Sequencing library construction method, nucleic acid sequencing method, nanopore sequencing method and use

Abstract

Provided are a sequencing library construction method, a nucleic acid sequencing method, a nanopore sequencing method and a use. The sequencing library construction method comprises: using a first primer to carry out rolling circle amplification on a target nucleic acid cyclic library; using a second primer to carry out first nucleic acid amplification on a free fragment generated by rolling circle amplification; linearizing the target nucleic acid cyclic library to terminate rolling circle amplification, generating an extensible 3' end as an amplification primer after linearizing the target nucleic acid cyclic library, and at the same time, using the second primer to carry out second nucleic acid amplification on the free fragment generated by rolling circle amplification, to obtain a double-stranded amplification product; and linking a sequencing adapter to the double-stranded amplification product to prepare a sequencing library. The present invention can solve the problem in the prior art of low accuracy in nanopore sequencing, and is suitable for the field of high-throughput sequencing.

Description

Sequencing library construction methods, nucleic acid sequencing methods, nanopore sequencing methods and their applications Technical Field

[0001] This invention relates to the field of high-throughput sequencing, and more specifically, to a method for constructing sequencing libraries, a nucleic acid sequencing method, a nanopore sequencing method, and their applications. Background Technology

[0002] Single-molecule sequencing is a high-throughput sequencing technology that can directly sequence a single nucleic acid molecule, providing more comprehensive and accurate sequence information. It has become an important tool in the fields of genomics and biology research, offering more possibilities for scientific research and medical applications.

[0003] Nanopore sequencing is a single-molecule level detection technology with advantages such as high sequencing speed, long read length, direct sequencing, high throughput, low cost, small size, and portability. In nanopore sequencing, a single nanopore is embedded in an insulating, impermeable membrane, forming a stable ion current channel. Under the influence of voltage, single-stranded nucleic acid molecules pass through the nanopore, thus reducing the ion current flowing through it. Because different bases on the single-stranded nucleic acid molecule have different molecular structures and sizes, the current flowing through the nanopore exhibits differences corresponding to the base sequence. By analyzing the current change signal using algorithms, the sequence of the perforated single-stranded nucleic acid can be read in real time. However, the accuracy of current nanopore sequencing technology is still limited, which severely restricts its application. Multiple amplifications of the target nucleic acid followed by nanopore sequencing can significantly improve sequencing accuracy.

[0004] Oxford Nanopore Technologies (ONT) has developed a four-nanopore sequencing technology for target nucleic acid sequences, which includes: (1) different adapters connecting the two ends of the double strand of the nucleic acid to be tested. One end is a Y-type adapter that binds to helicase and polymerase, and the other end is a hairpin adapter. The top strand of the Y-type adapter consists of a guide sequence + helicase binding site + spacer sequence + a sequence complementary to the bottom strand. The bottom strand of the adapter consists of a sequence complementary to the top strand + a sequence containing the hairpin structure. (2) The helicase binds between the guide sequence and spacer sequence of the top strand of the Y-type adapter and is blocked by the spacer sequence; the polymerase binds to the hairpin position of the Y-type adapter and amplifies using dNTPs, so that both the forward and reverse strands of the nucleic acid to be tested are amplified once. (3) The amplified product is added to a sequencing system embedded with nanopores. After the guide sequence is captured by the nanopores, the helicase passes through the limiting sequence under the action of an electric field and controls the sequencing through the nanopores. Thus, the target nucleic acid sequence can be sequenced four times (see patent applications CN103827320A and CN106103741A). A schematic diagram of the four-nanopore sequencing technology of ONT target nucleic acid sequence is shown in Figure 1.

[0005] The disadvantages of the 4-nanopore sequencing technology developed by ONT are: (1) Connecting different adapters to both ends of the double strand of the nucleic acid to be tested is a relatively complex problem, which requires complex preliminary operations (such as introducing restriction endonuclease sites by using PCR and connecting adapters to both ends, obtaining different sticky ends by enzyme digestion, and then connecting them with adapters with different sticky ends; or adding different adapters at the same time during the TA ligation process, and then obtaining the target product with different adapters at both ends through screening). This process is complicated and the product acquisition efficiency is low. (2) This method can only achieve a maximum of 4 sequencing of the target nucleic acid sequence, and the number of sequencing times of the target nucleic acid fragment is limited. (3) When performing 4 sequencing using this method, the helicase controls the sense strand, antisense strand, sense strand (amplification), and antisense strand (amplification) to pass through the nanopore sequentially to complete the sequencing. However, the sequencing speed of different strands is significantly different during this sequencing process. The antisense strand and the antisense strand (amplification) show an increase in the pore current during sequencing, that is, an increase in the average current value of the electrical signal. The reason is that the sense strand or sense strand (amplified) passes through the nanopore first, and when the antisense strand or antisense strand (amplified) passes through the nanopore immediately afterward, they hybridize again on the other side of the pore to form a double strand. This rehybridization process leads to an increase in the average current value of the electrical signal and the pore-passing speed when the antisense strand or antisense strand (amplified) passes through the pore. Furthermore, the speed at which the same helicase controls double-strand sequencing differs from that controlling single-strand sequencing. This four-sequencing method inevitably requires controlling both double-strand and single-strand sequencing. These changes in the electrical signal at different sequencing stages increase the difficulty of base identification during sequencing result analysis and reduce sequencing accuracy.

[0006] Summary of the Invention

[0007] The main objective of this invention is to provide a method for constructing sequencing libraries, a nucleic acid sequencing method, a nanopore sequencing method, and its applications, in order to solve the problem of low accuracy in nanopore sequencing in the prior art.

[0008] To achieve the above objectives, according to a first aspect of the present invention, a method for constructing a sequencing library is provided, the method comprising: performing rolling circle amplification on a circular library of target nucleic acids using a first primer; performing first nucleic acid amplification on the free fragments generated by rolling circle amplification using a second primer; terminating rolling circle amplification by opening the circular library of target nucleic acids, wherein the circular library of target nucleic acids generates an extendable 3' end which becomes an amplification primer; simultaneously performing second nucleic acid amplification on the free fragments generated by rolling circle amplification using the second primer, thereby obtaining a double-stranded amplification product; and ligating the double-stranded amplification product with a sequencing adapter to prepare a sequencing library.

[0009] Further, the construction method includes: A) constructing a circular target nucleic acid library, or using naturally occurring circular target nucleic acids as the circular target nucleic acid library; annealing the circular target nucleic acid library and the first primer to obtain an amplification complex; wherein, in the amplification complex, the nucleic acid strand of the circular target nucleic acid library bound to the first primer is the first strand, and the first primer is the initial second strand; B) performing rolling circle amplification of the circular target nucleic acid library using polymerase and the first primer to obtain an extended second strand; wherein, the extended second strand includes a complementary second strand that is complementary to the bases of the first strand and a free free second strand. A) After rolling circle amplification begins and a free second strand is generated, the second primer is paired with the free second strand for complementary amplification of the first nucleic acid using polymerase to synthesize the complementary strand of the free second strand; B) The first strand is circularized to terminate rolling circle amplification; using polymerase, the extendable 3' end generated after the circularization of the target nucleic acid circular library, and the second primer, the second nucleic acid is amplified using the single-stranded free second strand as a template to fully synthesize the complementary strand, thereby obtaining the double-stranded amplification product; C) The sequencing adapter is ligated to the double-stranded amplification product to prepare the sequencing library.

[0010] Further, the target nucleic acid circular library includes a single-stranded circular library, a double-stranded circular library, a bubbly double-stranded circular library, or a dumbbell-shaped single-stranded circular library; preferably, the method for constructing the target nucleic acid circular library includes: constructing the target nucleic acid into a target nucleic acid circular library using a library construction adapter; preferably, the library construction adapter contains a first nucleotide that is resistant to polymerase and readily forms DNA strand breaks; more preferably, the first nucleotide includes deoxyuridine nucleotide, deoxyhypoxanthine nucleotide, or ribonucleotide; preferably, the library construction adapter includes 1-10 first nucleotides.

[0011] Further, A) includes: ligating a library-building adapter to a target nucleic acid to obtain an amplification complex simultaneously with a circular library of the target nucleic acid; wherein the target nucleic acid is a single-stranded nucleic acid; the library-building adapter is a first library-building adapter, which consists of a base strand and a top strand; the middle portion of the top strand of the library-building adapter is complementary to the base strand; the two ends of the top strand of the library-building adapter are complementary to the two ends of the target nucleic acid, so that the top strand of the library-building adapter acts as a clamp to assist the base strand of the library-building adapter in ligating the target nucleic acid into a circular library, and the 3' end of the top strand of the library-building adapter becomes the first primer; or the target The nucleic acid is a double-stranded nucleic acid; the library construction adapter is the first library construction adapter, which consists of a base strand, a first top strand, and a second top strand; the first top strand can be complementary to the 3' end of the base strand, and the second top strand can be complementary to the 5' end of the base strand; the base strand can be linked to the sense or antisense strand of the target nucleic acid to form a loop; correspondingly, the 3' end of the second top strand and the 5' end of the first top strand can be linked to the two ends of the antisense or sense strand of the target nucleic acid; the 3' end of the first top strand becomes the first primer.

[0012] Furthermore, the target nucleic acid circular library contains a known sequence, and the first primer is complementary to the known sequence; or the target nucleic acid circular library does not contain a known sequence, and the first primer contains degenerate bases, and the first primer is complementary to the target nucleic acid circular library through the degenerate bases.

[0013] Further, B) includes: using polymerase with a target nucleic acid circular library as a template to extend the first primer to achieve rolling circle amplification and obtain an extended second strand; the extended second strand includes a complementary second strand that is complementary to the first strand and a free second strand. As rolling circle amplification proceeds, the second primer continuously pairs with the newly generated free second strand and amplifies the first nucleic acid to synthesize a complementary strand of the free second strand; preferably, the 5' end of the second primer contains an artificially modified nucleotide that can inhibit polymerase chain displacement activity, and the complementary strand formed by the amplification of the first nucleic acid exists in a segmented manner, with each segment not connected by a chemical bond.

[0014] Further, the number of artificially modified nucleotides is 1-10; preferably, the artificially modified nucleotides include any one or more of the following: LNA, PNA, BNA, GNA, and TNA; more preferably, the artificially modified nucleotide is LNA; even more preferably, the artificially modified nucleotide appears continuously at the 5' end of the second primer, or appears interspersed with deoxyribonucleotides, and the number of deoxyribonucleotides between the artificially modified nucleotides is 1-5.

[0015] Furthermore, the free second strand contains a known sequence, and the second primer pairs complementaryly with the known sequence; or the free second strand does not contain a known sequence, and the second primer contains a degenerate base, and the second primer pairs complementaryly with the free second strand through the degenerate base.

[0016] Further, the polymerase has strand displacement activity; preferably, the polymerase is selected from DNA polymerase or RNA polymerase; preferably, the polymerase is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I, Vent DNA polymerase, 9°N DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, and E. coli RNA polymerase.

[0017] Furthermore, the 3' end of the first primer is a nucleotide containing a thiomodified form; preferably, the number of thiomodified nucleotides is 1-10.

[0018] Further, the construction method is performed in an amplification buffer; preferably, the amplification buffer contains a pH buffer system; preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, and MOPS buffer system; preferably, the amplification buffer contains any one or more of the following: NTP, dNTP, and ddNTP; preferably, the amplification buffer contains K + and / or Na + Preferably, the amplification buffer also contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ Preferably, the amplification buffer contains additives or auxiliary reagents to enhance the polymerase extension reaction; preferably, the additives or auxiliary reagents include any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, and ethylenediaminetetraacetic acid.

[0019] Furthermore, the sequencing adapter is an NGS sequencing adapter, an SMRT sequencing adapter, or a nanopore sequencing adapter with sticky ends, the sticky ends of the sequencing adapter being able to complementarily pair with the sticky ends of the double-stranded amplification product; preferably, the first primer contains a retarding structure capable of terminating the amplification of the first or second nucleic acid, the synthesized complementary strand extending to the retarding structure and then terminating, so that the double-stranded amplification product forms sticky ends; preferably, the retarding structure includes modified nucleotides or intercalation arms; preferably, the number of modified nucleotides or intercalation arms is 1-10.

[0020] Further, the sequencing adapter is a complex of a top chain and a bottom chain that are complementary and bound to a helicase; the top chain consists of, in sequence, a guide sequence, a helicase-binding sequence, a restraint sequence, a bottom chain complementary sequence, and a sequence forming a sticky end; the bottom chain consists of, in sequence, a sequence forming a sticky end, a top chain complementary sequence, and a sequence complementary to the restraint sequence; the bottom chain complementary sequence and the top chain complementary sequence can be complementary and paired, the bottom chain and the top chain can anneal, and form a sticky end that can be complementary and paired with the sticky end of the double-stranded amplification product; preferably, the guide sequence is a sequence of 10 to 50 nucleotides or a mesoarm-like modification, the mesoarm-like modification including any one or more of the following: iSp18, iSp9, iSpC3, iSpC6, and iSpC12; More preferably, the sequence is composed of 20-40 iSpC3s, and even more preferably, the sequence is composed of 30 iSpC3s; preferably, the helicase-binding sequence is composed of 5-40 nucleotides, more preferably, the sequence is composed of 5-40 thymine nucleotides; even more preferably, the sequence is composed of 10 thymine nucleotides; preferably, the limiting sequence is composed of an arm-like modification, which includes any one or more of the following: iSp18, iSp9, iSpC3, iSpC6, and iSpC12; more preferably, the sequence is composed of 2-6 iSp18s; even more preferably, the sequence is composed of 4 iSp18s; preferably, the end of the bottom chain also includes a fixed sequence or cholesterol modification.

[0021] Furthermore, the sequencing adapter also contains a helicase bound to the helicase binding sequence; preferably, the helicase is selected from any one or more of the following: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, and DnaB helicase.

[0022] To achieve the above objectives, according to a second aspect of the present invention, a nucleic acid sequencing method is provided, comprising: obtaining a sequencing library using the above-described construction method, sequencing the sequencing library, and acquiring information about the target nucleic acid.

[0023] To achieve the above objectives, according to a third aspect of the present invention, a nanopore sequencing method is provided, comprising: obtaining a sequencing library using the above-described construction method, and passing the sequencing library through a nanopore under the action of an electric field to obtain information on the target nucleic acid.

[0024] Furthermore, the nanopores are located on the membrane material; preferably, the membrane material is bound with a restraint sequence, which is bound to the membrane material by cholesterol modification at the end, and the restraint sequence can be complementary to the bottom chain in the above-mentioned sequencing adapter.

[0025] Further, the nanopore is a transmembrane protein pore or a solid pore; preferably, the transmembrane protein in the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, and GspD; preferably, the transmembrane protein is also linked to an auxiliary fragment, which is selected from any one or more of the following: a tag, an enzyme cleavage site, a signal peptide, a guide peptide, and a detectable label.

[0026] Furthermore, the membrane material includes an amphiphilic membrane; preferably, the membrane material includes a phospholipid bilayer, a diblock copolymer, or a triblock copolymer.

[0027] Furthermore, the voltage that generates the electric field force is ≥10mV, preferably 50mV-250mV.

[0028] Further, the sequencing library is subjected to nanopore sequencing in a sequencing buffer; preferably, the sequencing buffer contains a pH buffer system; preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, MOPS buffer system; preferably, the sequencing buffer contains one or more of NTPs, dNTPs, or ddNTPs; preferably, the sequencing buffer contains K + and / or Na + Preferably, the sequencing buffer also contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ .

[0029] To achieve the above objectives, according to a fourth aspect of the present invention, the above-described construction method, or the above-described nucleic acid sequencing method, or the above-described nanopore sequencing method is provided for use in the construction of sequencing libraries.

[0030] To achieve the above objectives, according to a fifth aspect of the present invention, the above-described construction method and / or the above-described nanopore sequencing method are provided for application in nanopore sequencing of target nucleic acids.

[0031] By applying the technical solution of this invention and utilizing the above-mentioned sequencing library construction method, multiple copies of the target nucleic acid circular library can be achieved by using polymerase to perform rolling circle replication. The copy number can be greater than 4 or more, and the copy number is not limited by the method. This allows for more sequencing of the target nucleic acid in subsequent sequencing, thereby improving sequencing accuracy. Attached Figure Description

[0032] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0033] Figure 1 illustrates a schematic diagram of the four-nanopore sequencing technology for the target nucleic acid sequence of ONT in the background art, where A is the guide sequence in the top strand, B is the helicase binding site in the top strand, C is the restriction sequence in the top strand, D is the sequence in the top strand complementary to the bottom strand, E is the sequence in the bottom strand complementary to the top strand, and F is the sequence in the bottom strand containing a hairpin structure. It is a helicase. G is a polymerase, G is a sequence containing a hairpin structure, and H is the double strand of the nucleic acid to be tested.

[0034] Figure 2 shows a schematic diagram of a circular library according to an embodiment of the present invention.

[0035] Figure 3 shows a schematic diagram of the binding of the first library construction adapter to a single-stranded target nucleic acid according to an embodiment of the present invention.

[0036] Figure 4 shows a schematic diagram of the binding of the first library construction adapter to the double-stranded target nucleic acid in an embodiment of the present invention.

[0037] Figure 5 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing according to Embodiment 1 of the present invention.

[0038] Figure 6 shows a schematic diagram of the preparation of a single-stranded circular library according to Embodiment 1 of the present invention.

[0039] Figure 7 shows the electrophoresis results after end repair and A addition of the target nucleic acid in Embodiments 1, 2 and 3 of the present invention.

[0040] Figure 8 shows the electrophoresis results of the amplification products of the target nucleic acid according to Example 1 of the present invention.

[0041] Figure 9 shows a schematic diagram of the construction process of the sequencing adapter complex according to Embodiments 1, 2 and 3 of the present invention.

[0042] Figure 10 shows the electrophoresis results of the sequencing adapter complexes according to Embodiments 1, 2 and 3 of the present invention.

[0043] Figure 11 shows the current signal results of multiple nanopore sequencing of the target nucleic acid sequence according to Embodiment 1 of the present invention.

[0044] Figure 12 shows the average current value of the electrical signal and the perforation time during the sequential sequencing of the target nucleic acid sequence in multiple nanopore sequencing processes according to Embodiment 1 of the present invention.

[0045] Figure 13 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing according to Embodiment 2 of the present invention.

[0046] Figure 14 shows a schematic diagram of the preparation of a double-stranded cyclic library according to Embodiment 2 of the present invention.

[0047] Figure 15 shows the electrophoresis results of the amplification products of the target nucleic acid according to Example 2 of the present invention.

[0048] Figure 16 shows the current signal results of multiple nanopore sequencing of the target nucleic acid sequence according to Embodiment 2 of the present invention.

[0049] Figure 17 shows the average current value and perforation time of the electrical signal during the sequential sequencing of the target nucleic acid sequence in multiple nanopore sequencing according to Embodiment 2 of the present invention.

[0050] Figure 18 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing according to Embodiment 3 of the present invention.

[0051] Figure 19 shows a schematic diagram of the construction of a dumbbell-shaped single-chain loop library according to Embodiment 3 of the present invention.

[0052] Figure 20 shows the electrophoresis results of the amplification products of the target nucleic acid according to Example 3 of the present invention.

[0053] Figure 21 shows the current signal results of multiple nanopore sequencing of the target nucleic acid sequence according to Example 3 of the present invention.

[0054] Figure 22 shows the average current value of the electrical signal and the perforation time during the sequential sequencing of the target nucleic acid sequence in multiple nanopore sequencing processes according to Embodiment 3 of the present invention. Detailed Implementation

[0055] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0056] As mentioned in the background section, sequencing libraries constructed using existing technologies for nanopore sequencing suffer from problems such as low sequencing accuracy. In this application, the inventors attempt to develop a new method for constructing sequencing libraries, and thus propose a series of protection schemes.

[0057] In a first typical embodiment of this application, a method for constructing a sequencing library is provided. The method includes: performing rolling circle amplification on a circular library of target nucleic acids using a first primer; performing first nucleic acid amplification on the free fragments generated by rolling circle amplification using a second primer; terminating rolling circle amplification by opening the circular library of target nucleic acids, wherein the circular library of target nucleic acids generates an extendable 3' end after opening the circle, which becomes an amplification primer; simultaneously performing second nucleic acid amplification on the free fragments generated by rolling circle amplification using the second primer, thereby obtaining a double-stranded amplification product; and ligating the double-stranded amplification product with a sequencing adapter to prepare a sequencing library.

[0058] The aforementioned circular target nucleic acid library contains the target nucleic acid for sequencing. The double-stranded amplification product prepared using the above construction method contains multiple copies of the aforementioned target nucleic acid. Using the above construction method, sequencing libraries containing multiple copies of the target nucleic acid can be prepared.

[0059] Preferably, in both the first and second nucleic acid amplification processes, an excess of the second primer is used for nucleic acid amplification to bind and amplify the free fragments as much as possible.

[0060] In a preferred embodiment, the construction method includes: A) constructing a circular library of target nucleic acids, or using naturally occurring circular nucleic acids as the circular library of target nucleic acids; annealing the circular library of target nucleic acids and a first primer to obtain an amplification complex; wherein, in the amplification complex, the nucleic acid strand of the circular library of target nucleic acids bound to the first primer is the first strand, and the first primer is the initial second strand; B) performing rolling circle amplification of the circular library of target nucleic acids using a polymerase and a second primer to obtain an extended second strand; wherein, the extended second strand includes a complementary second strand that is complementary to the bases of the first strand and a free free... A) After the rolling circle amplification begins and a free second strand is generated, the second primer is paired with the free second strand for base complementarity, and the first nucleic acid is amplified using polymerase, so that the free second strand synthesizes a complementary strand; B) The first strand is circularized to terminate the rolling circle amplification; using polymerase, the extendable 3' end generated after the target nucleic acid circular library is circularized, and the second primer, the second nucleic acid is amplified using the single-stranded free second strand as a template, so that the second strand is fully synthesized into a complementary strand, thereby obtaining a double-stranded amplification product; C) The sequencing adapter is ligated to the double-stranded amplification product to prepare a sequencing library.

[0061] In the above-described method for constructing sequencing libraries, linear target nucleic acids are first circularized to construct a circular target nucleic acid library. The target nucleic acid can also be a naturally occurring circular nucleic acid, meaning it can be used directly as a circular library without prior circularization. The first primer is annealed to the circular target nucleic acid library to obtain an amplification complex. In the amplification complex, the first primer is the initial second strand, and the nucleic acid strand of the circular library bound to the first primer is the first strand (step A above). The circular target nucleic acid library is then amplified using rolling circle amplification with the first primer. Based on the first primer (initial second strand), the circular target nucleic acid library is used as a template for extension to obtain an extended second strand. The extended second strand includes a complementary second strand that pairs with the bases of the first strand and a free second strand. As rolling circle amplification proceeds, the length of the free second strand gradually increases, and the target nucleic acid sequence information exists in multiple copies within the extended second strand. To prevent the single-stranded free second strand from becoming too long and forming complex secondary structures that could affect subsequent sequencing, during or after rolling circle amplification, the second primer is used to continuously perform base pairing with the newly generated free second strand, and the free second strand is used as a template for the first nucleic acid amplification, so that the free second strand synthesizes a complementary strand, and the free second strand is amplified into a double strand as much as possible (step B above).

[0062] Further, the first strand is opened to terminate rolling circle amplification. After the first strand is opened, an extendable 3' end is generated, which becomes an amplification primer. Using an excess of the second primer, the free fragment generated by rolling circle amplification is further amplified with a second nucleic acid, allowing the second strand to fully synthesize a complementary strand, thereby obtaining the double-stranded amplification product (the end of the double-stranded amplification product also includes a double-stranded structure formed by the opened first strand and the complementary second strand), achieving multi-copy amplification of the target nucleic acid (step C above).

[0063] Finally, using ligases or other commonly used methods (including but not limited to click chemistry), the sequencing adapters are ligated to the aforementioned double-stranded amplification products to prepare sequencing libraries capable of high-throughput sequencing. These sequencing libraries carry the genetic information obtained from multiple rolling circle replications of the target nucleic acid circular library. In subsequent sequencing (including but not limited to nanopore sequencing), multiple sequencing of the target sequence can be performed in a single sequencing reaction, improving sequencing accuracy and efficiency.

[0064] In a preferred embodiment, the target nucleic acid circular library includes a single-stranded circular library, a double-stranded circular library, a bubbly double-stranded circular library, or a dumbbell-shaped single-stranded circular library; preferably, the method for constructing the target nucleic acid circular library includes: constructing the target nucleic acid into a target nucleic acid circular library using a library construction adapter; preferably, the library construction adapter contains a first nucleotide that is resistant to polymerase and readily forms DNA strand breaks; more preferably, the first nucleotide includes deoxyuridine nucleotide, deoxyhypoxanthine nucleotide, or ribonucleotide, or other modified nucleotides; preferably, the library construction adapter includes 1-10 first nucleotides.

[0065] The aforementioned target nucleic acid circular libraries include various types of circular libraries, including but not limited to single-stranded circular libraries, double-stranded circular libraries, or dumbbell-shaped single-stranded circular libraries formed by connecting hairpin connectors at both ends. The corresponding circular libraries can be flexibly constructed according to different types of target nucleic acids. The types of circular libraries are shown in Figure 2.

[0066] The first nucleotide mentioned above includes, but is not limited to, deoxyuridine nucleotides, deoxyinosine nucleotides, ribonucleotides, or other modified nucleotides. Taking deoxyuridine nucleotides as an example, deoxyuridine nucleotides are introduced into a circular library, and rolling circle amplification is performed using a polymerase that can tolerate the template containing deoxyuridine nucleotides. Then, a nick is created at the deoxyuridine nucleotide position using a USER enzyme (or USER II enzyme, or USER III enzyme). The first nucleotides include, but are not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and their continuous or intermittent distribution in the linker can achieve the above effect.

[0067] For example, if the first strand contains deoxyxanthine nucleotides (dI), it can be cleaved by enzymes such as endonuclease V to achieve circular opening. If the first strand contains RNA bases, it can be cleaved by enzymes such as RNase H or RNase A to achieve circular opening.

[0068] In a preferred embodiment, A) above includes linking the library construction adapter to the target nucleic acid to obtain an amplification complex while obtaining a circular library of the target nucleic acid;

[0069] The target nucleic acid is a single-stranded nucleic acid; the library construction adapter is the first library construction adapter, which consists of a base strand and a top strand; the middle part of the top strand of the library construction adapter can complementarily pair with the base strand; the two ends of the top strand of the library construction adapter complementarily pair with the two ends of the target nucleic acid, so that the top strand of the library construction adapter acts as a clamp to assist the base strand of the library construction adapter in connecting with the target nucleic acid to form a loop, thus forming a circular library of the target nucleic acid, and the 3' end of the top strand of the library construction adapter becomes the first primer;

[0070] The target nucleic acid may be a double-stranded nucleic acid; the library construction adapter is the first library construction adapter, which consists of a base strand, a first top strand, and a second top strand; the first top strand can be complementary to the 3' end of the base strand, and the second top strand can be complementary to the 5' end of the base strand; the base strand can be linked to the sense or antisense strand of the target nucleic acid to form a loop; correspondingly, the 3' end of the second top strand and the 5' end of the first top strand can be linked to the two ends of the antisense or sense strand of the target nucleic acid; the 3' end of the first top strand becomes the first primer.

[0071] The process of the library-building adapter forming a structure with the single-stranded target nucleic acid is shown in Figure 3, and the process of the library-building adapter forming a structure with the double-stranded target nucleic acid is shown in Figure 4.

[0072] In a preferred embodiment, the target nucleic acid circular library contains a known sequence, and the first primer is complementary to the bases of the known sequence; or the target nucleic acid circular library does not contain a known sequence, the first primer contains degenerate bases, and the first primer is complementary to the bases of the target nucleic acid circular library through the degenerate bases.

[0073] In the above construction method, if the target nucleic acid circular library contains a known sequence, including but not limited to the target nucleic acid and / or the adapter used to construct the circular library containing a known sequence, then the first primer pairs complementaryly with the known sequence to obtain an amplification complex, which is then subjected to subsequent mixed amplification. If the target nucleic acid circular library does not contain a known sequence, then annealing with the target nucleic acid circular library and subsequent rolling circle amplification can also be achieved using a first primer containing degenerate bases, i.e., a random primer. In other words, the above method can be used to construct sequencing libraries for unknown target nucleic acid sequences.

[0074] In a preferred embodiment, B) includes: using polymerase to extend the first primer using a target nucleic acid circular library as a template to achieve rolling circle amplification and obtain an extended second strand; the extended second strand includes a complementary second strand that is complementary to the bases of the first strand and a free second strand. As rolling circle amplification proceeds, the second primer continuously performs complementary base pairing with the newly generated free second strand and amplifies the first nucleic acid, so that the free second strand synthesizes a complementary strand, and the free second strand is amplified into a double strand as much as possible; preferably, the 5' end of the second primer contains an artificially modified nucleotide that can inhibit polymerase chain displacement activity, and the complementary strand formed by the amplification of the first nucleic acid exists in a segmented manner, with each segment not connected by a chemical bond.

[0075] Preferably, the 5' end of the second primer contains an artificially modified nucleotide that inhibits polymerase chain displacement activity. The previously formed complementary strand fragment will not be affected by subsequent nucleic acid amplification and will not unwind from the second strand. During subsequent nucleic acid amplification, as the polymerase travels with the nucleic acid amplification process to the previously formed complementary strand fragment, the presence of the artificially modified nucleotide inhibiting polymerase chain displacement activity prevents further amplification. The complementary strand obtained using this second primer exists in segmented form, and these segments are not connected by chemical bonds (phosphodiester bonds).

[0076] In a preferred embodiment, the number of artificially modified nucleotides is 1-10; preferably, the artificially modified nucleotides include any one or more of the following: LNA (locked nucleic acid), PNA (peptide nucleic acid), BNA (bridging nucleic acid), glycerol nucleic acid (GNA), and threonine nucleic acid (TNA); more preferably, the artificially modified nucleotide is LNA; even more preferably, the artificially modified nucleotide appears continuously at the 5' end of the second primer, or appears interspersed with deoxyribonucleotides, and the number of deoxyribonucleotides between the artificially modified nucleotides is 1-5.

[0077] In a preferred embodiment, the free second strand contains a known sequence, and the second primer pairs complementaryly with the bases of the known sequence; or the free second strand does not contain a known sequence, and the second primer contains degenerate bases, i.e., a random primer. The second primer pairs complementaryly with the bases of the free second strand through the degenerate bases.

[0078] In a preferred embodiment, the double-stranded amplification product can be made to form sticky ends. Correspondingly, the sequencing adapter is an NGS sequencing adapter, an SMRT sequencing adapter, or a nanopore sequencing adapter with sticky ends. The sticky ends of the sequencing adapter can be complementary to the sticky ends of the double-stranded amplification product. Preferably, the first primer contains a retardation structure that can terminate the amplification of the first or second nucleic acid. The synthesized complementary strand extends to the retardation structure and then terminates, so that the double-stranded amplification product forms sticky ends. Preferably, the retardation structure includes modified nucleotides or inter-arm modifications. Preferably, the number of modified nucleotides or inter-arm modifications is 1-10.

[0079] The first primer contains a retardation structure that terminates the amplification of either the first or second nucleic acid; specifically, the 5' end of the extended second strand obtained by rolling circle amplification contains this retardation structure. During the amplification of either the first or second nucleic acid, the polymerase stops replicating upon reaching this retardation structure, resulting in sticky ends in the double-stranded amplification product. These sticky ends facilitate the subsequent ligation of sequencing adapters to the double-stranded amplification product. Alternatively, other methods (including but not limited to enzyme digestion) can be used to incorporate sticky ends into the double-stranded amplification primers. These sticky ends on the double-stranded amplification primers complement the sticky ends on the sequencing adapters, allowing sequencing adapters adapted to different sequencing technologies (including but not limited to NGS sequencing, SMRT sequencing, or nanopore sequencing) to be ligated onto the double-stranded amplification product, thus obtaining a sequencing library capable of sequencing.

[0080] In a preferred embodiment, the sequencing adapter is a complex of a top and bottom strand that are complementary and bound to a helicase; the top strand consists of, in sequence, a guide sequence, a helicase-binding sequence, a restraint sequence, a bottom strand complementary sequence, and a sequence forming a sticky end; the bottom strand consists of, in sequence, a sequence forming a sticky end, a top strand complementary sequence, and a sequence complementary to the restraint sequence; the bottom strand complementary sequence and the top strand complementary sequence are complementary and can pair; the bottom and top strands are annealed to form sticky ends that can pair complementaryly with the sticky ends of the double-stranded amplification product; preferably, the guide sequence is 10–50. A sequence consisting of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, where the spacer modifier includes any one or more of the following: iSp18, iSp9, iSp18, iSp19 ... SpC3, iSpC6, and iSpC12; more preferably, a sequence consisting of 20-40 iSpC3s, and even more preferably, a sequence consisting of 30 iSpC3s; preferably, the helicase-binding sequence is a sequence consisting of 5-40 nucleotides, including but not limited to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, The sequence consists of 37, 38, 39, or 40 thymine nucleotides (T); more preferably, it consists of 5-40 thymine nucleotides (T); even more preferably, it consists of 10 T; preferably, the limiting sequence is a sequence composed of intercostal arm modifications, including any one or more of the following: iSp18, iSp9, iSpC3, iSpC6, and iSpC12; more preferably, it consists of 2-6 iSp18; even more preferably, it consists of 4 iSp18; preferably, the end of the bottom chain also includes a fixed sequence or cholesterol modification.

[0081] The sequencing adapter used in this application is a double-stranded complex formed by complementary pairing of the top and bottom strands. The guide sequence in the top strand is used for capture by the nanopore for sequencing; the helicase-binding sequence is the binding site between the helicase used for nanopore sequencing and the sequencing adapter. These restriction sequences limit the position of the helicase, preventing it from shifting when bound to the binding sequence and ensuring it remains bound to the sequencing adapter. Helicase bound to other positions will shift and detach from the sequencing adapter. Using these restriction sequences, a sequencing adapter complex with a 1:1 ratio of helicase to sequencing adapter can be prepared. The complementary bottom strand sequence is used for base pairing with the complementary top strand sequence in the bottom strand to form a partially complementary sequencing adapter complex.

[0082] The sequencing adapter contains a sequence complementary to the sticky ends, used to ligate the sequencing adapter to the double-stranded amplification product to obtain a sequencing library. Preferably, the bottom strand also includes a fixation sequence or cholesterol modification at its end, which can bind to the restraint sequence on the membrane material used to fix the nanopore in nanopore sequencing or to the membrane material itself, fixing the double-stranded amplification product around the nanopore, facilitating the subsequent extension of the second strand into the nanopore to complete the sequencing.

[0083] The sequencing adapter described above is used to ligate the double-stranded amplification product. This not only improves ligation efficiency but also ensures that the top strand of the sequencing adapter complex, which contains motor proteins, is connected to the extended second strand obtained by rolling circle amplification of the target nucleotide sequence using the first primer, forming a sequencing strand that passes through the nanopore, thus enabling sequencing of the target nucleotide sequence. In a preferred embodiment, the polymerase described above has strand displacement activity. Optionally, the first polymer is a polymerase with strand displacement activity obtained by modifying a polymerase without strand displacement activity. Preferably, the polymerase is selected from DNA polymerase or RNA polymerase. Preferably, the polymerase is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I, Vent DNA polymerase, 9°N DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, and E. coli RNA polymerase.

[0084] The polymerase used in this application possesses strand substitution activity, which allows for the generation of new nucleic acid strands by replacing existing nucleic acid strands during replication. This polymerase with strand substitution activity enables the aforementioned rolling circle amplification. Preferably, the polymerase is a polymerase with strand substitution activity obtained by modifying a polymerase without strand substitution activity.

[0085] In a preferred embodiment, the 3' end of the first primer is a thiolated nucleotide; preferably, the number of thiolated nucleotides is 1-10. The thiolation at the 3' end of the first primer resists the 3'-5' exonuclease activity of polymerase.

[0086] In a preferred embodiment, the reaction time for rolling circle amplification is 1-120 minutes or longer; preferably, the reaction temperature for rolling circle amplification is >0°C; preferably, the reaction time for the first nucleic acid amplification is 1-120 minutes or longer; preferably, the reaction temperature for the first nucleic acid amplification is >0°C.

[0087] In a preferred embodiment, the reaction time for amplifying the second nucleic acid after the first chain is opened is 10-360 minutes or longer; preferably, the reaction temperature for amplifying the second nucleic acid is >0°C.

[0088] Preferably, in the first nucleic acid amplification and / or the second nucleic acid amplification, the second primer is in excess.

[0089] In a preferred embodiment, the construction method is performed in an amplification buffer; preferably, the amplification buffer contains a pH buffer system; preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, and MOPS buffer system; preferably, the amplification buffer contains any one or more of the following: NTP, dNTP, and ddNTP; preferably, the amplification buffer contains K + and / or Na + Preferably, the amplification buffer also contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ Preferably, the amplification buffer contains additives or auxiliary reagents to enhance the polymerase extension reaction; preferably, the additives or auxiliary reagents include any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, and ethylenediaminetetraacetic acid.

[0090] In a preferred embodiment, the sequencing adapter further contains a helicase bound to the helicase binding sequence; preferably, the helicase is selected from any one or more of the following: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, and DnaB helicase.

[0091] In a second typical embodiment of this application, a nucleic acid sequencing method is provided, which includes: obtaining a sequencing library using the above-mentioned sequencing library construction method, sequencing the sequencing library, and obtaining target nucleic acid information.

[0092] In a third typical embodiment of this application, a nanopore sequencing method is provided, which includes: obtaining a sequencing library using the above-described sequencing library construction method, and passing the sequencing library through a nanopore under the action of an electric field to obtain target nucleic acid information.

[0093] The sequencing library prepared using the above construction method contains a second strand of the target nucleic acid sequence with multiple copies, and the second strand also contains complementary fragments of the target nucleic acid sequence. Using the nanopore sequencing method described above, the sequencing library passes through the nanopore under the influence of an electric field, completing the sequencing of the genetic information fragment containing the target nucleic acid sequence.

[0094] The sequencing adapter complex used in this application is a double-stranded compound formed by complementary pairing of the top and bottom strands, with helicase bound to the sequencing adapter. The guide sequence in the top strand is used for capture by the nanopore for sequencing; the helicase-binding sequence is the binding site between the helicase for nanopore sequencing and the sequencing adapter. These restriction sequences limit the position of the helicase, preventing it from shifting and ensuring it remains bound to the sequencing adapter. Helicase bound to other positions shifts and detaches from the sequencing adapter. Using these restriction sequences, a sequencing adapter complex with a 1:1 ratio of helicase to sequencing adapter can be prepared. The complementary bottom strand sequence is used for base pairing with the complementary top strand sequence in the bottom strand, forming a partially complementary sequencing adapter complex. The sequencing adapter is ligated to the double-stranded amplification product via sticky ends to obtain a sequencing library.

[0095] In a preferred embodiment, the nanopores are located on the membrane material; preferably, the membrane material is bound with a restraint sequence, which is bound to the membrane material by end cholesterol modification, and the restraint sequence is complementary to the bottom strand in the sequencing adapter.

[0096] Preferably, the bottom chain can be complementary to the restraint sequence, which binds to the membrane material through cholesterol modification at the end, thereby binding the sequencing library around the nanopore and increasing the permeation efficiency of the sequencing library.

[0097] In a preferred embodiment, the sequencing adapter further contains a helicase bound to the helicase binding sequence; preferably, the helicase is selected from any one of the following or its mutant modifications: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, and DnaB helicase.

[0098] The sequencing adapter complex described above is used to ligate the double-stranded amplification product. This not only improves ligation efficiency but also ensures that the top strand of the sequencing adapter complex, which contains helicase, is connected to the extended second strand obtained by rolling circle amplification of the target nucleic acid using the first primer. This results in a sequencing strand that passes through the nanopore, enabling sequencing of the target nucleic acid sequence.

[0099] In the nanopore sequencing method described above, sequencing libraries that have undergone multiple amplifications of the target nucleic acid are sequenced, and the sequencing process is consistently controlled by helicase in the double-stranded sequencing library. If the target nucleic acid circular library in the above construction method is a single-stranded or double-stranded circular library, the multiple copies of the amplified sequencing strand are consecutive copies of the sense or antisense strand of the target nucleic acid sequence. There is no rehybridization process when the sequencing strand passes through the pore, and it does not affect the average current value of the electrical signal of different copies or the pore-passing speed.

[0100] In a preferred embodiment, the nanopore is a transmembrane protein pore or a solid pore; preferably, the transmembrane protein in the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, and GspD; preferably, the transmembrane protein is also linked to an auxiliary fragment, which is selected from any one or more of the following: a tag, an enzyme cleavage site, a signal peptide, a guide peptide, and a detectable label.

[0101] In a preferred embodiment, the membrane material comprises an amphiphilic membrane; preferably, the membrane material comprises a phospholipid bilayer, di-block copolymers, or tri-block copolymers.

[0102] In a preferred embodiment, the voltage that generates the electric field force is ≥10mV, preferably 50mV-250mV, including but not limited to 50, 75, 100, 125, 150, 175, 200, 225 or 250mV.

[0103] In a preferred embodiment, the sequencing library is subjected to nanopore sequencing in a sequencing buffer; preferably, the sequencing buffer contains a pH buffer system; preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, and MOPS buffer system; preferably, the sequencing buffer contains any one or more of the following: NTP, dNTP, and ddNTP; preferably, the sequencing buffer contains K + and / or Na + Preferably, the sequencing buffer also contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ .

[0104] In a third typical embodiment of this application, a method for constructing the above-described sequencing library, or the above-described nucleic acid sequencing method, or the above-described nanopore sequencing method is provided. This method is applied in the construction of sequencing libraries.

[0105] In a fourth typical embodiment of this application, the above-described construction method and / or the above-described nanopore sequencing method are provided for application in nanopore sequencing of target nucleic acids.

[0106] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0107] Example 1:

[0108] Figure 5 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing in Example 1.

[0109] I. Constructing a circular library

[0110] 1. A variety of known methods can be used to construct circular libraries. In this embodiment, adapters are connected to both ends of the double strand of the target nucleic acid to denature the double-stranded nucleic acid into single-stranded nucleic acid. The single-stranded nucleic acid is then ligated into a single-stranded loop using a splint ligation. Finally, nuclease digestion is used to remove the non-circular nucleic acid fragments, thereby preparing a single-stranded circular library (Figure 6).

[0111] 2. Following the manufacturer's instructions, NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) were used to perform end repair and dA-tailing on the double-stranded target nucleic acid (SEQ ID NO: 1) with the characteristic sequence. The reaction conditions were incubation at 20°C for 10 minutes and 65°C for 10 minutes. The end-repaired and dA-tailing products were purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions. Electrophoresis was performed after the operation, and the results are shown in Figure 7.

[0112] SEQ ID NO: 1 (5'-3'):

[0113] The underlined part in SEQ ID NO: 1 indicates the characteristic sequence.

[0114] 3. Dissolve the top chain (SEQ ID NO: 2) and bottom chain (SEQ ID NO: 3) of the adapter sequence in TE buffer (pH=8) according to the manufacturer's instructions, and anneal them to form the adapter. The annealing process is as follows: incubate at 95°C for 5 minutes, cool down to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0115] SEQ ID NO: 2: 5'Phosphorylation (5' phosphorylation)-GGAGGAGGAACdUTT 3';

[0116] Wherein, dU stands for deoxyuridine.

[0117] SEQ ID NO: 3: 5'Phosphorylation-AAGTTCCTCCTCCTTTTTTTTTTTTTTTTTTTTGAGAG 3'.

[0118] 4. Following the manufacturer's instructions, use the NEBNext Quick Ligation Module (NEB, E6056) to perform the ligation reaction on the end-repaired and A-added target nucleic acid and the annealed ligator. The reaction conditions are: incubation at 25°C for 60 minutes.

[0119] 5. Purify the ligation product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions. Denature the purified ligation product at 95°C for 3 minutes and then immediately place it on ice for 2 minutes.

[0120] 6. Following the manufacturer's instructions, use the NEBNext Quick Ligation Module (NEB, E6056) for splice ligation. Denatured single-stranded nucleic acids are ligated end-to-end into single-stranded circular sequences with the assistance of the splice sequence (SEQ ID NO: 4). The splice sequence (SEQ ID NO: 4) is dissolved in TE buffer (pH=8). The reaction conditions are: incubation at 37°C for 60 minutes.

[0121] SEQ ID NO: 4: 5'AAAGTCCTCCTCCCTCTCAAAAAAAAA 3'.

[0122] 7. Digest the non-circular nucleic acids using Exonuclease I (NEB, M0293) and Exonuclease III (NEB, M0206) according to the manufacturer's instructions. The reaction conditions are: incubation at 37°C for 30 minutes.

[0123] 8. Purify the digestion product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain a single-stranded circular library.

[0124] II. Target Nucleic Acid Sequence Amplification

[0125] 1. Mix the obtained single-stranded circular library, the forward primer (first primer), and the reaction buffer (NEB, M0269S) for phi29 DNA polymerase, and then anneal. Dissolve the forward primer (first primer) in TE buffer (pH=8). The annealing process is as follows: incubate at 95°C for 5 minutes, then cool to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0126] The sequence of the first primer in this embodiment is: 5'Phosphorylation-TGCT-iSpC3-SEQ ID NO: 5 3'.

[0127] Wherein SEQ ID NO: 5: AAAAAAGGAGGAG*G*A, "*" indicates thiomodification.

[0128] The structure of iSpC3 is as follows

[0129] The structure of thiomodified is The sulfur atom replaces an oxygen atom in the phosphate ester bond between the bases in the oligonucleotide.

[0130] 2. Add phi29 DNA polymerase (NEB, M0269) to the incubation product from the previous step and incubate at 30°C for 30 minutes.

[0131] 3. Add dNTPs and excess reverse primer (second primer, SEQ ID NO: 6) to the incubation product from the previous step to amplify the second strand and its complementary strand. Dissolve the reverse primer (second primer, SEQ ID NO: 6) in TE buffer (pH=8). Amplification conditions: incubation at 8°C for 20 minutes.

[0132] In this embodiment, the sequence of the second primer is SEQ ID NO: 6: 5'(LNA_T)(LNA_C)(LNA_C)(LNA_T)CCTCCTTTTTT 3'.

[0133] The structure of LNA (locked nucleoside A) is as follows: Base represents a base, and LNA_T and LNA_C refer to thymine and cytosine, respectively, which are modified with locked nucleic acids.

[0134] 4. Purify the amplification products using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0135] 5. The purified product was treated with USER III Enzyme (NEB, M5509S) to create a single nucleotide nick at the uracil position in the cyclic library. The reaction conditions were 37°C for 30 minutes.

[0136] 6. Add dNTPs, excess reverse primer (second primer), phi29 DNA polymerase (NEB, M0269), and phi29 DNA polymerase reaction buffer (NEB, M0269) to the incubation product from the previous step, and amplify at 30°C for 30 minutes.

[0137] 7. Purify the amplification product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain the amplified product of the target nucleic acid sequence. Electrophoresis was performed after the procedure, and the results are shown in Figure 8.

[0138] III. Construction of sequencing adapter complexes

[0139] 1. The construction process of the sequencing adapter complex is shown in Figure 9.

[0140] 2. Dissolve Sequence A and Sequence B (SEQ ID NO: 9) separately in TE buffer (pH=8) according to the manufacturer's instructions. Anneal Sequence A and Sequence B at a 1:1 ratio to form sequencing adapters. The annealing process is as follows: incubate at 95°C for 5 minutes, cool down to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0141] Sequence A: 5' (iSpC3)30 -SEQ ID NO:7-(iSp18)4-SEQ ID NO:8 3';

[0142] SEQ ID NO: 7: TTTTTTTTTT;

[0143] SEQ ID NO: 8: GGTTGTTTCTGTTGGTGCTGATATTGCT.

[0144] SEQ ID NO: 9: 5'Phosphorylation-AGCAAGCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA 3'.

[0145] 3. Prokaryotic expression of helicase He(T4Dda-(ΔM1)G1 / E94C / C109A / C136A / K194L / A360C, SEQ ID NO: 10) was completed in Escherichia coli, and the target protein was obtained after multiple purification steps.

[0146] 4. Mix the helicase and sequencing adapter at a molecular ratio of 9:1. The final concentration of the reaction buffer is 25mM HEPES, 50mM KCl, 0.5mM EDTA, 2.5mM MgCl2, pH=8.0. Incubate at room temperature for 30 minutes.

[0147] 5. Add 0.25 volumes of 5mM ATP to the incubation product and incubate at room temperature for 30 minutes.

[0148] 6. Following the manufacturer's instructions, the sequencing adapter complex was purified using AMPure XP beads (Beckman Coulter, A63882) to obtain the sequencing adapter complex. The purified sequencing adapter complex was then subjected to electrophoresis, and the results are shown in Figure 10, indicating that a large amount of 1:1 sequencing adapter complex was obtained.

[0149] IV. Constructing Sequencing Libraries

[0150] 1. Following the manufacturer's instructions, ligate the amplified product of the target nucleic acid sequence to the sequencing adapter complex using the NEBNext Quick Ligation Module (NEB, E6056) and incubate at 25°C for 60 minutes.

[0151] 2. Purify the sequencing library using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0152] V. Nanopore sequencing

[0153] 1. A single-channel nanopore detection system was built based on patch clamp and signal amplifier to complete the embedding of a single pore protein.

[0154] 2. The sequencing library and the restraint sequence were mixed and added to a single-channel system. The changes in the current signal were observed and obtained at 180mV. The sequencing buffer was: 470mM KCl, 25mM HEPES, 10mM MgCl2, 30mM ATP, pH=8.10; the sequencing temperature was 30℃.

[0155] Restraint sequence: 5'Cholesterol(5'cholesterol modified)-(iSp18)4–SEQ ID NO: 11 3'.

[0156] SEQ ID NO: 11: TTGACCGCTCGCCTC.

[0157] 3. Sequencing to obtain the current signal of multiple nanopore sequencing of the target nucleic acid sequence. A representative current signal is shown in Figure 11. Based on the adapter sequence signal and characteristic sequence signal of the single-stranded loop, it can be determined that the target sequence was sequenced 9 times in succession. The current signals of the first, second, third, fourth, fifth, sixth, seventh, eighth and ninth (incomplete) sequencing are 1D, 2D, 3D, 4D, 5D, 6D, 7D, 8D and 9D (incomplete), respectively.

[0158] 4. The average current value of the electrical signal and the piercing time during the sequential sequencing of a single target nucleic acid sequence in multiple nanopore sequencing processes were statistically analyzed. As shown in Figure 12, the average current value of the electrical signal and the piercing time during sequential sequencing were almost unchanged.

[0159] Example 2:

[0160] Figure 13 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing in Example 2.

[0161] I. Constructing a double-chain ring library

[0162] 1. A variety of known methods can be used to construct a circular library. In this embodiment, a double-stranded circular library is prepared by connecting adapters to both ends of the double strand of the target nucleic acid and then using nuclease digestion to remove non-circular nucleic acid fragments, as shown in Figure 14.

[0163] 2. Following the manufacturer's instructions, NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) were used to perform end repair and dA-tailing on the double-stranded target nucleic acid (SEQ ID NO: 1) with the characteristic sequence. The reaction conditions were incubation at 20°C for 10 minutes and 65°C for 10 minutes. The end-repaired and dA-tailing products were purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions. Electrophoresis was performed after the operation, and the results are shown in Figure 7.

[0164] 3. Dissolve the top chain (SEQ ID NO: 12) and bottom chain (SEQ ID NO: 13) of the adapter sequence in TE buffer (pH=8) according to the manufacturer's instructions, and anneal them to form the adapter. The annealing process is as follows: incubate at 95°C for 5 minutes, cool down to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0165] SEQ ID NO: 12: 5'Phosphorylation-AAGTTCCTCCCTTTTTTTTTTTTTTTTTTTGAGAGGGAGGAGGAACdUTT 3' (dU=deoxyUridine).

[0166] SEQ ID NO: 13: 5'Phosphorylation-AAGTTCTCCTCCCTCTCAAAAAAAAAAAAAA AAAAAAGGAGGAGGAACTTT 3'.

[0167] 4. Following the manufacturer's instructions, use the NEBNext Quick Ligation Module (NEB, E6056) to perform the ligation reaction on the end-repaired and A-added target nucleic acid and the annealed ligator. The reaction conditions are: incubation at 25°C for 60 minutes.

[0168] 5. Purify the ligation product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0169] 6. Digest the un-circularized nucleic acid fragments at both ends using Exonuclease I (NEB, M0293) and Exonuclease III (NEB, M0206) according to the manufacturer's instructions. The reaction conditions are: incubation at 37°C for 30 minutes.

[0170] 7. Purify the digestion product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain a double-stranded cyclic library.

[0171] II. Target Nucleic Acid Sequence Amplification

[0172] 1. Mix the obtained double-stranded circular library, the forward primer (first primer, 5'Phosphorylation-TGCT-iSpC3-SEQ ID NO: 5 3'), and the reaction buffer (NEB, M0269S) for phi29 DNA polymerase, and then anneal. Dissolve the forward primer (first primer) in TE buffer (pH=8). The annealing process is as follows: incubate at 95°C for 5 minutes, then cool to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0173] 2. Add phi29 DNA polymerase (NEB, M0269) to the incubation product from the previous step and incubate at 30°C for 30 minutes.

[0174] 3. Add dNTPs and excess reverse primer (second primer, SEQ ID NO: 6) to the incubation product from the previous step to amplify the second strand and its complementary strand. Dissolve the reverse primer (second primer, SEQ ID NO: 6) in TE buffer (pH=8). Amplification conditions: incubation at 8°C for 20 minutes.

[0175] 4. Purify the amplification products using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0176] 5. The purified product was treated with USER III Enzyme (NEB, M5509S) to create a single nucleotide nick at the uracil position in the cyclic library. The reaction conditions were 37°C for 30 minutes.

[0177] 6. Add dNTPs, excess reverse primer (second primer), phi29 DNA polymerase (NEB, M0269), and phi29 DNA polymerase reaction buffer (NEB, M0269) to the incubation product from the previous step, and amplify at 30°C for 30 minutes.

[0178] 7. Purify the amplification product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain the amplified product of the target nucleic acid sequence. Electrophoresis was performed after the procedure, and the results are shown in Figure 15.

[0179] III. Construction of sequencing adapter complexes

[0180] 1. The construction process of the sequencing adapter complex is shown in Figure 9.

[0181] 2. Following the manufacturer's instructions, sequence A(5'(iSpC3)) 30 Sequence A (SEQ ID NO: 7-(iSp18)4) and Sequence B (SEQ ID NO: 8 3') were dissolved in TE buffer (pH=8). Sequence A and Sequence B were annealed in a 1:1 ratio to form sequencing adapters. The annealing process was as follows: incubation at 95°C for 5 minutes, cooling to 25°C at a rate of 0.1°C / s, and then incubation for another 30 minutes.

[0182] 3. Prokaryotic expression of helicase He (SEQ ID NO: 10) was completed in Escherichia coli, and the target protein was obtained through multiple purification steps.

[0183] 4. Mix the helicase and sequencing adapter at a molecular ratio of 9:1. The final concentration of the reaction buffer is 25mM HEPES, 50mM KCl, 0.5mM EDTA, 2.5mM MgCl2, pH=8.0. Incubate at room temperature for 30 minutes.

[0184] 5. Add 0.25 volumes of 5mM ATP to the incubation product and incubate at room temperature for 30 minutes.

[0185] 6. Following the manufacturer's instructions, the sequencing adapter complex was purified using AMPure XP beads (Beckman Coulter, A63882) to obtain the sequencing adapter complex. The purified sequencing adapter complex was then subjected to electrophoresis, and the results are shown in Figure 10, indicating that a large amount of 1:1 sequencing adapter complex was obtained.

[0186] IV. Constructing Sequencing Libraries

[0187] 1. Following the manufacturer's instructions, ligate the amplified product of the target nucleic acid sequence to the sequencing adapter complex using the NEBNext Quick Ligation Module (NEB, E6056) and incubate at 25°C for 60 minutes.

[0188] 2. Purify the sequencing library using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0189] V. Nanopore sequencing

[0190] 1. A single-channel nanopore detection system was built based on patch clamp and signal amplifier to complete the embedding of a single pore protein.

[0191] 2. The sequencing library and the restraint sequence (5'Cholesterol-(iSp18)4–SEQ ID NO: 11 3') were mixed and added to a single-channel system. The changes in the current signal were observed and obtained at 180mV. The sequencing buffer was: 470mM KCl, 25mM HEPES, 10mM MgCl2, 30mM ATP, pH=8.10; the sequencing temperature was 30℃.

[0192] 3. Sequencing to obtain the current signal of multiple nanopore sequencing of the target nucleic acid sequence. A representative current signal is shown in Figure 16. Based on the ligation sequence signal and the characteristic sequence signal, it can be determined that the target sequence was sequenced 9 times in succession. The current signals of the first, second, third, fourth, fifth, sixth, seventh, eighth and ninth sequencing are 1D, 2D, 3D, 4D, 5D, 6D, 7D, 8D and 9D, respectively.

[0193] 4. The average current value of the electrical signal and the piercing time during the sequential sequencing of a single target nucleic acid sequence in multiple nanopore sequencing processes were statistically analyzed. As shown in Figure 17, the average current value of the electrical signal and the piercing time during sequential sequencing were almost unchanged.

[0194] Example 3:

[0195] Figure 18 shows a schematic diagram of the method for multiple amplification of target nucleic acid and nanopore sequencing in Example 3.

[0196] I. Constructing a dumbbell-shaped single-chain loop library formed by connecting hairpin connectors at both ends.

[0197] 1. A variety of known methods can be used to construct circular libraries. In this embodiment, hairpin connectors are attached to both ends of the target nucleic acid double strand, and then the nucleic acid fragments without hairpin connectors at both ends are removed by digestion with nucleases, thereby preparing a dumbbell-shaped single-stranded circular library with hairpin connectors at both ends (Figure 19).

[0198] 2. Following the manufacturer's instructions, the target nucleic acid (SEQ ID NO: 1) with the characteristic sequence was subjected to end repair and dA-tailing using NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546). The reaction conditions were incubation at 20°C for 10 minutes followed by incubation at 65°C for 10 minutes. The end-repaired and dA-tailing products were purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions. Electrophoresis was performed after the operation, and the results are shown in Figure 7.

[0199] 3. Dissolve the hairpin sequence (SEQ ID NO: 14) in TE buffer (pH=8) according to the manufacturer's instructions and anneal it to form a hairpin structure. The annealing process is as follows: incubate at 95°C for 5 minutes, cool down to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0200] SEQ ID NO: 14: 5'Phosphorylation-TCTCTCTCTTTCCTTGGCTCACAGAACGACATTdUGAGAGAGAT 3' (dU=deoxyUridine).

[0201] 4. Following the manufacturer's instructions, use the NEBNext Quick Ligation Module (NEB, E6056) to perform the ligation reaction between the end-repaired and A-added target nucleic acid and the annealed hairpin adapter. The reaction conditions were 25°C incubation for 60 minutes.

[0202] 5. Purify the ligation product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0203] 6. Digest nucleic acid fragments without hairpin adapters at both ends using Exonuclease I (NEB, M0293) and Exonuclease III (NEB, M0206) according to the manufacturer's instructions. The reaction conditions were incubation at 37°C for 30 minutes.

[0204] 7. Purify the digestion product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain a dumbbell-shaped single-stranded ring library with hairpin connectors at both ends.

[0205] II. Target Nucleic Acid Sequence Amplification

[0206] 1. Mix the obtained dumbbell-shaped single-stranded circular library (formed by connecting hairpin connectors at both ends), the forward primer (first primer), and the reaction buffer (NEB, M0269S) for phi29 DNA polymerase, and then anneal. Dissolve the forward primer (first primer) in TE buffer (pH=8). The annealing process is as follows: incubate at 95°C for 5 minutes, then cool to 25°C at a rate of 0.1°C / s, and continue incubating for 30 minutes.

[0207] The sequence of the first primer in this embodiment is: 5'Phosphorylation-TGCT-iSpC3-SEQ ID NO: 15 3'.

[0208] SEQ ID NO: 15: ATGTCGTTCTGTGAGCCAA*G*G, where "*" indicates thiomodification.

[0209] 2. Add phi29 DNA polymerase (NEB, M0269) to the incubation product from the previous step and incubate at 30°C for 30 minutes.

[0210] 3. Add dNTPs and excess reverse primer (second primer, SEQ ID NO: 16) to the incubation product from the previous step to amplify the second strand and its complementary strand. Dissolve the reverse primer (second primer, SEQ ID NO: 16) in TE buffer (pH=8). Amplification conditions: incubation at 8°C for 20 minutes.

[0211] In this embodiment, the sequence of the second primer is SEQ ID NO: 16: 5'(LNA_C)(LNA_C)(LNA_T)(LNA_T) GGCTCACAGAACGACAT 3'.

[0212] 4. Purify the amplification products using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0213] 5. The purified product was treated with USER III Enzyme (NEB, M5509S) to create a single nucleotide nick at the uracil position in the cyclic library. The reaction conditions were 37°C for 30 minutes.

[0214] 6. Add dNTPs, excess reverse primer (second primer), phi29 DNA polymerase (NEB, M0269), and phi29 DNA polymerase reaction buffer (NEB, M0269) to the incubation product from the previous step, and amplify at 30°C for 30 minutes.

[0215] 7. Purify the amplification product using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain the amplified product of the target nucleic acid sequence. Electrophoresis was performed after the procedure, and the results are shown in Figure 20.

[0216] III. Construction of sequencing adapter complexes

[0217] 1. The construction process of the sequencing adapter complex is shown in Figure 9.

[0218] 2. Following the manufacturer's instructions, sequence A(5'(iSpC3)) 30Sequence A (SEQ ID NO: 7-(iSp18)4) and Sequence B (SEQ ID NO: 8 3') were dissolved in TE buffer (pH=8). Sequence A and Sequence B were annealed in a 1:1 ratio to form sequencing adapters. The annealing process was as follows: incubation at 95°C for 5 minutes, cooling to 25°C at a rate of 0.1°C / s, and then incubation for another 30 minutes.

[0219] 3. Prokaryotic expression of helicase He (SEQ ID NO: 10) was completed in Escherichia coli, and the target protein was obtained through multiple purification steps.

[0220] 4. Mix the helicase and sequencing adapter at a molecular ratio of 9:1. The final concentration of the reaction buffer is 25mM HEPES, 50mM KCl, 0.5mM EDTA, 2.5mM MgCl2, pH=8.0. Incubate at room temperature for 30 minutes.

[0221] 5. Add 0.25 volumes of 5mM ATP to the incubation product and incubate at room temperature for 30 minutes.

[0222] 6. Following the manufacturer's instructions, the sequencing adapter complex was purified using AMPure XP beads (Beckman Coulter, A63882) to obtain the sequencing adapter complex. The purified sequencing adapter complex was then subjected to electrophoresis, and the results are shown in Figure 10, indicating that a large amount of 1:1 sequencing adapter complex was obtained.

[0223] IV. Constructing Sequencing Libraries

[0224] 1. Following the manufacturer's instructions, ligate the amplified product of the target nucleic acid sequence to the sequencing adapter complex using the NEBNext Quick Ligation Module (NEB, E6056) and incubate at 25°C for 60 minutes.

[0225] 2. Purify the sequencing library using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.

[0226] V. Nanopore sequencing

[0227] 1. A single-channel nanopore detection system was built based on patch clamp and signal amplifier to complete the embedding of a single pore protein.

[0228] 2. The sequencing library and the restraint sequence (5'Cholesterol-(iSp18)4–SEQ ID NO: 11 3') were mixed and added to a single-channel system. The changes in the current signal were observed and obtained at 180mV. The sequencing buffer was: 470mM KCl, 25mM HEPES, 10mM MgCl2, 30mM ATP, pH=8.10; the sequencing temperature was 30℃.

[0229] 3. Sequencing to obtain the current signal of multiple nanopore sequencing of the target nucleic acid sequence. A representative current signal is shown in Figure 21. Based on the hairpin sequence signal and the characteristic sequence signal, it can be determined that the target sequence was sequenced 12 times consecutively. The current signals of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh and twelfth (incomplete) sequencing are 1D, 2D, 3D, 4D, 5D, 6D, 7D, 8D, 9D, 10D, 11D and 12D (incomplete) sequencing, respectively.

[0230] 4. The average current value of the electrical signal and the piercing time during the sequential sequencing of a single target nucleic acid sequence in multiple nanopore sequencing processes were statistically analyzed, as shown in Figure 22. There are differences in the average current value of the electrical signal and the piercing time during sequential sequencing. This difference is because the circular library used is a dumbbell-shaped single-stranded loop formed by hairpin connectors at both ends. The multiple copies of the sequencing strand obtained by amplification are multiple copies of the sense and antisense strands of the target nucleic acid sequence that alternate. There is a rehybridization process when the sequencing strand passes through the pore, and the average current value of the electrical signal and the piercing time of different copies will change.

[0231] From the above description, it can be seen that in the above library construction and nanopore sequencing, (1) a circular library of target nucleic acid is constructed using a variety of known molecular biology methods, and natural or modified nucleotides that are resistant to polymerase and easily form strand breaks can be introduced into the circular library. (2) Rolling circle amplification is performed using the first primer, while an excess of the second primer binds to the displaced free second strand; the first and second primers may be modified. (3) After obtaining a sufficiently long sequencing strand (second strand) of the target nucleic acid sequence through multiple amplifications by rolling circle amplification, the circular library is treated to form strand breaks, and then fully synthesized again with an excess of the second primer to obtain a double-stranded amplification product with sticky ends. (4) A sequencing adapter complex with sticky ends is constructed. (5) Both the double-stranded amplification product and the sequencing adapter complex carry mutually matching sticky ends, which are easy to connect, and ensure that the sequencing strand is the second strand obtained by rolling circle amplification with the first primer. (6) The obtained sequencing library is subjected to nanopore sequencing to achieve multiple sequencing of the target nucleic acid sequence.

[0232] The embodiments of the present invention achieve the following technical effects: ① Applicable to constructing circular libraries of target nucleic acids in various ways; ② Utilizing the first primer for rolling circle amplification while simultaneously using an excess of the second primer for complementary strand synthesis, reducing the generation of long single strands; ③ The first primer is modified, with a thiolated 3' end to resist the 3'-5' exonuclease activity of polymerase, and contains modified nucleotides or spacers that terminate complementary strand synthesis, giving the amplification product sticky ends; ④ The second primer is modified, with an artificially modified nucleic acid sequence at the 5' end that inhibits polymerase chain displacement activity, preventing the displacement of the previously synthesized complementary strand; ⑤ Introducing natural polymerase-resistant and easily breakable strands during the construction of circular libraries. Alternatively, nucleotide modifications can be used. After obtaining a sufficiently long sequencing strand from multiple amplifications of the target nucleic acid sequence via rolling circle amplification, the circular library is processed to create strand breaks, avoiding excessive copy numbers of the sequencing strand during the subsequent synthesis. ⑥ The sequencing adapter complex construction process is simple and has high yield. ⑦ Both the double-stranded amplification product and the sequencing adapter complex carry mutually matching sticky ends, making them easy to ligate and ensuring that the sequencing strand is the multi-copy strand obtained from the rolling circle amplification of the first primer. ⑧ When using single-stranded or double-stranded circular libraries, the multiple copies of the amplified sequencing strand are consecutive copies of the sense or antisense strand of the target nucleic acid sequence. There is no rehybridization process when the sequencing strand passes through the well, which does not affect the average current value and passing speed of the electrical signal of different copies.

[0233] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for constructing a sequencing library, characterized in that, The construction method includes: The target nucleic acid circular library was amplified by rolling circle amplification using the first primer; The free fragment generated by the rolling circle amplification was amplified using a second primer for the first nucleic acid amplification. The circular library of the target nucleic acid is opened to terminate rolling circle amplification. After the circular library of the target nucleic acid is opened, an extendable 3' end is generated, which becomes an amplification primer. At the same time, the free fragment generated by the rolling circle amplification is amplified by the second primer to obtain a double-stranded amplification product. The sequencing library is prepared by ligating the double-stranded amplification product with a sequencing adapter.

2. The construction method according to claim 1, characterized in that, The construction method includes: A) Construct a circular library of target nucleic acids, or use naturally occurring circular target nucleic acids as a circular library of target nucleic acids; The target nucleic acid circular library and the first primer are annealed to obtain an amplification complex; wherein, in the amplification complex, the nucleic acid strand of the target nucleic acid circular library bound to the first primer is the first strand, and the first primer is the initial second strand; B) The target nucleic acid circular library is amplified by rolling circle using polymerase and the first primer to obtain an extended second strand; wherein the extended second strand includes a complementary second strand that is complementary to the bases of the first strand and a free second strand; After the rolling circle amplification begins and the free second strand is generated, the second primer is paired with the free second strand, and the first nucleic acid is amplified using the polymerase to synthesize the complementary strand of the free second strand. C) Open the first strand to terminate the rolling circle amplification; using the polymerase, the extendable 3' end generated after the circular opening of the target nucleic acid circular library, and the second primer, continue to amplify the second nucleic acid using the free second strand in its single-stranded state as a template, fully synthesize the complementary strand, and thereby obtain the double-stranded amplification product; D) Ligate the sequencing adapter to the double-stranded amplification product to prepare the sequencing library.

3. The construction method according to claim 2, characterized in that, The target nucleic acid circular library includes single-stranded circular libraries, double-stranded circular libraries, double-stranded circular libraries with bubbling, or dumbbell-shaped single-stranded circular libraries; Preferably, the method for constructing the target nucleic acid circular library includes: constructing the target nucleic acid into the target nucleic acid circular library using a library construction adapter; Preferably, the library construction adapter contains a first nucleotide that is resistant to the polymerase and readily forms DNA strand breaks; more preferably, the first nucleotide includes deoxyuridine nucleotide, deoxyhypoxanthine nucleotide, or ribonucleotide. Preferably, the library construction adapter includes 1-10 of the first nucleotide.

4. The construction method according to claim 3, characterized in that, A) includes: linking the library construction adapter to the target nucleic acid, thereby obtaining the amplification complex while obtaining the target nucleic acid circular library; Wherein, the target nucleic acid is a single-stranded nucleic acid; the library construction adapter is a first library construction adapter, which consists of a library construction adapter base strand and a library construction adapter top strand; the middle portion of the library construction adapter top strand can be complementary to the library construction adapter base strand; the two ends of the library construction adapter top strand are complementary to the two ends of the target nucleic acid, so that the library construction adapter top strand acts as a clamp to assist the library construction adapter base strand in connecting with the target nucleic acid to form a loop, thereby forming the target nucleic acid circular library, and the 3' end of the library construction adapter top strand becomes the first primer; Alternatively, the target nucleic acid may be a double-stranded nucleic acid; the library construction adapter is a first library construction adapter, which consists of a library construction adapter base strand, a library construction adapter first top strand, and a library construction adapter second top strand; the first top strand of the library construction adapter can be complementary to the 3' end of the library construction adapter base strand, and the second top strand of the library construction adapter can be complementary to the 5' end of the library construction adapter base strand; the library construction adapter base strand can be linked to the sense or antisense strand of the target nucleic acid to form a loop; correspondingly, the 3' end of the second top strand of the library construction adapter and the 5' end of the first top strand of the library construction adapter can be linked to both ends of the antisense or sense strand of the target nucleic acid; the 3' end of the first top strand of the library construction adapter becomes the first primer.

5. The construction method according to claim 1 or 2, characterized in that, The target nucleic acid circular library contains a known sequence, and the first primer is complementary to the known sequence; or The target nucleic acid circular library does not contain any known sequences, and the first primer contains degenerate bases, which are complementary to the target nucleic acid circular library.

6. The construction method according to claim 2, characterized in that, B) includes: using the polymerase with the target nucleic acid circular library as a template to extend the first primer to achieve rolling circle amplification and obtain the extended second strand; The extended second strand includes a complementary second strand that is complementary to the first strand and a free second strand. As the rolling circle amplification proceeds, the second primer continuously pairs with the newly generated free second strand and performs the first nucleic acid amplification to synthesize the complementary strand of the free second strand. Preferably, the 5' end of the second primer contains an artificially modified nucleotide that can inhibit polymerase chain displacement activity, and the complementary strand formed by the amplification of the first nucleic acid exists in a segmented manner, with each segment not connected by a chemical bond.

7. The construction method according to claim 6, characterized in that, The number of artificially modified nucleotides is 1-10; Preferably, the artificially modified nucleotide includes any one or more of the following: LNA, PNA, BNA, GNA, and TNA; more preferably, the artificially modified nucleotide is LNA; More preferably, the artificially modified nucleotides appear continuously at the 5' end of the second primer, or The artificially modified nucleotides are spaced apart from each other, and the number of deoxyribonucleotides between them is 1-5.

8. The construction method according to claim 6, characterized in that, The free second strand contains a known sequence, and the second primer is complementary to the known sequence; or The free second strand does not contain a known sequence, and the second primer contains a degenerate base, which is complementary to the free second strand.

9. The construction method according to claim 2, characterized in that, The polymerase has chain displacement activity; preferably, the polymerase is selected from DNA polymerase or RNA polymerase. Preferably, the polymerase is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNAPolymerase I, Vent DNA polymerase, 9°N DNA polymerase, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, and E. coli RNA polymerase.

10. The construction method according to claim 1 or 2, characterized in that, The 3' end of the first primer is a nucleotide containing a thiomodified form; Preferably, the number of thiolated nucleotides is 1-10.

11. The construction method according to claim 1 or 2, characterized in that, The construction method is performed in an amplification buffer; Preferably, the amplification buffer contains a pH buffer system; Preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, and MOPS buffer system; Preferably, the amplification buffer contains any one or more of the following: NTP, dNTP, and ddNTP; Preferably, the amplification buffer contains K + and / or Na + ; Preferably, the amplification buffer further contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ ; Preferably, the amplification buffer contains additives or auxiliary reagents that enhance the polymerase extension reaction; Preferably, the additive or auxiliary reagent includes any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, and ethylenediaminetetraacetic acid.

12. The construction method according to claim 2, characterized in that, The sequencing adapter is an NGS sequencing adapter, an SMRT sequencing adapter, or a nanopore sequencing adapter with sticky ends, and the sticky ends of the sequencing adapter can be complementary to the sticky ends of the double-stranded amplification product. Preferably, the first primer contains a blocking structure capable of terminating the amplification of the first nucleic acid or the second nucleic acid, and the synthesized complementary strand extends to the blocking structure and then terminates, so that the double-stranded amplification product forms the sticky ends. Preferably, the blocking structure includes modified nucleotides or intercostal arm modifications; Preferably, the number of modified nucleotides or intercostal arms is 1-10.

13. The construction method according to claim 12, characterized in that, The sequencing adapter is a complex consisting of a top strand and a bottom strand that are complementary and bound to a helicase. The top chain consists of, in sequence, a guide sequence, a helicase-binding sequence, a restriction sequence, a complementary sequence to the bottom chain, and a sequence that forms a sticky end; The bottom chain consists of, in sequence, a sequence forming viscous ends, a top chain complementary sequence, and a sequence complementary to the restraint sequence; The complementary sequence of the bottom chain and the complementary sequence of the top chain can be complementaryly paired, and the bottom chain and the top chain can be annealed to form sticky ends that can be complementaryly paired with the sticky ends of the double-stranded amplification product. Preferably, the guide sequence is a sequence consisting of 10 to 50 nucleotides or an arm-like modification, wherein the arm-like modification includes one or more of the following: iSp18, iSp9, iSpC3, iSpC6, and iSpC12; more preferably, it is a sequence consisting of 20 to 40 iSpC3s, and even more preferably, it is a sequence consisting of 30 iSpC3s; Preferably, the helicase binding sequence is a sequence of 5 to 40 nucleotides, more preferably a sequence of 5 to 40 thymine nucleotides; and even more preferably a sequence of 10 thymine nucleotides. Preferably, the limiting sequence is a sequence composed of intersegmental modifications, wherein the intersegmental modifications include any one or more of the following: iSp18, iSp9, iSpC3, iSpC6, and iSpC12; more preferably, it is a sequence composed of 2-6 iSp18s; and even more preferably, it is a sequence composed of 4 iSp18s. Preferably, the end of the bottom chain further includes a fixed sequence or cholesterol modification.

14. The construction method according to claim 13, characterized in that, The sequencing adapter also contains a helicase bound to the helicase binding sequence; Preferably, the helicase is selected from any one or more of the following: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, and DnaB helicase.

15. A nucleic acid sequencing method, characterized in that, The nucleic acid sequencing method includes: obtaining a sequencing library using the construction method described in any one of claims 1-14, and sequencing the sequencing library to obtain information about the target nucleic acid.

16. A nanopore sequencing method, characterized in that, The nanopore sequencing method includes: obtaining a sequencing library using the construction method described in any one of claims 1-14, and passing the sequencing library through a nanopore under the action of an electric field to obtain information about the target nucleic acid.

17. The nanopore sequencing method according to claim 16, characterized in that, The nanopores are located on the membrane material; Preferably, the membrane material is bound with a restraint sequence, which is bound to the membrane material by a cholesterol modification at its end, and the restraint sequence is complementary to the bottom strand of the sequencing adapter of claim 13.

18. The nanopore sequencing method according to claim 16, characterized in that, The nanopores are transmembrane protein pores or solid pores; Preferably, the transmembrane protein in the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, and GspD; Preferably, the transmembrane protein is further linked to an auxiliary fragment, which is selected from any one or more of the following: a tag, an enzyme cleavage site, a signal peptide, a guide peptide, and a detectable label.

19. The nanopore sequencing method according to claim 17, characterized in that, The membrane material includes an amphiphilic membrane; Preferably, the membrane material comprises a phospholipid bilayer, a diblock copolymer, or a triblock copolymer.

20. The nanopore sequencing method according to claim 16, characterized in that, The voltage that generates the electric field force is ≥10mV, preferably 50mV-250mV.

21. The nanopore sequencing method according to claim 16, characterized in that, The sequencing library was sequenced in a nanopore in a sequencing buffer. Preferably, the sequencing buffer contains a pH buffer system; Preferably, the pH buffer system includes any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, and MOPS buffer system; Preferably, the sequencing buffer contains one or more of NTPs, dNTPs, or ddNTPs; Preferably, the sequencing buffer contains K + and / or Na + ; Preferably, the sequencing buffer further contains any one or more of the following metal ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ , and Cd 2+ .

22. The application of the construction method of any one of claims 1-14, the nucleic acid sequencing method of claim 15, or the nanopore sequencing method of any one of claims 16-21 in the construction of sequencing libraries.

23. The construction method of any one of claims 1-14 and / or the nanopore sequencing method of any one of claims 16-21, applied in nanopore sequencing of target nucleic acids.

Images