOI of 0.1 in 1 mL OptiMEM media for 1 hour at 37oC. Infection media was removed and replaced with 2 mL of complete DMEM. Each well was utilized for a single time point at which supernatant was removed and titered by the Spearman–Kärber Method for TCID50calculation. Oncolytic ability of chimeric vesiculoviruses was determined by screening against a panel of solid and hematological tumor cell lines. Cells were seeded at 1e4 cells / well in a 96- well plate in 50 µL complete medium. The following day viruses were added in 10-fold dilutions in 50 µL OptiMEM. At 72 hours post infection cell viability was ready by Promega CellTiter 96®AQueous One Solution Cell Proliferation Assay (MTS) kit instructions. Experiments were performed with 3 technical replicates per plate and 3 biological replicates. Neutralization assays performed with commercially available antibodies by incubating 1:1 volumes of 10-fold dilutions of antibody and virus for 1 hour at 37oC in OptiMEM.50 µL of virus-antibody solution was incubated for 72 hours on BHK-21 cells, seeded day prior at 1e4 cells / well in 50 µL complete DMEM. Cell viability was read by Attorney Docket No.07039-2326WO1 / 2024-129 Promega CellTiter 96®AQueous One Solution Cell Proliferation Assay (MTS) kit instructions. Experiments were performed with 2 technical replicates per plate and 3 biological replicates. Neutralization assays performed with patient serum involved incubating 1:1 volumes of patient serum at 2-fold dilutions and virus at 1e4 TCID50 units per well for 1 hour at 37oC in OptiMEM.50ul of virus-antibody solution was incubated for 72 hours on BHK-21 cells, seeded day prior at 1e4 cells / well in 50ul complete DMEM. Cell viability was read by Promega CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) kit instructions. Experiments were performed with 3 technical replicates per plate and 3 biological replicates. Results Publicly available sequences of G polypeptide open reading frames (ORFs) were codon optimized for production in BHK-21 producer cells and cloned into a VSV-XN2 rescue plasmid (Genscript, USA). Following viral rescue, full RNA genome sequencing was performed to validate the final viral product and confirm pseudotype success (Figure 2A-B). Plaque assays were performed and chimeric VSVs and respective wild type vesiculoviruses displayed equivalent plaque sizes (Figure 3). Equivalent plaque size was indicative of the pivotal role the viral glycoprotein plays in efficient virus budding from the cell. The chimeric VSVs showed high titer production, 2x107to 4x1010TCID50 / mL within 24-hours of viral infection (Figure 4). The chimeric VSVs demonstrated oncolytic ability in both solid and liquid cancer cell line models (Figure 5). The chimeric VSVs escaped neutralization by commercially available VSV-G antibody clones 1E9F9 and 8G5F11 (Figure 6). The chimeric VSVs also escaped neutralization by patient serum containing anti-VSV antibodies (Figure 7). Attorney Docket No.07039-2326WO1 / 2024-129 Example 2: Chimeric Oncolytic VSVs The results in this Example re-present and expand on at least some of the results provided in other Examples. Methods Amino acid or nucleotide sequences were obtained from National Center for Biotechnology Information (NCBI) reference sequences. For genera information outside of the Vesiculovirus genus, the International Committee on Taxonomy of Viruses (ICTV) virus taxonomy profile: Rhabdoviridae was referenced. Sequences were aligned using Muscle Alignment tool. Aligned sequences underwent maximum likelihood fit with 500 bootstrap replicates. This analysis involved 34 nucleotide sequences or 22 amino acid sequences. Evolutionary analyses were conducted in MEGA11. Branch points display bootstrap confidence and branch lengths are proportional to the number of nucleotide substitutions per site between the sequences represented. Branches represent the estimated evolutionary distance between viral species. Chimeric vesiculovirus kinetics was performed by seeding 5e5 BHK-21 cells in 6- well plates overnight. The following day cells were infected with an MOI of 0.1 in 1 mLOptiMEM media for 1 hour at 37 . Infection media was removed and replaced with 2 mLof complete DMEM. Each well was utilized for a single time point at which supernatant was removed and titered by the Spearman–Kärber Method for TCID50calculation. Plaque assays were performed by incubation of 10-fold dilutions of viral stock in 1 mL OptiMEM media on confluent Vero-E6 cells in 6-well plates for 1 hour at 37oC. Infection media was removed and replaced with 2% agar overlay.48 hours post infection agar overlay was removed and plaques were visualized by 0.5% crystal violet solution containing 20% methanol. Plates were imaged using GE Amersham Imager 680 and plaque size was calculated using ImageJ macro ViralPlaque. Cell lines were cultured in ATCC recommended complete DMEM or RPMI. Complete media includes supplementation with 10% Fetal Bovine Serum and 1% Penicillin- Streptomycin. HCC lines: Hep3B, HepG2, Huh7; CCA lines: EGI-1, GBD-1, CAK-1; SARC lines: A673, 143B, HTB-88; PANC lines: PANC-1, HPAF-II, MiaPaca-2; AML lines: MV4- 11, THP-1, HEL-92; Borad laboratory stocks of ATCC acquired lines. RCC lines: UMRC3, Attorney Docket No.07039-2326WO1 / 2024-129A498; PC lines: PC3. GBM lines: GBM22, GBM43, GBM44. Cells were seeded at 1e4cells / well in a 96-well plate in 50 µL complete medium. The following day viruses were added in 10-fold dilutions (MOI 10-0.01) in 50 µL OptiMEM. At 72 hours post infection cell viability was read by Promega CellTiter 96®AQueous One Solution Cell Proliferation Assay (MTS) kit instructions. Experiments were performed with 3 technical replicates per plate and 3 biological replicates. Neutralization assays were performed with monoclonal antibodies 8G5F11 and 1E9F9 (Absolute Antibody, UK), patient serum, or mouse plasma. Patient serum and mouseplasma were heat inactivated for 30 minutes at 56 . Antibody was pre-incubated with virus(500 TCID50 units) in equal volumes for 1 hour at 37 . Antibody / virus mix was added toBHK-21 cells, seeded day prior at 1e4 cells / well in 96 well plate.72 hours post infection cell viability was read by Promega CellTiter 96®AQueous One Solution Cell Proliferation Assay (MTS) kit instructions. Experiments were performed with 3 technical replicates per plate. Monoclonal antibody experiments were performed 3 individual times. Patient serum was assessed from two patients at day 22 and 29. Mouse experiments are representative of 4 mice per group. In Vivo studies were performed by obtaining female C57Bl / 6J (Strain #:000664) mice from The Jackson Laboratory (Bar Harbor, ME). Mice were 6-8 weeks of age upon receipt and maintained in a specific pathogen-free BSL2 biohazard facility. C57Bl / 6J mice were challenged intravenously with respective viral vector at vaccination doses of 1e7 TCID50 units in 50 µL PBS. Mice were subcutaneously implanted with 5e5 B16-OVA- IFNAR- / - cells. Once tumors reached approximately 0.2 cm in diameter, three treatments were administered intravenously at doses of 5e6 TCID50 / units on day 0, 5e6 TCID50 / units on day 3, and 1e6 TCID50 / units on day 5 for an average of 3.5e6 TCID50 / units per dose. Mice were monitored and tumor volume was calculated using the following equation: (LengthxWidth2) / 2. Analysis of viral delivery to the tumor microenvironment was performed using resected tumors. Resected tumors were individually weighed before being surgically divided for individual analysis by viral plaque assay, qPCR, and flow cytometry. Tumor sections for plaque assay were disrupted in OptiMEM using a Tissueruptor (Qiagen, USA) for no more than 10 seconds to preserve virus integrity. Tissue homogenate was serially diluted in 10-fold volumes before transferring to confluent BHK-21 cells in 12 well plates. Attorney Docket No.07039-2326WO1 / 2024-129Virus infection occurred for 2 hours at 37 before removal of infection media and overlaywith 3% carboxymethyl cellulose (CMC) solution. After 48 hours plaques were visualized by removing CMC overlay and staining cell monolayer with 0.1% crystal violet solution containing 80% methanol. Viral qPCR was performed by extracting viral RNA from tumor tissues using the RNeasy Mini Kit (Qiagen, USA) following the manufacturer’s protocol. cDNA synthesis was performed using the iScript cDNA Synthesis Kit (Bio-Rad, USA). SYBR Green-based real-time quantitative PCR (qPCR) was conducted using the Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Expression of VSV-N was quantified using mouse qPCR Primers (forward: 5’-TGTCTACCAAGGCCTCAAATC-3’ (SEQ ID NO:16); reverse: 5’- CCTGCTTTCCCGATGTTTATTC-3’ (SEQ ID NO:17)). Gene expression levels were normalized to Rplp0 using mouse qPCR Primers (forward: 5’- CGCTTGTACCCATTGATGATG-3’ (SEQ ID NO:18); reverse: 5’- TTATAACCCTGAAGTGCTCGAC-3’(SEQ ID NO:19)) and analyzed using the Ct method. Single cell suspensions of spleens and tumors were generated from euthanized mice and immediately processed for flow cytometry studies. Tumors were weighed and digestedwith DNAse I (Sigma) and Liberase TL (Roche) for 30 min in a 37 water bath. Spleensand tumors were subjected to ACK red blood cell lysis buffer. Cells were stained for surface markers, washed, and fixed in 4% formaldehyde as previously described. Samples were analyzed using a Cytek Aurora spectral flow cytometer with SpectroFlo (V3.1.0) software for unmixing and Flowjo (V10.1) for data analysis. Tetramers for Ova257-264 (SIINFEKL (SEQ ID NO:14))-APC and VSVN52-59 (RGYVYQGL (SEQ ID NO:15))-PE were obtained from the NIH Tetramer Core Facility. Tetramers were used at a concentration of 1:100 andincubated at 4 for 30 minutes before full surface marker panel staining. Murine antibodypanel: CD45.2 (eBioscience, NovaFluor 585), CD3 (BioLegend, AF700), CD4 (BioLegend, PerCP), CD8b.2 (BioLegend, PacBlue), CD11b (BioLegend, PerCP / Cy5.5), CD11c (BioLegend, BV510), CD19 (BD Horizon, RB744), NK1.1 (BioLegend, FITC), F4 / 80 (BioLegend, APC-Fire810), CD206 (BioLegend, PE-Fire700), PD-1 (BioLegend, BV711), CD39 (BioLegend, PE-Dazzle), CCR7 (BioLegend, PE-Cy7), CD44 (BioLegend, BV785), Attorney Docket No.07039-2326WO1 / 2024-129 CD62L (BD Horizon, BV605), Zombie live / dead (BioLegend, NIR), IFNy (BioLegend, APC). For intracellular staining and detection of IFNy, cell suspensions were first cultured inRPMI + IL2 (1:1000) at 37 + 5% CO2 for no more than 12 hours. Suspensions were thenstimulated with viral or tumor peptides and Golgi plug 1:1000 (BD) as denoted at a peptide concentration of 1 µg / mL for 4 hours. Cells were then stained and fixed using BD Cytofix / Cytoperm plus with BD Golgi Plug kit (BD Biosciences 555028). Statistical analyses were performed using GraphPad Prism 10.3.1 software. Where applicable curves were assessed with Sigmoidal curves with Four-Parameter Logistic Models. In vitro data was assessed with One-way ANOVAs with Sidaks’s multiple comparison posttest. In vivo data was assessed with Kruskal-Wallis test with Dunn’s correction and survival curves were assessed by Mantel-Cox test. P-values have been set at p=<0.05 and ns=>0.05. Error bars denote the SEM of samples. Figures were generated using GraphPad Prism 10.3.1 software, Biorender, and Adobe Illustrator. Cluster plot analysis was performed using R CATALYST package in R.4.3.1. Pre-established exclusion criteria from mouse survival studies included removal of animals with failed tumor engraftment and those which were euthanized due to endpoint criteria outside of tumor sizes reaching 1cm in diameter. Data from spleen samples with poor overall viability were excluded from analysis. Results The Vesiculovirus genus displays broad evolutionary expansion indicative of RNA viruses and their high mutational rate (Figure 8A). Viral species separate into distinct clades with the potential to induce unique serotype responses. Generation of an oncolytic Vesiculovirus library by creating a chimeric virus panel expressing unique viral glycoproteins within the vesiculovirus genus (Figure 8B). Chimeric viruses maintained fast oncolytic replication cycle compared to prototypic VSV (Figure 8C). Viruses induced new viral progeny within a 24-hour window. These viruses produced high titers necessary for potential manufacturing of intravenous doses. Quantitative analysis of plaque images exemplary of Figure 3 (Figure 8D). The glycoprotein served as an essential protein in the viral life cycle for spread from cell to cell. Utilizing a vesiculovirus library displayed oncolytic capacity in a broad range of cancer cell line models (Figure 8E). Attorney Docket No.07039-2326WO1 / 2024-129 The chimeric VSVs escaped neutralization by commercially available, monoclonal VSV-G antibody clones 1E9F9 and 8G5F11 (Figure 9A). The chimeric VSVs escaped cross neutralization by patient serum containing polyclonal anti-VSV antibodies (Figure 9B). These results demonstrate that the viral glycoproteins displayed unique serotypes, different from VSV. A concept for a murine model to establish pre-existing viral immunity before intentional treatment of cancer model with oncolytic vesiculovirus is shown in Figures 10A and 10B. Evasion of pre-existing immunity displays potential of a repeat dosing strategy in oncolytic virotherapy. Survival curve showing that using unique oncolytic vesiculoviruses for repeat dosing allows improvement on overall survival of mice compared to mouse treated with a repeated dose of identical viral vector (Figure 10C). Tumor burden curves showing that treatment with novel vesiculovirus vectors causes a significant delay in tumor growth (Figure 10D). Further dosing with a vector library, should continue to delay tumor growth. Viral plaque assay where plaques indicate presence of live, replication competent virus within the tumor sample (Figure 10E). This indicated delivery of the viral vector, even with the establishment of pre-existing anti-viral immunity. qPCR further validating delivery of the virus to the tumor (Figure 10F). Viral genomes were stable for longer than replication competent virus, providing a larger window for accurate depiction of delivery of the virus to the tumor bed. Seroconversion after the immunization dose validates that the viral vectors stimulate a humoral response (Figure 11A). This humoral response must be evaded for delivery of the treatment vector to the tumor microenvironment and improvement on mouse survival. Potential cross neutralization was determined (Figure 11B). Prior in vitro data utilized antibody populations generated against the prototypic VSV vector. In this murine model, polyclonal antibody populations were generated against our novel vesiculovirus glycoproteins. These antibody populations did not cross react to VSV, the treatment vector. Morreton virus displayed mild cross reactivity. End of study serum displayed two antibody populations, representative of the two unique viral vectors the murine group was exposed to (Figure 11C). This showed that each viral vector has a unique serotype, that does not cross react with other members of the vesiculovirus library. This provides evidence for the ability to continue repeat dosing with the vesiculovirus library. Attorney Docket No.07039-2326WO1 / 2024-129 The delivery of a vesiculovirus vector to the tumor microenvironment, even with pre- existing anti-viral immunity, still stimulated infiltration of a diverse immune cell population with pro-inflammatory characteristics (Figure 12A). T cells are drivers of anti-tumor immunity. The T-cell populations within the tumor microenvironment showed that vesiculovirus delivery induces activation of T cells, markers CD44, CD39, and PD-1 (Figure 12B). Higher counts of these markers indicate infiltration and expansion of responsive T cell populations. These T cells were active, but not exhausted. Over-expression of CD44, CD39, and PD-1 proteins on the cell surface indicate exhausted T-cells, with dysfunctional response. By indicating that treatment groups have low MFI, which indicates low overall protein expression of these markers, these results demonstrate a healthy tumor microenvironment, that is proinflammatory and not exhausted. : Distinction of anti-viral versus anti-tumor CD8 T cells (Figure 12C). Pre-existing immunity could reduce the effectiveness of oncolytic virotherapy when given in repeat doses. However, our data indicates that even in an environment skewed towards anti-viral T-cells, we still generated anti-tumor T cell responses. The anti-tumor T cell responses that drive murine survival and delay in tumor growth. Memory cell populations show that the immunization step of the experiment induced anti-viral memory that was likely restimulated by the treatment dose (Figure 12D). However, generation of effector memory populations against the tumor antigen was still seen. Continued dosing with the oncolytic vesiculovirus library can restimulate anti-tumor immune memory cell populations. No toxicity was displayed in the mice (Figure 13A). When looking at overall interferon levels within the blood the only group with mildly elevated IFN levels was the CARV-VSV group. This could be a result of this group displaying longer replication of virus or indicative of alternative biological functions the Carajas glycoprotein can induce. Assessing general inflammatory markers following a second dose of oncolytic virotherapy does not display overt toxicity (Figure 13B). Of note, the only group with consistent elevation in inflammatory markers is the VSV-VSV cohort. This could indicate that the pre- existing humoral immunity to VSV, when stimulated with a second dose of VSV, has a stronger innate immune response, that can be captured in inflammation markers within the blood. Also providing evidence for viral neutralization and lack of delivery to the tumor. Attorney Docket No.07039-2326WO1 / 2024-129 None of the novel vesiculovirus glycoproteins displayed innate avoidance of the complement cascade (Figure 14). Complement is activated by natural IgM antibodies binding to viral proteins. Cancer cell lines, like patients, display heterogenous responses to oncolytic virotherapy (Figure 15). The interferon pathway is a strong predictor of patient response, by whether or not the cancer is interferon signaling intact. In the cancer cell line panel, cell lines that are generally susceptible to oncolysis did not induce IFNs, indicating defective signaling. Cell lines that are generally resistant to oncolysis had greater levels of IFN signaling, providing a mechanism of resistance. The Carajas chimeric virus (CARV), appearred to induce IFNs in resistant cell lines, but still induced oncolysis. Example 3: Exemplary Recombinant VSV Sequences This Example provides exemplary recombinant (e.g., codon optimized) nucleic acid sequences that can encode a VSV G polypeptide. Nucleotides shown in underlined font indicate points of optimization. Exemplary recombinant nucleic acid that can encode a MORV-G polypeptide SEQ ID NO:1: ATGCTGGTGCTGTACCTGCTGCTGTCCCTGCTGGCCCTGGGCGCCCAGTGTAAGTTCACCAT CGTGTTCCCTCACAACCAGAAGGGCAACTGGAAGAACGTGCCTGCCAACTACCAGTATTGCC CTTCCTCCTCCGACCTGAACTGGCACAACGGCCTGATCGGCACCTCCCTGCAGGTGAAGATG CCCAAGTCCCACAAGGCCATCCAGGCTGACGGATGGATGTGCCACGCTGCTAAGTGGGTGAC CACCTGCGACTTCCGGTGGTACGGCCCTAAGTATGTGACCCACTCCATCAAGTCCATGATCC CCACCGTGGACCAGTGTAAGGAGTCCATCGCCCAGACCAAGCAGGGCACCTGGCTGAACCCT GGATTCCCTCCTCAGTCCTGCGGATACGCCTCCGTGACCGACGCTGAGGCCGTGATCGTGAA GGCTACCCCTCACCAGGTGCTGGTGGACGAGTATACCGGCGAGTGGGTGGACTCCCAGTTCC CTACCGGCAAGTGTAACAAGGACATCTGCCCCACCGTGCACAACTCCACCACCTGGCACTCC GACTATAAGGTGACCGGCCTGTGCGACGCCAACCTGATCTCTATGGACATCACCTTCTTCTC AGAGGACGGCAAGCTGACCTCCCTGGGCAAGGAGGGCACCGGCTTCAGGTCCAACTACTTCG CCTATGAGAACGGCGACAAGGCCTGTCGGATGCAGTACTGCAAGCACTGGGGCGTGAGGCTG CCTTCCGGCGTGTGGTTCGAGATGGCCGACAAGGACATCTATAACGACGCCAAGTTCCCTGA Attorney Docket No.07039-2326WO1 / 2024-129 CTGTCCTGAGGGCTCCTCCATCGCTGCTCCTTCCCAGACCTCCGTGGACGTGTCCCTGATCC AGGACGTGGAGCGTATCCTGGACTACTCCCTGTGCCAGGAGACCTGGTCCAAGATCCGTGCC CACCTGCCTATCTCCCCCGTGGACCTGTCCTATCTGTCCCCTAAGAACCCTGGCACCGGACC TGCCTTCACCATCATCAACGGCACCCTGAAGTACTTCGAGACCCGGTATATCAGGGTGGACA TCGCCGGCCCTATCATCCCCCAGATGCGTGGCGTGATCTCCGGCACCACCACCGAGAGGGAG CTGTGGACCGACTGGTATCCTTACGAGGACGTGGAGATCGGACCTAACGGCGTGCTGAAGAC CGCTACCGGCTACAAGTTCCCTCTGTATATGATCGGCCACGGCATGCTGGACTCCGACCTGC ACATCTCCTCCAAGGCCCAGGTGTTCGAGCACCCTCACATCCAGGACGCTGCCTCCCAGCTG CCTGACGACGAGACCCTGTTCTTCGGCGACACCGGCCTGTCCAAGAACCCTATCGAGCTGGT GGAGGGCTGGTTCTCCGGCTGGAAGTCCACCATCGCCTCCTTCTTCTTCATCATCGGCCTGG TCATCGGCCTGTACCTGGTGCTGCGTATCGGCATCGCCCTGTGCATCAAGTGCAGGGTGCAG GAGAAGCGTCCCAAAATCTACACCGACGTGGAGATGAACCGTCTGGACCGGTAA Exemplary recombinant nucleic acid that can encode a JURV-G polypeptide SEQ ID NO:2: ATGGAGTCCCTGCCTTTCTCCGCCCTGCTGGCCGTGCTGTCCATCACCCTGTGCGACTCCGC CATCCCCATCTTCTTCCCTTCCGAGCCCCAGCTGGAGTGGAAGCCTGTGCTGCCTGGCTCCC GGTACTGCCCTCAGTCCAACGAGATGTCCCTGGACCCCGACCTGAAGAAGTCCACCATCTCC GTGAAGGTGCCTATCGGCGTGACCCCCTCCAAGTCCGACGGCTACCTGTGCCACGGCGCTAA GTGGGTGTCCACCTGCGACTTCAGGTGGTACGGCCCTAAGTATATCACCCACTCCATCCACA ACCTGCGTCCCACCACCAACGACTGTGAGGACGCCATCAAGAAGTACGAGGCCGGCACCCTG ATCAACCCTGGCTTCCCTCCCGACTCCTGCGCCTATGCCACCGTGACCGACTCCGAGCACCT GGTCATCCTGATCACCCCTCACCACGTGGGAGTGGACGACTACAGGGGAGCTTGGGTGGACG ACTCCTTCCCCTCCGGCGTGTGCGAGACCAACCAGTGCGACACCACCCACAACTCCTCCATC TGGATTCCTAAGACCAAGACCCGGCACAACATCTGTTCCCAGACCTTCGCCAACCTGTCCGT GACCATCTCCTACAGGGAGGGAGGAGCTATGAAGGGAGCTGACATGGTGTTCCACTCCAAGT ATCACCCTCACATGGTGGGCGGCCACATCTGTAAGATGAACTTCTGCAACAAGCAGGGCCTG CGTCTGCAGAACGAGGAGTGGATCGAGATCCCCTCCGGCACCAAAGTGGGCAACCAGGACCT GATGAACCTGTTCTCCGACTGTAAGTCCGGCCTGGAGGTGCGGTCCACCCTGAGGTCCGAGG GAGCTAACACCCTGACCTGGGAGACCCAGCGTCTGCTGGACTACGCCCTGTGCCAGAACACC Attorney Docket No.07039-2326WO1 / 2024-129 TGGGACAAGTTCGACAACCAGGGAGCCGTGTCCGCCCTGGACCTGTCCTACCTGGCTGCCCG GGCCCCTGGCAAGGGAGTGGCCTATACCATGATCAACGGCACCCTGCACTCCGCCCCTACCC GTTATGTGCGGATGTGGATCGAGTCCCCCAGCATGGAGGAGCTGAAGGCCAAGAAGGAGTCC TCCTCCGGCGTGGAGACCTCCATCTGGAACCAGTGGTTCCCTTTCAAGGGAGGAGAGATCGG ACCTAACGGACTGATCAAGGCCGGCAACAAGTACAAGTTCCCTCTGTATCTGGTGGGCATGG GCATGCTGGACGACGAGATCAACGCCCTGGAGCTGGGAGGACCTATCGACCACCCTCAGAGG GCCCACGCTCAGGCCGTGCTGGGCGACGAGGAGACCCTGTTCTTCGGCGACACCGGAGTGGG CAAGAACCCTGTGGAGCTGATCACCGGCTGGTTCTCCGGCTGGAAGGAGACCATCATGGCCG TGGTGGCCATCTTCCTGCTGGTCATCGTGCTGTACGGCGTGCTGCGTTGTTGCCCTACCATC TGCGTGCTGTGCAAGCGGAAGTCCCGGCACAGGACCAAGGACATGGAGATGCAGTATATCCC CAACAACCAGAGGCACTGGCGTTAA Exemplary recombinant nucleic acid that can encode a MSPV-G polypeptide SEQ ID NO:3: ATGGAGTCCCTGCTGAAGGCCATCTGCGTGCTGCTGCTGATCCACTGTTCCCGTTGCGACCT GCCTATCGTGTTCCCCGACCAGAAGGAGCTGCTGTGGAACCCTGTGCTGAAGACCAACAGGT ACTGCCCTCAGACCCGTGAGATCGCTCCTCTGGACAAGCCCAAGACCCTGAAGATCACCACC GGCGTGCCTGTGCGGTCCCCTAAGGAGAAGATCGAGGGCTACCTGTGCCACTCCGGCAAGTG GGTGACCACCTGCGACTACCGGTGGTATGGCGCCAAGTATGTGACCCACTCCATCCACCACC TGAAGCCTACCGACCAGATGTGCAGGGACGCCATCTCCCAGTACAACGGAGGCACCCTGCTG AACCCTGGATTCCCTCCTGAGGTGTGCGGCTATGCCTCCGTGACCGACTCCGAGCTGATCAT CACCCTGATCACCCCTCACACCGTGGGCGTGGACGACTACAGGGGCCTGTGGATCGACCCTT CCTTCCCCAACGGCGAGTGTAACTCCATCGTGTGCGAGACCATCCACAACTCCACCAAGTGG GTGTCCAAGGGCGAGATGCCTACCGACATCTGTCAGCAGACCTTCACCACCATCAAGATGGA CGTGTCCTATCCTTCCGACACCACCTCCCAGGGCTCCCTGCTGTCCTTCCACTCCCCTTACC ACCCCCACATCTCCGGCAAGGACATCTGTAAGATGTCCTATTGCGGCTCCAACGGCCTGCGT CTGCCTAACGGCGAGTGGTTCTCCATCATCAACACCTCCAAGATCGGCAACAAGAACCTGAT CGACTTCTTCTCCCCCTGTAAGGCTGGAGTGGAGGTGAGGTCCACCCTGCAGTCCGAGGGCT CCCAGACCATCGCCTGGGAGACCCAGCGTATGCTGGACTACGCCCTGTGCCAGAACACCTGG GACAAGTTCGAGCGTGGAGAGCCTCTGTCCCCCCTGGACCTGAACTACCTGGCTCCTCGGGT GCCCGGCAAGGGAATGGCCTATACCATCATCAACAACACCCTGCACTCCTCCCACGCCGTGT Attorney Docket No.07039-2326WO1 / 2024-129 ATCGGAGGGTGTGGATCGAGGGCCCTATCATCGGCGAGATGAAGGGCAAGATCGAGTCCGCC ACCGGAGTGGCCAAGGAAATCTGGGCCCAGTGGTTCGAGTTCGGCCAGAACAAGATCGGCCC TAACGGCGTGATCAAGACCAACGACGGCATCAAGTTCCCCCTGTATGCCATCGGCACCGGCC TGATCGACCAGGACATCCACGAGCTGTCCGAGGTGTCCCCTATGGACCACCCCCACCTGGTG CACGCCAAGAAGTACGTGTCCGAGGACGACGAAATCTACTTCGGCGACACCGGCGTGTCCCA CAACCCTGTGGAAATCTTCTCCGGCTGGTTCACCAACTGGAAGGAGGGCCTGATGAAGTTCT CCATCCTGGTGCTGTCCATCCTGATCTTCTACGTGGTCATCCGGCTGGTCATGTGCATCCCT CTGAAGTGCAAGAAGGAGCGTAAGCCTCGGCTGGAGTTCGAGCTGCAGCCCCGGGAGTGGGA GTATTCCAGGGCCTAA Exemplary recombinant nucleic acid that can encode a ISFV-G polypeptide SEQ ID NO:4: ATGACCTCCGTGCTGTTCATGGTGGGCGTGCTGCTGGGAGCCTTCGGCTCCACCCACTGTTC CATCCAGATCGTGTTCCCTTCCGAGACCAAGCTGGTGTGGAAGCCCGTGCTGAAGGGCACCC GTTACTGCCCTCAGTCCGCCGAGCTGAACCTGGAGCCCGACCTGAAGACAATGGCCTTCGAC TCCAAGGTGCCTATCGGCATCACCCCCTCCAACTCCGACGGCTACCTGTGCCACGCTGCTAA GTGGGTGACCACCTGCGACTTCCGGTGGTACGGCCCTAAGTATATCACCCACTCTGTGCACT CCCTGAGGCCTACCGTGTCCGACTGTAAGGCTGCTGTGGAGGCCTACAACGCTGGCACCCTG ATGTATCCTGGATTCCCTCCTGAGTCCTGCGGATACGCCTCCATCACCGACTCCGAGTTCTA TGTGATGCTGGTGACCCCTCACCCTGTGGGAGTGGACGACTACAGGGGACACTGGGTGGACC CTCTGTTCCCCACCTCCGAGTGTAACTCCAACTTCTGCGAGACCGTGCACAACGCCACCATG TGGATTCCTAAGGACCTGAAGACCCACGACGTGTGCTCCCAGGACTTCCAGACCATCCGGGT GTCCGTGATGTATCCTCAGACCAAGCCTACCAAGGGAGCCGACCTGACCCTGAAGTCCAAGT TCCACGCCCACATGAAGGGCGACCGGGTGTGCAAGATGAAGTTCTGCAACAAGAACGGCCTG CGTCTGGGCAACGGCGAGTGGATCGAAGTGGGCGACGAAGTGATGCTGGACAACTCCAAGCT GCTGTCCCTGTTCCCTGACTGTCTGGTGGGCTCCGTGGTGAAGTCCACCCTGCTGTCCGAGG GAGTGCAGACCGCCCTGTGGGAGACCGACAGGCTGCTGGACTACTCCCTGTGCCAGAACACC TGGGAGAAGATCGACCGTAAGGAGCCCCTGTCCGCCGTGGACCTGTCCTACCTGGCTCCTCG GTCCCCTGGCAAGGGAATGGCCTATATCGTGGCTAACGGCTCCCTGATGTCCGCCCCTGCCC GGTATATCAGGGTGTGGATCGACTCCCCCATCCTGAAGGAGATCAAGGGCAAGAAGGAGTCC GCCTCCGGAATCGACACCGTGCTGTGGGAGCAGTGGCTGCCTTTCAACGGCATGGAGCTGGG Attorney Docket No.07039-2326WO1 / 2024-129 CCCCAACGGCCTGATCAAGACCAAGTCCGGCTACAAGTTCCCTCTGTATCTGCTGGGCATGG GCATCGTGGACCAGGACCTGCAGGAGCTGTCCTCCGTGAACCCTGTGGACCACCCTCACGTG CCTATCGCTCAGGCCTTCGTGTCCGAGGGAGAGGAGGTGTTCTTCGGCGACACCGGCGTGTC CAAGAACCCTATCGAGCTGATCTCCGGCTGGTTCTCCGACTGGAAGGAGACCGCCGCCGCCC TGGGATTCGCTGCCATCTCCGTGATCCTGATCATCGGCCTGATGAGGCTGCTGCCTCTGCTG TGCCGGAGGCGTAAGCAGAAGAAAGTGATCTACAAGGACGTGGAGCTGAACTCCTTCGACCC CCGTCAGGCCTTCCACCGGTAA Exemplary recombinant nucleic acid that can encode a RADV-G polypeptide SEQ ID NO:5: ATGATCTCCATCACCTTCGTGTACCTGATCATCATCCTGTCCCTGTCCTGGGGCGAGATGAT GATCCCTTTCCCCGACGTGACCACCACCACCTGGAAGCCCGTGCTGAAGGGCGAGCACCACT GTCCTTCCTCCTCCGACGTGGACATCCTGTCCAGGATGTCCACCCTGAAGCTGCAGGTGCGT ATCCCCACCGGCTCCGTGGCCTCCAAGTCCGACGGACTGCTGTGCCACGGCGCTAAGTGGGT GACCACCTGCGACTTCCGTTGGTACGGCTCCAAGTATATCACCCACTCCCTGCACTCCATCA GGCCCACCCTGTCCCAGTGTACCGAGGCTGCTAAGGCCTACAAGGAGGGCCGGCTGATGGCT CCTGGATTCCCTCCTGAGTCCTGCGGCTGGAACTCCGTGACCGACTCCGAGCTGCTGTCCAT CCTGGTGACCCCTCACCACACCGGAGTGGACGACTATAGGGGCATCTGGATCGACTCCATGT TCCCTGGCGGCGAGTGTAAGGAGATGGTGTGCGACACCGTGCAGGGCCACACCATCTGGATG TCCACCTCCAACCTGACCACCGCTTGCGGAGTGGCCTTCAAGCAGATCCAGGGCCAGTTCTA CTATCTGAACTCCGGCCACCAGCCTAACAAGGAGGGCACCTTCTTCCACTCCCCTAACCACC CCAACTCCCCTCTGTCCACCGCCTGTCGTAAGAAGTACTGCAACCAGGAGGGCATCGTGATC CACACCGGAGAGTGGATCGGCGTGCCCTGGAACACCCGTATCCGGGACGTGCAGCTGGACTC CTATACCGACCTGTGCGCCGAGTCCACCGAGATCAAGTCCACCATCGGCTCCGCCCCTATCC GTGTGATCGCCTGGGAGATGGAGCGTGTGATGGACTTCGCCCTGTGCCAGACCGTGTGGGAC AAGGTGAACAGGGGCGACCCCCTGTCCCCTCTGGACCTGTCTTACCTGTCCTCCCGTGCCCC CGGCAAGGGCCTGGCCTATACCATCATCAACGAGACCCTGCACGTGGCCCACGTGCGTTACA TCCGGACCTATATCAAGGCCCCTATCATGGAGGAGATCAAGGGCTCCAGGGGCGACCGTTCC GCCGCTGAGTCCGTGCTGTGGACCCAGTGGTTCCCCTACGGCGACGGAGAGATCGGACCTAA CGGACTGCTGAAGACCAACGGCTCCTTCAAGTTCCCTTTCTATCTGGTGGGCATGGGCGCCA TCGACGACGACCTGATCGAGCTGTCCAACGCCGACCCCATCGACCACCCTCAGAAGGCCATC Attorney Docket No.07039-2326WO1 / 2024-129 GCCTCCGTGCACCTGAACACCGACGAGGAGCTGTTCTTCGGCAACACCGGCTCCGACTCCAA CCCTGTGGAGGCTGTGGAGGGATGGTTCGCCTCCTGGAAGTCCGCCGGCATCAACATGGCCC TGATCGTGCTGTGCGTGCTGCTGGTGCTGATCTTCCTGAGGTCCCTGCCTGCCCTGATCAAG CTGATCCACCGGTACAGGGTGTCCCGGTCCCGGCAGACCGACGTGGAGCTGAACTCCATCAA CGAGACCGCTAGGACCGGCTCCGTGGGACCTGACATCATCCCTGGAGCTTGGAGGGTGCACG ACTCCGGCGTGCGGCAGTCCCAGTTCTTCAGGAACAACCCCCGGAGGCTGGGCCCTTAA Exemplary recombinant nucleic acid that can encode a PERV-G polypeptide SEQ ID NO:6: ATGTCCTCCAAGATCGTGCTGGCCGCCATCTGTCTGTGCTCCGTGCAGTACGTGGCCTGTTC CTTCCAGATCGTGTTCCCTGAGTTCAACAACGCCGCCTGGCTGCCCTACCTGAAGACCTCCC GTTATTGCCCTCAGTCCGCCGAGATGGAGTTCGAGAGGAGGGTGTCCACCACCCTGCTGTCC GCCGACGTGCCTATCGGAGTGACCCCCACCAAGTCCGACGGCTACCTGTGCCACGCTGCTAA GTGGGTGACCACCTGCGACTTCCGTTGGTACGGCCCCAAGTATGTGACCCACTCCATCCACG ACCTGACCCCTGCTCAGGTGGACTGTCACGAGGCCCTGGCCAGGTACAAGGCTGGCACCCTG TTCAACCCTGGATTCCCTCCTGCCTCCTGCGGCTATGCCACCATCACCGACTCCGAGCAGAA GGTGGTCATGATCACCCCTCACCACGTGGGCATCGACGACTACCGGGGCAAGTGGATCGACC CTATCTTCCCCGGCGGCGAGTGTACCACCAACTATTGCGAGACCCTGCACAACTCCTCCGTG TGGCTGCCCGCCGACGAGAAGATCGTGGACATCTGTGCCCAGACCTTCAGGAAGATCAAGGT GACCGCTACCTACCCTTCCGAGGGAGCCGTGACCAAGGAGACCATCTCCCTGCACTCCGCCT ACCACCCTCACGTGCCTGGCACCGGCATCTGTCGGATGACCTATTGCTCCAAGGAGGGCCTG AGGCTGCCTAACGGCGAGTGGCTGGGCATCTTCTACGACAACAGGATCAAGACCACCGACGT GCGTACCGTGTTCCCTGCTTGTCCTGACGGCCTGGAGGTGAAGTCCACCCTGAACTCCGACG GCGCCAACACCATCGCCTGGGAGACCCAGAGGATGCTGGACTATGCCCTGTGCCAGTCCACC TGGGACAAGGTGCAGAACAAGGAGCCCCTGTCCGCCGTGGACCTGTCCTACCTGTCCGCCCG TTCCCCTGGCAAGGGCCTGGCCTATACCGTGATCAACGGCACCCTGCACTTCGCCCACGTGC GGTACGTGAGGACCTGGATCGACGGCCCCGTGCTGAAGGACCTGAAGGGCTCCAGGTTCGAC CCTACCGCTGCTCAGAAGACCCTGTGGGACCAGTGGTTCCCTTTCGGCTCCAACGAGATCGG CCCCAACGGCCTGCTGAAGACCCCTAAGGACTTCAAGTTCCCCCTGTATATCATCGGCACCG GACTGGTGGACGAGGACCTGCAGGAGCTGTCCGAGGCTGGACCTATCGACCACCCTCAGATC Attorney Docket No.07039-2326WO1 / 2024-129 CCTGACGCCTCCGGCATCCTGCCTAACTCCGAGCAGGTGTACTATGGCGACACCGGCGTGTC CAAGAACCCTATCGAGCTGATCGAGGGCTGGTTCGCCAACTGGAAGGAGACCGTGATGTCCA TCGTGGGCCTGGTGCTGCTGATCACCATCGTGTTCACCGTGCTGAAGTGTATCGGCACCTGC CGTTCCCTGCGTAGGAAGCGGAAGATCGAGAAGGACATCGAGCTGCAGGAGATCGGCCCTTA CCAGCCCACCACCTATAGGCCTCGTTAA Exemplary recombinant nucleic acid that can encode a CARV-G polypeptide SEQ ID NO:7: ATGAAGATGAAGATGGTCATCGCCGGCCTGATCCTGTGCATCGGCATCCTGCCCGCCATCGG CAAGATCACCATCTCCTTCCCTCAGTCCCTGAAGGGCGACTGGCGTCCTGTGCCCAAGGGCT ACAACTATTGCCCCACCTCCGCCGACAAGAACCTGCACGGCGACCTGATCGACATCGGACTG CGTCTGCGGGCCCCTAAGTCCTTCAAGGGCATCTCCGCCGACGGATGGATGTGCCACGCTGC TCGTTGGATCACCACCTGCGACTTCCGGTGGTACGGCCCCAAGTATATCACCCACTCCATCC ACTCCTTCAGGCCTTCCAACGACCAGTGTAAGGAGGCCATCCGTCTGACCAACGAGGGCAAC TGGATCAACCCTGGATTCCCTCCTCAGTCCTGCGGATACGCCTCCGTGACCGACTCCGAGTC CGTGGTGGTGACCGTGACCAAGCACCAGGTGCTGGTGGACGAGTATTCCGGCTCCTGGATCG ACTCCCAGTTCCCTGGAGGCTCCTGTACCTCCCCTATCTGCGACACCGTGCACAACTCCACC CTGTGGCACGCTGACCACACCCTGGACTCCATCTGTGACCAGGAGTTCGTGGCTATGGACGC CGTGCTGTTCACCGAGTCCGGCAAGTTCGAGGAGTTCGGCAAGCCCAACTCCGGCATCCGGT CCAACTACTTCCCTTATGAGTCCCTGAAGGACGTGTGCCAGATGGACTTCTGCAAGAGGAAG GGCTTCAAGCTGCCCTCCGGCGTGTGGTTCGAGATCGAGGACGCCGAGAAGTCCCACAAGGC CCAGGTGGAGCTGAAGATCAAGAGGTGTCCCCACGGCGCCGTGATCTCCGCCCCTAACCAGA ACGCCGCCGACATCAACCTGATCATGGACGTGGAGCGTATCCTGGACTACTCCCTGTGCCAG GCCACCTGGTCCAAGATCCAGAACAAGGAGGCCCTGACCCCCATCGACATCTCCTATCTGGG ACCTAAGAACCCTGGACCTGGACCTGCCTTCACCATCATCAACGGCACCCTGCACTACTTCA ACACCAGGTATATCCGTGTGGACATCGCCGGCCCTGTGACCAAGGAGATCACCGGATTCGTG TCCGGCACCTCCACCTCCCGGGTGCTGTGGGACCAGTGGTTCCCCTACGGCGAGAACTCCAT CGGCCCTAACGGCCTGCTGAAGACCGCCTCCGGCTACAAGTATCCCCTGTTCATGGTGGGCA CCGGCGTGCTGGACGCTGACATCCACAAGCTGGGAGAGGCTACCGTGATCGAGCACCCTCAC GCCAAGGAGGCCCAGAAGGTGGTGGACGACTCCGAAGTGATCTTCTTCGGCGACACCGGCGT GTCCAAGAACCCCGTGGAGGTGGTGGAGGGATGGTTCTCCGGATGGCGTTCCTCCCTGATGT Attorney Docket No.07039-2326WO1 / 2024-129 CCATCTTCGGCATCATCCTGCTGATCGTGTGCCTGGTGCTGATCGTGCGTATCCTGATCGCC CTGAAGTACTGTTGCGTGCGGCACAAGAAGAGGACCATCTATAAGGAGGACCTGGAGATGGG CCGTATCCCTCGGAGGGCCTAA OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.07039-2326WO1 / 2024-129 WHAT IS CLAIMED IS:

1. A method for treating cancer, wherein said method comprises administering achimeric vesiculovirus to a mammal having cancer, where said mammal is a mammal that was previously administered an oncolytic vesiculovirus virus different from said chimeric vesiculovirus, wherein said chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises a nucleic acid sequence encoding a glycoprotein (G) polypeptide of a second vesiculovirus species different from said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species.

2. The method of claim 1, wherein said mammal is a human.

3. The method of any one of claims 1-2, wherein said cancer is selected from the groupconsisting of hepatocellular carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, urothelial carcinoma, gastric adenocarcinoma, small cell lung cancer, non-small cell lung cancer, breast ductal adenocarcinoma, head and neck cancer, colorectal adenocarcinoma, melanoma, basal cell carcinoma, renal cell carcinoma, osteosarcoma, myeloma, lymphoma, and leukemia.

4. The method of any one of claims 1-2, wherein said administering comprisesintratumoral injection.

5. The method of any one of claims 1-4, wherein one or more codons of said nucleicacid sequence encoding said G polypeptide are optimized for translation in a human.

6. The method of any one of claims 1-5, wherein said first vesiculovirus species is avesicular stomatitis virus (VSV).

7. The method of any one of claims 1-6, wherein said second vesiculovirus species isselected from the group consisting of a Morreton virus (MORV), a Jurona virus (JURV), aAttorney Docket No.07039-2326WO1 / 2024-129 Malpais Springs virus (MSPV), an Isfahan virus (ISFV), a Radi virus (RADV), a Perinet virus (PERV), and a Carajas virus (CARV).

8. The method of any one of claims 1-7, wherein said method further comprisesadministering, to said mammal, a second chimeric vesiculovirus, wherein a genome of said second chimeric vesiculovirus comprises a genome of a second vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, and wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

9. The method of any one of claims 1-7, wherein said method further comprisesadministering, to said mammal, a third chimeric vesiculovirus, wherein a genome of said third chimeric vesiculovirus comprises a genome of a third vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said third vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said third vesiculovirus species, wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

10. The method of any one of claims 1-7, wherein said method further comprises administering, to said mammal, a fourth chimeric vesiculovirus, wherein a genome of said fourth chimeric vesiculovirus comprises a genome of a fourth vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said fourth vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said fourth vesiculovirus species, wherein said G polypeptideAttorney Docket No.07039-2326WO1 / 2024-129 heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

11. A method for treating cancer, wherein said method comprises: (a) administering a first chimeric vesiculovirus to a mammal having cancer, wherein a genome of said first chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said first vesiculovirus species, and (b) at least about 3 days after said step (a), administering a second chimeric vesiculovirus to said mammal, wherein a genome of said second chimeric vesiculovirus comprises a genome of a second vesiculovirus species that (a) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

12. The method of claim 11, wherein said mammal is a human.

13. The method of any one of claims 11-12, wherein said cancer is selected from the group consisting of hepatocellular carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, urothelial carcinoma, gastric adenocarcinoma, small cell lung cancer, non- small cell lung cancer, breast ductal adenocarcinoma, head and neck cancer, colorectalAttorney Docket No.07039-2326WO1 / 2024-129 adenocarcinoma, melanoma, basal cell carcinoma, renal cell carcinoma, osteosarcoma, myeloma, lymphoma, and leukemia.

14. The method of any one of claims 11-13, wherein one or more codons of said nucleic acid sequence encoding said G polypeptide are optimized for translation in a human.

15. The method of any one of claims 11-14, wherein said first vesiculovirus species is the same species as said second vesiculovirus species.

16. The method of claim 15, wherein said first vesiculovirus species is VSV and said second vesiculovirus species is VSV.

17. A chimeric vesiculovirus, wherein said chimeric vesiculovirus comprises a genome of a first vesiculovirus species that (a) comprises a nucleic acid sequence encoding a glycoprotein (G) polypeptide of a second vesiculovirus species different from said first vesiculovirus species and (b) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of the first vesiculovirus species, wherein one or more codons of said nucleic acid sequence encoding said G polypeptide are optimized for translation in a human.

18. The chimeric vesiculovirus of claim 17, wherein said first vesiculovirus species is a VSV.

19. The chimeric vesiculovirus of any one of claims 17-18, wherein said second vesiculovirus species is selected from the group consisting of a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, and a CARV.

20. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:1.Attorney Docket No.07039-2326WO1 / 2024-129 21. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

2.

22. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

3.

23. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

4.

24. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

5.

25. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

6.

26. The chimeric vesiculovirus of any one of claims 17-19, wherein said nucleic acid sequence encoding said G polypeptide comprises a nucleotide sequence set forth in SEQ ID NO:

7.

27. A vector comprising nucleic acid encoding a chimeric vesiculovirus of any one of claims 17-26.

28. A composition comprising a chimeric vesiculovirus of any one of claims 17-26 or a vector of claim 27.Attorney Docket No.07039-2326WO1 / 2024-129 29. The use of a composition comprising a chimeric vesiculovirus of any one of claims 17-26 or a vector of claim 27 to treat cancer.

30. A chimeric vesiculovirus of any one of claims 17-26 or a vector of claim 27 for use in the preparation of a medicament to treat cancer.

31. A chimeric vesiculovirus of any one of claims 17-26 or a vector of claim 27 for use in the treatment of cancer.

32. A panel of chimeric vesiculoviruses, wherein said panel comprises: (a) a first chimeric vesiculovirus comprising a genome of a first vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said first vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said first vesiculovirus species, and (b) a second chimeric vesiculovirus comprising a genome of a second vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said second vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said second vesiculovirus species, wherein said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

33. The panel of claim 32, wherein said panel further comprises: (c) a third chimeric vesiculovirus comprising a genome of a third vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said third vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said third vesiculovirus species, wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus is different from saidAttorney Docket No.07039-2326WO1 / 2024-129 G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

34. The panel of claim 33, wherein said panel comprises: (d) a fourth chimeric vesiculovirus comprising a genome of a fourth vesiculovirus species that (i) comprises nucleic acid encoding a G polypeptide heterologous to said fourth vesiculovirus species and (ii) lacks at least a portion of an endogenous vesiculovirus nucleic acid sequence that encodes a G polypeptide of said fourth vesiculovirus species, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said third vesiculovirus species of said third chimeric vesiculovirus, wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said second vesiculovirus species of said second chimeric vesiculovirus, and wherein said G polypeptide heterologous to said fourth vesiculovirus species of said fourth chimeric vesiculovirus is different from said G polypeptide heterologous to said first vesiculovirus species of said first chimeric vesiculovirus.

35. The panel of any one of claims 32-34, wherein each of said first, second, third, or fourth vesiculovirus species is a VSV.

36. The panel of any one of claims 32-35, wherein said G polypeptide heterologous to said first, second, third, or fourth vesiculovirus species is a G polypeptide of a virus selected from the group consisting of a MORV, a JURV, a MSPV, an ISFV, a RADV, a PERV, and a CARV.

37. A kit comprising a chimeric vesiculovirus of any one of claims 17-26, a vector of claim 27, or a panel of any one of claim 32-25.

Images