Hypoimmunogenic universal induced pluripotent stem cells

By genetically engineering iPSCs to reduce HLA expression, the immunogenicity challenge is addressed, enabling more effective and compatible allogeneic cell therapy.

WO2025225866A1PCT designated stage Publication Date: 2025-10-30YIPSCELL INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/003036
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-22
Filing Date
2025-03-07
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

The immunogenicity of induced pluripotent stem cells (iPSCs) limits their use in allogeneic cell therapy due to immune responses triggered by mismatched human leukocyte antigen (HLA) types, leading to transplant rejection.

Method used

Genetically engineer iPSCs to reduce the expression of HLA class I and class II antigens, using methods such as CRISPR/Cas systems, to create hypoimmunogenic stem cells that minimize immune recognition.

Benefits of technology

The engineered iPSCs exhibit reduced immunogenicity, enhancing their transplantability and compatibility across different genetic backgrounds, thereby improving the success of allogeneic cell therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025003036_30102025_PF_FP_ABST
    Figure KR2025003036_30102025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to hypoimmunogenic universal induced pluripotent stem cells and a method for producing same The induced pluripotent stem cells according to one aspect have reduced immunogenicity in allogeneic transplantation for the purpose of disease treatment and do not cause immune rejection in the recipient's body, and thus may be utilized as a source for developing cell therapeutic agents.
Need to check novelty before this filing date? Find Prior Art

Description

Low-immunogenicity, universal induced pluripotent stem cells

[0001] The present invention relates to a universal induced pluripotent stem cell with low immunogenicity.

[0002]

[0003] In cell therapy, immunogenicity is a critical factor in determining the success of allogeneic transplantation. Research on stem cells as cell therapy has been conducted using adult stem cells, MSCs, ESCs, and iPSCs. Among these, iPSCs are somatic cells that have been engineered with Yamanaka factors to achieve pluripotency and infinite proliferation, enabling differentiation into target cells such as heart, nerve, cartilage, and bone. Research has been conducted to utilize iPSCs in cell therapy, but their use in allogeneic therapy is limited by immunogenicity. In the present invention, we aimed to create hypoimmunogenic universal iPSCs (iPSCs) by genetically modifying iPSCs to overcome immunogenicity and utilize them as a source cell for cell therapy.

[0004] The major histocompatibility complex (MHC), also known as HLA (Human Leukocyte Antigen), encodes the 'MHC molecule' that functions in the immune system and is located on chromosome 6. It is composed of HLA class I (A, B, and C) and the class II (DR, DQ, DP) molecules and is the part with the most polymorphism among human genes. Class I MHC, HLA-A, B, C, has the role of presenting foreign proteins to cytotoxic T cells and is composed of a polymorphic α chain and a non-polymorphic Beta 2M. Class II MHC, HLA-DR, DQ, DP, has a polymorphic beta 1 and a non-polymorphic alpha chain and Beta 2, and has the role of presenting foreign proteins to helper T cells.

[0005] Human leukocyte antigens (HLA) are the most important genes when considering transplantation. These genes consist of HLA class I (A, B, C) and class II (DR, DQ, DP), and are the most polymorphic part of the human genome. HLA protein polymorphism is essential for immune protection, but it often leads to failure due to immune responses when transplanting organs from different genetic backgrounds. This same principle applies to cell therapy. When donor cells are classified as non-self due to mismatched HLA types, they can be attacked by CD4 T cells, CD8 T cells, and NK cells, which in turn triggers an immune response.

[0006]

[0007] One aspect is to provide hypoimmunogenic stem cells genetically engineered to have reduced expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and HLA class II compared to parent cells.

[0008] Another aspect provides a method for producing hypoimmunogenic stem cells, comprising the step of genetically engineering stem cells to have reduced expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II compared to parent cells.

[0009]

[0010] One aspect provides hypoimmunogenic stem cells genetically engineered to have reduced expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II compared to parent cells.

[0011] The above "parent cell" is a cell that has not been artificially manipulated to reduce the expression or activity of one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II according to one aspect, and may be a cell that has been induced to have pluripotent differentiation ability through an artificial dedifferentiation process from a cell freshly isolated from a human body, a cell cultured therefrom, or a differentiated cell.

[0012] The above "Human Leukocyte Antigen (HLA)" is synonymous with histocompatibility antigen and is a cell surface protein also called Major Histocompatibility Antigen Complex (MHC). In humans, it is known that six types are expressed, six types derived from paternal genes and six types derived from maternal genes, or a total of six pairs. The role of HLA is to display fragments of proteins existing within the cell on the surface of the cell so that infections or mutations that may have occurred in the body can be detected by immune cells. For this reason, it is also called antigen presenting protein (APP). These antigen presenting proteins become the main target of attack by immune cells existing in the body of the transplant recipient if they are not autologous cells. Generally, HLA classes are used to test the tissue compatibility between the donor and the recipient during cell, tissue, and organ transplantation. Transplantation is possible if the HLA antigens of the donor and recipient are all the same, but since there are more than 9719 types of alleles of HLA classes I and II, and each person has numerous genetic polymorphisms in each HLA gene, it is not easy to find a donor with a completely matching HLA type. When transplanting cells, tissues, or organs, if the HLA-A genes of the donor and the HLA-A genes of the recipient do not match, the immune cells in the recipient's body recognize the difference and attack the donor cells, ultimately leading to transplant failure due to immune rejection. In this regard, one aspect provides a method for manufacturing transplant-compatible cells, specifically cells that are homozygous or null for immunocompatibility antigens through genetic manipulation.

[0013] The term "transplantability" above refers to the property of not causing an immune rejection response upon cell transplantation. Cells, tissues, or organs can be made transplantable by reducing the expression of genes that cause immune rejection. As a non-limiting example, cells, tissues, or organs can be made transplantable by reducing the expression level of the HLA genes. Transplantable cells may include cells that are homozygous for or deficient in immunocompatibility antigens.

[0014] The above human leukocyte antigens (HLA) can be classified into "HLA class I" and "HLA class II". HLA-A, HLA-B, and HLA-C belong to HLA class I, and HLA-DR, HLA-DP, and HLA-DQ belong to HLA class II. Normal somatic cells express only three pairs of HLA class I, HLA-A, HLA-B, and HLA-C, while immune cells express a total of six pairs of HLA class I and HLA class II.

[0015] In one specific example, the human leukocyte antigen class I may be at least one selected from the group consisting of HLA-A, HLA-B, and HLA-C, and the human leukocyte antigen class II may be at least one selected from the group consisting of HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB. Specifically, the human leukocyte antigen class I may be at least one selected from the group consisting of HLA-A and HLA-B, and the human leukocyte antigen class II may be at least one selected from the group consisting of HLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5, and more specifically, the human leukocyte antigen class I may be HLA-A and HLA-B, and the human leukocyte antigen class II may be HLA-DRA.

[0016] In one specific example, the stem cells may be genetically engineered to have reduced expression of one or more proteins selected from the group consisting of HLA-A, HLA-B and HLA-DRA, specifically, the stem cells may be genetically engineered to have reduced expression of all of the HLA-A, HLA-B and HLA-DRA proteins.

[0017] By manipulating the expression of HLA-A, HLA-B and HLA-DRA to be reduced, immune evasion can be obtained, while at the same time maintaining the expression of HLA-C, HLA-E, HLA-F and HLA-G, there is an effect of being able to defend against attacks by NK cells.

[0018] In one specific example, the stem cell may be genetically engineered with at least one region selected from the group consisting of exon 1 to exon 3 of a gene encoding HLA-A, exon 1 to exon 3 of a gene encoding HLA-B, and exon 1 to exon 3 of a gene encoding HLA-DRA, and specifically, the stem cell may be genetically engineered with at least one region selected from the group consisting of exon 2 of a gene encoding HLA-A, exon 3 of a gene encoding HLA-A, exon 2 of a gene encoding HLA-B, exon 3 of a gene encoding HLA-B, exon 2 of a gene encoding HLA-DRA, and exon 3 of a gene encoding HLA-DRA. More specifically, one or more regions selected from the group consisting of the exon 2 region of the gene encoding HLA-A of the stem cell, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA may be genetically engineered.

[0019] In one specific example, the exon 2 region of the gene encoding HLA-A, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA of the stem cells may all be genetically engineered.

[0020] The above term "genetic engineering" or "genetically engineered" refers to the act of introducing one or more genetic modifications into a cell or a cell produced thereby.

[0021] The genetic manipulation may be induced by a physical method to modify the nucleic acid sequence of a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II. The physical method may be, for example, X-ray irradiation, gamma ray irradiation, or the like.

[0022] Additionally, the genetic manipulation may be induced by a chemical method to modify the nucleic acid sequence of a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II, or to change the expression of the gene. The chemical method may be, for example, treatment with ethyl methanesulfonate, treatment with dimethyl sulfate, etc.

[0023] Additionally, the genetic manipulation may be induced by a modification in the nucleic acid sequence of a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II by a gene editing system. The gene editing system may be, for example, a meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR / Cas system, etc.

[0024] Additionally, the genetic manipulation may be induced by a change in gene expression by binding to mRNA transcribed from a gene encoding one or more proteins selected from the group consisting of HLA class I and HLA class II by an RNA interference (RNAi) system.

[0025] In one specific example, the stem cell may be genetically engineered through an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR / Cas system, X-ray irradiation, gamma ray irradiation, ethyl methanesulfonate treatment, or dimethyl sulfate treatment, and specifically, may be engineered through a CRISPR / Cas system, and the genetic engineering may be induced by a modification in the nucleic acid sequence of a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II.

[0026] Genetically engineered to have "reduced expression" or "inactivated" one or more genes encoding the human leukocyte antigen class I and human leukocyte antigen class II means that one or more genes encoding the human leukocyte antigen class I and human leukocyte antigen class II or the genes encoding the same exhibit expression or activity at a level lower than the level of expression or activity of one or more genes encoding the human leukocyte antigen class I and human leukocyte antigen class II or the genes encoding the same measured in comparable stem cells of the same species or parent cells thereof, or that there is no expression or activity. That is, in the stem cells, the expression or activity of one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II or a gene encoding the same may be reduced by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more compared to the expression or activity of the original unmanipulated stem cells, or a 100% reduction, that is, one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II or a gene encoding the same may not be expressed at all.

[0027] Genetically engineered stem cells in which the expression or activity of one or more genes encoding the human leukocyte antigen class I and human leukocyte antigen class II is reduced can be identified using any method known in the art. The term "inactivation" may mean that a gene is not expressed at all, or that a protein is produced that is not active even if it is expressed. The term "depression" may mean that a gene encoding a specific protein is expressed at a lower level than in non-engineered cells, or that the protein expressed by the specific gene is expressed but its activity is low.

[0028] The decrease in expression or activity of one or more genes selected from the group consisting of the human leukocyte antigen class I and the human leukocyte antigen class II or the genes encoding them may be caused by mutation, replacement, deletion of part or all of the genes encoding one or more genes selected from the group consisting of the human leukocyte antigen class I and the human leukocyte antigen class II or by insertion of one or more bases into the genes, and may be caused by a genetic manipulation means encoding one or more genes selected from the group consisting of the human leukocyte antigen class I and the human leukocyte antigen class II.

[0029] In general, the "CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system", a widely known genetic engineering tool, collectively refers to a sequence encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or active portion tracrRNA), a tracr-mate sequence (including a "direct repeat" and a tracrRNA-processing portion direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), a guide RNA or other sequences and transcripts from a CRISPR locus, and other elements that accompany the expression of a CRISPR-associated (hereinafter referred to as Cas) gene or induce its activity. In one embodiment, one or more elements of the CRISPR system are derived from a type I, type II or type III CRISPR system. In one embodiment, one or more elements of the CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. Typically, a CRISPR system is characterized by an element (also referred to as a protospacer in the context of an endogenous CRISPR system) that promotes the formation of a CRISPR complex at the site of the target sequence. In the context of the formation of a CRISPR complex, a "target sequence" or "target gene" refers to a sequence designed to have complementarity with a guide sequence, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. While perfect complementarity is not required, sufficient complementarity exists to cause hybridization and promote the formation of a CRISPR complex. The target sequence can comprise any polynucleotide, such as a DNA or RNA polynucleotide.In one specific embodiment, the target sequence is located within the nucleus or cytoplasm of the cell.

[0030] The above Cas protein forms an active endonuclease, or nickase, when it forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). Non-limiting examples of the above Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, a homolog thereof or a homolog thereof. Modified versions may be included. These enzymes are known; for example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein is available from the SwissProt database under accession number Q99ZW2. In one embodiment, the unmodified CRISPR enzyme, e.g., Cas9, has DNA cleavage activity.

[0031] In one specific example, the CRISPR enzyme may be a Cas9 protein, and the Cas9 protein may be one or more Cas9 proteins selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophiles, a Cas9 protein derived from Streptococcus aureus, and a Cas9 protein derived from Neisseria meningitidis, and specifically, a Cas9 protein derived from Streptococcus pyogenes. In one embodiment, the Cas9 protein is codon-optimized for expression in a eukaryotic cell, and when using the Streptococcus pyogenes derived Cas9 protein, the expression or activity of one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II or a gene encoding the same can be maximally reduced.

[0032] The term “nuclear localization sequence or signal (NLS)” refers to an amino acid sequence that functions to transport a specific substance (e.g., a protein) into the cell nucleus, and generally functions to transport it into the cell nucleus through a nuclear pore. Although the nuclear localization sequence is not required for the activity of the CRISPR complex in eukaryotes, it is believed that including such a sequence enhances the activity of the system, particularly targeting nucleic acid molecules in the nucleus.

[0033] Additionally, RNA-guided CRISPR (clustered regularly interspaced short palindrome repeats)-associated nuclease Cas9 offers a breakthrough technology for knockout, transcriptional activation, and repression of target genes using a single guide RNA (sgRNA) (i.e., crRNA-tracrRNA fusion transcript), and this technology is known to target numerous genetic loci.

[0034] The Cas9 (or Cpf1) protein refers to an essential protein component in the CRISPR / Cas9 system, and information on the Cas9 (or Cpf1) gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI). CRISPR-associated genes encoding Cas (or Cpf1) proteins are known to exist in more than 40 different Cas (or Cpf1) protein families, and eight CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube) can be defined according to specific combinations of Cas genes and repeat structures. Therefore, each of the above CRISPR subtypes can form a repeat unit to form a polyribonucleotide-protein complex.

[0035] The above gene knockout may refer to the regulation of the activity of a gene, e.g., inactivation, by deletion, substitution, and / or insertion of one or more nucleotides in whole or in part of the gene. The gene inactivation may refer to the suppression or downregulation of the expression of the gene, or the modification so that the gene encodes a protein that has lost its original function. In addition, the gene regulation may refer to a change in the function of the gene due to the structural modification of the protein obtained by the deletion of the exon region by simultaneously targeting both intron regions surrounding one or more exons of the target gene, or the expression of the protein in a dominant negative form.

[0036] In one specific example, the target sequence used to knock out a gene encoding at least one selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II in the stem cell may include, for example, a gene encoding at least one selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II, specifically, at least one selected from the group consisting of a gene encoding HLA-A, a gene encoding HLA-B, and a gene encoding HLA-DRA, and more specifically, at least one selected from the group consisting of an exon 2 region of a gene encoding HLA-A, an exon 3 region of a gene encoding HLA-B, an exon 3 region of a gene encoding HLA-B, an exon 2 region of a gene encoding HLA-DRA, and an exon 3 region of a gene encoding HLA-DRA.

[0037] In one specific example, it may include all of the exon 2 region of the gene encoding HLA-A, the exon 3 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA.

[0038] In one manufacturing example, in the case of HLA-A, G0002-HLA-A-g1(+, ACAGCGACGCCGCGAGCCAG, PAM: AGG) gRNA was manufactured with the ACAGCGACGCCGCGAGCCAG base sequence located within codons 37 to 43 in exon 2 as the target sequence and the AGG sequence as the PAM sequence, and in the case of HLA-B, G0002-HLA-B-g1(-, GCTGTCGAACCTCACGAACT, PAM: GGG) gRNA was manufactured with the GCTGTCGAACCTCACGAACT base sequence located within codons 31 to 38 in exon 2 as the target sequence and the GGG sequence as the PAM sequence, and in the case of HLA-DRA, TGGCAAAGAAGGAGACGGTC base sequence located within codons 36 to 42 in exon 2 as the target sequence and the TGG sequence as the PAM sequence. G0002-HLA-DRA-g2(+, TGGCAAAGAAGGAGACGGTC, PAM: TGG) gRNA was prepared (see Preparation Example 1).

[0039] In one embodiment, ICE analysis was performed to confirm the effectiveness of the designed gRNA sequences, and as a result, it was confirmed that G0002-HLA-A-g1 had an efficiency of 91%, G0002-HLA-B-g1 had an efficiency of 78%, and G0002-HLA-DRA-g2 had an efficiency of 86% (see Example 1).

[0040] The genetic manipulation that is artificially performed to reduce the expression or activity of one or more selected from the group consisting of the human leukocyte antigen class I and human leukocyte antigen class II or the gene encoding the same may be such that one or more selected from the group consisting of the human leukocyte antigen class I and human leukocyte antigen class II is not expressed in the form of a protein having its original function. The manipulation of the gene may be induced by one or more of the following:

[0041] 1) Deletion of all or part of the gene encoding HLA class I and / or HLA class II, e.g., deletion of 1 bp or more of the nucleotides of the gene encoding HLA class I and / or HLA class II, e.g., deletion of 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide,

[0042] 2) Substitution of 1 bp or more of the nucleotides of the gene encoding HLA class I and / or HLA class II, for example, 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide, with a nucleotide different from the original (parent cell),

[0043] 3) insertion of one or more nucleotides, e.g., 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide (each independently selected from A, T, C, and G) into any position of the target gene, and

[0044] 4) A combination of two or more selected from 1) to 3) above.

[0045] The modified portion ('target region') of the gene encoding the HLA class I and / or HLA class II is at least 1 bp, at least 3 bp, at least 5 bp, at least 7 bp, at least 10 bp, at least 12 bp, at least 15 bp, at least 17 bp, at least 20 bp of the gene, for example, 1 bp to 30 bp, 3 bp to 30 bp, 5 bp to 30 bp, 7 bp to 30 bp, 10 bp to 30 bp, 12 bp to 30 bp, 15 bp to 30 bp, 17 bp to 30 bp, 20 bp to 30 bp, 1 bp to 27 bp, 3 bp to 27 bp, 5 bp to 27 bp, 7 bp to 27 bp, 10bp to 27bp, 12bp to 27bp, 15bp to 27bp, 17bp to 27bp, 20bp to 27bp, 1bp to 25bp, 3bp to 25bp, 5bp to 25bp, 7bp to 25bp, 10bp to 25bp, 12bp to 25bp, 15bp to 25bp, 17bp to 25bp, 20bp to 25bp, 1bp to 23bp, 3bp to 23bp, 5bp to 23bp, 7bp to 23bp, 10bp to 23bp, 12bp to 23bp, 15bp to 23bp, It may be a continuous base sequence region of 17bp to 23bp, 20bp to 23bp, 1bp to 20bp, 3bp to 20bp, 5bp to 20bp, 7bp to 20bp, 10bp to 20bp, 12bp to 20bp, 15bp to 20bp, 17bp to 20bp, 21bp to 25bp, 18bp to 22bp, or 21bp to 23bp.

[0046] In another embodiment, one million induced pluripotent stem cells were mixed with the CRISPR / CAS9 system and electroporated to induce intracellular transfection. After approximately 28 days of culture, PCR and Sanger sequencing were performed to screen the collected clones, and genotyping was performed to ultimately select cells in which the HLA-A, HLA-B, and HLA-DRA genes were manipulated. Sequencing of the cells revealed that a 1 bp insertion occurred in the HLA-A region, a 28 bp deletion occurred in the HLA-B region, and a 1 bp deletion occurred in the HLA-DRA region (see Example 2).

[0047] The terms "chimeric RNA", "chimeric guide RNA", "guide RNA", "single guide RNA (sgRNA)" and "synthetic guide RNA" are used interchangeably and refer to a polynucleotide sequence comprising a guide sequence, a tracr sequence and / or a tracr mate sequence. The term "guide sequence" refers to a sequence of about 20 bp within a guide RNA that directs a target site and may be used interchangeably with the term "guide" or "spacer". The term "tracr mate sequence" may also be used interchangeably with the term "direct repeat(s)". The guide RNA may be composed of two RNAs, namely a CRISPR RNA (crRNA) and a transactivating crRNA (tracrRNA), or may be a single-chain RNA (sgRNA) comprising portions of crRNA and tracrRNA and hybridizing to the target DNA.

[0048] In general, a guide sequence is any polynucleotide sequence that has sufficient complementarity with the target polynucleotide sequence to hybridize with the target sequence and induce sequence-specific binding of a CRISPR complex to the target sequence. In addition, any base sequence that can be used for genetic manipulation to reduce the expression or activity of one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II or a gene encoding the same can be used as a guide RNA without limitation. For example, the base sequence may be a sequence that can hybridize with a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II. In addition, a portion of the guide RNA base sequence can be modified to modify / enhance the function of the guide RNA. Also, in one specific embodiment, the degree of complementarity between the guide sequence and its corresponding target sequence is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more when optimally aligned using an appropriate alignment algorithm. The optimal alignment may be determined by use of any algorithm suitable for aligning sequences, non-limiting examples of which may include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, CA, USA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).In one embodiment, the guide sequence is at least about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 nucleotides in length. In one embodiment, the guide sequence is at most about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 nucleotides in length. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence can be assessed by any suitable assay. For example, components of a CRISPR system sufficient to form a CRISPR complex comprising a guide sequence to be tested can be provided to a host cell having the corresponding target sequence, e.g., after transfection with a vector encoding components of the CRISPR sequence, such as by assessing preferential cleavage within the target sequence by, e.g., a SURVEYOR assay as described herein. Similarly, cleavage of a target polynucleotide sequence can be assessed in vitro by providing components of a CRISPR complex comprising the target sequence, the guide sequence to be tested, and a control guide sequence different from the test guide sequence, and comparing the binding or cleavage rates between the test and control guide sequence reactions at the target sequence. Other assays are possible and will be readily available to those skilled in the art.

[0049] The guide sequence can be selected to target any target sequence. In one embodiment, the target sequence is a sequence within the genome of the cell. Exemplary target sequences can include those that are unique within the target genome. For example, for a Cas9 from Streptococcus pyogenes, a unique target sequence within the genome can include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG, wherein NNNNNNNNNNNNXGG (N is A, G, T, or C; X can be anything) has a single occurrence within the genome. A unique target sequence within the genome can include a Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG, wherein NNNNNNNNNNNXGG (N is A, G, T, or C; X can be anything) has a single occurrence within the genome. For Streptococcus thermophilus CRISPR1 Cas9, the unique target sequence within the genome can comprise a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXXAGAAW, wherein NNNNNNNNNNNNXXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence within the genome. The unique target sequence within the genome can comprise a Streptococcus thermophilus CRISPR1 Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXXAGAAW, wherein NNNNNNNNNNNXXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) has a single occurrence within the genome.For Streptococcus pyogenes Cas9, the unique target sequence within the genome can comprise a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGGXG, wherein NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence within the genome. The unique target sequence within the genome can comprise a Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG, wherein NNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence within the genome. In each of these sequences, "M" can be A, G, T, or C.

[0050] In one specific example, the CRISPR / Cas system may include one or more polynucleotides selected from the group consisting of a polynucleotide comprising a base sequence of SEQ ID NO: 1, a polynucleotide comprising a base sequence of SEQ ID NO: 2, and a polynucleotide comprising a base sequence of SEQ ID NO: 3.

[0051] In one specific example, the CRISPR / Cas system may include a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3.

[0052] In one specific example, the polynucleotide can complementarily bind to a gene encoding at least one selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II, and specifically, can bind to at least one site selected from a site consisting of exon 1 to exon 3 of the gene encoding at least one selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II.

[0053] In one specific example, the polynucleotide may include a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 1, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 1.

[0054] In one specific example, the polynucleotide may include a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 2, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 2.

[0055] In one specific example, the polynucleotide may include a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 3, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 3.

[0056] In one specific example, a base sequence comprising a polynucleotide consisting of the base sequence of SEQ ID NOs: 1 to 3 can serve as a gRNA of the CRISPR / CAS system and can target a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II. Specifically, one or more regions selected from regions consisting of exons 1 to 3 of the gene encoding HLA-A, exons 1 to 3 of the gene encoding HLA-B, and exons 1 to 3 of the gene encoding HLA-DRA may be targeted, and more specifically, one or more regions selected from regions consisting of exon 2 of the gene encoding HLA-A, exon 3 of the gene encoding HLA-A, exon 2 of the gene encoding HLA-B, exon 3 of the gene encoding HLA-B, exon 2 of the gene encoding HLA-DRA, and exon 3 of the gene encoding HLA-DRA may be targeted.

[0057] In one specific example, all of the exon 2 region of the gene encoding HLA-A, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA may be targeted.

[0058] In one specific example, the exon 2 region of the gene encoding HLA-A may include a polynucleotide consisting of a base sequence of SEQ ID NO: 4, and the exon 2 region and exon 3 region of the gene encoding HLA-A may include a polynucleotide consisting of a base sequence of SEQ ID NO: 5.

[0059] In one specific example, the polynucleotide consisting of the base sequence of SEQ ID NO: 4 may be a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 4, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 4.

[0060] In one specific example, the polynucleotide consisting of the base sequence of SEQ ID NO: 5 may be a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 5, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 5.

[0061] In one specific example, the exon 2 region of the gene encoding HLA-B may include a polynucleotide consisting of a base sequence of SEQ ID NO: 6, and the exon 2 region and exon 3 region of the gene encoding HLA-B may include a polynucleotide consisting of a base sequence of SEQ ID NO: 7.

[0062] In one specific example, the polynucleotide consisting of the base sequence of SEQ ID NO: 6 may be a polynucleotide consisting of a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 6, for example, a polynucleotide consisting of a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 6.

[0063] In one specific example, the polynucleotide comprising the base sequence of SEQ ID NO: 7 may be a polynucleotide comprising a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 7, for example, a polynucleotide comprising a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 7.

[0064] In one specific example, the exon 2 region of the gene encoding the HLA-DRA may include a polynucleotide consisting of the base sequence of SEQ ID NO: 8, and the exon 2 region and the exon 3 region of the gene encoding the HLA-DRA may include a polynucleotide consisting of the base sequence of SEQ ID NO: 9.

[0065] In one specific example, the polynucleotide comprising the base sequence of SEQ ID NO: 8 may be a polynucleotide comprising a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 8, for example, a polynucleotide comprising a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 8.

[0066] In one specific example, the polynucleotide comprising the base sequence of SEQ ID NO: 9 may be a polynucleotide comprising a base sequence having 70% or more homology with the base sequence of SEQ ID NO: 9, for example, a polynucleotide comprising a base sequence having 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more or 100% homology with the base sequence of SEQ ID NO: 9.

[0067] In one specific example, the CRISPR / Cas system may include a Cas9 (CRISPR associated protein 9) protein or a gene encoding a Cas9 protein and a NLS (Nuclear Localization Signal) protein or a gene encoding an NLS protein.

[0068] In one specific example, the "system" may include a complex of a nucleic acid and a Cas protein, wherein the nucleic acid includes at least one selected from the group consisting of a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3, and specifically, a complex of a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3; and a Cas protein. More specifically, the Cas protein may be a Cas9 protein.

[0069] In one specific example, with respect to RNPs, preformed RNPs can be introduced into cells to initiate target genomic DNA editing. This RNP-based delivery has the advantage of reducing off-target effects compared to vector delivery and enabling direct delivery of the Cas protein and gRNA to the nucleus of the cell.

[0070] To form ribonucleoproteins (RNPs), Cas proteins and gRNAs can be synthesized and purified individually to produce RNPs. In some cases, Cas proteins and cleavage factor RNAs can be directly expressed via plasmids, and then the self-assembled RNPs can be purified.

[0071] In addition, the "system" may be a vector including a polynucleotide encoding at least one selected from the group consisting of a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3; and a polynucleotide encoding a Cas protein; and a vector including a polynucleotide encoding a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3; and a polynucleotide encoding a Cas protein. More specifically, the Cas protein may be a Cas9 protein.

[0072] In one specific example, a polynucleotide encoding at least one selected from the group consisting of a polynucleotide comprising the base sequence of SEQ ID NO: 1, a polynucleotide comprising the base sequence of SEQ ID NO: 2, and a polynucleotide comprising the base sequence of SEQ ID NO: 3; and a polynucleotide encoding a Cas protein may be contained in the same vector, or may be contained in different vectors.

[0073] The above term "vector" refers to a means for expressing a target gene in a host cell. For example, it may include a plasmid vector, a cosmid vector, a bacteriophage vector, an adenovirus vector, a retrovirus vector, and a viral vector such as an adeno-associated virus vector. A vector that can be used as the above recombinant vector can be produced by manipulating a plasmid (e.g., V1k_GE, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, and pUC19, etc.), a phage, or a virus (e.g., SV40, etc.) that is frequently used in the art.

[0074] In the above vector, a gene encoding a guide RNA that binds to a gene encoding at least one selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II, a gene encoding the Cas protein, and a gene encoding the NLS may be operably linked to a promoter. The term "operably linked" refers to a functional linkage between a nucleotide expression regulatory sequence (e.g., a promoter sequence) and another nucleotide sequence. The regulatory sequence can regulate transcription and / or translation of another nucleotide sequence by being "operably linked."

[0075] In one specific example, the CRISPR / Cas system may be delivered to cells by electroporation.

[0076] The term "hypoimmunogenicity" above means that the cells, when transplanted into another organism, exhibit a reduced or eliminated immune rejection response compared to the wild type. The immune rejection response may be reduced by at least 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100%.

[0077] In another example, the immunogenicity of genetically engineered stem cells was analyzed, and it was confirmed that the expression levels of HLA-A, HLA-B, and HLA-DRA were significantly reduced compared to the parent cells both when IFNγ stimulation was given and when it was not given, and it was also confirmed that central memory T cells (TCM) and effector memory T cells (TEM) did not proliferate, indicating that the genetically engineered stem cells do not exhibit immunogenicity (see Example 4).

[0078] The above "stem cell" refers to an undifferentiated cell that has the ability to self-replicate and differentiate into two or more different types of cells. The stem cell may be an autologous or allogeneic stem cell.

[0079] At this time, the stem cell may be an induced pluripotent stem cell, an embryonic stem cell, a somatic cell nuclear transfer embryonic stem cell, or an adult stem cell, and specifically, may be an induced pluripotent stem cell.

[0080] The above "induced pluripotent stem cells" refer to cells that are induced to have pluripotent differentiation capacity through an artificial dedifferentiation process from differentiated cells, and are also called induced stem cells. The artificial dedifferentiation process may be performed by using viral or non-viral vectors such as retrovirus, lentivirus, and Sendai virus, or by introducing non-viral induced differentiation factors such as proteins and cell extracts, or may include a dedifferentiation process using stem cell extracts, compounds, etc. Induced pluripotent stem cells have almost the same characteristics as embryonic stem cells, specifically, they show a similar cell shape, have similar gene and protein expression patterns, have pluripotency in vitro and in vivo, form teratomas, and when inserted into a mouse blastocyst, form chimera mice, and germline transmission of genes is possible.

[0081] Induced pluripotent stem cells include induced pluripotent stem cells derived from any species, including humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, rats, or rabbits, but may specifically be induced pluripotent stem cells derived from humans.

[0082] The somatic cells before the above-mentioned induced pluripotent stem cells are dedifferentiated may be somatic cells derived from umbilical cord, umbilical cord blood, blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, amniotic fluid, or placenta. Specifically, the somatic cells may include peripheral blood mononuclear cells, fibroblasts, hepatocytes, adipocytes, epithelial cells, epidermal cells, chondrocytes, muscle cells, cardiac muscle cells, melanocytes, neural cells, glial cells, astroglial cells, monocytes, macrophages, and the like, and more specifically, may be induced pluripotent stem cells derived from peripheral blood mononuclear cells.

[0083] In one specific example, the human leukocyte antigen class I may be at least one selected from the group consisting of HLA-A and HLA-B, and may include both HLA-A and HLA-B.

[0084] In one specific example, the human leukocyte antigen class II may be HLA-DRA.

[0085] In one specific example, the stem cell can express at least one protein selected from the group consisting of OCT4, SSEA4, NANOG, SOX2, ESRRB, TRA-1-60, SOX17, BRACHYURY and PAX 6 at the same level as the parent cell, and specifically, can express at least one protein selected from the group consisting of OCT4, SSEA4, NANOG, TRA-1-60, SOX17, BRACHYURY and PAX 6 at the same level as the parent cell.

[0086] In another example, the degree of expression of pluripotency markers of genetically engineered stem cells was analyzed, and it was confirmed that the pluripotency markers OCT4, SSEA4, NANOG, and TRA-1-60 were expressed at a level similar to that of the parent cells that had not been genetically engineered. In addition, it was confirmed that the markers SOX17, BRACHYURY, and PAX 6, which indicate differentiation potential for differentiation into three germ layers, were expressed at a level similar to that of the parent cells (see Example 3).

[0087] In another example, the differentiation potential of genetically engineered stem cells into mesodermal lineage endothelial cells was confirmed, and it was confirmed that they differentiated into endothelial cells through mesoderm, similar to the parent cells, and expressed both endothelial cell markers CD31 and VE-Cadherin (Example 5).

[0088]

[0089] Another aspect provides a method for producing hypoimmunogenic stem cells, comprising the step of genetically engineering stem cells to have reduced expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II.

[0090] The above “human leukocyte antigen”, “stem cell” and “low immunogenicity” may be within the ranges described above.

[0091] In one specific example, the genetically manipulating step may be genetically manipulating one or more regions selected from the group consisting of exon 1 to exon 3 of a gene encoding HLA-A, exon 1 to exon 3 of a gene encoding HLA-B, and exon 1 to exon 3 of a gene encoding HLA-Dra of the stem cell, and specifically, may be genetically manipulating one or more regions selected from the group consisting of exon 2 of a gene encoding HLA-A, exon 3 of a gene encoding HLA-A, exon 2 of a gene encoding HLA-B, exon 3 of a gene encoding HLA-B, exon 2 of a gene encoding HLA-DRA, and exon 3 of a gene encoding HLA-DRA of the stem cell. More specifically, it may be a method of genetically manipulating one or more regions selected from the group consisting of the exon 2 region of the gene encoding HLA-A of the stem cell, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA.

[0092] In one specific example, the genetically manipulating step may be genetically manipulating all of the exon 2 region of the gene encoding HLA-A, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA of the stem cells.

[0093] The term "genetic engineering" or "genetically engineered" refers to the act of introducing one or more genetic modifications into a cell or a cell produced thereby.

[0094] Additionally, the genetic manipulation may be induced by a gene editing system to modify the base sequence of a gene encoding one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II. The gene editing system may be, for example, a meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR / Cas system, or the like.

[0095] The above Cas protein can form an active endonuclease or nickase when it forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). Non-limiting examples of the above Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, a homolog thereof or a homolog thereof. It may include a modified version, specifically Cas9. These enzymes are known; for example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein is available from the SwissProt database under accession number Q99ZW2. In one embodiment, the unmodified CRISPR enzyme, e.g., Cas9, has DNA cleavage activity.

[0096] In one specific example, the CRISPR enzyme may be a Cas9 protein, and the Cas9 protein may be one or more Cas9 proteins selected from the group consisting of a Cas9 protein derived from Streptococcus pyogenes, a Cas9 protein derived from Campylobacter jejuni, a Cas9 protein derived from Streptococcus thermophiles, a Cas9 protein derived from Streptococcus aureus, and a Cas9 protein derived from Neisseria meningitidis, and specifically, a Cas9 protein derived from Streptococcus pyogenes. In one embodiment, the Cas9 protein is codon-optimized for expression in a eukaryotic cell, and when using the Streptococcus pyogenes derived Cas9 protein, the expression or activity of one or more selected from the group consisting of human leukocyte antigen class I and human leukocyte antigen class II or a gene encoding the same can be maximally reduced.

[0097] The term “nuclear localization sequence or signal (NLS)” refers to an amino acid sequence that functions to transport a specific substance (e.g., a protein) into the cell nucleus, and generally functions to transport it into the cell nucleus through a nuclear pore. Although the nuclear localization sequence is not required for the activity of the CRISPR complex in eukaryotes, it is believed that including such a sequence enhances the activity of the system, particularly targeting nucleic acid molecules in the nucleus.

[0098] Additionally, RNA-guided CRISPR (clustered regularly interspaced short palindrome repeats)-associated nuclease Cas9 offers a breakthrough technology for knockout, transcriptional activation, and repression of target genes using a single guide RNA (sgRNA) (i.e., crRNA-tracrRNA fusion transcript), and this technology is known to target numerous genetic loci.

[0099] The Cas9 (or Cpf1) protein refers to an essential protein component in the CRISPR / Cas9 system, and information on the Cas9 (or Cpf1) gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI). CRISPR-associated genes encoding Cas (or Cpf1) proteins are known to exist in more than 40 different Cas (or Cpf1) protein families, and eight CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube) can be defined according to specific combinations of Cas genes and repeat structures. Therefore, each of the above CRISPR subtypes can form a repeat unit to form a polyribonucleotide-protein complex.

[0100] The genetic manipulation that is artificially performed so that the expression or activity of at least one gene encoding at least one selected from the group consisting of human leukocyte antibody class I and HLA human leukocyte antibody class II is reduced may be such that at least one selected from the group consisting of human leukocyte antibody class I and human leukocyte antibody class II is not expressed in a protein form having its original function. The manipulation of the gene may be induced by at least one of the following:

[0101] 1) Deletion of all or part of the gene encoding HLA class I and / or HLA class II, e.g., deletion of 1 bp or more of the nucleotides of the gene encoding HLA class I and / or HLA class II, e.g., deletion of 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide,

[0102] 2) Substitution of 1 bp or more of the nucleotides of the gene encoding HLA class I and / or HLA class II, for example, 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide, with a nucleotide different from the original (parent cell),

[0103] 3) insertion of one or more nucleotides, e.g., 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide (each independently selected from A, T, C, and G) into any position of the target gene, and

[0104] 4) A combination of two or more selected from 1) to 3) above.

[0105] In one embodiment, the gene editing system can be introduced into cells by electroporation, a gene gun, sonoporation, magnetofection, transient cell compression, or cell squeezing.

[0106] The term "introduction" above may refer to inserting a nucleic acid and protein complex into a cell, or may refer to inserting a vector comprising a polynucleotide encoding a nucleic acid and a protein into a cell.

[0107] In one specific example, the genetically manipulating step may be performed by introducing into the stem cell a CRISPR / Cas system comprising at least one selected from the group consisting of a polynucleotide comprising a base sequence of SEQ ID NO: 1, a polynucleotide comprising a base sequence of SEQ ID NO: 2, and a polynucleotide comprising a base sequence of SEQ ID NO: 3.

[0108] In one specific example, a base sequence comprising a polynucleotide consisting of the base sequences of SEQ ID NOS: 1 to 3 can serve as a gRNA of the CRISPR / CAS system and can target a gene encoding one or more selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II. Specifically, one or more regions selected from regions consisting of exons 1 to 3 of the gene encoding HLA-A, exons 1 to 3 of the gene encoding HLA-B, and exons 1 to 3 of the gene encoding HLA-DRA may be targeted, and more specifically, one or more regions selected from regions consisting of exon 2 of the gene encoding HLA-A, exon 3 of the gene encoding HLA-A, exon 2 of the gene encoding HLA-B, exon 3 of the gene encoding HLA-B, exon 2 of the gene encoding HLA-DRA, and exon 3 of the gene encoding HLA-DRA may be targeted.

[0109] In one specific example, all of the exon 2 region of the gene encoding HLA-A, the exon 2 region of the gene encoding HLA-B, and the exon 2 region of the gene encoding HLA-DRA may be targeted.

[0110]

[0111] In one aspect, low immunogenicity, universal induced pluripotent stem cells can be useful in developing cell therapy products using them as a source because they have low immunogenicity and do not cause immune rejection in the recipient's body when used for allogeneic transplantation for the purpose of treating diseases.

[0112]

[0113] Figure 1 is a schematic diagram showing the overall method for producing iPSCs with triple HLA gene knockout and the results thereof.

[0114] Figure 2 is a diagram showing the results of evaluating the effectiveness of gRNA used for knockout and confirming that the gene was knocked out, and whether the HLA gene and protein were expressed when IFN γ stimulation was applied to the manufactured iPSC.

[0115] Figure 3 is a diagram showing the results of an experiment that can confirm the morphology and karyotype of the manufactured iPSC and its pluripotency.

[0116] Figure 4 is a diagram showing the results of an experiment confirming the in vitro immunogenicity evaluation using PBMC or NK cells when IFN γ stimulation was applied to manufactured iPSCs.

[0117] Figure 5 is a diagram showing the results of an experiment confirming the differentiation ability of manufactured iPSCs into endothelial cells and the expression of HLA proteins.

[0118]

[0119] Hereinafter, the present invention will be described in detail by way of examples to specifically explain the present invention.

[0120] Manufacturing example

[0121] Manufacturing Example 1. Preparation of induced pluripotent stem cells

[0122] The applicant prepared his own induced pluripotent stem cells (iPSCs). The results of HLA type analysis of the iPSCs are shown in [Table 1] below.

[0123] LocusAllele 1Allele 2HLA A11:01:01:0129:01:01:01HLA B13:02:01:0158:01:01:01HLA C03:02:02:0102:02:02:01HLA DRB 107:01:01:0115:01:01:02HLA DRA01:02:0101:01:02

[0124] Manufacturing Example 2. Manufacturing of iPSCs with triple HLA gene knockout - g RNA design

[0125] To create hypoimmunogenic iPSCs without immune rejection, we used YiP3, a PBMC (Peripheral Blood Mononuclear Cell)-derived iPSC line that has different alleles of the HLA gene on chromosome 6. In the case of the YiP3 line, each allele of HLA-A had HLA-A 11:01:01:01 and HLA-A 29:01:01:01, HLA-B had HLA-B 13:02:01:01 and HLA-B 58:01:01:01, HLA-C had HLA-C 03:02:02 and HLA-C 02:02:02, and HLA-DRA had HLA-DRA 01:02:01 and HLA-DRA 01:01:02. A knockout strategy was established to knock out HLA-A and HLA-B, which exhibit polymorphism in HLA class 1, using CRISPR / CAS9 as the knockout region, knock out HLA-DRA to eliminate HLA-DR, which exhibits polymorphism in HLA class 2, and leave HLA-C, which is known to be minor in polymorphism (Figures 1a and 1b).

[0126] CRISPR / CAS9 was used as a gene knockout system, and the PAM site (NGG) was designed to exist in the part excluding the heterogeneous region in the HLA-A gene and to allow 20 base pairs to function as biallelic genes. For each gene, each allele was aligned using the IPD-IMGT / HLA DATA base, and for HLA-A, the g RNA, G0002-HLA-A-g1 (+, ACAGCGACGCCGCGAGCCAG, PAM: AGG), located within codons 37 to 43 in exon 2, for HLA-B, the g RNA, G0002-HLA-B-g1 (-, GCTGTCGAACCTCACGAACT, PAM: GGG), located within codons 31 to 38 in exon 2, and for HLA-DRA, the g RNA, G0002-HLA-DRA-g2 (+, TGGCAAAGAAGGAGACGGTC, PAM: TGG), located within codons 36 to 42 in exon 2, were designed (Figs. 1a to 1e).

[0127] GeneGuide RNA sequenceSEQ ID NO:HLA-AACAGCGACGCCGCGAGCCAG1HLA-BGCTGTCGAACCTCACGAACT2HLA-DRATGGCAAAGAAGGAGACGGTC3

[0128] Example

[0129] Example 1. Validation of gRNA

[0130] An experiment was conducted to confirm the effectiveness of the gRNA manufactured in Manufacturing Example 1 above. On Day 0, 10,000 iPSCs were mixed with CRISPR / CAS9 Reagent (RNP complex) and electroporated. These were then seeded on plates and cultured in an incubator at 37°C. On Day 3, transfected cells were collected for each candidate g RNA through flow cytometry sorting, and a total of 10,000 cells were collected for analysis. The transfected bulk iPSCs were analyzed by PCR and Sanger sequencing. Afterwards, ICE (interlaced chain reaction) analysis was performed to evaluate the effectiveness of g RNA.

[0131] As a result of the experiment, among the candidates for g RNA of HLA-A, G0002-HLA-A-g1 showed an efficiency of 91%, G0002-HLA-Bg 1, which is a g RNA of HLA-B, showed an efficiency of 78%, and G0002-HLA-DRA-g2, which is a g RNA of HLA-DRA, showed an efficiency of 86% (Figs. 2a to 2c).

[0132]

[0133] Example 2. Confirmation of triple HLA gene knockout in iPSCs

[0134] On Day 0, one million iPSCs were mixed with CRISPR / CAS9 Reagent (RNP complex) and electroporated. To determine the RNP complex conditions, two conditions of 40 μg each gRNA and 80 μg each gRNA were performed, and the degree of KO of each gene was analyzed using ICE analysis.

[0135] On Days 3-5, transfected cells were collected and single cell cloning was performed through fax analysis. Approximately 10,000 cells were collected and EP (Electrostatic Potential) pool analysis was performed. From Day 5 to Day 11-13, the genotype of the transfected EP pool was analyzed through Next Generation Sequencing (NGS). Then, 48 single clones were collected by seeding in 96-well plates. From Days 11-13 to Days 25-28, each clone was screened and genotyped through PCR and Sanger sequencing. After this, clones with six triple HLA genes knocked out were collected, and cells with the final HLA-A, HLA-B, and HLA-DRA genes manipulated were finally selected through NGS analysis.

[0136] The genotyping results of cells with triple HLA gene knockout were finally confirmed by performing further sequencing verification, and the sequencing verification results confirmed that 1 bp was inserted as a Homo type in the HLA-A region, 28 bp was deleted in the HLA-B region, and 1 bp was deleted in the HLA-DRA region (Figs. 2d to 2f).

[0137] When confirmed through PCR, it was confirmed that the expression of each gene for HLA-A, HLA-B, and HLA-DRA was reduced in genetically engineered cells (Fig. 2g).

[0138] Flow cytometry analysis confirmed the expression of HLA-A, HLA-B, and HLA-DR in iPSCs that had been genetically modified without any stimulation. As a result, they were not expressed at the protein level, and HLA-C, which was not genetically modified, was not expressed either. When IFNγ was stimulated in iPSCs for two days to activate HLA proteins, it was confirmed that the protein expression of HLA-A, HLA-B, and HLA-C increased in YiP3 before genetic modification, and HLA-A increased by 99.03%, HLA-B by 91.61%, HLA-C by 88.35%, and HLA-DR by 0.04%. In contrast, in the case of genetically modified iPSCs, HLA-A was significantly reduced by 0.07%, HLA-B by 0.15%, and HLA-DR by 0.02%. In the case of HLA-C, which was not a genetically modified region, protein expression was confirmed to be not reduced by 97.34% (Fig. 2h). This indicates that HLA-A, HLA-B, and HLA-DRA were selectively knocked out as a result of genetic manipulation, and this can be confirmed at the protein level.

[0139]

[0140] Example 3. Characterization of genetically engineered cells

[0141] To analyze the characteristics of genetically modified cells, comparative experiments were performed with YiP3 before genetic modification.

[0142] Alkaline Phosphatase (AP) staining was performed to confirm morphology and differentiation potential. iPSCs were seeded at low density on VTN-N-coated 6-well culture dishes and cultured for 5 days to form colonies. The dishes were washed with 1 mL of 0.05% PBST and fixed with 1 mL of 4% PFA for 10 min at RT. The cells were washed once with 1 mL of 0.05% PBST, and 1 mL of a staining solution containing Fast Red Violet, Naphthol AS-BI phosphate solution, and TDW (Sigma, SCR004) was added and incubated in the dark at room temperature for 30 min. Afterwards, the cells were washed once with 0.05% PBST and twice with 1 × DPBS.

[0143] Analysis of the alkaline phosphatase (AP) staining pattern confirmed that the genetically modified cells had a colony shape and were undifferentiated (Figures 3a and 3b).

[0144] RNA isolation was performed using TRIZOL reagent (Invitrogen, 15596026). cDNA was synthesized from the isolated RNA using the RevertAid First Strand cDNA synthesis kit (ThermoFisher, K1622). qRT-PCR (Quantitative Real-Time PCR) was performed using a QuantStudio 3 instrument (Applied Biosystems) and Power SYBR Green PCR Master Mix (Applied Biosystems, 4367659). At the mRNA level, pluripotency markers OCT4, SOX2, KLF4, LIN28, and NANOG were expressed, while SOX17, an endoderm differentiation marker, BRACHYUARY, a mesoderm differentiation marker, and PAX6, an ectoderm differentiation marker, were not expressed (Fig. 3c).

[0145]

[0146] To compare the expression of pluripotency markers at the protein level of each clone with YiP3, flow cytometry was performed to compare the expression of OCT4, SSEA4, NANOG, TRA-1-60, and the negative marker CD34. For FACS analysis, cells were dissociated using 1 X TrypLE Express Enzyme and fixed with Fixation and Permeabilization solution (BD, 554722) for 20 minutes at 4°C. Wash twice with 1 X Perm / Wash solution (BD, 554723), and react with antibodies APC - conjugated HLA-A (BD, 568024), BV510 - conjugated HLA-B (BD, 752615), PE - conjugated HLA-C (BD, 566372), FITC - conjugated HLA-DR (Invitrogen, 11-9956-42), and APC - conjugated mouse Ig G (BD, 554681), BV510 - conjugated Ig G (BD, 563039), PE - conjugated mouse Ig G (BD, 555058), FITC - conjugated mouse Ig G (Invitrogen, 11-4732-42) as respective isotype controls at 4 ℃ for 40 minutes. Afterwards, cells were washed twice with 1X Perm / Wash solution and analyzed using an Attune NxT instrument (Invitrogen).

[0147] Flow cytometry analysis confirmed that the genetically engineered cells expressed pluripotency markers at levels similar to YiP3 (Figures 3d and 3e).

[0148] To investigate the differentiation ability of iPSCs before and after genetic manipulation into the three germ layer lineages, differentiation was induced using the STEMdiff Trilineage Differentiation Kit (STEMCELL technology, 05230). Cells were seeded at 2.0 x 10 in 24-well plates coated with 1 ug / mL iMatrix-511MG (Nippi, MX892012). 5 cells / well (ectoderm, endoderm) or 1.0 x 10 5 Cells were cultured at a density of 10 cells / well (mesoderm), and 10 μm Y-27632 was added together. For differentiation into ectoderm, the medium was changed daily for 1 week, and for differentiation into mesoderm or endoderm, the medium was changed daily for 5 days. For immunostaining, cells were fixed with 4% paraformaldehyde and immunofluorescence staining was performed.

[0149] As a result, we confirmed the expression of markers SOX17, BRACHYURY, and PAX6 in iPSCs after genetic manipulation, thereby confirming that the differentiation potential of genetically manipulated iPSCs was the same as that of YiP3 (Fig. 3f).

[0150] Next, we performed karyotype analysis to confirm that the genetically modified iPSCs had a normal karyotype with no numerical or structural abnormalities despite the genetic manipulation compared to YiP3 (Fig. 3g).

[0151]

[0152] Example 4. In vitro immunogenicity analysis

[0153] In addition, to determine whether genetically engineered iPSCs have immune evasion, T cells from PBMCs with different YiP3 and HLA types were isolated and co-cultured to determine the degree of proliferation of effector memory T cells (TEM) and central memory T cells (TCM).

[0154] First, donors with different YiP3 and HLA types for each allele were selected, and PBMCs from donors with allele 1 of HLA-A 02:01, HLA-B 15:01, HLA-C 01:02, and HLA-DRB1 11:01 and allele 2 of HLA-A 02:07, HLA-B 46:01, HLA-C 04:01, and HLA-DRB1 15:02 were selected (Fig. 4a). Both YiP3 before genetic manipulation and iPSCs after manipulation were cultured after IFN γ stimulation for two days before co-culture with PBMCs. After removing T cells from PBMCs from donors with different HLA types, the proliferation of T cells activated by antigens presented by antigen-presenting cells in PBMCs was analyzed. YiP3, genetically engineered iPSCs and T cell-depleted PBMCs, CFSE-labeled CD4 + After stimulation through co-culture of T cells, CD4 + TCM(CD3 + CD4 + CD45RO + CD62L + ) and CD4 + TEM(CD3 + CD4 + CD45RO + CD62L - ) Cell proliferation was evaluated by analyzing it using a flow cytometer.

[0155] CD4 + Immunogenicity assays were performed to evaluate T cell responses. PBMCs were cultured at 37 °C in a 5% CO 2 Cultured in AIM-V medium (Gibco, 12055-083) for 1 day in an incubator. CD4 + CD4 to classify T cells + A T cell isolation kit (Miltenyi, 130-096-533) was used. Collected CD4 +T cells were added with 0.5 μm CFSE (Invitrogen, C34554) and incubated in a dark room at 37 °C for 10 minutes, and washed once with 1 X DPBS.

[0156] CD4 - CD3 in PBMCs - / CD4 - CD3 microbeads (Miltenyi, 130-050-101) were used to obtain cells. The obtained CD3 - / CD4 - Cells were cultured for 20 minutes with 10 μg / ml Mitomycin C, and then washed with AIM-V medium. CD3 - / CD4 - PBMC 3.0 x 10 5 CD4 cells labeled with CFSE + T, 4 x 10 5 Cells were co-cultured in 24-well plates. 3 x 10 of each type were seeded to induce direct alloantigen stimulation. 3 iPSCs were added to each well and cultured in an incubator at 37°C for 1 week after treatment with 1 mg / ml of IL-2. To confirm the immunogenicity of iPSCs, CFSE-labeled CD4 + T cell proliferation was analyzed by flow cytometry. The remaining cells were further stimulated with CD3 for 7 days. - / CD4 - PBMCs, 3.0 x 10 5 Cells and iPSCs, 3.0 x 10 3 Cells were added and co-cultured and analyzed weekly for a total of 3 weeks to assess long-term immunogenicity.

[0157] PBMC on the first day of coculture, CFSE-labeled CD4 + After co-culture with TCM for 7 days, the results of analysis showed that in the case of YiP3 without genetic modification, CD4 +TCM increased slightly and T cell depletion was observed again on day 7 - after stimulation with PBMC and IFNγ-stimulated YiP3 and genetically modified iPSCs, cells were collected on day 14 and 21 and analyzed, and CFSE-labeled CD4 + TCM was found to increase with YiP3, whereas in HLA-gene-manipulated iPSCs, it was not increased compared to YiP3. CFSE-labeled CD4 + Similar patterns were observed in the co-culture results with TEM. This confirmed that the HLA types of iPSCs manipulated with HLA-A, HLA-B, and HLA-DRA genes did not exhibit immunogenicity when co-cultured with PBMCs of different HLA types (Figs. 4b to 4d).

[0158] To determine whether genetically engineered iPSCs have significantly lower immunogenicity, the expression level of CD107a, a NK cell activation marker, was examined.

[0159] First, NK cells were isolated from peripheral blood mononuclear cells (Fig. 4e) of different donors with different HLA types (HLA-A 30:04, HLA-A 02:03, HLA-B 38:02, HLA-B 14:01, HLA-DRB1 15:02, HLA-DRB1 07:01), stimulated with IL-2, and co-cultured with genetically engineered iPSCs. After 6 hours of co-culture, the proportion of cells expressing CD107a, an activation marker of NK cells, was measured by flow cytometry. The proportion of cells expressing CD107a was 6.71% in non-genetically engineered iPSCs, whereas it was 1.37% in genetically engineered iPSCs (Fig. 4f).

[0160] That is, it can be confirmed that the activity level of NK cells was significantly reduced in genetically modified iPSCs compared to non-genetically modified stem cells (p < 0.01, compared to non-genetically modified stem cells) (Fig. 4g).

[0161]

[0162] Example 5. Confirmation of differentiation potential and Western blot

[0163] To confirm the degree of differentiation of genetically engineered iPSCs into endothelial cells, a mesodermal lineage, differentiation was induced. As a result of differentiation induction, YiP3 and genetically engineered iPSCs differentiated into endothelial cells (ECs) through hematopoietic mesoderm, and the differentiated morphology was similar to primary ECs. When the population of cells expressing both the EC markers CD31 and VE-Cadherin was confirmed by flow cytometry, it was confirmed to be 95.69% for YiP3 and 91.9% for genetically engineered iPSCs. These results showed that the genetically engineered iPSCs had a differentiation rate of over 90% into endothelial cells, similar to YiP3, and it was confirmed that there was no abnormality in their differentiation potential (Figures 5a and 5b).

[0164] Western blot was performed to confirm protein expression of HLA-A, HLA-B, and HLA-C in EC cells differentiated from iPSCs with or without IFNγ stimulation.

[0165] 5.0 x 10 per mL to lyse cells 61 X proteinase cocktail (Invitrogen, 78430) was added to the RIPA lysis buffer (Invitrogen, 89901) of the cells and incubated for 10 minutes in a refrigerated state. After centrifugation at 13,200 x g for 20 minutes, the lysate was collected and the protein concentration was measured using the BCA assay kit (Invitrogen, 23227). 4X LDS sample buffer (Invitrogen, B0007) and 10 X reducing agent (Invitrogen, B0009) were mixed with the cell lysate according to the sample concentration, boiled for 5 minutes, and each sample was separated by electrophoresis on 4-12% Bis-Tris PAGE gels (Invitrogen, NW04125BOX). Then, the proteins were transferred to PVDF membranes via i-Blot and blocked with 5% skim milk for 1 hour to block nonspecific binding. Primary antibodies HLA-A (Abcam, ab52922, 1:5,000), HLA-B (Abcam, ab193415, 1:1,000), HLA-C (Abcam, ab126722, 1:1,000), HLA-DR (Abcam, ab92511, 1:1,000), HLA-DRA (Proteintech, PTG-17221-1-AP, 1:1:000), β-Actin (SantaCruz, sc-47778 HRP, 1:1,000) were diluted in 5% skim milk, and the membranes were incubated overnight at 4°C. The membrane was washed three times with 1X PBS-T buffer on an orbital shaker and then incubated with secondary antibody diluted 1:10,000 for 1 hour. The membrane was then washed three times and detected using Advansta ECL reagent (K-12045) on an iBright 1500 instrument (Invitrogen).

[0166] Western blot results showed that when there was no IFNγ stimulation, HLA-A, HLA-B, and HLA-C proteins were not expressed, but when there was IFNγ stimulation, HLA-A and HLA-B proteins were expressed in YiP3 that had not been genetically modified, and in the case of genetically modified iPSCs, HLA-A and HLA-B proteins were not expressed. In addition, it was confirmed that HLA-C, which had not been genetically modified, was present in both YiP3 and genetically modified iPSCs (Fig. 5c).

[0167] As a result, it was confirmed that when iPSCs with HLA-A, HLA-B, and HLA-DRA knockout were differentiated into ECs, they could differentiate into cells expressing EC markers and did not express HLA-A and HLA-B proteins. For reference, HLA-DRA protein could not be confirmed in differentiated EC cells.

Claims

1. A hypoimmunogenic stem cell genetically engineered to have reduced expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II compared to the parent cell.

2. A stem cell according to claim 1, wherein the human leukocyte antigen class I is at least one selected from the group consisting of HLA-A, HLA-B, and HLA-C.

3. A stem cell according to claim 1, wherein the human leukocyte antigen class II is at least one selected from the group consisting of HLA-DR, HLA-DP, and HLA-DQ.

4. In claim 1, the stem cell is a stem cell in which at least one region selected from the group consisting of an exon region of a gene encoding HLA-A, an exon region of a gene encoding HLA-B, and an exon region of a gene encoding HLA-DRA is genetically engineered.

5. In claim 4, the stem cell is a stem cell in which at least one region selected from the group consisting of an exon 2 region of a gene encoding HLA-A, an exon 3 region of a gene encoding HLA-A, an exon 2 region of a gene encoding HLA-B, an exon 2 region of a gene encoding HLA-B, an exon 3 region of a gene encoding HLA-B, an exon 2 region of a gene encoding HLA-DRA, and an exon 3 region of a gene encoding HLA-DRA is genetically engineered.

6. In claim 1, the stem cell is a stem cell genetically engineered through an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR / Cas system, X-ray irradiation, gamma ray irradiation, ethyl methanesulfonate treatment, or dimethyl sulfate treatment.

7. A stem cell according to claim 6, wherein the CRISPR / Cas system comprises at least one polynucleotide selected from the group consisting of a polynucleotide consisting of a base sequence of sequence number 1, a polynucleotide consisting of a base sequence of sequence number 2, and a polynucleotide consisting of a base sequence of sequence number 3.

8. In claim 1, the stem cell is an induced pluripotent stem cell.

9. In claim 1, the stem cell is a stem cell derived from one or more selected from the group consisting of umbilical cord, umbilical cord blood, blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, amniotic fluid, and placenta.

10. A method for producing low immunogenic stem cells, comprising the step of genetically engineering stem cells so that the expression of one or more human leukocyte antigens selected from the group consisting of human leukocyte antigen (HLA) class I and human leukocyte antigen class II is reduced compared to parent cells.

11. A method according to claim 10, wherein the genetically manipulating step genetically manipulates at least one region selected from the group consisting of an exon region of a gene encoding HLA-A, an exon region of a gene encoding HLA-B, and an exon region of a gene encoding HLA-DRA of the stem cell.

12. A method according to claim 11, wherein the genetically manipulating step genetically manipulates at least one region selected from the group consisting of an exon 2 region of a gene encoding HLA-A, an exon 3 region of a gene encoding HLA-A, an exon 2 region of a gene encoding HLA-B, an exon 2 region of a gene encoding HLA-B, an exon 3 region of a gene encoding HLA-B, an exon 2 region of a gene encoding HLA-DRA, and an exon 3 region of a gene encoding HLA-DRA.

13. A method according to claim 10, wherein the genetically manipulating step is performed by introducing a CRISPR / Cas system into a stem cell, the CRISPR / Cas system including at least one selected from the group consisting of a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, and a polynucleotide consisting of a base sequence of SEQ ID NO: 3.

Citation Information

Patent Citations

  • System for controlling waste heat and heat source by using organic rankine cycle of ship and ship having the same

    KR1020230034526A

  • Apparatus of return cast iron

    KR102153705B1