Multi-target double-stranded RNA conjugate for liver-specific delivery and pharmaceutical composition

By designing multi-target double-stranded RNA conjugates and utilizing specific linkers and lipid or receptor ligands to achieve liver-specific delivery, the problem of multi-target siRNA delivery in existing technologies has been solved, improving delivery efficiency and gene targeting effect.

WO2025223315A1PCT designated stage Publication Date: 2025-10-30SUZHOU SIRAN BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/089800
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-25
Filing Date
2025-04-18
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

Existing technologies lack efficient multi-target or multi-target siRNA delivery strategies, especially in liver-specific delivery, making it difficult to achieve simultaneous targeting and efficient delivery of multiple gene targets.

Method used

Design a multi-target double-stranded RNA conjugate that links multiple double-stranded RNAs together via a linker and utilizes a specific linker group, such as the group shown in general structural formula (Ⅰ), to achieve liver-specific delivery. The linker contains phosphodiester bonds or thiophosphodiester bonds and binds to lipids or receptor ligands for delivery.

Benefits of technology

It achieves liver-specific delivery to multiple targets, improves cellular uptake efficiency and activity, and can simultaneously target multiple genes or different mRNA sites of the same gene, providing a more effective gene expression regulation tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025089800_30102025_PF_FP_ABST
    Figure CN2025089800_30102025_PF_FP_ABST
Patent Text Reader

Abstract

A multi-target double-stranded RNA conjugate for liver-specific delivery and a pharmaceutical composition. The multi-target double-stranded RNA conjugate comprises a first double-stranded RNA, a second double-stranded RNA, and a connecting body connected to both the first double-stranded RNA and the second double-stranded RNA, wherein the connecting body comprises one or more of groups represented by structural general formula (I).
Need to check novelty before this filing date? Find Prior Art

Description

A multi-target double-stranded RNA conjugate and pharmaceutical composition for liver-specific delivery Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a multi-target double-stranded RNA conjugate and pharmaceutical composition for liver-specific delivery. Background Technology

[0002] siRNA (small interfering RNA) drugs are a class of therapeutic agents that utilize RNA molecules to target and silence specific genes. This method is commonly used to treat a range of diseases caused by the overexpression or dysfunction of certain genes, such as genetic diseases, viral infections, and cancer. As a hot topic in small nucleic acid drug development, small interfering RNA drugs have gained widespread application due to their advantages such as high gene silencing efficiency, controllable adverse reactions, and convenient synthesis. However, the instability of siRNA sequences and the difficulty in in vivo delivery, hindering their ability to reach the target site and exert their effects, have been obstacles to early siRNA drug development. Although some delivery systems have been developed, current technologies mostly focus on delivering double-stranded siRNA to a single target site or region, lacking strategies for simultaneously and efficiently delivering siRNA to multiple targets or regions. Summary of the Invention

[0003] The purpose of this invention is to provide a double-stranded RNA conjugate and pharmaceutical composition capable of simultaneous multi-target liver-specific delivery.

[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0005] A first aspect of the present invention provides a multi-target double-stranded RNA conjugate, comprising a first double-stranded RNA, a second double-stranded RNA, and a linker respectively linked to the first double-stranded RNA and the second double-stranded RNA, wherein the linker comprises one or more groups as shown in general structural formula (I):

[0006] Wherein, L is absent or selected from one or more linkage combinations of the groups shown in formulas (A1)-(A14):

[0007] Wherein, R' is H, a C1-C10 alkyl group or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 20; j2 is an integer from 1 to 20;

[0008] m is an integer between 0 and 6;

[0009] Q is R2 and R3 are independently selected from H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl, respectively;

[0010] X is R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, and C2-C20 alkynyl, respectively, or R4 and R5 are directly linked to form a ring; p is an integer from 1 to 6.

[0011] Z is N or CR9, wherein R9 is selected from H, C1-C20 alkyl or C3-C10 cycloalkyl;

[0012] It is a C3-C8 cycloalkyl or C3-C8 heterocyclic group;

[0013] R1 is selected from H, fluorine, hydroxyl, cyano, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl;

[0014] Y is absent, or is fluorine, chlorine, hydroxyl, or a delivery molecule.

[0015] According to some specific embodiments, the groups shown in A1-A14 can be arbitrarily combined and connected to form L, wherein the left and right ends of the groups shown in A1-A14 can be interchanged. Taking A7 as an example, N of A7 can be connected to the group on the Y side or the group on the Z side. Preferably, L is selected from at least two combinations of the groups shown in A1-A14.

[0016] Further, L is selected from one or more connection combinations of formulas A1, A2, A3, A5, A6, A7, A8, A10, A11, and A13; preferably, L is selected from at least two connection combinations of formulas A1, A2, A3, A5, A6, A7, A8, A10, A11, and A13.

[0017] Further, L is selected from one or more connection combinations of formulas A1, A2, A3, A5, A6, and A7; preferably, L is selected from at least two connection combinations of formulas A1, A2, A3, A5, A6, and A7.

[0018] Furthermore, L is selected from one or more connection combinations of formulas A1, A2, A5, and A7; more preferably, L is selected from at least two connection combinations of formulas A1, A2, A5, and A7. More preferably, L contains formulas A1, A2, and A5 simultaneously, and the number of formulas A1, A2, and A5 is one or more, and the number of multiple formulas can be two, three, four, or five.

[0019] Furthermore, L does not exist.

[0020] According to some specific embodiments, R' is hydrogen, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group. Preferably, R' is hydrogen, a C1-C5 alkyl group, or a C4-C6 cycloalkyl group. Preferably, R' is hydrogen.

[0021] According to some specific implementations, j1 is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15; j2 is an integer from 1 to 15, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. Preferably, j1 is an integer from 3 to 15; j2 is an integer from 3 to 15.

[0022] According to some specific implementations, m represents an integer from 0 to 3, such as 0, 1, 2 or 3.

[0023] According to some specific embodiments, R2 and R3 are each independently selected from H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl. Preferably, R2 and R3 are each independently selected from H, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl. Preferably, R2 and R3 are each independently selected from H, C1-C3 alkyl, C1-C3 alkoxy, C2-C4 alkenyl, or C2-C4 alkynyl. Preferably, R2 and R3 are both H.

[0024] According to some specific implementation methods, X is... Wherein, R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, and C2-C10 alkynyl, respectively, or R4 and R5 are directly connected to form a three- to eight-membered ring; p is 1, 2, 3, 4, 5, or 6. Preferably, R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, and C2-C5 alkynyl, respectively, or R4 and R5 are directly connected to form a four- to six-membered carbon ring; p is an integer from 1 to 3. Preferably, X represents

[0025] According to some specific embodiments, Z is CR9, wherein R9 is selected from H, C1-C10 alkyl, or C3-C8 cycloalkyl. Preferably, R9 is selected from H, C1-C5 alkyl, or C3-C5 cycloalkyl.

[0026] According to some specific implementation methods It is a C3-C6 cycloalkyl or a C3-C8 nitrogen-containing heterocyclic group. Preferably, It consists of four to eight nitrogen-containing saturated heterocycles.

[0027] According to some specific embodiments, R1 is selected from H, fluorine, hydroxyl, cyano, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl. Preferably, R1 is selected from H, fluorine, hydroxyl, cyano, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, or C2-C5 alkynyl. Preferably, R1 is H.

[0028] According to some specific implementations, Y is absent, or is a hydroxyl group, or is... Furthermore, Y is

[0029] According to some more specific and preferred embodiments, the group represented by general structural formula (I) is selected from any of the structures shown below:

[0030] According to some specific embodiments, the linker consists of 1 to 6 groups with the same or different structures as shown in general structural formula (I) linked by phosphate diester bonds or thiophosphate diester bonds. Further, the linker may contain 1, 2, 3, or 4 groups as shown in general structural formula (I).

[0031] According to some specific embodiments, the connector has the structure described in formula (II):

[0032] The definitions of L and Y are the same as those in the general formula (Ⅰ), as detailed above, and will not be repeated here; the three Ls in formula (Ⅱ) may have the same or different structures; the three Ys in formula (Ⅱ) may have the same or different structures.

[0033] M is either O or S;

[0034] m represents an integer from 0 to 6; for example, 0, 1, 2, 3, 4, 5 or 6; the three values ​​of m in equation (II) may be the same or different;

[0035] It is a four- to eight-membered nitrogen-containing saturated heterocycle, and the three in formula (II) The structures are the same or different;

[0036] This indicates the site where a group is covalently bonded.

[0037] According to some more specific embodiments, the multi-target double-stranded RNA conjugate is selected from any of the structures shown below:

[0038] Where M is O or S, siRNA1 is the first double-stranded RNA, and siRNA2 is the second double-stranded RNA.

[0039] According to some specific embodiments, the linker is connected to the positive strand of the first double-stranded RNA and the positive strand of the second double-stranded RNA, respectively.

[0040] Furthermore, the linker is connected to the 3' end of the positive strand of the first double-stranded RNA and the 5' end of the positive strand of the second double-stranded RNA, respectively.

[0041] According to some specific implementations, the first double-stranded RNA and the second double-stranded RNA target different genes or different mRNA locations of the same gene.

[0042] According to some specific embodiments, the 3' end and / or 5' end of the positive strand of the second double-stranded RNA are connected with reverse debased deoxyribose residues.

[0043] Furthermore, the reverse debased deoxyribose residue is linked to the linker or the nucleotide of the second double-stranded RNA via a phosphodiester bond or a thiophosphate diester bond.

[0044] Furthermore, the 3' end and / or 5' end of the positive strand of the first double-stranded RNA are connected with reverse debased deoxyribose residues.

[0045] Furthermore, the reverse debased deoxyribose residue is linked to the linker or the nucleotide of the first double-stranded RNA via a phosphodiester bond or a phosphothiodiester bond. According to some specific embodiments, the 5' end of the antisense strand of the first double-stranded RNA and / or the antisense strand of the second double-stranded RNA has a VP modification.

[0046] In one implementation, the 5' end of the antisense strand of the first double-stranded RNA is modified with VP.

[0047] In another embodiment, the 5' end of the antisense strand of the second double-stranded RNA is modified with VP.

[0048] In another embodiment, the 5' ends of the antisense strands of the first double-stranded RNA and the second double-stranded RNA are modified with VP.

[0049] In this article, "multiple targets" refers to two or more targets. When the RNA in a multi-target double-stranded RNA conjugate consists only of the first and second double-stranded RNAs, the conjugate is a dual-target double-stranded RNA conjugate.

[0050] According to some specific embodiments, the multi-target double-stranded RNA conjugate can be a three-target, four-target, or five-target double-stranded RNA conjugate, correspondingly including a third, fourth, or fifth double-stranded RNA. These double-stranded RNAs can be linked to adjacent double-stranded RNAs using the linkers described above.

[0051] According to some specific implementations, both the first double-stranded RNA and the second double-stranded RNA are siRNAs, which include a sense strand and an antisense strand.

[0052] According to some specific embodiments, the antisense strands of the first double-stranded RNA and the second double-stranded RNA are separated (i.e., there is no connection between the two antisense strands; each antisense strand pairs only with its respective sense strand). Alternatively, the antisense strands of the first and second double-stranded RNAs are linked by a nucleotide or a nucleotide derivative. Alternatively, the antisense strands of the first and second double-stranded RNAs are linked by a linker; wherein the linker can be any linker in the prior art; preferably, the linker is the linker described above. The nucleotide or nucleotide derivative or the linker can be biodegradable so that the two antisense strands can separate after entering the body to perform their respective functions.

[0053] According to some specific embodiments, each nucleotide in the first double-stranded RNA and the second double-stranded RNA is independently modified or unmodified. Each double-stranded RNA may employ siRNA targeting its respective site.

[0054] According to some embodiments, at least one nucleotide in the sense strand or antisense strand of the first double-stranded RNA and the second double-stranded RNA is a modified nucleotide. In some embodiments, the number of modified nucleotides in the sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen. In some embodiments, the number of modified nucleotides in the antisense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty-one. In some embodiments, all nucleotides in the sense strand and the antisense strand are modified nucleotides.

[0055] According to some implementation methods, some or all of the nucleotides in siRNA are modified nucleotides, and these modifications on the nucleotide groups do not cause the siRNA to significantly weaken or lose its function of inhibiting the expression of the corresponding gene.

[0056] According to certain embodiments, at least one phosphate ester group in the sense chain or the antisense chain is a phosphate ester group with a modifying group. Preferably, the phosphate ester group with a modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0057] According to some embodiments, the 5' terminal nucleotide of the positive strand is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0058] According to some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate-derived group.

[0059] According to some embodiments, the modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof.

[0060] Further, the modified nucleotide is selected from 2'-fluoromodified nucleotides, 2'-methoxymodified nucleotides, 2'-O-CH2-CH2-O-CH3modified nucleotides, 2'-O-CH2-CH=CH2modified nucleotides, 2'-CH2-CH2-CH=CH2modified nucleotides, 2'-deoxynucleotides, nucleotide analogs, reverse debased deoxyribose residues, or any combination of two or more thereof.

[0061] According to some preferred and specific embodiments, in the sense strand of each double-stranded RNA, 2'-fluorinated nucleotides are located at positions 7, 8, and 9 of the sense strand, with the remaining positions being non-fluorinated nucleotides, in a 5' to 3' orientation; or, 2'-fluorinated nucleotides are located at positions 7, 9, and 11 of the sense strand, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 9, 10, and 11 of the sense strand, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 10, 11, and 12 of the sense strand, with the remaining positions being non-fluorinated nucleotides; or, 2'-fluorinated nucleotides are located at positions 8, 9, and 10 of the sense strand, with the remaining positions being non-fluorinated nucleotides.

[0062] According to other preferred and specific embodiments, in the antisense strand of each double-stranded RNA, 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 of the antisense strand in a 5' to 3' direction, with the remaining positions being non-fluorinated nucleotides; or, in a 5' to 3' direction, 2'-fluorinated nucleotides are located at positions 2, 14, and 16 of the antisense strand, with the remaining positions being non-fluorinated nucleotides.

[0063] Furthermore, the hydroxyl group at the 2' position of the ribosome of the non-fluorinated modified nucleotide is replaced by a methoxy group.

[0064] Furthermore, in the sense and antisense strands of each double-stranded RNA, the 5' end base of the sense strand and the 3' end base of the sense strand are respectively linked to a reverse debased deoxyribose residue containing a phosphate ester group or a thiophosphate ester group.

[0065] According to some preferred and specific embodiments, in the positive strand of each double-stranded RNA, in a 5' to 3' orientation, the positive strand contains one or more phosphate thioester groups located at the following positions:

[0066] Between the first and second nucleotides starting at the 5' end of the positive strand;

[0067] Between the second and third nucleotides starting at the 5' end of the positive strand.

[0068] Furthermore, in the sense strand of each double-stranded RNA, the sense strand may optionally contain one or more phosphate thioester groups located at the following positions, in a 5' to 3' orientation:

[0069] Between the first and second nucleotides starting at the 3' end of the positive strand;

[0070] Between the second and third nucleotides starting at the 3' end of the positive strand.

[0071] According to some preferred and specific embodiments, in each double-stranded RNA antisense strand, in a 5' to 3' orientation, the antisense strand contains one or more phosphate thioester groups located at the following positions:

[0072] Between the first and second nucleotides starting at the 5' end of the antisense strand;

[0073] Between the second and third nucleotides starting at the 5' end of the antisense strand;

[0074] Between the first and second nucleotides starting at the 3' end of the antisense strand;

[0075] Between the second and third nucleotides starting at the 3' end of the antisense strand.

[0076] According to some preferred and specific embodiments, in the 5' to 3' direction, any one or more nucleotides at positions 6 to 10 of the antisense strand include those as shown in the structural formula. The modifications shown are illustrated, where R1 is H, OH, or CH3, and R2 is a native nucleobase, a modified nucleobase, a universal base, or an H atom. By adding the modifications shown in this structural formula to the antisense strand, the off-target activity of siRNA can be reduced, with minimal impact on the on-target activity of siRNA.

[0077] Furthermore, such as structural The modifications shown are selected from any of the following structures:

[0078] According to some specific embodiments, the 0 to 5 nucleotides at the 3' and / or 5' ends of the first double-stranded RNA and / or the second double-stranded RNA are debased nucleotides, deoxyribonucleotides, or nucleotide analogs. More preferably, the nucleotides at the 3' and / or 5' ends of the first double-stranded RNA and / or the second double-stranded RNA are -GrGr-, -GrGrdAdT-, -dTdTdT-, -GrdAdT-, -IB-, or -s-IB-s-.

[0079] According to some specific embodiments, the multi-target double-stranded RNA conjugate further includes a conjugating group covalently conjugated to the first double-stranded RNA and / or the second double-stranded RNA, wherein the conjugating group is a lipid or a receptor ligand. The lipid can be any lipid currently available for siRNA delivery. The ligand can be selected from any of the following: D-mannose, L-mannose, D-arabinose, D-xylfuranose, L-xylfuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannose, β-D-mannose, α-D-mannose, β-D-mannose, α-D-glucose pyranose, β-D-glucose pyranose, α-D-glucose pyranose, β-D-glucose pyranose, α-D- Furanose, β-D-furanose, α-D-fructose, α-D-fructose pyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactopyranose, β-D-galactopyranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine 2-Amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl-D-mannpyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-ethanolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2, 3,4-Tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucopyranoside methyl ester, 4-Thio-β-D-galactopyranose, 3,4,6,7-Tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-dehydrated-D-alosulfonyl, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose.

[0080] Preferably, the definition of the conjugating group is the same as that of the linker. Preferably, the number of conjugating groups is one or multiple groups connected sequentially. The multiple groups can be 2 to 6, for example, 2, 3, 4, 5, or 6.

[0081] In some embodiments, the multi-target double-stranded RNA conjugate does not contain the conjugation group; in other embodiments, the multi-target double-stranded RNA conjugate contains the conjugation group. Specifically, when the linker does not have liver-specific delivery properties, the multi-target double-stranded RNA conjugate contains the conjugation group; while when the linker has liver-specific delivery properties, the multi-target double-stranded RNA conjugate may or may not contain the conjugation group.

[0082] A second aspect of the present invention provides a multi-target double-stranded RNA conjugate, comprising a first double-stranded RNA, a second double-stranded RNA, a linker connected to the first double-stranded RNA and the second double-stranded RNA respectively, and a reverse debased deoxyribose residue connected to the 3' end and / or 5' end of the positive strand of the second double-stranded RNA.

[0083] According to some specific embodiments, the reverse debased deoxyribose residue is linked to the linker or the nucleotide of the second double-stranded RNA via a phosphodiester bond or a thiophosphate diester bond.

[0084] According to some specific embodiments, the 3' end and / or 5' end of the positive strand of the first double-stranded RNA are connected with reverse debased deoxyribose residues.

[0085] Furthermore, the reverse debased deoxyribose residue is linked to the linker or the nucleotide of the first double-stranded RNA via a phosphodiester bond or a thiophosphate diester bond.

[0086] The linker in this embodiment can be a linker capable of multi-target delivery in the prior art, or it can be a linker described in the multi-target double-stranded RNA provided in the first aspect above, i.e., a linker with the group shown in the general structural formula (I) and the specific structure defined under the general formula.

[0087] The first and second double-stranded RNAs in this embodiment are also described in the first aspect above, and will not be repeated here.

[0088] In some implementations, the sequence of the sense strand of the first double-stranded RNA is 5'-AUAACUCACUAUAAUUACA-3' (SEQ ID NO:1), and the sequence of the antisense strand is 5'-UGUAAUUAUAGUGAGUUAUUU-3' (SEQ ID NO:2).

[0089] In some implementations, the sequence of the sense strand of the second double-stranded RNA is 5'-CAGUGUUCUUGCUCUAUAA-3' (SEQ ID NO:3), and the sequence of the antisense strand is 5'-UUAUAGAGCAAGAACACUGUU-3' (SEQ ID NO:4).

[0090] In some implementations, the sequence of the sense strand of the first double-stranded RNA is 5'-CCUGUUUUGCUUUUGUAAA-3' (SEQ ID NO:5), and the sequence of the antisense strand is 5'-UUUACAAAAGCAAAACAGGUC-3' (SEQ ID NO:6).

[0091] In some implementations, the sequence of the sense strand of the second double-stranded RNA is 5'-UAUUCUCAGUGCUCUCCUA-3' (SEQ ID NO:7), and the sequence of the antisense strand is 5'-UAGGAGAGCACUGAGAAUACU-3' (SEQ ID NO:8).

[0092] The present invention also provides a pharmaceutical composition comprising the above-described multi-target double-stranded RNA conjugate, and a pharmaceutically acceptable carrier or excipient.

[0093] According to some specific embodiments, the pharmaceutical composition has liver-specific delivery properties.

[0094] The present invention also provides the use of the above-described multi-target double-stranded RNA conjugate or the above-described pharmaceutical composition in the preparation of a medicament for inhibiting the expression of multiple target genes.

[0095] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0096] The double-stranded RNA conjugates or pharmaceutical compositions of the present invention can simultaneously deliver multiple targets to the liver specifically, improve cellular uptake efficiency and activity, and can simultaneously target multiple genes or different mRNA sites of the same gene, providing a more effective tool for regulating gene expression and expanding its application in siRNA drug development. Attached Figure Description

[0097] Figure 1 shows the in vivo activity results of the siRNA conjugate in mice in Example 3.

[0098] Figure 2 shows the relative residual expression level of TTR mRNA in mice for the siRNA conjugate in Example 4.

[0099] Figure 3 shows the relative residual expression level of C5 mRNA in mice for the siRNA conjugate in Example 4.

[0100] Figure 4 shows the in vivo activity results of the siRNA conjugate in mice in Example 5.

[0101] Figure 5 shows the residual PCSK9 activity of the siRNA conjugate in Hep3B cells in Example 6.

[0102] Figure 6 shows the residual APOC3 activity of the siRNA conjugate in Hep3B cells in Example 6. Detailed Implementation

[0103] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application should have the ordinary meaning understood by one of ordinary skill in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the medicinal materials, reagents, and other materials used in the following embodiments are commercially available products. When used herein and in the appended claims, the singular forms “a,” “an,” “another,” and “the” include the plural referents, unless the context clearly indicates otherwise.

[0104] definition

[0105] As used in this article, a hyphen ("-") that is not between two letters or two symbols or It is used to indicate the location of the substituent connection point.

[0106] As used herein, “optional” or “optionally” means that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, “optionally substituted alkyl” includes “alkyl” and “substituted alkyl” as defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substituent form that is spatially impractical, synthetically infeasible, and / or inherently unstable.

[0107] As used herein, “alkyl” refers to a straight-chain or branched alkyl group having a specified number of carbon atoms, typically from 1 to 20 carbon atoms, such as from 1 to 10 carbon atoms, or from 1 to 8 or 1 to 6 carbon atoms. For example, C1-C6 alkyl groups comprise straight-chain and branched alkyl groups with 1 to 6 carbon atoms. When referring to an alkyl residue having a specific number of carbon atoms, it is intended to encompass all branched and straight-chain forms having that number of carbon atoms; thus, for example, “butyl” means including n-butyl, sec-butyl, isobutyl, and tert-butyl; “propyl” includes n-propyl and isopropyl. Alkylenes are subsets of alkyl groups, referring to residues that are identical to alkyl groups but have two connection sites.

[0108] As used herein, “cycloalkyl” refers to a non-aromatic carbon ring, typically having 3 to 7 cyclic carbon atoms. The ring may be saturated or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, and cyclohexenyl, as well as bridging and cage-like cyclic groups, such as norbornane.

[0109] In the context of this invention, uppercase letters A, U, C, G: represent the base composition of nucleotides; lowercase letter m: indicates that the nucleotide adjacent to the left of letter m is a methoxy-modified nucleotide; lowercase letter f: indicates that the nucleotide adjacent to the left of letter f is a fluorinated nucleotide; lowercase letter s: indicates that the two nucleotides adjacent to the left and right of letter s are linked by a thiophosphate group; letter combination VP: indicates that the nucleotide adjacent to the right of letter combination VP is a vinyl phosphate-modified nucleotide, as shown below. The structure of the thiophosphate group is shown in formula (1). The lowercase literal d: indicates that the nucleotide adjacent to the right of the letter is a deoxynucleotide, such as dA for deoxyadenosine. m5dC refers to 5-methyldeoxycytidine. The lowercase literal r: indicates that the nucleotide adjacent to the left of the letter is a ribonucleotide, such as Gr for guanylic acid. IB refers to a reverse debased deoxyribose residue. -s-IB- or -s-IB-s- indicates that the phosphate bond in IB is a thiophosphate bond.

[0110] As used herein, the term "nucleotide position" refers to the position of the nucleotide within an oligonucleotide, counting from the nucleotide at its 5' end. For example, nucleotide position 1 refers to the 5' end nucleotide of an oligonucleotide.

[0111] As used herein, double-stranded RNA refers to a polymeric form of nucleotides ranging from 2 to 2500 nucleotides. In some embodiments, the double-stranded RNA has 500 to 1500 nucleotides, typically, for example, where the double-stranded RNA is used in gene therapy. In some embodiments, the double-stranded RNA has 7 to 100 nucleotides. In some embodiments, the double-stranded RNA has 15 to 100 nucleotides. In another embodiment, the double-stranded RNA has 15 to 50 nucleotides, typically, for example, where the double-stranded RNA is a nucleic acid inhibitor molecule. In another embodiment, the double-stranded RNA is a double strand having 25 to 40 nucleotides. In yet another embodiment, the double-stranded RNA has 19 to 40 or 19 to 25 nucleotides, typically, for example, where the double-stranded RNA is a double-stranded nucleic acid inhibitor molecule and forms a double helix having at least 18 to 25 base pairs. Typically, as described herein, the double-stranded RNA contains one or more phosphorus-containing internucleotide linking groups. In other embodiments, as described herein, the internucleotide linking group is a phosphorylated amide group.

[0112] As used herein, "fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by fluorine, having the structure shown in formula (7). In some embodiments, the 2'-alkyl-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (8).

[0113] Where base represents a base, such as A, U, G, C, or T.

[0114] As used in this article, "non-fluorinated nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribosyl group is replaced by a non-fluorinated group.

[0115] As used herein, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA.

[0116] In the context of this invention, particularly in describing methods for preparing siRNA, siRNA-containing compositions, or siRNA conjugates of this application, unless otherwise specified, the term "nucleoside monomer" refers to unmodified or modified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this application are commercially available.

[0117] Various hydroxyl protecting groups may be used in this disclosure. Generally, protecting groups make chemical functional groups insensitive to specific reaction conditions and can be added to and removed from the functional group in the molecule without substantially impairing the rest of the molecule.

[0118] The pharmaceutically acceptable carriers described in this disclosure can be carriers conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethyl ethylene) phosphate. The excipients may be one or more of phosphate, PPEEA, and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and their derivatives. The excipients may be one or more of a variety of formulations or compounds conventionally used in the art. For example, other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic regulators.

[0119] The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry.

[0120] As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder.

[0121] As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” siRNA, siRNA conjugates, or pharmaceutical compositions may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0122] In this invention, the compounds represented by general formula (I) and general formula (II) and the compounds with specific structural formulas include their tautomers, racemates, enantiomers, diastereomers, mixtures thereof, etc.

[0123] The technical solution provided by the present invention will be further described below with reference to specific embodiments. The following embodiments are for illustrative purposes only and do not limit the scope of protection of the present invention.

[0124] Example 1: Synthesis of siRNA

[0125] Unless otherwise specified, the reagents described herein can be obtained from any molecular biology reagent supplier and must meet the quality / purity standards required for molecular biology applications.

[0126] siRNA sequences were synthesized at a 200 nmol level using solid-support-mediated phosphoramide chemistry on a Dr. Oligo48 synthesizer (Biolytic). The solid support was a universal solid support (Shenzhen DouDian Biotechnology). Nucleoside monomers, including 2'-F RNA and 2'-O-methyl RNA, were purchased from Shanghai Zhaowei or Suzhou Jima. The coupling time for all phosphoramides (50 mM acetonitrile solution) was 6 min. 5-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6 M acetonitrile solution). 0.22 M PADS dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Kelama) was used as the sulfidation agent, with a sulfidation reaction time of 3 min. Iodopyridine / aqueous solution (Kelama) was used as the oxidant, with an oxidation reaction time of 2 min.

[0127] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. The mixture was then centrifuged at high speed, and the supernatant was transferred to another centrifuge tube. After concentration and evaporation to dryness, purification was performed using C18 reversed-phase chromatography with a mobile phase of 0.1M TEAA and acetonitrile. DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LC-MS, and then quantified by UV (260 nm).

[0128] The obtained single-stranded oligonucleotides were annealed in equimolar ratios according to the complementary pairing of two sequences. The resulting double-stranded siRNA was then dissolved in 1X PBS and adjusted to the required concentration for the experiment. These monomers are interconnected to form oligonucleotides via 5'-3'-phosphodiester bonds.

[0129] Example 2 Preparation of siRNA conjugates

[0130] 1. GalNAc target or connector

[0131] 1. L96 (N-[tris(GalNAc-alkyl)-amide-decanoyl]]-4-hydroxyprolyl-(GalNAc-alkyl)) was purchased from Asymchem Laboratories (Tianjin) Co., Ltd., and its structural formula is as follows:

[0132] 2. The precursor compound I-1-7 of SA51, the synthesis method of which can be found in the invention patent application number 2024100522838, has the following structural formula:

[0133] 3. The synthesis method of the precursor compound SA102 is described in invention patent application number 2024100522838, and its structural formula is as follows:

[0134] II. Preparation of siRNA conjugates

[0135] Nucleoside monomers were linked sequentially from 3' to 5' along the nucleotide arrangement using a solid-phase phosphorous amide method. Each linkage involved four steps: deprotection, coupling, capping, and oxidation or sulfidation. The sense and antisense chains were synthesized under the same conditions.

[0136] Instruments and equipment: Biolytic Dr. Oligo 48 solid-phase synthesizer, DS0200 Embed CPG Frits universal synthesis column from DouDian Biotechnology, and DC189650 (80mg) 96-well plate desalting column from DouDian Biotechnology. Table 1 lists the reagents used to synthesize siRNA conjugates.

[0137] Table 1

[0138] The synthesis conditions are as follows:

[0139] Nucleoside monomers were provided in 0.05 M acetonitrile solution. The deprotection reaction conditions were the same for each step: 25 °C, 3 min reaction time, DCA as the deprotection reagent, and 180 μL injection volume.

[0140] The coupling reaction conditions were identical for each step, including a temperature of 25°C and a reaction time of 3 minutes. The injection volume of the nucleoside monomer was 90 μL, and the injection volume of the ACT catalyst was 110 μL.

[0141] Each capping step was performed under identical conditions, including a temperature of 25°C and a reaction time of 2 minutes. The capping reagent solution was a 1:1 molar ratio of CapA to CapB. The injection volume of the capping reagent was 180 μL.

[0142] The oxidation reaction conditions were the same for each step, including a temperature of 25°C, a reaction time of 3 minutes, and an injection volume of 180 μL for the oxidizing reagent OXD.

[0143] The vulcanization reaction conditions were identical for each step, including a temperature of 25°C, a reaction time of 4 minutes, and a 0.05 M PADS pyridine acetonitrile solution as the vulcanizing agent. The injection volume of the vulcanizing agent was 180 μL.

[0144] After the last nucleoside monomer was ligated, the nucleic acid sequence ligated on the solid-phase support was sequentially cut, deprotected, purified, and desalted, and then freeze-dried to obtain the sense and antisense strands, wherein:

[0145] The cleavage and deprotection conditions were as follows: The synthesized nucleotide sequence linked to the vector was added to a mixture of ammonia and ethanol in a 3:1 ratio to a volume of 0.8 mL. The reaction was carried out at 50 °C for 15 h. The remaining vector was removed by filtration, and the supernatant was concentrated to dryness under vacuum.

[0146] The purification and desalting conditions are as follows: Desalting was performed using a C18 reversed-phase column. Specific conditions include:

[0147] (1) Sample preparation

[0148] Add 0.1M TEAA (triethylamine acetate) to the oligonucleotide sample to a volume of 0.8mL.

[0149] (2) Activation of 96-well plate

[0150] Activation: 0.8 mL of acetonitrile was passed through each well of a 96-well plate for activation;

[0151] Equilibration: Equilibrate the 96-well plate with 0.8 mL of TEAA (pH 7.0) solution.

[0152] (3) The purification process shall be carried out in the following order:

[0153] Pass 0.8 mL of a solution containing oligonucleotides through a desalting column;

[0154] Wash the 96-well plate twice with 0.8 mL of 6.5% ammonia to remove failed sequences;

[0155] Rinse the 96-well plate twice with 0.8 mL of deionized water to remove salts;

[0156] The 96-well plate was washed three times with 0.8 mL of 3% trifluoroacetic acid to remove DMT, and the adsorbed layer was observed to turn orange-red.

[0157] Rinse the 96-well plate with 0.8 mL of 0.1 M TEAA;

[0158] Rinse the 96-well plate twice with 0.8 mL of deionized water to remove trifluoroacetic acid and residual salts;

[0159] Elute with 0.6 mL of 20% acetonitrile and collect and freeze-dry.

[0160] The detection methods are as follows: The purity of the above-mentioned sense and antisense chains was detected and the molecular weight was analyzed using a WATERS ACQUITY UPLC-LTQ LCMS (COLUMN: ACQUITY UPLC BEH C18). The measured values ​​are consistent with the theoretical values, indicating that the synthesized sense and antisense chains are conjugated with groups at the 3' and / or 5' ends.

[0161] The annealing procedure is as follows: The synthesized sense and antisense chains are dissolved separately in water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. The solutions are then calibrated to an equimolar ratio using a concentration meter, heated at 90°C for 5 minutes, and then slowly cooled naturally to allow them to form a double-chain structure through hydrogen bonding. Samples are taken and sent for SEC purity testing of the product. The double-chain samples are then lyophilized.

[0162] Example 3: Activity of different conjugates in mice

[0163] In this embodiment, siRNA was selected for synthesis, and its in vivo activity was evaluated in mice. The siRNA conjugate was obtained using the solid-phase synthesis method described in Example 2, and the specific sequence and modification information are shown in Table 2.

[0164] Table 2

[0165] Experimental methods:

[0166] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Seven days after administration, the animals were euthanized, and liver tissue was harvested. The liver was dissected and placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression levels of target genes C5 and TTR mRNA were detected by fluorescence qPCR (Vazyme, Q711).

[0167] C5 primer for target gene:

[0168] Forward primer: CCAGCCCAATCAAGTTCCTAGAG (SEQ ID NO:9);

[0169] Reverse primer: CGGCGTGTAAACAGGTTTGTC (SEQ ID NO:10);

[0170] Target gene TTR primers:

[0171] Forward primer: CTGCTGTAGACGTGGCTGTAA (SEQ ID NO:11);

[0172] Reverse primer: CTTCCAGTACGATTTGGTGTCC (SEQ ID NO:12);

[0173] GAPDH primers for internal reference gene:

[0174] Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO:13);

[0175] Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO:14);

[0176] The results are expressed as the residual expression level of the siRNA-administered group compared to the solvent group (the solvent group was 100%). The sequences of the conjugates used for injection are shown in Table 2. The results are shown in Figure 1. Compared with the mixture of two single-target conjugates (SD004758+SD004759), the activity of SD004519 (dTdTdT as a linker) in the dual-target molecule was the best, but it was still slightly worse than the mixture.

[0177] Example 4: Activity of different designed dual-target molecules in mice

[0178] In this embodiment, siRNA was selected for conjugation synthesis, and its in vivo activity was evaluated in mice. The siRNA conjugate was obtained by the solid-phase synthesis method described in Example 2, and the specific sequence and modification information are shown in Table 3.

[0179] Table 3

[0180] Experimental methods:

[0181] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Seven and 21 days after administration, the animals were euthanized, and liver tissue was harvested. The liver was dissected and placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression levels of target genes TTR mRNA and C5 mRNA were detected by fluorescence qPCR (Vazyme, Q711).

[0182] C5 primer for target gene:

[0183] Forward primer: CCAGCCCAATCAAGTTCCTAGAG (SEQ ID NO:9);

[0184] Reverse primer: CGGCGTGTAAACAGGTTTGTC (SEQ ID NO:10);

[0185] Target gene TTR primers:

[0186] Forward primer: CTGCTGTAGACGTGGCTGTAA (SEQ ID NO:11);

[0187] Reverse primer: CTTCCAGTACGATTTGGTGTCC (SEQ ID NO:12);

[0188] GAPDH primers for internal reference gene:

[0189] Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO:13);

[0190] Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO:14);

[0191] The results are expressed as the residual expression level of the siRNA-administered group compared to the solvent group (the solvent group was 100%). The conjugate sequences used for injection are shown in Table 3. The results are shown in Figures 2 and 3. Compared with the mixture of two single-target conjugates (SD004757+SD004383), the dual-target molecule SD004885 showed the best activity and was similar to the mixture.

[0192] Example 5: Activity of different designed dual-target molecules in mice

[0193] In this embodiment, siRNA was selected for conjugation synthesis, and its in vivo activity was evaluated in mice. The siRNA conjugate was obtained by the solid-phase synthesis method described in Example 2, and the specific sequence and modification information are shown in Table 4.

[0194] Table 4

[0195] Experimental methods:

[0196] SPF-grade female C57BL / 6J mice aged 6-8 weeks, weighing 20±2g, were selected. Before administration, the mice were weighed and observed. Animals with uniform weight and normal condition were randomly divided into groups of 4 mice each. The experimental group received the conjugate, while the solvent group received phosphate-buffered saline (PBS). The conjugate was administered subcutaneously at a dose of 1 mg / kg per mouse. Seven days after administration, the animals were euthanized, and liver tissue was harvested. The liver was dissected and placed in an RNA separator (Invitrogen, AM7021M) for subsequent RNA extraction. The liver tissue was ground in lysis buffer (Zhiang Biotechnology, MNTR / FX96) (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B). The expression levels of target genes TTR mRNA and C5 mRNA were detected by fluorescence qPCR (Vazyme, Q711).

[0197] C5 primer for target gene:

[0198] Forward primer: CCAGCCCAATCAAGTTCCTAGAG (SEQ ID NO:9);

[0199] Reverse primer: CGGCGTGTAAACAGGTTTGTC (SEQ ID NO:10);

[0200] Target gene TTR primers:

[0201] Forward primer: CTGCTGTAGACGTGGCTGTAA (SEQ ID NO:11);

[0202] Reverse primer: CTTCCAGTACGATTTGGTGTCC (SEQ ID NO:12);

[0203] GAPDH primers for internal reference gene:

[0204] Forward primer: TGCACCACCAACTGCTTAG (SEQ ID NO:13);

[0205] Reverse primer: GATGCAGGGATGATGTTC (SEQ ID NO:14);

[0206] The results are expressed as the residual expression level of the siRNA-administered group compared to the solvent group (the solvent group was 100%). The conjugate sequences used for injection are shown in Table 4. The results are shown in Figure 4. Compared with the mixture of two single-target conjugates (SD004757+SD004383), the activity of SD005429 in the dual-target molecule was the best and similar to that of the mixture.

[0207] Example 6: In vitro activity of dual-target molecules in Hep3B cells

[0208] In this embodiment, siRNA was selected for conjugation synthesis, and its in vitro activity was evaluated in Hep3B cells. The siRNA conjugate was obtained by the solid-phase synthesis method described in Example 2, and the specific sequence and modification information are shown in Table 5.

[0209] Table 5

[0210] In Hep3B cells, the in vitro activity of the siRNAs listed in Table 5 was tested using 11 concentrations (starting at 5 nM and serially diluted 3-fold).

[0211] Hep3B cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 hours before transfection, Hep3B cells were seeded into 96-well plates at a density of 20,000 cells per well with 100 μL of medium per well.

[0212] Referring to the product instruction manual, siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150). The final siRNA transfection concentrations were 5 nM, 1.67 nM, 0.56 nM, 0.19 nM, 0.062 nM, 0.021 nM, 0.0069 nM, 0.0023 nM, 0.00076 nM, 0.00025 nM, and 0.000085 nM. Twenty-four hours after transfection, RNA was isolated from cells using a tissue cell extraction kit (Zhiang Biotechnology, MNTR / FX96). Reverse transcription was performed using a reverse transcription kit (HiScript III All-in-one RT SuperMix Perfect for qPCR, R333-01), and quantitative real-time PCR was performed using a qPCR reaction kit (Yeasen, 11211ES08) to determine the mRNA levels of PCSK9 and APOC3. The mRNA levels of PCSK9 and APOC3 were corrected based on the level of the GAPDH internal reference gene.

[0213] Primers and probes for the target gene PCSK9:

[0214] Forward primer: ACGTGGCTGGCATTGCA (SEQ ID NO:15);

[0215] Reverse primer: AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO:16);

[0216] Probe: CATGATGCTGTCTGCCGAGCCG (SEQ ID NO:17);

[0217] APOC3 primers and probes for the target gene:

[0218] Forward primer: GGGTGACCGATGGCTTCA (SEQ ID NO:18);

[0219] Reverse primer: GTCCAAATCCCAGAACTCAGAGA (SEQ ID NO:19);

[0220] Probe: ACTACTGGAGCACCGTTA (SEQ ID NO:20);

[0221] GAPDH primers and probes for the internal reference gene:

[0222] Forward primer: TGCACCACCAACTGCTTAGC (SEQ ID NO:21);

[0223] Reverse primer: ACTGTGGTCATGAGTCCTTCCA (SEQ ID NO:22);

[0224] Probe: TCATCCATGACAACTTTGGTA (SEQ ID NO:23).

[0225] The results are expressed as the remaining percentage of PCSK9 and APOC3 mRNA expression (representing 100%) relative to cells not treated with siRNA. A lower remaining percentage indicates higher inhibitory activity of the siRNA. The results are shown in Figures 5 and 6, and Table 6. Based on the IC50 values, the dual-target molecule SD5518-G2760G3077 showed significantly better activity than the single-target mixture (SD004198+SD005693).

[0226] Table 6

[0227] Compared to existing small nucleic acid interference technologies, we offer a novel dual-target siRNA molecule design scheme. Experimental results demonstrate that this scheme can simultaneously inhibit the expression of multiple target genes within the same cell, with efficacy comparable to or even better than that of single-target siRNA molecules. The dual-target siRNA molecule of this application allows for simultaneous inhibition of multiple target gene expression with a single dose, resulting in better dosing compliance, more controllable compound synthesis quality, and greater ease of use.

[0228] The present invention has been described in detail above, with the aim of enabling those skilled in the art to understand and implement the invention. However, this description should not be construed as limiting the scope of protection of the invention. All equivalent changes or modifications made in accordance with the spirit and essence of the invention should be included within the scope of protection of the invention.

Claims

1. A multi-target double-stranded RNA conjugate, characterized in that: It includes a first double-stranded RNA, a second double-stranded RNA, and a linker connected to the first double-stranded RNA and the second double-stranded RNA, respectively, wherein the linker contains one or more groups as shown in general structural formula (I): Wherein, L is absent or selected from one or more linkage combinations of the groups shown in formulas (A1)-(A14): Wherein, R' is H, a C1-C10 alkyl group or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 20; j2 is an integer from 1 to 20; m is an integer between 0 and 6; Q is R2 and R3 are independently selected from H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl, respectively; X is R4 and R5 are independently selected from H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, and C2-C20 alkynyl, respectively, or R4 and R5 are directly linked to form a ring; p is an integer from 1 to 6. Z is N or CR9, wherein R9 is selected from H, C1-C20 alkyl or C3-C10 cycloalkyl; It is a C3-C8 cycloalkyl or C3-C8 heterocyclic group; R1 is selected from H, fluorine, hydroxyl, cyano, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl; Y is absent, or is fluorine, chlorine, hydroxyl, or a delivery molecule; This indicates the site where a group is covalently bonded.

2. The multi-target double-stranded RNA conjugate according to claim 1, characterized in that: L does not exist or is selected from one or more connection combinations of formulas A1, A2, A3, A5, A6, A7, A8, A10, A11, and A13; or, R' is hydrogen, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; j1 is an integer from 1 to 15; j2 is an integer from 1 to 15; or, m is an integer between 0 and 3; or, R2 and R3 are each independently selected from H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or... X is or, Z is CR9, where R9 is selected from H, C1-C10 alkyl, or C3-C8 cycloalkyl; or, It is a C3-C6 cycloalkyl or a C3-C8 nitrogen-containing heterocyclic group; or, R1 is selected from H, fluorine, hydroxyl, cyano, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or, Y is absent, or is a hydroxyl group, or is...

3. The multi-target double-stranded RNA conjugate according to claim 1 or 2, characterized in that: L does not exist or is selected from one or more connection combinations of formulas A1, A2, A3, A5, A6, and A7; or, R' is hydrogen, a C1-C5 alkyl group, or a C4-C6 cycloalkyl group; j1 is an integer from 3 to 15; j2 is an integer from 3 to 15; or, Y is 4. The multi-target double-stranded RNA conjugate according to claim 1 or 2, characterized in that: L does not exist or is selected from one or more connection combinations of formulas A1, A2, A5, and A7; furthermore, L does not exist or is selected from at least two connection combinations of formulas A1, A2, A5, and A7.

5. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 4, characterized in that: The group represented by the general structural formula (Ⅰ) can be selected from any of the structures shown below:

6. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 5, characterized in that: The linker consists of 1 to 6 structurally identical or different groups as shown in general formula (Ⅰ) linked by phosphate diester bonds or thiophosphate diester bonds.

7. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 6, characterized in that: The connector is the structure described in formula (II): Wherein, the definitions of L and Y are the same as in any one of claims 1 to 5, and the structures of the three Ls in formula (II) are the same or different; the structures of the three Ys in formula (II) are the same or different; M is either O or S; m is an integer from 0 to 6, and the three values ​​of m in equation (II) are the same or different; It is a four- to eight-membered nitrogen-containing saturated heterocycle, and the three in formula (II) The structures are the same or different; This indicates the site where a group is covalently bonded.

8. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 7, characterized in that: The multi-target double-stranded RNA conjugate is selected from any of the structures shown below: Where M is O or S, siRNA1 is the first double-stranded RNA, and siRNA2 is the second double-stranded RNA.

9. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 8, characterized in that: The linker is connected to the positive strand of the first double-stranded RNA and the positive strand of the second double-stranded RNA, respectively; the 3' end and / or 5' end of the positive strand of the second double-stranded RNA are connected with reverse debased deoxyribose residues.

10. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 9, characterized in that: The 3' end and / or 5' end of the positive strand of the first double-stranded RNA are connected with reverse debased deoxyribose residues.

11. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 10, characterized in that: The antisense strand of the first double-stranded RNA is separated from the antisense strand of the second double-stranded RNA, or they are linked by nucleotides or nucleotide derivatives, or by a linker; the definition of the linker may be the same as or different from that of the linker.

12. The multi-target double-stranded RNA conjugate according to any one of claims 1 to 11, characterized in that: The linker is connected to the 3' end of the positive strand of the first double-stranded RNA and the 5' end of the positive strand of the second double-stranded RNA, respectively; or, The first double-stranded RNA and the second double-stranded RNA target different genes or different mRNA sites of the same gene; or, Both the first double-stranded RNA and the second double-stranded RNA are siRNAs; or, The multi-target double-stranded RNA conjugate further includes a conjugating group covalently conjugated to the first double-stranded RNA and / or the second double-stranded RNA, wherein the conjugating group is a lipid or receptor ligand; preferably, the definition of the conjugating group is the same as that of the linker; or... Each nucleotide in the first double-stranded RNA and the second double-stranded RNA is independently a modified or unmodified nucleotide; or, The multi-target double-stranded RNA conjugate has liver-specific targeting; or The 5' end of the antisense strand of the first double-stranded RNA and / or the antisense strand of the second double-stranded RNA has a VP modification.

13. A multi-target double-stranded RNA conjugate, characterized in that: It includes a first double-stranded RNA, a second double-stranded RNA, a linker connected to the first double-stranded RNA and the second double-stranded RNA respectively, and a reverse debased deoxyribose residue connected to the 3' end and / or 5' end of the positive strand of the second double-stranded RNA.

14. The multi-target double-stranded RNA conjugate according to claim 13, characterized in that: The reverse debased deoxyribose residue is linked to the linker or the nucleotide of the second double-stranded RNA via a phosphodiester bond or a phosphothiodiester bond; or... The connector is the connector as described in any one of claims 1 to 8; or... The 3' end and / or 5' end of the positive strand of the first double-stranded RNA are connected to a reverse debased deoxyribose residue, which is connected to the linker or the nucleotide of the first double-stranded RNA via a phosphodiester bond or a phosphothiodiester bond.

15. A pharmaceutical composition, characterized in that: It includes the multi-target double-stranded RNA conjugate of any one of claims 1 to 14, and a pharmaceutically acceptable carrier or excipient.

Citation Information

Patent Citations

  • RNAi agents for inhibiting PNPLA3 expression, pharmaceutical compositions and methods of use thereof

    CN115397436A

  • Double-stranded RNA (Ribonucleic Acid) for regulating angiotensinogen gene expression, conjugate of double-stranded RNA, pharmaceutical composition and application of double-stranded RNA

    CN117568350A

  • Bis-rnai compounds for CNS delivery

    WO2023283403A2