Prophylactic or therapeutic agent for liver fibrosis, cirrhosis, and liver cancer, and intrasinusoidal pressure biomarker

Abstract

The present invention addresses the problem of providing technology that is for preventing or treating the progression of liver conditions leading to liver cancer and targets a phenomenon other than hepatocyte death. This problem is solved by a prophylactic or therapeutic agent that is for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer, contains at least one substance selected from the group consisting of CTGF inhibitors and integrin αV inhibitors, and is for patients suspected of having increased intrasinusoidal pressure.

Description

Preventive or therapeutic agent for liver fibrosis, liver cirrhosis, and liver cancer, and intrasinusoidal pressure biomarker

[0001] The present invention relates to a preventive or therapeutic agent for liver fibrosis, liver cirrhosis, and liver cancer, an intrasinusoidal pressure biomarker, and the like.

[0002] It is estimated that more than 300,000 people in Japan suffer from liver cirrhosis, with approximately 17,000 deaths annually. Liver cirrhosis is thought to develop when hepatic fibrosis progresses due to persistent hepatocyte death caused by chronic hepatitis, such as viruses or alcohol, leading to further liver fibrosis and liver cancer. For this reason, preventive and therapeutic strategies aimed at inhibiting hepatocyte death, the underlying cause of liver cirrhosis, have been reported. However, cases have been reported in which liver pathology progressed despite inhibition of hepatocyte death (Non-Patent Document 1).

[0003] J Gastroenterol. 2021 56(1):67-77.

[0004] An objective of the present invention is to provide a technology for preventing or treating the progression of liver pathologies that lead to liver cancer, by targeting a phenomenon different from hepatocyte death.

[0005] In view of the above-mentioned problems, the present inventors have conducted extensive research and have focused on intrasinusoidal pressure, finding that its increase promotes liver fibrosis and hepatocarcinogenesis. Based on this finding, further research has revealed that the above-mentioned problems can be solved by a preventive or therapeutic agent for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in subjects suspected of having increased intrasinusoidal pressure, which agent contains at least one selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor. Furthermore, 10 genes have been identified as intrasinusoidal pressure biomarkers. The present invention encompasses the following aspects.

[0006] Item 1. A preventive or therapeutic agent for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure, comprising at least one agent selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor.

[0007] Item 1A. A method for preventing or treating at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer, comprising administering at least one selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor to a subject suspected of having increased intrasinusoidal pressure.

[0008] Item 1B. At least one substance selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor for use in the prevention or treatment of at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure.

[0009] Item 1C. Use of at least one selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor for the manufacture of an agent for the prophylaxis or treatment of at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure.

[0010] Item 1D. Use of at least one agent selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor as a preventive or therapeutic agent for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure.

[0011] Item 2. The preventive or therapeutic agent according to Item 1, wherein the CTGF inhibitor is at least one selected from the group consisting of CTGF function inhibitors and CTGF expression inhibitors, and / or the integrin αV inhibitor is at least one selected from the group consisting of integrin αV function inhibitors and integrin αV expression inhibitors.

[0012] Item 3. The preventive or therapeutic agent according to Item 1 or 2, wherein the CTGF inhibitor is at least one selected from the group consisting of a low molecular weight compound, a polynucleotide targeting CTGF, an expression cassette for the polynucleotide, a peptide, a protein, and an antibody, and / or the integrin αV inhibitor is at least one selected from the group consisting of a low molecular weight compound, a polynucleotide targeting integrin αV, an expression cassette for the polynucleotide, a peptide, a protein, and an antibody.

[0013] Item 4. The preventive or therapeutic agent according to any one of Items 1 to 3, wherein the CTGF inhibitor is an inhibitor of CTGF in hepatic sinusoidal endothelial cells and / or the integrin αV inhibitor is an inhibitor of integrin αV in hepatic sinusoidal endothelial cells.

[0014] Item 5. The preventive or therapeutic agent according to any one of Items 1 to 4, which contains the CTGF inhibitor and the disease is liver cancer, or which contains the integrin αV inhibitor.

[0015] Item 6. The preventive or therapeutic agent according to any one of Items 1 to 5, wherein the subject has at least one disease selected from the group consisting of congestive liver damage, liver cirrhosis, Budd-Chiari syndrome, portal vein thrombosis, sinusoidal obstruction syndrome, and post-Fontan syndrome.

[0016] Item 7. (1) A method for examining at least one selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, comprising a step of detecting the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB in a biological sample collected from a subject.

[0017] Item 8. The method according to Item 7, further comprising: (2) determining the presence or absence of increased intrasinusoidal pressure in the subject and / or the presence or absence of at least one disease selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, based on the amount or concentration of the protein and / or the mRNA detected in step (1).

[0018] Item 9. The method according to Item 8, wherein the step (2) comprises: (2A) determining that the subject has increased intrasinusoidal pressure and / or is suffering from at least one condition selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, when the amount or concentration of the protein and / or the mRNA detected in the step (1) is equal to or greater than a cutoff value; and / or (2B) determining that the subject does not have increased intrasinusoidal pressure and / or is not suffering from at least one condition selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, when the amount or concentration of the protein and / or the mRNA detected in the step (1) is equal to or less than a cutoff value.

[0019] Item 10. The preventive or therapeutic agent according to any one of Items 1 to 6, wherein the subject is a subject who has been determined by the method according to Item 9 to have increased intrasinusoidal pressure and / or to be suffering from at least one condition selected from the group consisting of liver fibrosis, liver cirrhosis, and liver cancer.

[0020] Item 11. At least one diagnostic agent selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, comprising a binding molecule for the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB.

[0021] Item 11A. Use of a binding molecule against the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB in the manufacture of a diagnostic agent for at least one disease selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer.

[0022] Item 11B. Use of a binding molecule against the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB as a diagnostic agent for at least one disease selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer.

[0023] Item 12. The diagnostic agent according to Item 11, which is a companion diagnostic agent for the preventive or therapeutic agent according to any one of Items 1 to 6.

[0024] The present invention provides a technology for preventing or treating the progression of liver pathology leading to liver cancer, and a companion diagnostic technology for the same, which targets a phenomenon other than hepatocyte death. Specifically, the present invention provides a preventive or therapeutic agent for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure, a method for testing at least one disease selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, a diagnostic agent for at least one disease selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, a companion diagnostic agent for the preventive or therapeutic agent, and the like.

[0025]

[0033] Figure 1 shows an outline of the experimental results of Test Example 1-3.

[0034] Figure 1 shows immunostaining results (upper left) showing that CDH5, used as Cre, is expressed in LSECs, RT-qPCR results for CTGF (upper right), and a protocol (bottom) for Test Example 1-4.

[0035] Figure 1 shows stained images of liver tissue sections for Test Example 1-4.

[0036] Figure 1 shows serum ALT measurement results (top) and quantification of stained areas in liver tissue sections (bottom) for Test Example 1-4.

[0037] Figure 1 shows portal vein pressure measurement results (top) and RT-qPCR results for capillarization markers (bottom) for Test Example 1-4.

[0038] Figure 1 shows liver tumor formation rate measurement results for Test Example 1-4.

[0039] Figure 1 shows the protocol for Test Example 1-6.

[0039] Figure 1 shows Western blotting results (top) showing suppression of integrin signaling activity and YAP / TAZ activity, and fluorescent double immunostaining results (bottom) showing reduced CTGF expression in LSECs of the treatment group for Test Example 1-6-1.

[0039] Figure 1 shows stained images of liver tissue sections for Test Example 1-6-2. Quantitative results of stained areas of liver tissue sections (top row), measurement results of serum ALT levels, intrahepatic hydroxyproline levels, and portal vein pressure (middle row), and RT-qPCR results of fibrosis markers and capillarization markers (bottom row) are shown in Test 1-6-2. RT-qPCR results of 10 biomarkers are shown in Test 2-4. Correlation analysis results between the expression levels of 10 biomarkers and portal vein pressure are shown in Test 2-4. Serum ELISA results of 3 biomarkers are shown in Test Example 2-6. Calculation results of serum N-terminal CTGF levels are shown in Test Example 2-7. Single-cell analysis results are shown in Test Example 3-1-1. HE-stained and Sirius red-stained images of surgically resected specimens and Western blotting results are shown in Test Example 3-1-2. Single-cell analysis results are shown in Test Example 3-1-3. Results of single-cell-based spatial gene expression analysis are shown in Test Example 3-1-4. 1 shows HE staining images, mRNA mapping images, and mRNA expression levels of surgically resected specimens in Test Example 3-1-5. 1 shows Sirius red staining images, mRNA mapping images, and mRNA expression levels in Test Example 3-1-6. 1 shows the results of spatial gene expression analysis in Test Example 3-2-1.1 shows an mRNA mapping image and mRNA expression levels in Test Example 3-2-2. 1 shows an mRNA mapping image and mRNA expression levels in Test Example 3-2-3. 1 shows the results of serum ELISA for biomarkers in Test Example 4-1. 1 shows the correlation between serum EDN1 and FBLN2 values ​​and liver stiffness in FALD cases in Test Example 4-2.

[0026] In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0027] 1. Preventive or Therapeutic Agent In one aspect, the present invention relates to an agent for preventing or treating at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure (sometimes referred to herein as the "agent of the present invention"), which comprises at least one agent selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor. This will be described below.

[0028] 1-1. Active Ingredients 1-1-1. Target of Inhibition The CTGF gene encodes connective tissue growth factor. The integrin αV gene encodes integrin αV. The CTGF (CTGF protein, CTGF mRNA) to be inhibited is an expression product of the CTGF gene, and is the CTGF protein or CTGF mRNA expressed by an organism or its cells (particularly, hepatic sinusoidal endothelial cells) to which the agent of the present invention is applied. Similarly, the integrin αV (integrin αV protein, integrin αV mRNA) to be inhibited is an expression product of the integrin αV gene, and is the integrin αV protein or integrin αV mRNA expressed by an organism or its cells (particularly, hepatic sinusoidal endothelial cells) to which the agent of the present invention is applied. Therefore, the CTGF protein / mRNA and integrin αV protein / mRNA to be inhibited can be changed as necessary depending on the target organism species. The biological species is not particularly limited, and examples thereof include animals, such as various mammals, including humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer.

[0029] The amino acid and nucleotide sequences of CTGF protein / mRNA and integrin αV protein / mRNA derived from various biological species are known. Specifically, for example, the human CTGF gene is identified by NCBI gene ID 1490. Examples of the amino acid sequence of the human CTGF protein include the amino acid sequence shown in SEQ ID NO: 1, and examples of the nucleotide sequence of the human CTGF mRNA include the nucleotide sequence shown in SEQ ID NO: 2. For example, the human integrin αV gene is identified by NCBI gene ID 3685. Examples of the amino acid sequence of the human integrin αV protein include the amino acid sequence shown in SEQ ID NO: 3, and examples of the nucleotide sequence of the human integrin αV mRNA include the nucleotide sequence shown in SEQ ID NO: 4. Furthermore, the amino acid and nucleotide sequences of various biological species can be obtained or estimated from the above information. CTGF protein / mRNA and integrin αV protein / mRNA may also include the above-mentioned splicing variants.

[0030] The CTGF protein to be inhibited may have amino acid mutations such as substitutions, deletions, additions, and insertions, as long as it retains its inherent properties, i.e., the ability to proliferate and differentiate into chondrocytes. The CTGF mRNA to be inhibited may also have base mutations such as substitutions, deletions, additions, and insertions, as long as the protein translated from the mRNA retains its inherent properties, i.e., the ability to proliferate and differentiate into chondrocytes.

[0031] The integrin αV protein to be inhibited may have amino acid mutations such as substitutions, deletions, additions, and insertions, so long as it retains its original properties, i.e., the ability to form a membrane protein (integrin) through heterodimerization with the integrin β chain and the ability to bind to a ligand. The integrin αV mRNA to be inhibited may also have base mutations such as substitutions, deletions, additions, and insertions, so long as the protein translated from the mRNA retains its original properties, i.e., the ability to form a membrane protein (integrin) through heterodimerization with the integrin β chain and the ability to bind to a ligand.

[0032] The amino acid sequence mutation is preferably a substitution, more preferably a conservative substitution, from the viewpoint of less loss of activity. The nucleotide sequence mutation is preferably a mutation that does not result in an amino acid substitution in the protein translated from the mRNA, or a mutation that results in a conservative amino acid substitution.

[0033] Preferred examples of CTGF proteins to be inhibited include proteins that have an amino acid sequence that is 85 to 100% identical to the amino acid sequence of wild-type CTGF protein (e.g., SEQ ID NO: 1) and that have the ability to promote chondrocyte proliferation and differentiation.

[0034] A preferred example of the CTGF mRNA to be inhibited is a base sequence that has 85 to 100% identity to the base sequence of wild-type CTGF mRNA (e.g., SEQ ID NO: 2) and encodes a protein that has the ability to proliferate and differentiate chondrocytes.

[0035] A preferred example of the integrin αV protein to be inhibited is a protein consisting of an amino acid sequence that is 85 to 100% identical to the amino acid sequence of a wild-type integrin αV protein (e.g., SEQ ID NO: 3), and that has the ability to form a membrane protein (integrin) by heterodimerizing with an integrin β chain and to bind to a ligand.

[0036] A preferred example of the integrin αV mRNA to be inhibited is a nucleotide sequence that has 85 to 100% identity to the nucleotide sequence of wild-type integrin αV mRNA (e.g., SEQ ID NO: 4) and encodes a protein that has the ability to form a membrane protein (integrin) by heterodimerizing with the integrin β chain and the ability to bind to a ligand.

[0037] The identity is more preferably 90% or more, even more preferably 95% or more, and even more preferably 98% or more.

[0038] As used herein, the term "identity" of an amino acid sequence refers to the degree of correspondence between two or more comparable amino acid sequences. Therefore, the greater the correspondence between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity between amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF, "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc Natl Acad Sci USA. 87:2264-2268 (1990); Karlin S, Altschul SF, "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTX, based on the BLAST algorithm, has been developed. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of nucleotide sequences is also defined in the same manner as above.

[0039] As used herein, the term "conservative substitution" refers to the substitution of an amino acid residue with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine constitutes a conservative substitution. Other examples of conservative substitutions include substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine.

[0040] 1-1-2. Inhibitors CTGF / integrin αV inhibitors are not particularly limited, as long as they are components that can inhibit the function and / or expression of CTGF / integrin αV. CTGF / integrin αV inhibitors preferably include low-molecular-weight compounds, polynucleotides that target CTGF / integrin αV, expression cassettes for such polynucleotides, peptides, proteins, antibodies, and the like. CTGF / integrin αV inhibitors can be used alone or in combination of two or more types.

[0041] In a preferred embodiment of the present invention, the CTGF inhibitor is an inhibitor of CTGF in the liver (particularly hepatic sinusoidal endothelial cells) (e.g., a CTGF inhibitor targeted to the liver (particularly hepatic sinusoidal endothelial cells), a liver (particularly hepatic sinusoidal endothelial cell)-specific CTGF inhibitor), and / or the integrin αV inhibitor is an inhibitor of integrin αV in the liver (particularly hepatic sinusoidal endothelial cells) (e.g., an integrin αV inhibitor targeted to the liver (particularly hepatic sinusoidal endothelial cells), a liver (particularly hepatic sinusoidal endothelial cell)-specific integrin αV inhibitor).

[0042] 1-1-2-1. Function Inhibitors There are no particular limitations on the CTGF / integrin αV function inhibitors, so long as they are capable of inhibiting the function of CTGF / integrin αV protein expressed by the organism or its cells (particularly sinusoidal endothelial cells) to which the agent of the present invention is applied. CTGF / integrin αV function inhibitors can be used alone or in combination of two or more.

[0043] CTGF function inhibitors are not particularly limited as long as they can inhibit the binding of CTGF to its receptor (integrins, including integrin αV) and its functional expression. Examples include substances that bind to the receptor-binding domain of CTGF or other domains required for functional expression (e.g., domains that interact with other proteins). Examples of such domains include the IGFBP domain located on the N-terminus of CTGF and the CT domain located on the C-terminus. The IGFBP domain is generally known to contribute to the progression of fibrosis, and the CT domain is known to interact with integrins. Integrin αV function inhibitors are not particularly limited as long as they can inhibit the binding of integrins, including integrin αV, to their ligands. Examples of such function inhibitors include low-molecular-weight compounds (e.g., molecular weights of 1000 or less, 800 or less, 700 or less, or 600 or less; e.g., molecular weights of 100 or more, 150 or more, or 200 or more), antibodies, etc.

[0044] The binding region can be determined based on known information and / or can be predicted based on known information (for example, by building a docking model).

[0045] The inhibitory ability can be measured and evaluated, for example, according to the "In vitro integrin functional assays" previously reported (Nat. Med. 19(12), 1-12 (2013)).

[0046] Various CTGF / integrin αV function inhibitors are commercially available, and many have been reported in various literature. Examples of integrin αV function inhibitors include CWHM12, and inhibitors currently undergoing clinical research include IDL-2965, PLN-74809, PLN-1474, JSM-6427, and AXT-107. In addition to these, known inhibitors (e.g., inhibitors described in known literature (Nature Reviews Drug Discovery volume 21, pages 60-78 (2022))) can be used without limitation. In one embodiment, the integrin αV function inhibitor is an RGD peptide analog.

[0047] The antibodies include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, and portions of the above antibodies that have antigen-binding activity, such as Fab fragments and fragments produced by an Fab expression library. Antibodies of the present invention also include antibodies that have antigen-binding activity to a polypeptide consisting of at least 8, preferably 15, and more preferably 20 consecutive amino acids from the amino acid sequence of CTGF / integrin αV.

[0048] In addition to the above, other CTGF / integrin αV function inhibitors can also be used, as long as they have binding affinity (preferably specific binding affinity) to CTGF / integrin αV (e.g., peptides, proteins, artificial antibodies, aptamers, etc.). When a protein or peptide such as an antibody is used as the CTGF / integrin αV function inhibitor, its expression cassette can also be used instead.

[0049] 1-1-2-2. Expression Inhibitors CTGF / integrin αV expression inhibitors are not particularly limited, as long as they are capable of suppressing the expression levels of CTGF / integrin αV protein and / or CTGF / integrin αV mRNA expressed by an organism or its cells (particularly sinusoidal endothelial cells) to which the agent of the present invention is applied. CTGF / integrin αV expression inhibitors can be used alone or in combination of two or more.

[0050] Examples of CTGF / integrin αV expression inhibitors include CTGF / integrin αV-specific small interfering RNA (siRNA), CTGF / integrin αV-specific microRNA (miRNA), CTGF / integrin αV-specific antisense nucleic acids, and expression cassettes thereof; CTGF / integrin αV-specific ribozymes; and CTGF / integrin αV gene editing agents using the CRISPR / Cas system.

[0051] In addition, suppression of expression means suppressing the expression levels of CTGF / integrin αV protein, CTGF / integrin αV mRNA, etc. to, for example, 1 / 2, 1 / 3, 1 / 5, 1 / 10, 1 / 20, 1 / 30, 1 / 50, 1 / 100, 1 / 200, 1 / 300, 1 / 500, 1 / 1000, or 1 / 10,000 or less, and also includes reducing these expression levels to zero.

[0052] 1-1-2-2-1. siRNA, miRNA, Antisense Nucleic Acids CTGF / integrin αV-specific siRNA is not particularly limited as long as it is a double-stranded RNA molecule that specifically suppresses the expression of the gene encoding CTGF / integrin αV. In one embodiment, the siRNA is preferably, for example, 18 or more bases, 19 or more bases, 20 or more bases, or 21 or more bases in length. Furthermore, the siRNA is preferably, for example, 25 or less bases, 24 or less bases, 23 or less bases, or 22 or less bases in length. It is contemplated that the upper and lower limits of the siRNA length described herein may be arbitrarily combined.

[0053] The structure of the siRNA is not particularly limited. The siRNA may be a small hairpin RNA (shRNA). The siRNA may have additional bases at the 5' or 3' end. The siRNA may have a protruding sequence (overhang) at the 3' end, specifically, for example, dTdT (dT represents deoxythymidine) added thereto.

[0054] siRNA and / or shRNA sequences can be searched for using search software provided free of charge on various websites, including, for example, the siRNA Target Finder provided by Ambion (http: / / www.ambion.com / jp / techlib / misc / siRNA_finder.html), the insert design tool for pSilencer® Expression Vector (http: / / www.ambion.com / jp / techlib / misc / psilencer_converter.html), and GeneSeer provided by RNAi Codex (http: / / codex.cshl.edu / scripts / newsearchhairpin.cgi).

[0055] Any CTGF / integrin αV-specific miRNA may be used as long as it inhibits the translation of the gene encoding CTGF / integrin αV. For example, miRNAs may inhibit translation by pairing with the 3' untranslated region (UTR) of a target mRNA, rather than cleaving it like siRNAs. The miRNA may be a pri-miRNA (primary miRNA), a pre-miRNA (precursor miRNA), or a mature miRNA. The length of the miRNA is not particularly limited; the length of a pri-miRNA is typically several hundred to several thousand bases, the length of a pre-miRNA is typically 50 to 80 bases, and the length of a mature miRNA is typically 18 to 30 bases. In one embodiment, the CTGF / integrin αV-specific miRNA is preferably a pre-miRNA or a mature miRNA, and more preferably a mature miRNA. Such CTGF / integrin αV-specific miRNAs may be synthesized by known techniques or purchased from a company that provides synthetic RNAs.

[0056] CTGF / integrin αV-specific antisense nucleic acids are nucleic acids containing a base sequence complementary or substantially complementary to the base sequence of the mRNA of a gene encoding CTGF / integrin αV, or a portion thereof, and function to inhibit CTGF / integrin αV protein synthesis by binding to the mRNA to form a specific and stable duplex. Antisense nucleic acids may be DNA, RNA, or DNA / RNA chimeras. When the antisense nucleic acid is DNA, the RNA:DNA hybrid formed by the target RNA and the antisense DNA is recognized by endogenous ribonuclease H (RNase H), causing selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only a sequence in the mRNA but also a sequence in an intron region in the initial translation product of the CTGF / integrin αV gene. Intron sequences can be determined by comparing the genomic sequence with the cDNA base sequence of the CTGF / integrin αV gene using homology search programs such as BLAST and FASTA. The length of the target region of a CTGF / integrin αV-specific antisense nucleic acid is not limited, as long as hybridization of the antisense nucleic acid results in inhibition of translation into CTGF / integrin αV protein. The CTGF / integrin αV-specific antisense nucleic acid may be the entire sequence or a partial sequence of the mRNA encoding CTGF / integrin αV. Considering ease of synthesis, antigenicity, and intracellular internalization, oligonucleotides consisting of approximately 10 to approximately 40 bases, particularly approximately 15 to approximately 30 bases, are preferred, but are not limited to these. More specifically, preferred target regions of the CTGF / integrin αV gene include, but are not limited to, the 5'-end hairpin loop, 5'-end untranslated region, translation initiation codon, protein-coding region, ORF translation termination codon, 3'-end untranslated region, 3'-end palindrome region, and 3'-end hairpin loop.

[0057] As used herein, "complementary" refers not only to binding based on a perfect complementary relationship (A and T, and G and C), but also to binding based on a complementary relationship sufficient to allow hybridization under stringent conditions. Stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe binds, as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego, CA). For example, typical post-hybridization washing conditions include 1×SSC, 0.1% SDS, and 37°C. It is preferable that the hybridized state is maintained even after washing under such conditions. Although not particularly limited, examples of more stringent hybridization conditions include approximately "0.5xSSC, 0.1% SDS, 42°C," and examples of even more stringent hybridization conditions include washing conditions of approximately "0.1xSSC, 0.1% SDS, 65°C."

[0058] CTGF / integrin αV-specific siRNA, CTGF / integrin αV-specific miRNA, and CTGF / integrin αV-specific antisense nucleic acids can be prepared by determining the target sequence of mRNA or an initial transcription product based on the cDNA or genomic DNA sequence of the CTGF / integrin αV gene and synthesizing a complementary sequence using a commercially available automated DNA / RNA synthesizer. Antisense nucleic acids containing various modifications can also be chemically synthesized by known techniques.

[0059] The expression cassette for CTGF / integrin αV-specific siRNA, CTGF / integrin αV-specific miRNA, or CTGF / integrin αV-specific antisense nucleic acid is not particularly limited, so long as it is a polynucleotide in which CTGF / integrin αV-specific siRNA, CTGF / integrin αV-specific miRNA, or CTGF / integrin αV-specific antisense nucleic acid has been incorporated in an expressible state. Typically, the expression cassette comprises a polynucleotide comprising a promoter sequence and a coding sequence for the CTGF / integrin αV-specific siRNA, CTGF / integrin αV-specific miRNA, or CTGF / integrin αV-specific antisense nucleic acid (and, if necessary, a transcription termination signal sequence), as well as other sequences as necessary.

[0060] As used herein, the terms "nucleic acid" and "polynucleotide" are not particularly limited and encompass both natural and artificial nucleic acids. Specifically, in addition to DNA, RNA, and the like, known chemical modifications may be used, as exemplified below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue, such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. Furthermore, the hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example, by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc. Also usable are BNA (LNA), in which the conformation of the sugar moiety of the nucleotide is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety.

[0061] 1-1-2-2-2. Gene Editing Agents The CTGF / integrin αV gene editing agent is not particularly limited, as long as it is capable of suppressing expression of the CTGF / integrin αV gene using a target sequence-specific nuclease system (e.g., a CRISPR / Cas system). CTGF / integrin αV gene expression can be suppressed, for example, by disrupting the CTGF / integrin αV gene or by modifying the CTGF / integrin αV gene promoter to suppress promoter activity.

[0062] When the CRISPR / Cas system is employed, for example, a typical example of a CTGF / integrin αV gene editing agent is, but is not limited to, a vector comprising a guide RNA expression cassette targeting the CTGF / integrin αV gene or its promoter and a Cas protein expression cassette (CTGF / integrin αV gene editing vector). In addition to this typical example, a combination of a vector comprising a guide RNA and / or its expression cassette targeting the CTGF / integrin αV gene or its promoter, and a vector comprising a Cas protein and / or its expression cassette can also be used as a CTGF / integrin αV gene editing agent.

[0063] There are no particular limitations on the guide RNA as long as it is used in the CRISPR / Cas system. For example, various guide RNAs can be used that can bind to a target site in genomic DNA (e.g., the CTGF / integrin αV gene, its promoter, etc.) and guide the Cas protein to the target site in genomic DNA by binding to the Cas protein.

[0064] As used herein, the term "target site" refers to a site on genomic DNA that consists of a DNA strand (target strand) and its complementary DNA strand (non-target strand), which consists of a PAM (Proto-spacer Adjacent Motif) sequence and a sequence adjacent to the 5' side of the PAM sequence that is approximately 17 to 30 bases long (preferably 18 to 25 bases long, more preferably 19 to 22 bases long, and particularly preferably 20 bases long).

[0065] The guide RNA has a sequence involved in binding to a target site in genomic DNA (sometimes referred to as a crRNA (CRISPR RNA) sequence), and this crRNA sequence binds complementary (preferably complementary and specific) to a sequence excluding the PAM sequence complementary sequence of the non-target strand, thereby enabling the guide RNA to bind to the target site in genomic DNA. Furthermore, the guide RNA has a sequence involved in binding to a Cas protein (sometimes referred to as a tracrRNA (trans-activating crRNA) sequence), and this tracrRNA sequence binds to the Cas protein, thereby guiding the Cas protein to the target site in genomic DNA.

[0066] The tracrRNA sequence is not particularly limited. The tracrRNA sequence is typically an RNA sequence of approximately 50 to 100 bases long that can form multiple (usually three) stem-loops, and the sequence varies depending on the type of Cas protein used. Various known sequences can be used as the tracrRNA sequence depending on the type of Cas protein used.

[0067] The guide RNA typically contains the above-mentioned crRNA sequence and tracrRNA sequence. The guide RNA may be a single-stranded RNA (sgRNA) containing the crRNA sequence and the tracrRNA sequence, or an RNA complex formed by complementary binding of an RNA containing the crRNA sequence and an RNA containing the tracrRNA sequence.

[0068] The Cas protein is not particularly limited as long as it is used in the CRISPR / Cas system, and various proteins can be used, for example, proteins that can bind to a target site in genomic DNA in a complex with a guide RNA and cleave the target site. Cas proteins derived from various organisms are known, including the Cas9 protein, and more preferably the Cas9 protein endogenously contained in bacteria belonging to the genus Streptococcus. Information on the amino acid sequences of various Cas proteins and their coding sequences can be easily obtained from various databases such as NCBI.

[0069] CTGF / integrin αV gene editing agents can be easily produced using known genetic engineering techniques, such as PCR, restriction enzyme digestion, DNA ligation, in vitro transcription / translation, and recombinant protein production techniques.

[0070] 1-2. Uses At least one selected from the group consisting of CTGF inhibitors and integrin αV inhibitors can be used as an active ingredient in an agent for preventing or treating at least one disease selected from the group consisting of liver fibrosis, liver cirrhosis, and liver cancer in subjects suspected of having increased intrasinusoidal pressure.

[0071] The agent of the present invention is used to administer to a subject suspected of having increased intrasinusoidal pressure (preferably a subject with increased intrasinusoidal pressure). A "subject suspected of having increased intrasinusoidal pressure" refers to, for example, a subject with a disease / disorder / syndrome that causes or has the potential to cause increased intrasinusoidal pressure. More specifically, the "subject may be a subject with at least one condition selected from the group consisting of congestive liver damage, liver cirrhosis, Budd-Chiari syndrome, portal vein thrombosis, sinusoidal obstruction syndrome, and Fontan postoperative syndrome. Furthermore, a "subject suspected of having increased intrasinusoidal pressure" may be a subject determined to have increased intrasinusoidal pressure and / or to be suffering from at least one condition selected from the group consisting of liver fibrosis, liver cirrhosis, and liver cancer by the testing method of the present invention described below.

[0072] In one embodiment, the agent of the present invention can also exert a preventive or therapeutic effect on liver fibrosis, cirrhosis, and liver cancer that are caused independently of hepatocyte death (i.e., liver cell death is not the cause of the disease, and in one embodiment, does not involve hepatocyte death). Therefore, in one embodiment, the target diseases of the agent of the present invention are liver fibrosis, cirrhosis, and liver cancer that are caused independently of hepatocyte death.

[0073] As used herein, "treatment" includes concepts such as cure, remission, alleviation, mitigation, and suppression of progression of symptoms. Furthermore, "prevention" includes concepts such as not only preventing the onset of a disease but also delaying the onset of the disease and suppressing symptoms once the disease has occurred.

[0074] The content of the active ingredient in the agent of the present invention can be appropriately determined taking into consideration the type of target disease, the desired therapeutic effect, the administration method, the treatment period, the age and body weight of the patient, etc. For example, the content of the active ingredient in the agent of the present invention can be about 0.0001 to 100 parts by weight, assuming that the total amount of the agent of the present invention is 100 parts by weight.

[0075] The administration form of the agent of the present invention is not particularly limited as long as the desired effect is obtained, and it can be administered to mammals, including humans, by either oral administration or parenteral administration (e.g., intravenous injection, intramuscular injection, subcutaneous administration, rectal administration, transdermal administration, or topical administration). Parenteral administration is preferred. Dosage forms for oral and parenteral administration and their preparation methods are well known to those skilled in the art, and can be prepared according to conventional methods by mixing the active ingredient with a pharmaceutically acceptable carrier, etc.

[0076] Dosage forms for parenteral administration include injectable preparations (e.g., drip infusions, intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (e.g., ointments, poultices, lotions, creams, and gels), suppositories, inhalants, eye preparations, eye ointments, nasal drops, ear drops, liposomes, and LNP (Lipid Nano Particle) preparations. For example, injectable preparations are prepared by dissolving the active ingredient in distilled water for injection, and solubilizers, buffers, pH adjusters, isotonicity agents, soothing agents, preservatives, stabilizers, and the like can be added as needed. The agent of the present invention can also be prepared as a lyophilized preparation for immediate use.

[0077] The agent of the present invention may further contain other drugs that are effective in treating or preventing diseases.

[0078] The agent of the present invention can contain any carrier or additive, for example, a pharmaceutically acceptable carrier or additive.

[0079] Pharmaceutically acceptable carriers and additives include, but are not limited to, excipients such as sucrose and starch; binders such as cellulose and methylcellulose; disintegrants such as starch and carboxymethylcellulose; lubricants such as magnesium stearate and aerosil; flavorings such as citric acid and menthol; preservatives such as sodium benzoate and sodium bisulfite; stabilizers such as citric acid and sodium citrate; suspending agents such as methylcellulose and polyvinylpyrrolide; dispersing agents such as surfactants; diluents such as water and physiological saline; base waxes, etc.

[0080] The dosage of the agent of the present invention can be determined based on various factors, such as the route of administration, the type of disease, the severity of symptoms, the patient's age, sex, and body weight, the severity of the disease, pharmacological findings such as pharmacokinetic and toxicological characteristics, whether a drug delivery system is used, and whether the agent is administered as part of a combination of other drugs. The dosage of the agent of the present invention can be, for example, approximately 1 μg / kg (body weight) to 10 g / kg (body weight) per day. The administration schedule of the agent of the present invention can also be determined taking into account factors similar to those for the dosage. For example, the above daily dosage can be administered 1 to 5 times per day to 1 month.

[0081] 2. Method for Examining At Least One Kind of Pathogen Selected from the Group Consisting of Intrasinusoidal Pressure, Liver Fibrosis, Cirrhosis, and Liver Cancer In one aspect, the present invention relates to (1) a method for examining at least one Pathogen selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer (also referred to herein as the "examination method of the present invention"), which comprises the step of detecting the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB in a biological sample collected from a subject (also referred to herein as the "target molecule of the present invention"). This method is described below.

[0082] 2-1. Step (1) The subject may be any mammal, but in one embodiment, it is a mammal suspected of having increased intrasinusoidal pressure (see 1-2 above). Examples of mammals include rodents such as mice, rats, hamsters, and guinea pigs, laboratory animals such as rabbits, pets such as dogs and cats, livestock such as cows, pigs, goats, horses, and sheep, primates such as monkeys, orangutans, and chimpanzees, and humans, with humans being particularly preferred.

[0083] The biological sample is not particularly limited as long as it can contain the target molecule of the present invention. Examples of biological samples include body fluids such as whole blood, serum, plasma, follicular fluid, menstrual blood, saliva, cerebrospinal fluid, synovial fluid, urine, interstitial fluid, sweat, tears, and saliva, as well as samples derived from these body fluids. Biological samples can also be biological tissues, preferably liver tissues (particularly preferably sinusoidal endothelial cells), or samples derived from these tissues. Samples derived from body fluids / tissues are not particularly limited as long as they are samples prepared from body fluids / tissues, and examples include samples obtained by concentrating or purifying proteins or nucleic acids contained in the body fluids / tissues. Preferred examples of body fluids include whole blood, serum, and plasma. Biological samples may be used alone or in combination of two or more types.

[0084] Biological samples can be collected from subjects by methods known to those skilled in the art. For example, whole blood can be collected by drawing blood using a syringe or the like. It is desirable that blood be collected by a medical professional such as a doctor or nurse. Serum is a portion of blood from which blood cells and specific blood coagulation factors have been removed, and can be obtained, for example, as the supernatant after blood clotting. Plasma is a portion of blood from which blood cells have been removed, and can be obtained, for example, as the supernatant after centrifugation under conditions that do not cause blood clotting.

[0085] The CTGF gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 1490. CTGF genes of other species can be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known CTGF genes. The amino acid sequence / nucleotide sequence of CTGF can be easily identified based on known information and / or based on identity analyses with the known amino acid sequence / nucleotide sequence of CTGF. An example of the amino acid sequence of human CTGF is the amino acid sequence shown in SEQ ID NO: 1, and an example of the nucleotide sequence of human CTGF mRNA is the nucleotide sequence shown in SEQ ID NO: 2.

[0086] The ESM1 gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 71690. ESM1 genes of other organisms can also be easily identified in accordance with known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known ESM1 genes. The amino acid sequence / nucleotide sequence of ESM1 can also be easily identified in accordance with known information and / or based on identity analyses with the amino acid sequence / nucleotide sequence of known ESM1. An example of the amino acid sequence of human ESM1 is the amino acid sequence shown in SEQ ID NO: 5, and an example of the nucleotide sequence of human ESM1 mRNA is the nucleotide sequence shown in SEQ ID NO: 6.

[0087] The ANGPT2 gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 285. ANGPT2 genes of other organisms can also be easily identified based on known information and / or based on identity analysis with the amino acid sequence / nucleotide sequence of a known ANGPT2 gene. The amino acid sequence / nucleotide sequence of ANGPT2 can also be easily identified based on known information and / or based on identity analysis with the known amino acid sequence / nucleotide sequence of ANGPT2. An example of the amino acid sequence of human ANGPT2 is the amino acid sequence shown in SEQ ID NO:7, and an example of the nucleotide sequence of human ANGPT2 mRNA is the nucleotide sequence shown in SEQ ID NO:8.

[0088] The PLAU gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 5328. PLAU genes of other organisms can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known PLAU genes. The amino acid sequence / nucleotide sequence of PLAU can also be easily identified based on known information and / or based on identity analyses with the amino acid sequence / nucleotide sequence of known PLAU. An example of the amino acid sequence of human PLAU is the amino acid sequence shown in SEQ ID NO: 9, and an example of the nucleotide sequence of human PLAU mRNA is the nucleotide sequence shown in SEQ ID NO: 10.

[0089] The EDN1 gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 1906. EDN1 genes of other organisms can also be easily identified based on known information and / or based on identity analysis with the amino acid sequence / nucleotide sequence of a known EDN1 gene. The amino acid sequence / nucleotide sequence of EDN1 can also be easily identified based on known information and / or based on identity analysis with the known EDN1 amino acid sequence / nucleotide sequence. An example of the amino acid sequence of human EDN1 is the amino acid sequence shown in SEQ ID NO: 11, and an example of the nucleotide sequence of human EDN1 mRNA is the nucleotide sequence shown in SEQ ID NO: 12.

[0090] The PDGFB gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 5155. PDGFB genes of other species can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known PDGFB genes. The amino acid sequence / nucleotide sequence of PDGFB can be easily identified based on known information and / or based on identity analyses with the known amino acid sequence / nucleotide sequence of PDGFB. An example of the amino acid sequence of human PDGFB is the amino acid sequence shown in SEQ ID NO: 13, and an example of the nucleotide sequence of human PDGFB mRNA is the nucleotide sequence shown in SEQ ID NO: 14.

[0091] The ADM gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 133. ADM genes of other species can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known ADM genes. The amino acid sequence / nucleotide sequence of ADM can also be easily identified based on known information and / or based on identity analyses with the known ADM amino acid sequence / nucleotide sequence. An example of the amino acid sequence of human ADM is the amino acid sequence shown in SEQ ID NO: 15, and an example of the nucleotide sequence of human ADM mRNA is the nucleotide sequence shown in SEQ ID NO: 16.

[0092] The CXCL9 gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 4283. CXCL9 genes of other organisms can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known CXCL9 genes. The amino acid sequence / nucleotide sequence of CXCL9 can also be easily identified based on known information and / or based on identity analyses with the known CXCL9 amino acid sequence / nucleotide sequence. An example of the amino acid sequence of human CXCL9 is the amino acid sequence shown in SEQ ID NO: 17, and an example of the nucleotide sequence of human CXCL9 mRNA is the nucleotide sequence shown in SEQ ID NO: 18.

[0093] The FBLN2 gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 2199. FBLN2 genes of other organisms can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known FBLN2 genes. The amino acid sequence / nucleotide sequence of FBLN2 can also be easily identified based on known information and / or based on identity analyses with the known FBLN2 amino acid sequence / nucleotide sequence. An example of the amino acid sequence of human FBLN2 is the amino acid sequence shown in SEQ ID NO: 19, and an example of the nucleotide sequence of human FBLN2 mRNA is the nucleotide sequence shown in SEQ ID NO: 20.

[0094] The INHBB gene is known, and in the case of humans, it is, for example, the gene designated NCBI Gene ID 3625. INHBB genes of other species can also be easily identified based on known information and / or based on identity analyses with the amino acid sequences / nucleotide sequences of known INHBB genes. The amino acid sequence / nucleotide sequence of INHBB can also be easily identified based on known information and / or based on identity analyses with the known amino acid sequence / nucleotide sequence of INHBB. An example of the amino acid sequence of human INHBB is the amino acid sequence shown in SEQ ID NO: 21, and an example of the nucleotide sequence of human INHBB mRNA is the nucleotide sequence shown in SEQ ID NO: 22.

[0095] Among the above genes, in one embodiment of the present invention, CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, and ADM are preferred from the viewpoint of test accuracy. In another embodiment of the present invention, from the same viewpoint, CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, and CXCL9 are preferred.

[0096] Among the above genes, in one embodiment of the present invention, CTGF, ANGPT2, EDN1, and PDGFB are preferred, from the viewpoint that they are particularly suitable for analysis using blood samples (whole blood, serum, and plasma). In another embodiment of the present invention, from the same viewpoint, CTGF, ESM1, ANGPT2, PLAU, CXCL9, EDN1, and FBLN2 are preferred, and CTGF, ESM1, ANGPT2, PLAU, and CXCL9 are more preferred.

[0097] CTGF is composed of four domains, Module 1 to Module 4, from the N-terminus. In addition to the full-length CTGF, there is also an N-terminal region (Module 1-2) and a C-terminal region (Module 3-4). The C-terminal region is susceptible to degradation, and it is believed that the full-length and N-terminal regions are mainly present in blood. Therefore, when detecting CTGF protein in blood samples, it is preferable to detect a fragment of the N-terminal region of CTGF. In this case, to distinguish it from full-length CTGF, it is preferable to use the signal value obtained by subtracting the signal value obtained by detecting the C-terminal region of CTGF (which detects full-length) from the signal value obtained by detecting the N-terminal region of CTGF (which detects both full-length and N-terminal fragment) as the detection signal value of the N-terminal region fragment.

[0098] The target molecules of the present invention that are the detection targets in step (1) also include isoforms and those containing mutations that occur between individuals.

[0099] When detecting a target molecule of the present invention that is a protein, the method for detecting the target molecule of the present invention (preferably a method for measuring the amount or concentration of the target molecule of the present invention) is not particularly limited, as long as it is a method that can detect the target molecule of the present invention. Examples of such methods include immunoassays. Immunoassays can be widely used, regardless of whether they are direct, indirect, homogeneous, heterogeneous, competitive, or non-competitive. More specific examples of immunoassays include ELISA (e.g., direct, indirect, sandwich, or competitive), radioimmunoassay (RIA), immunoradiometric assay (IRMA), enzyme immunoassay (EIA), sandwich EIA, immunochromatography, Western blot, immunoprecipitation, slot or dot blot assay, immunohistochemical staining, fluorescent immunoassay, immunoassay using an avidin-biotin or streptavidin-biotin system, and immunoassay using surface plasmon resonance (SPR). Specifically, the target molecule of the present invention can be detected by immunoassay, for example, by contacting a labeled antibody directly or indirectly with a molecule binding to the target molecule of the present invention that has bound to the target molecule of the present invention, and quantifying the signal derived from the label of the bound labeled antibody. The labeled antibody used in this case and the antibody that mediates between the labeled antibody and the molecule binding to the target molecule of the present invention or the target molecule of the present invention are not particularly limited, and examples that can be used include antibodies against antibody constant regions and anti-idiotype antibodies.

[0100] When detecting a protein target molecule of the present invention, binding molecules to the target molecule of the present invention include, for example, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, or molecules containing portions of the above antibodies that have antigen-binding ability, such as Fab fragments and fragments produced by an Fab expression library. Binding molecules to the target molecule of the present invention that have antigen-binding ability to a polypeptide consisting of at least 8 consecutive amino acids, preferably 15 amino acids, and more preferably 20 amino acids, from the amino acid sequence of the target molecule of the present invention are also included in the binding molecules to the target molecule of the present invention.

[0101] The type of label used in the label (e.g., labeled antibody) for detecting the target molecule of the present invention, which is a protein, is not particularly limited. Examples of labels include fluorescent substances, luminescent substances, dyes, enzymes, gold colloids, and radioisotopes. Among these, enzyme labels such as peroxidase and alkaline phosphatase are preferred from the viewpoints of safety, economy, detection sensitivity, and the like.

[0102] When detecting a target molecule of the present invention that is mRNA, the method for detecting the target molecule of the present invention (preferably a method for measuring the amount or concentration of the target molecule of the present invention) is not particularly limited, as long as it is capable of detecting the target molecule of the present invention. Examples of such methods include RNA-Seq, Northern blotting, RNase protection assay, reverse transcription polymerase chain reaction (RT-PCR) (Weis JH et al., Trends in Genetics 1992;8:263-264), and quantitative real-time RT-PCR (Held CA et al., Genome Research 1996;6:986-994). In one embodiment, the above methods can use molecules (e.g., primers, probes, etc.) that bind to the target molecule of the present invention. The primer pair and probe contain sequences that can complementarily bind to the nucleotide sequence of the target molecule mRNA of the present invention or its complementary sequence, and can be synthesized based on known base sequences. The base lengths of the primers and probes are not particularly limited. The primers can each be 10 to 50 nucleotides in length, preferably 15 to 30. The probes can range in length from 10 nucleotides to the full length of the nucleotide sequence complementary to the nucleotide sequence of the mRNA of the molecule of interest of the present invention, preferably 20 to 150 nucleotides.

[0103] The primer pair and probe may be made of natural nucleic acids such as RNA and DNA, or may be made of a combination of natural nucleic acids with chemically modified nucleic acids or pseudo nucleic acids, if necessary. Examples of chemically modified nucleic acids and pseudo nucleic acids include PNA (Peptide Nucleic Acid), LNA (Locked Nucleic Acid; registered trademark), methylphosphonate DNA, phosphorothioate DNA, and 2'-O-methyl RNA. Furthermore, the primer and probe may contain a fluorescent substance and / or a quencher substance, or a radioisotope (e.g., 32 P, 33 P, 35 Labeling or modification may be performed using a labeling substance such as Fluorescent Protein I (FITC), Texas Amino Acids (TFA), or a modifying substance such as biotin, (streptavidin), or magnetic beads. The labeling substance is not limited, and commercially available substances can be used. For example, fluorescent substances such as FITC, Texas Amino Acids (TFA), Cy3, Cy5, Cy7, Cyanine 3, Cyanine 5, Cyanine 7, FAM, HEX, VIC, fluorescamine and its derivatives, and rhodamine and its derivatives can be used. Quencher substances such as AMRA, DABCYL, BHQ-1, BHQ-2, or BHQ-3 can be used. The labeling position of the labeling substance in the primer and probe can be determined appropriately depending on the properties of the modifying substance and the intended use. Generally, modification is performed at the 5' or 3' end. Furthermore, a single primer and probe molecule may be labeled with one or more types of labeling substances. The design of the nucleotide sequences of primers and probes and the selection of labeling substances are well known and are disclosed in molecular biology experimental protocol books such as Molecular Cloning: A Laboratory Manual by Sambrook, J and Russell, DW (3rd ed., Cold Spring Harbor Laboratory Press, 2001).

[0104] The detection method may be adopted singly or in combination of two or more.

[0105] According to the testing method of the present invention including step (1), it is possible to provide the amount and / or concentration of the target molecule of the present invention, which is an indicator of at least one test selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, thereby assisting in testing intrasinusoidal pressure, etc.

[0106] 2-2. Step (2) In one embodiment, the testing method of the present invention preferably further comprises the step of: (2) determining the presence or absence of increased intrasinusoidal pressure in the subject and / or the presence or absence of at least one disease selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, based on the amount or concentration of the protein and / or the mRNA detected in step (1).

[0107] More specifically, step (2) can include: (2A) determining that the subject has increased intrasinusoidal pressure and / or is suffering from at least one disease selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer when the amount or concentration of the protein and / or mRNA detected in step (1) is equal to or greater than a cutoff value; and / or (2B) determining that the subject does not have increased intrasinusoidal pressure and / or is not suffering from at least one disease selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer when the amount or concentration of the protein and / or mRNA detected in step (1) is equal to or less than a cutoff value.

[0108] The cutoff value is set in advance based on, for example, statistical analysis or ROC analysis of data on the amount or concentration of each target molecule of the present invention in subjects with increased intrasinusoidal pressure and subjects without increased intrasinusoidal pressure, by preparing a database tracking the amount or concentration of each target molecule of the present invention and the presence or absence of at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer for the evaluation population. Alternatively, the cutoff value can be set each time. When the cutoff value is determined by statistical analysis, for example, the median, arithmetic mean, or other average value of the data on the amount or concentration of the target molecule of the present invention in the evaluation population can be used. When the cutoff value is determined by ROC analysis, for example, the cutoff value based on ROC analysis can be the amount or concentration of the target molecule of the present invention at the point on the ROC curve where the distance between the point on the vertical axis (sensitivity or true positive) of the ROC curve graph where it is 1.0 and the point on the horizontal axis (1 - specificity) where it is 0.0 is the smallest, or it can be a cutoff value derived from the Youden index of the ROC curve (Cancer 1950;3:32-35.). Once established, the database of the evaluation population may be used to set the cutoff value in the method of the present invention for evaluating the presence or absence of increased intrasinusoidal pressure in a subject without any changes. Alternatively, new subjects, including the subject of the present invention, may be incorporated into the evaluation population, and the database of the evaluation population for intrasinusoidal pressure may be updated as appropriate and used to set the cutoff value in the method of the present invention for evaluating the presence or absence of increased intrasinusoidal pressure in a subject. The cutoff value can be, for example, a percentile value of the amount or concentration value of the target molecule of the present invention in a biological sample in a reference subject group, for example, any of the 10th to 90th percentile values, any of the 30th to 70th percentile values, or any of the 40th to 60th percentile values.

[0109] A subject determined to have increased intrasinusoidal pressure in step (2) can be determined to be a target for administration of the agent of the present invention. That is, the testing method of the present invention can be used as a companion diagnosis for the agent of the present invention.

[0110] 3. At least one diagnostic agent selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer In one aspect, the present invention relates to at least one diagnostic agent (the diagnostic agent of the present invention) selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, which comprises a molecule capable of binding to a target molecule of the present invention. This will be described below.

[0111] The diagnostic agent of the present invention is a drug for examining at least one selected from the group consisting of intrasinusoidal pressure, liver fibrosis, liver cirrhosis, and liver cancer (specifically, for examining the presence or absence of increased intrasinusoidal pressure and / or the presence or absence of at least one disease selected from the group consisting of liver fibrosis, liver cirrhosis, and liver cancer). The diagnostic agent of the present invention can be used in the testing method of the present invention. Furthermore, the diagnostic agent of the present invention can be used as a companion diagnostic agent for the agent of the present invention.

[0112] The test agent of the present invention may be in the form of a composition containing a molecule capable of binding to a target molecule of the present invention. The composition may contain other components as necessary. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0113] The test agent of the present invention may be in the form of a kit containing a molecule capable of binding to a target molecule of the present invention. The kit may also contain instruments, reagents, and the like that can be used to carry out the test method of the present invention.

[0114] The binding molecule for the target molecule of the present invention can be immobilized on any solid phase, and therefore the test agent of the present invention can be provided in the form of a substrate on which the binding molecule for the target molecule of the present invention is immobilized (for example, a microarray chip on which a probe is immobilized, or another example, an ELISA plate on which an antibody is immobilized).

[0115] The solid phase used for immobilization is not particularly limited as long as it can immobilize antibodies, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. There are no particular limitations on the immobilization of the detection agent to the solid phase.

[0116] Examples of the apparatus include test tubes, microtiter plates, agarose particles, latex particles, purification columns, epoxy-coated slide glasses, and gold colloid-coated slide glasses.

[0117] Examples of the reagent include labeled antibodies and standard samples (positive control, negative control).

[0118] As the labeled antibody, various commercially available antibodies can be used depending on the type (for example, isotype) of the molecule that binds to the target molecule of the present invention.

[0119] The target molecule of the present invention can be used as a standard sample. The target molecule of the present invention can be obtained, for example, by culturing cells into which an expression vector for the target molecule of the present invention has been introduced and purifying the target molecule from the cells or the culture supernatant.

[0120] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0121] Test Example 1. Development of preventive / therapeutic drugs 1 Test Example 1-1. Creation of a mouse model of increased intrasinusoidal pressure <Test 1-1-1> Wild-type male C57BL / 6J mice (CLEA Japan) aged 8-10 weeks underwent partial inferior vena cava ligation (pIVCL) according to a previous report (Simonetto DA, et al. Hepatology 2015). Under triple anesthesia, the IVC between the diaphragm and liver was partially ligated using a 0.6 mm spacer to induce hepatic congestion. All steps except for the partial IVC ligation were performed in a sham surgery.

[0122] HE staining images and serum ALT levels (measured using a Hitachi 7180 automated analyzer at Oriental Yeast Co., Ltd.) were obtained 6 weeks after pIVCL and sham surgery. HE staining revealed hemorrhagic necrosis around the central vein and dilated sinusoids in the pIVCL group, but no elevation of serum ALT or signs of liver inflammation were observed. Portal vein pressure was measured directly using a 1.2 Fr microcatheter (Transonic, FTH-1211B-0018) inserted into the superior mesenteric vein and analyzed using the dedicated software LabScribe4 software chart 5.5.6 (Transonic, ADInstruments). Portal vein pressure measurements at 2 and 6 weeks after surgery revealed elevated portal vein pressure early after surgery. The resulting mouse model allows for analysis of the effects of elevated intrasinusoidal pressure without the influence of hepatocyte death.

[0123] <Study 1-1-2> Sirius red staining (PSI, Picrosirius Red Stain Kit) and intrahepatic hydroxyproline levels were measured 2, 6, and 12 weeks after pIVCL and sham surgery. Results indicated that liver fibrosis progressed over time after pIVCL. Regarding intrahepatic hydroxyproline levels, hydroxyproline was extracted and quantified from 10 mg of liver tissue using a Hydroxyproline Assay Kit (CBO, STA-675). At 48 weeks after pIVCL, tumor formation was observed in half of the mice (5 / 10), with a predominance in the peripheral hepatic area. These results demonstrate that increased intrasinusoidal pressure contributes to the progression of liver pathology independently of hepatocyte death.

[0124] Experimental Example 1-2. Analysis of a Mouse Model of Increased Intrasinusoidal Hypertension (pIVCL) <Experiment 1-2-1> Single-cell analysis was performed on pIVCL and nonparenchymal hepatocytes 2 weeks after sham surgery. Pronase E (Sigma-Aldrich, 107433) and collagenase (Sigma-Aldrich, C5138) were perfused through the portal vein to prepare a cell suspension. Hepatocytes were removed by low-speed centrifugation (50 g). Dead cells and red blood cells were removed by density gradient centrifugation using Percoll PLUS (Cytiva, GE17-5445-02). Whole transcriptome analysis (BD Rhapsody) was performed. Primary quality control was performed using the Seven Bridge pipeline using FASTQ files obtained by next-generation sequencing and a mouse genome annotation file (GRCm39). Secondary quality control was then performed using the single-cell analysis software SeqGeq (BD Rhapsody) by excluding cells with counts <2000, gene counts <500, and mitochondrial gene ratios >20%. After normalization and batch effect correction, the resulting cells were integrated and clustered using Seurat. The results were displayed as a UMAP. Cell populations in each cluster were identified by extracting marker genes. Regarding endothelial cell clusters, clusters of portal and central venous endothelial cells and zone-specific hepatic sinusoidal endothelial cells (LSECs) were identified by analyzing characteristic gene expression patterns in each region.

[0125] Next, we performed gene expression analysis focusing on Zone 3 LSECs, the region where fibrosis first occurs in pIVCL model mice. The top 10 secreted proteins that were significantly elevated in Zone 3 LSEC clusters in the pIVCL group, in descending order of fold change, were Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm. In particular, Ctgf, with a fold change of approximately 12, was significantly elevated compared to the other nine secreted proteins, which had fold changes of 2-3.

[0126] <Test 1-2-2> Gene expression analysis was performed focusing on LSECs in Zone 3, where fibrosis first occurs in pIVCL model mice. 373 genes were significantly elevated in the pIVCL group, with the gene with the highest expression increase being connective tissue growth factor (CTGF). CTGF expression was more elevated in Zone 3 compared to Zone 1, and the only cell population other than LSECs where elevated expression was observed was hepatic stellate cells.

[0127] Furthermore, we identified many target genes of YAP / TAZ, which play a central role in mechanostress responses. Using Enrichr (https: / / maayanlab.cloud / Enrichr / ), we performed pathway analysis using Panther Pathway with these 373 genes and found a significant increase in integrin signaling.

[0128] Based on these results, we hypothesized that mechanical stimulation of the sinusoids due to hepatic congestion causes excessive production of CTGF from LSECs, which contributes to the progression of liver pathology.

[0129] <Study 1-2-3> mRNA was extracted from liver tissue 2 days, 2 weeks, 6 weeks, and 12 weeks after pIVCL and sham surgery, and RT-qPCR was used to measure CTGF expression early after surgery. mRNA was extracted from LSECs isolated 2 days after pIVCL and sham surgery, and RT-qPCR revealed increased CTGF expression. Cells were isolated by perfusion of pronase (Sigma-Aldrich, 107433) and collagenase (Sigma-Aldrich, C5138) through the portal vein. Hepatocytes were removed by low-speed centrifugation (50 g). Non-parenchymal hepatic cells were then removed by density gradient centrifugation using Percoll PLUS (Cytiva, GE17-5445-02) to remove dead cells and red blood cells. LSECs were then positively selected by MACS using CD146 microbeads (Miltenyi, 132-092-007). The primers used (Applied Bio System) were Actb (Mm00607939_s1) and Ctgf (Mm01192933_g1).

[0130] The correlation between CTGF gene expression and portal vein pressure was examined in a total of 24 samples: sham2w: n=4, pIVCL2w: n=6, sham6w: n=6, pIVCL6w: n=8. Portal vein pressure was measured directly using a 1.2 Fr microcatheter (Transonic, FTH-1211B-0018) inserted into the superior mesenteric vein and analyzed using the dedicated software LabScribe4 software chart 5.5.6 (ADInstruments). Intrahepatic CTGF mRNA level was strongly correlated with portal vein pressure (P<0.0001, R 2 = 0.6869).

[0131] Western blotting of liver tissue samples extracted from pIVCL and sham-operated mice 2 days, 2 weeks, 6 weeks, and 12 weeks after surgery demonstrated elevated expression of α-SMA and CTGF in the pIVCL group. Immunostaining for α-SMA and CTGF revealed positive cells primarily in Zone 3. Primary antibodies used were α-SMA (Abcam, ab5694), CTGF (Santa Cruz, sc-14939), and b-Actin (CST, #4967).

[0132] The above results showed that increased CTGF expression in LSECs and activation of hepatic stellate cells were observed early in the course of liver congestion.

[0133] <Study 1-2-4> mRNA was extracted from LSECs isolated 2 weeks after pIVCL and sham surgery, and RT-qPCR showed increased expression of YAP / TAZ target genes in the pIVCL group. Cells were isolated by perfusion of pronase (Sigma-Aldrich, 107433) and collagenase (Sigma-Aldrich, C5138) through the portal vein. Hepatocytes were removed by low-speed centrifugation (50 g). Density gradient centrifugation using Percoll PLUS (Cytiva, GE17-5445-02) removed dead cells and red blood cells to prepare a cell suspension of non-parenchymal liver cells. LSECs were then positively selected by MACS using CD146 microbeads (Miltenyi, 132-092-007). The primers used (Applied Bio System) were Actb (Mm00607939_s1), Tgfb1 (Mm01178820_m1), Ctgf (Mm01192933_g1), Cyr61 (Mm00487498_m1), Edn1 (Mm00438656_m1), and Myc (Mm00487804_m1).

[0134] Western blotting of proteins extracted from LSECs isolated from pIVCL and 2 weeks after sham surgery demonstrated YAP / TAZ activation in the pIVCL group. Primary antibodies used were phospho-YAP (Abcam, ab76252), YAP (Abcam, ab205270), TAZ (CST, #72804), CTGF (Santa Cruz, sc-14939), and b-Actin (CST, #4967). YAP and phospho-YAP were quantified using the image analysis software Fusion, and the YAP / phospho-YAP ratio was calculated.

[0135] Immunostaining of YAP and TAZ in pIVCL and 2 weeks after sham surgery showed that YAP / TAZ staining was predominantly in the nuclei of LSECs in the pIVCL group. Primary antibodies used were YAP (Abcam, ab205270) and TAZ (CST, #72804).

[0136] These results demonstrate that YAP / TAZ is persistently activated in LSECs after pIVCL.

[0137] <Test 1-2-5> 1mm of liver tissue was measured 6 weeks after pIVCL and sham surgery. 3 The specimens were cut into sections, fixed in 2.5% glutaraldehyde, and prepared for electron microscopy. Transmission electron microscopy revealed the appearance of a basement membrane along the sinusoidal wall 6 weeks after pIVCL.

[0138] RT-qPCR analysis of mRNA extracted from liver tissue samples 6 weeks after pIVCL and sham surgery showed an increase in capillarization markers. RT-qPCR analysis of mRNA extracted from LSECs isolated 2 weeks after pIVCL and sham surgery showed an increase in basement membrane-related markers. The primers used (Applied Bio System) were Actb (Mm00607939_s1), Pecam1 (Mm01242584_m1), Cd34 (Mm00519283_m1), Vwf (Mm00550376_m1), Plvap (Mm00453379_m1), Col4a1 (Mm01210125_m1), Lamc1 (Mm00711820_m1), Fn1 (Mm01256744_m1), Nid1 (Mm00477827_m1), and Hspg2 (Mm01181173_g1).

[0139] Test Example 1-3. Analysis of in vitro / ex vivo models <Test 1-3-1> LSECs were isolated from wild-type mice to examine their mechanostress response. For isolation, pronase (Sigma-Aldrich, 107433) and collagenase (Sigma-Aldrich, C5138) were perfused through the portal vein to prepare a cell suspension. Hepatocytes were then removed by low-speed centrifugation (50 g), and LSECs were positively selected by MACS using CD146 microbeads (Miltenyi, 132-092-007). Mouse LSECs used in subsequent in vitro experiments were isolated in a similar manner.

[0140] LSECs isolated from wild-type mice were cultured on 4cm collagen-coated plates. 2 Cells were plated overnight on a silicon chamber (STREX, STB-CH-04) and allowed to stand for 6 hours without serum. After 4 hours of growth stimulation (120%, 0.5 Hz) using a growth stimulation device (STREX, STB-150), mRNA was extracted and RT-qPCR was performed, demonstrating increased expression of CTGF. Primers (Applied Bio Systems) for Actb (Mm00607939_s1) and Ctgf (Mm01192933_g1) were used.

[0141] The human immortalized hepatic endothelial cell line TMNK-1 was also cultured under stretch, and mRNA and protein extraction were performed in the same manner. TMNK-1 showed that stretch stimulation increased CTGF expression, accompanied by YAP activation. Primers (Applied Bio Systems) for Actb (Hs01060665_g1) and Ctgf (Hs00170014_m1) were used. Primary antibodies used were phospho-YAP (abcam, ab76252), YAP (abcam, ab205270), CTGF (Santa Cruz, sc-14939), and b-Actin (CST, #4967).

[0142] <Test 1-3-2> siRNA was used to inhibit YAP (Ambion, Silencer) in the human immortalized hepatic endothelial cell line TMNK-1. TM Select, s20367), TAZ(Ambion, Silencer TM After silencing either YAP or TAZ genes, 48 ​​hours after siRNA addition, mRNA was extracted and RT-qPCR was performed. The results showed that siRNA suppressed YAP and TAZ expression and reduced CTGF expression. Furthermore, the YAP inhibitor Verteporfin (R&D SYSTEMS, #5305) was added at 1, 2, or 5 μg / mL. 48 hours later, mRNA was extracted and RT-qPCR showed reduced CTGF expression.

[0143] TMNK-1 was inhibited by siRNA, and 48 hours after siRNA addition, collagen-coated 4cm 2 The cells were plated overnight on a silicon chamber (STREX, STB-CH-04) and left serum-free for 6 hours. After that, a growth stimulus (120%, 0.5 Hz) was applied for 4 hours. mRNA was extracted and CTGF expression was analyzed by RT-qPCR. 2 TMNK-1 cells were plated overnight on a silicon chamber and allowed to stand for 4 hours without serum. Verteporfin was then added at 2 μg / mL. After 2 hours, stretching (120%, 0.5 Hz) was applied for 4 hours. mRNA was extracted and CTGF expression was analyzed by RT-qPCR. These results demonstrate that stretching upregulates CTGF expression in TMNK-1 cells in a YAP / TAZ-dependent manner. Primers (Applied Bio Systems) for Actb (Hs01060665_g1), Yap (Hs00902712_g1), Taz (Wwtr1; Hs00210007_m1), and Ctgf (Hs00170014_m1) were used.

[0144] <Test 1-3-3> LSECs isolated from wild-type mice were plated onto collagen-coated wells overnight, left serum-free for 6 hours, and then subjected to hydrostatic pressure stimulation (101 / 135 kPa, 0.01 Hz) for 8 hours using a hydrostatic pressure loading device. mRNA was extracted and RT-qPCR was performed, which showed an increase in YAP / TAZ target genes and basement membrane-related markers. Primers (Applied Bio Systems) used were Actb (Mm00607939_s1), Tgfb1 (Mm01178820_m1), Ctgf (Mm01192933_g1), Cyr61 (Mm00487498_m1), Edn1 (Mm00438656_m1), Myc (Mm00487804_m1), Plvap (Mm00453379_m1), Col4a1 (Mm01210125_m1), Lamc1 (Mm00711820_m1), Fn1 (Mm01256744_m1), Nid1 (Mm00477827_m1), and Hspg2 (Mm01181173_g1).

[0145] <Test 1-3-4> Human immortalized hepatic endothelial cell line TMNK-1 was plated onto collagen-coated wells overnight, left serum-free for 6 hours, and then subjected to hydrostatic pressure (101 / 135 kPa, 0.01 Hz) for 8 hours. mRNA was extracted and RT-qPCR showed an increase in YAP / TAZ target genes. Primers (Applied Bio Systems) were used: Actb (Hs01060665_g1), Tgfb1 (Hs00998133_m1), Ctgf (Hs00170014_m1), Cyr61 (Hs00155479_m1), Edn1 (Hs00174961_m1), and Myc (Hs00153408_m1).

[0146] The CTGF levels in the supernatant after the above culture were measured by ELISA (FUJIFILM, 290-84701), and the results showed that hydrostatic pressure stimulation also enhanced CTGF secretion by TMNK-1.

[0147] <Test 1-3-5> The human immortalized hepatic endothelial cell line TMNK-1 was treated with hydrostatic pressure (HPS) in the presence of CWHM-12 (MCE, HY-18644), a pan-integrin αV inhibitor. TMNK-1 cells were plated onto collagen-coated wells overnight and allowed to stand serum-free for 4 hours. CWHM-12 was then added at 1 μM. After 2 hours, HPS (101 / 135 kPa, 0.01 Hz) was added for 4 hours, and protein was extracted. Western blotting showed that CWHM-12 inhibited YAP / TAZ activity. The primary antibodies used were phospho-YAP (abcam, ab76252), YAP (abcam, ab205270), TAZ (CST, #72804), CTGF (Santa Cruz, sc-14939), and b-Actin (CST, #4967).

[0148] As described above, CWHM-12 was added at 1 μM, or the YAP inhibitor Verteporfin (R&D SYSTEMS, #5305) was added at 2 μg / mL, and HPS (101 / 135 kPa, 0.01 Hz) was applied for 8 hours to extract mRNA. TMNK-1 was also induced by siRNA to inhibit YAP (Ambion, Silencer). TM Select, s20367) and TAZ (Ambion, Silencer TM After silencing TMNK-1 cells with siRNA (S24787), the cells were plated onto collagen-coated wells overnight, incubated serum-free for 6 hours, and then subjected to HPS (101 / 135 kPa, 0.01 Hz) for 8 hours. mRNA was extracted. RT-qPCR demonstrated that HPS-induced upregulation of CTGF expression in TMNK-1 cells was significantly suppressed by CWHM-12, Verteporfin, and siYAP / TAZ. Primers (Applied Bio Systems) for Actb (Hs01060665_g1) and Ctgf (Hs00170014_m1) were used.

[0149] <Test 1-3-6> A gRNA sequence was designed (forward sequence: CACCGCACCGTACCACCGAAGATGC (SEQ ID NO: 23), reverse sequence: AAACGCATCTTCGGTGGTACGGTGC (SEQ ID NO: 24)), and TMNK-1 CTGF knockout cells (TMNK-1 CTGF KO) were generated using the CRISPR-Cas9 system. Plasmids expressing gRNA and Cas9 were created using LentiCRISPRv2 and transformed into the E. coli strain Stbl3. Virus particles were produced using HEK293 cells, which were then allowed to act on TMNK-1 and subjected to Puromycin selection. Single clones were obtained by limiting dilution.

[0150] CTGF knockout was confirmed by Western blotting (Santa Cruz, sc-14939) and ELISA (FUJIFILM, 290-84701). The effects of human recombinant (rh) CTGF (FUJIFILM, 036-19471) on these CTGF knockout cells were examined with or without the addition of CWHM-12 (MCE, HY-18644), a pan-Integrin α V inhibitor. TMNK-1 CTGF KO cells were plated overnight on collagen-coated wells and incubated for 4 hours in a serum-free environment. Then, CWHM-12 was added at 1 μM. After 2 hours, rhCTGF was added at 1 μg / mL. Protein was extracted 6 hours later. Western blotting demonstrated that rhCTGF-induced YAP / TAZ activation in CTGF knockout cells was suppressed in the presence of CWHM-12. The primary antibodies used were phospho-YAP (abcam, ab76252), YAP (abcam, ab205270), TAZ (CST, #72804), CTGF (Santa Cruz, sc-14939), and b-Actin (CST, #4967).

[0151] Human hepatic stellate cells (SCR, #5300) were plated overnight on collagen-coated wells and allowed to stand for 18 hours without serum. After 1 μg / mL rhCTGF was added, mRNA was extracted six hours later, and RT-qPCR demonstrated increased Col1a1 expression with rhCTGF. Primers (Applied Bio Systems) for Actb (Hs01060665_g1) and Ctgf (Hs00170014_m1) were used. Furthermore, a WST assay 48 hours after rhCTGF addition demonstrated increased cell viability.

[0152] <Test 1-3-7> Tamoxifen-induced endothelial cell-specific YAP / TAZ-deficient mice (iCdh5-Cre; YAP / TAZ fl / fl ) and iCdh5-Cre; YAP / TAZ fl / fl and YAP / TAZ fl / fl At 6 weeks of age, tamoxifen (Sigma, T5648-5G) was administered intraperitoneally at 0.1 mg / g / day for 5 days. LSECs were isolated at 9 weeks of age and subjected to hydrostatic pressure (HPS). Isolated LSECs were plated overnight, serum-free for 6 hours, and then subjected to HPS (101 / 135 kPa, 0.01 Hz) for 8 hours. mRNA was extracted and analyzed by RT-qPCR for CTGF and COL4A1 expression. HPS-induced upregulation of Ctgf and Col4a1 in LSECs was shown to be YAP / TAZ-dependent. Primers (Applied Bio Systems) for Actb (Mm00607939_s1), Ctgf (Mm01192933_g1), and Col4a1 (Mm01210125_m1) were used.

[0153] Summary of Experiments 1-3 Figure 1 shows an overview of the experimental results of Experiments 1-3. Pressure stimulation activates YAP / TAZ in LSECs via integrin αV, increasing the expression of CTGF and type IV collagen. CTGF promotes activation in hepatic stellate cells and also activates YAP / TAZ in LSECs via integrin αV. This, combined with the positive feedback of integrin αV-YAP / TAZ-CTGF, suggests that this leads to sustained activation of YAP / TAZ.

[0154] Test Example 1-4. Analysis of CTGF knockout mice Tamoxifen-induced endothelial cell-specific CTGF-deficient mice (iCdh5-Cre; CTGF fl / fl ) and iCdh5-Cre; CTGF fl / fl (CTGF iΔEC ) and CTGF fl / fl Mice aged 6-7 weeks were intraperitoneally administered tamoxifen (Sigma, T5648-5G) at 0.1 mg / g / day for 5 days, and then underwent pIVCL / sham at 9-10 weeks of age and were analyzed 6 weeks later. iΔEC and CTGF fl / fl We isolated mRNA from LSECs at 9–10 weeks of age and confirmed the knockout of CTGF in LSECs by RT-qPCR (Figure 2). Primers (Applied Bio Systems) for Actb (Mm00607939_s1) and Ctgf (Mm01192933_g1) were used.

[0155] Furthermore, immunohistochemistry (RSD, AF1002) confirmed that CDH5, used as Cre, was expressed in LSECs (Figure 2).

[0156] CTGF iΔEC and CTGF fl / flThe images of HE staining, Sirius red staining, α-SMA staining, and type IV collagen staining of liver tissue sections from the pIVCL group and sham group (a total of four groups) are shown (Figure 3). The image analysis software HALO was used to quantify the areas positive for Sirius red staining (PSI, Picrosirius Red Stain Kit), α-SMA staining (Abcam, ab5694), and type IV collagen staining (Abcam, ab6586). The results showed that knockout of CTGF in endothelial cells improved liver fibrosis caused by pIVCL (Figure 4).

[0157] CTGF iΔEC and CTGF fl / fl Portal vein pressure was measured 2 days and 6 weeks after surgery in four groups: the pIVCL group and the sham group. Measurements were taken directly through the superior mesenteric vein using a 1.2 Fr microcatheter (Transonic, FTH-1211B-0018) and analyzed using LabScribe4 software chart 5.5.6 (ADInstruments) (Figure 5, top). mRNA was extracted from liver tissue samples 6 weeks after surgery, and capillarization markers were analyzed by RT-qPCR (Figure 5, bottom). Primers (Applied Bio Systems) for Actb (Mm00607939_s1), Pecam1 (Mm01242584_m1), Plvap (Mm00453379_m1), and Ctgf (Mm01192933_g1) were used. We found that endothelial cell-specific CTGF deficiency attenuated portal hypertension caused by pIVCL and reduced the expression of capillarization markers.

[0158] CTGF iΔEC and CTGF fl / fl The incidence of liver tumor formation was evaluated 48 weeks after pIVCL. fl / fl ), 6 / 15 (40%), and knockout mice (CTGF iΔEC ) liver tumor formation was significantly suppressed in 0 / 16 mice (0%) and in knockout mice (Figure 6).

[0159] Test Example 1-5. Analysis of clinical specimens <Test 1-5-1> HE-stained and Sirius red-stained images were obtained from surgically resected specimens from a normal liver (donor of a living donor liver transplant), chronic hepatitis (chronic hepatitis C, after viral elimination), and two cases of Fontan-associated liver disease (FALD). In FALD, perisinusoidal fibrosis (fibrosis of the sinusoidal wall) was prominent in areas of congestion and sinusoidal dilation.

[0160] <Test 1-5-2> Immunostaining of CTGF (Santa Cruz, sc-14939), Integrin αV (Abcam, ab179475), and YAP (Abcam, ab205270) was performed in the case of Test 1-5-1. In FALD, CTGF and Integrin αV were stained along the sinusoidal walls (+ cholangiocytes) in areas of congestion and sinusoidal dilation, while YAP was stained mainly in the nuclei of LSECs (+ hepatic stellate cells, cholangiocytes).

[0161] <Study 1-5-3> Single-cell fixed RNA profiling (10x Genomic) was performed using surgically frozen specimens from two normal livers and three FALD cases. Primary quality control was performed using Cell Ranger using the FASTQ files and human genome annotation file (GRCh38) obtained by next-generation sequencing. Secondary quality control was performed using the single-cell analysis software SeqGeq (BD Rhapsody) by excluding cells with counts <2000, gene counts <500, and mitochondrial gene ratios >20%. The resulting cells were normalized, corrected for batch effects, and then integrated for clustering using Seurat. The results were displayed as a UMAP. Marker gene extraction was used to identify cell populations within each cluster. Gene expression analysis of endothelial cell clusters, including LSECs, revealed significantly elevated CTGF expression in the FALD group (fold change: 3.34, q-value <0.0001).

[0162] Test Example 1-6 Analysis of the effect of an integrin αV inhibitor The protocol for Test Example 1-6 is shown in FIG.

[0163] <Test 1-6-1> Proteins were extracted from liver tissue samples from the control (DMSO) and treatment (CWHM-12) groups 6 weeks after pIVCL. Western blotting demonstrated the suppression of integrin signaling activity and YAP / TAZ activity in liver tissue from the treatment group (Figure 8, top). The primary antibodies used were FAK (CST, #3285), phospho-FAK (CST, #3283), phospho-YAP (Abcam, ab76252), YAP (Abcam, ab205270), TAZ (CST, #72804), and b-Actin (CST, #4967).

[0164] Double immunofluorescence staining of frozen liver tissue from both groups demonstrated decreased CTGF expression in LSECs in the treatment group (Fig. 8, bottom). Primary antibodies used were LYVE-1 (Abcam, ab14917) and CTGF (Santa Cruz, sc-14939). Secondary antibodies used were Donkey Anti-Rabbit IgG H&L (Alexa Fluor® 488) (Abcam, ab150073) and Donkey Anti-Goat IgG H&L (Alexa Fluor® 647) (Abcam, ab150131).

[0165] <Test 1-6-2> Images of HE stained, Sirius red stained (PSI, Picrosirius Red Stain Kit), α-SMA immunostained (Abcam, ab5694), and type IV collagen stained (Abcam, ab6586) liver tissue sections from the control group (DMSO) and treatment group (CWHM-12) are shown (Figure 9). The areas positive for Sirius red staining, α-SMA staining, and type IV collagen staining were quantified using the image analysis software HALO, demonstrating that liver fibrosis improved in the treatment group (Figure 10, top).

[0166] Serum ALT levels (FUJIFILM, DRI-CHEM NX700) and hepatic hydroxyproline levels (CBO, Hydroxyproline Assay Kit) were measured (Fig. 10, middle panel). Portal vein pressure was measured directly using a 1.2 Fr microcatheter (Transonic, FTH-1211B-0018) inserted into the superior mesenteric vein and analyzed using the dedicated software LabScribe4 software chart 5.5.6 (ADInstruments). This showed that portal hypertension improved in the treatment group (Fig. 10, middle panel).

[0167] mRNA was extracted from liver tissue samples, and RT-qPCR demonstrated reduced expression of liver fibrosis and capillary markers in the treated liver tissue (Figure 10, bottom panel). Primers (Applied Bio Systems) for Actb (Mm00607939_s1), Tgfb1 (Mm01178820_m1), Ctgf (Mm01192933_g1), Col1a1 (Mm00801666_g1), Col4a1 (Mm01210125_m1), Pecam1 (Mm01242584_m1), Cd34 (Mm00519283_m1), and Plvap (Mm00453379_m1) were used.

[0168] These findings suggest that inhibition of integrin αV attenuates liver fibrosis and portal hypertension caused by pIVCL.

[0169] Test Example 2. Biomarker Development 1 <Test 2-1> The results of Test 1-2-1 are shown below.

[0170]

[0171] The top 10 secreted proteins that were significantly elevated in the pIVCL group in the Zone 3 LSEC cluster (in order of highest fold change) were Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm.

[0172] <Experiment 2-2> We examined the expression distribution of these genes (Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm) on the UMAP to clarify which clusters they are expressed in. Ctgf and Adm were elevated in hepatic stellate cells as well as LSECs, while the other genes were elevated specifically in LSECs.

[0173] <Test 2-3> The expression distribution of these genes (Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm) was also confirmed in single-cell analysis of a CCl4-administered model (a model of liver fibrosis progression due to liver injury). Cell suspension preparation, single-cell analysis protocol, and cell quality control were performed as in Test 1-2-1. Genes whose expression was elevated in clusters other than LSECs were elevated Ctgf and Adm in hepatic stellate cells, similar to the pIVCL model. Therefore, these genes were found to be LSEC-specifically expressed in other mouse models as well.

[0174] <Study 2-4> Portal vein pressure was measured at 2 and 6 weeks after pIVCL / sham surgery, and mRNA was extracted from liver tissue. The 10 genes were analyzed by RT-qPCR. Portal vein pressure was measured directly using a 1.2 Fr microcatheter (Transonic, FTH-1211B-0018) inserted into the superior mesenteric vein. Analysis was performed using the dedicated software LabScribe4 software chart 5.5.6 (ADInstruments). Expression was significantly elevated in both groups in the pIVCL group starting 2 weeks after surgery (Figure 11). The primers used (Applied Bio System) were Actb (Mm00607939_s1), Ctgf (Mm01192933_g1), Esm1 (Mm00469953_m1), Angpt2 (Mm00545822_m1), Plau (Mm00447054_m1), Edn1 (Mm00438656_m1), Pdgfb (Mm00440677_m1), Cxcl9 (Mm00434946_m1), Fbln2 (Mm00484266_m1), Inhbb (Mm03023992_m1), and Adm (Mm00437438_g1).

[0175] The expression of these 10 genes (Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm) in a total of 24 samples (sham2w: n=4, pIVCL: 6w, sham6w: n=6, pIVCL6w: n=8) was correlated with portal vein pressure. All genes showed a strong correlation with portal vein pressure (Figure 12).

[0176] <Experiment 2-5> LSECs isolated from wild-type mice were plated overnight, serum-free for 6 hours, and then subjected to hydrostatic pressure (101 / 135 kPa, 0.01 Hz) for 8 hours. RNA was extracted and RNA-seq was performed. Expression of the 10 genes listed above (Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm) was significantly elevated by hydrostatic pressure.

[0177] <Study 2-6> ELISA was performed on serum ANGPT2 (R&D SYSTEMS, MANG20), EDN1 (R&D SYSTEMS, DET100), and PDGFB (R&D SYSTEMS, MBB00) at 2 and 6 weeks after pIVCL / sham transplantation. Serum ANGPT2 and PDGFB levels were significantly elevated in the pIVCL group (Figure 13).

[0178] <Test 2-7> Both full-length and N-terminal CTGF are present in the blood. The C-terminal region is susceptible to degradation, and it is believed that the full-length and N-terminal regions are predominantly present in the blood. Therefore, serum levels of N-terminal CTGF, which is believed to be derived from fibrotic tissue, were calculated by measuring serum levels of total CTGF (full-length + N-terminal) (FUJIFILM, 292-84901) and full-length CTGF (FUJIFILM, 290-84701) by ELISA and calculating the difference. Serum N-terminal CTGF levels were elevated in the FALD group compared with control groups (healthy individuals hospitalized for colon polypectomy and chronic hepatitis C patients hospitalized for oral antiviral therapy), regardless of the degree of liver fibrosis (Figure 14).

[0179] Test Example 3. Development of preventive / therapeutic drugs 2 Test Example 3-1. Elucidation of the mechanism of progression of liver disease due to increased intrahepatic pressure and its effects <Test 3-1-1: Figure 15> Single-cell analysis was performed on liver parenchymal cells in the control group (DMSO) and the treatment group (CWHM-12) 6 weeks after pIVCL. The method was to perfuse pronase (Sigma-Aldrich, 107433) and collagenase (Sigma-Aldrich, C5138) from the portal vein to prepare a cell suspension, separate hepatocytes by low-speed centrifugation (50 g), and separate non-parenchymal liver cells by density gradient centrifugation with Percoll PLUS (Cytiva, GE17-5445-02) to remove dead cells and red blood cells. A cell suspension with a ratio of hepatocytes:non-parenchymal liver cells = 1:9 was prepared, and Whole Transcriptome Analysis (BD Rhapsody) was performed. Primary quality control was performed using the Seven Bridge pipeline with the FASTQ files obtained by the next-generation sequencer and the mouse genome annotation file (GRCm39). Subsequently, secondary quality control was performed by extracting cells with 500 < count number < 30,000, 250 < number of genes < 4,000, and mitochondrial gene ratio < 25% using R. The obtained cells were integrated after normalization and batch effect correction, followed by dimensionality reduction and clustering, and the results were shown in UMAP. The cell population of each cluster was identified by extracting marker genes, and clusters of pericentral LSEC and hepatic stellate cells (HSC) were identified. A decrease in the expression of the YAP / TAZ target gene group, Ctgf, and type 4 collagen (Col4a1, Col4a2) was observed in the pericentral LSEC cluster, and a decrease in the expression of Col1a1 and Col4a1 was observed in the HSC cluster.

[0180] <Test 3-1-2: Figure 16> HE-stained and Sirius red-stained images of surgically resected specimens from a normal liver (donor for living donor liver transplant) and two cases of Fontan-associated liver disease (FALD) were shown. In FALD, perisinusoidal fibrosis (fibrosis of the sinusoidal wall) was prominent in areas of congestion and sinusoidal dilation. Immunostaining for CTGF (Santa Cruz, sc-14939), integrin αV (Abcam, ab179475), and YAP (Abcam, ab205270) was also observed. In FALD, CTGF and integrin αV stained primarily along the sinusoidal wall in areas of congestion and sinusoidal dilation, while YAP stained primarily in the nuclei of LSECs.

[0181] Proteins extracted from frozen samples were analyzed by Western blotting to demonstrate YAP activation and increased expression of CTGF and type IV collagen in FALD. Primary antibodies used were phospho-YAP (Abcam, ab76252), YAP (Abcam, ab205270), TAZ (CST, #72804), CTGF (Santa Cruz, sc-14939), Collagen IV (Abcam, ab6586), and b-Actin (CST, #4967). mRNA was extracted from frozen samples to demonstrate increased expression of CTGF in FALD. Primers (Applied Bio Systems) for Actb (Hs01060665_g1) and Ctgf (Hs00170014_m1) were used. Serum total CTGF (full-length + N-terminal CTGF (FUJIFILM, 292-84901) and full-length CTGF (FUJIFILM, 290-84701) were measured by ELISA, and serum N-terminal CTGF levels were calculated by calculating the difference. Increased serum N-terminal CTGF levels were observed in FALD patients.

[0182] <Test 3-1-3: Figure 17> Single Cell Fixed RNA Profiling (10x Genomics) was performed using surgical frozen specimens from 3 cases of normal liver (2 cases of donors for living liver transplantation and 1 case of background liver with hepatic hemangioma) and 4 cases of FALD. Primary quality control was performed using Cell Ranger with the FASTQ files obtained by next-generation sequencer and the human genome annotation file (GRCh38). Subsequently, secondary quality control was performed using R to extract cells with 500 < count < 30,000, 250 < number of genes < 4,000, and mitochondrial gene ratio < 20%. The obtained cells were integrated after normalization and batch effect correction, followed by dimensionality reduction and clustering, and the results were shown using UMAP. By extracting marker genes, the cell population of each cluster was identified, and gene expression analysis was performed in the cluster of endothelial cells including LSEC. As a result, CTGF expression was significantly increased in the FALD group. In addition, an increase in the YAP / TAZ target gene group and an increase in the basement membrane-related gene group were observed in the endothelial cells of the FALD group. When cell-cell communication analysis was performed using CellChat, an increase in the number of signals from endothelial cells to each cell was observed in the FALD group, and particularly, the number of signals by the basement membrane components of endothelial cells was increased. It was suggested that the formation of the basement membrane of LSEC may contribute to the pathological progression of FALD.

[0183] <Study 3-1-4: Figure 18> Thin sections were prepared from FFPE blocks of normal liver (living donor liver transplant) and surgically resected specimens of Fontan-associated liver disease (FALD) patients, and single-cell spatial gene expression analysis was performed using a CosMx Spatial Molecular Imager (Bruker). The analysis area (FOV: 0.5 mm x 0.5 mm) was selected based on HE staining of serial sections. Cell segmentation was performed using anti-B2M / CD298, anti-PanCK, anti-CD45, anti-CK8 / 18 antibodies, and DAPI staining. mRNA was detected in the tissue using nine custom gene probes, including CCN2 (CTGF), in the CosMx Human Universal Cell Characterization RNA Panel (1000-plex). Analysis data were subjected to normalization, batch effect correction, dimensionality reduction, and clustering on the dedicated analysis platform, AtoMx. Clustering was performed using the liver reference file used for single-cell analysis. The data was converted into Seurat objects and clustered using UMAP in R to show the distribution of CTGF expression.

[0184] <Test 3-1-5: Figure 19> (Top) HE staining images and corresponding mapping images (created with AtoMx) of LSECs around the portal vein (periportal LSECs) and LSECs around the central vein (pericentral LSECs) in normal and FALD livers are shown, along with a merged image of CTGF mRNA (created with AtoMx). CTGF expression was compared between periportal and pericentral LSECs in normal and FALD livers. While no difference in expression was observed between the two in normal livers, CTGF expression was significantly elevated in pericentral LSECs in FALD livers.

[0185] (Bottom) Mapping images of COL1A1, COL1A2, COL4A1, and COL4A2 mRNA in pericentral LSECs and hepatic stellate cells (HSCs) from FALD livers (generated by AtoMx) and a merged image of CTGF mRNA (generated by AtoMx). Violin plots show the expression of COL1A1, COL1A2, COL4A1, and COL4A2 in periportal LSECs, pericentral LSECs, and hepatic stellate cells (HSCs). Type I collagen (COL1A1 and COL1A2) was highly expressed in HSCs, while type IV collagen (COL4A1 and COL4A2) was highly expressed not only in HSCs but also in pericentral LSECs.

[0186] <Test 3-1-6: Figure 20> In FALD livers, of the regions (FOV: 0.5mm x 0.5mm) analyzed with CosMx, the area around the central vein was classified by Sirius red staining into areas of mild fibrosis (perisinusoidal fibrosis) and areas of severe fibrosis (bridging fibrosis). Mapping images (created with AtoMx) of pericentral LSECs, hepatic stellate cells (HSCs), and CTGF, COL1A1, COL1A2, COL4A1, and COL4A2 mRNA in normal liver, perisinusoidal fibrosis areas in FALD liver, and bridging fibrosis areas in FALD liver are shown, as well as a merged image of CTGF mRNA (created with AtoMx). In pericentral LSECs, CTGF was highly expressed in both perisinusoidal and bridging fibrosis, whereas type IV collagen (COL4A1, COL4A2) was more highly expressed in bridging fibrosis. In HSCs, there was no difference in type IV collagen (COL4A1, COL4A2) expression, whereas type I collagen (COL1A1, COL1A2) was more highly expressed in bridging fibrosis. The proportion of hepatic stellate cells was increased in bridging fibrosis.

[0187] Combined with the results of in vitro and in vivo experiments, these findings suggest that CTGF increases in LSECs from the early stages of congestive liver injury, and that this, along with increased expression of type IV collagen in LSECs and increased expression of type I collagen in HSCs, may contribute to the progression from perisinusoidal fibrosis to bridging fibrosis.

[0188] Experimental Example 3-2. Application to Intrasinusoidal Hypertension and Development of New Therapeutics <Experimental Example 3-2-1: Figure 21> Thin sections were prepared from FFPE blocks of surgically resected specimens of normal liver (donor for living donor liver transplant), Fontan-associated liver disease (FALD), and cirrhotic liver (non-HBV / HCV), and single-cell-based spatial gene expression analysis was performed using a CosMx Spatial Molecular Imager (Bruker). The analysis area (FOV: 0.5 mm x 0.5 mm) was selected based on HE staining of serial sections. Cell segmentation was performed using anti-B2M / CD298, anti-PanCK, anti-CD45, anti-CK8 / 18 antibodies, and DAPI staining. mRNA was detected in the tissue using nine custom gene probes, including CCN2 (CTGF), in the CosMx Human Universal Cell Characterization RNA Panel (1000-plex). The analyzed data were normalized, corrected for batch effects, reduced in dimension, and clustered on the dedicated analysis platform AtoMx. Clustering was performed using a liver reference file used for single-cell analysis. The data were converted to Seurat objects and clustered using UMAP in R.

[0189] <Test 3-2-2: Figure 22> Pericentral LSECs (CV.LSECs), hepatic stellate cells (HSCs), and COL1A1, COL1A2, COL4A1, and COL4A2 mRNA mapping images (generated by AtoMx) from FALD livers, as well as merged CTGF mRNA images (generated by AtoMx) are shown. Violin plots are shown for periportal LSECs (PV.LSECs), pericentral LSECs (CV.LSECs), and hepatic stellate cells (HSCs). Type I collagen (COL1A1 and COL1A2) was highly expressed in HSCs, while CTGF and type IV collagen (COL4A1 and COL4A2) were highly expressed not only in HSCs but also in CV.LSECs.

[0190] <Test 3-2-3: Figure 23> Figure 23 shows mapping images (generated by AtoMx) of periportal LSECs (PV.LSECs), pericentral LSECs (CV.LSECs), and hepatic stellate cells (HSCs) from cirrhotic livers, as well as COL1A1, COL1A2, COL4A1, and COL4A2 mRNAs, and a merged image of CTGF mRNA (generated by AtoMx). In cirrhotic livers, ITGAV (integrin αV) was expressed in PV.LSECs, CV.LSECs, and HSCs. Type I collagen (COL1A1 and COL1A2) was highly expressed in HSCs, while type IV collagen (COL4A1 and COL4A2) was highly expressed in both PV.LSECs and CV.LSECs, as well as HSCs.

[0191] Test Example 4. Biomarker Development 2 <Test 4-1: Figure 24> The top 10 secretory proteins elevated in LSECs by single-cell analysis of the pIVCL model: Ctgf, Esm1, Angpt2, Plau, Edn1, Pdgfb, Cxcl9, Fbln2, Inhbb, and Adm. Serum concentrations were measured in normal livers, FALD, and patients with hepatitis C virus cirrhosis. ELISA for serum ESM1 (abcam, ab213776), ANGPT2 (R&D SYSTEMS, DANG20), PLAU (R&D SYSTEMS, DUPA00), EDN1 (R&D SYSTEMS, DET100), PDGFB (R&D SYSTEMS, DBB00), CXCL9 (R&D SYSTEMS, DCX900), FBLN2 (Abbexa, abx350725), INHBB (AssayGenie, HUFl02589), and ADM (AssayGenie, HUFl00565) was performed in 7 normal livers (healthy individuals hospitalized for colon polypectomy), 58 FALD cases (provided by the University of Tokyo), and 15 type C liver cirrhosis cases. Serum N-terminal CTGF was calculated by measuring serum total CTGF (full-length + N-terminal (FUJIFILM, 292-84901) and full-length CTGF (FUJIFILM, 290-84701) by ELISA and calculating the difference. Serum N-terminal CTGF, ESM1, ANGPT2, PLAU, and CXCL9 levels were significantly elevated in patients with FALD and cirrhosis compared with controls (normal liver).

[0192] <Test 4-2: Figure 25> Liver stiffness (kPa) is a non-invasive test that reflects hepatic congestion (increased intrasinusoidal pressure) and liver fibrosis. In FALD cases, serum EDN1 and FBLN2 levels showed a significant positive correlation with liver stiffness.

Claims

1. A preventive or therapeutic agent for at least one disease selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer in a subject suspected of having increased intrasinusoidal pressure, comprising at least one agent selected from the group consisting of a CTGF inhibitor and an integrin αV inhibitor.

2. The preventive or therapeutic agent according to claim 1, wherein the CTGF inhibitor is at least one selected from the group consisting of CTGF function inhibitors and CTGF expression inhibitors, and / or the integrin αV inhibitor is at least one selected from the group consisting of integrin αV function inhibitors and integrin αV expression inhibitors.

3. The preventive or therapeutic agent according to claim 1, wherein the CTGF inhibitor is at least one selected from the group consisting of a low molecular weight compound, a polynucleotide targeting CTGF, an expression cassette for said polynucleotide, a peptide, a protein, and an antibody, and / or the integrin αV inhibitor is at least one selected from the group consisting of a low molecular weight compound, a polynucleotide targeting integrin αV, an expression cassette for said polynucleotide, a peptide, a protein, and an antibody.

4. The preventive or therapeutic agent according to claim 1, wherein the CTGF inhibitor is an inhibitor of CTGF in hepatic sinusoidal endothelial cells, and / or the integrin αV inhibitor is an inhibitor of integrin αV in hepatic sinusoidal endothelial cells.

5. The preventive or therapeutic agent according to any one of claims 1 to 4, which comprises the CTGF inhibitor and the disease is liver cancer, or which comprises the integrin αV inhibitor.

6. The preventive or therapeutic agent according to any one of claims 1 to 4, wherein the subject has at least one condition selected from the group consisting of congestive liver damage, liver cirrhosis, Budd-Chiari syndrome, portal vein thrombosis, sinusoidal obstruction syndrome, and post-Fontan syndrome.

7. (1) A method for examining at least one selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, comprising the step of detecting the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB in a biological sample collected from a subject.

8. The method according to claim 7, further comprising: (2) determining whether the subject has increased intrasinusoidal pressure and / or whether the subject has at least one disease selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, based on the amount or concentration of the protein and / or mRNA detected in step (1).

9. The method according to claim 8, wherein the step (2) comprises: (2A) determining that the subject has increased intrasinusoidal pressure and / or is suffering from at least one condition selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, when the amount or concentration of the protein and / or the mRNA detected in the step (1) is equal to or greater than a cutoff value; and / or (2B) determining that the subject does not have increased intrasinusoidal pressure and / or is not suffering from at least one condition selected from the group consisting of hepatic fibrosis, cirrhosis, and liver cancer, when the amount or concentration of the protein and / or the mRNA detected in the step (1) is equal to or less than a cutoff value.

10. A preventive or therapeutic agent according to any one of claims 1 to 4, wherein the subject is a subject determined by the method of claim 9 to have increased intrasinusoidal pressure and / or to be suffering from at least one condition selected from the group consisting of liver fibrosis, cirrhosis, and liver cancer.

11. At least one diagnostic agent selected from the group consisting of intrasinusoidal pressure, liver fibrosis, cirrhosis, and liver cancer, which comprises a binding molecule for the protein and / or mRNA of at least one gene selected from the group consisting of CTGF, ESM1, ANGPT2, PLAU, EDN1, PDGFB, ADM, CXCL9, FBLN2, and INHBB.

12. The test agent according to claim 11, which is a companion diagnostic agent for the preventive or therapeutic agent according to any one of claims 1 to 4.

Images