Products and methods to inhibit expression of dynamin-1 variants and replace dynamin-1
Patent Information
- Application Number
- PCT/US2025/017354
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-26
- Filing Date
- 2025-02-26
- Publication Date
- 2025-10-30
AI Technical Summary
Current treatments for developmental and epileptic encephalopathy (DEE) associated with pathogenic dynamin-1 (DNM1) variants are limited to symptom management and do not address the underlying genetic defect, offering no hope of stopping or slowing disease progression, and antiepileptic drugs often lose efficacy over time.
RNA interference-based products, such as vectors and nanoparticles, are used to inhibit the expression of pathogenic DNM1 variants, while DNA-based products deliver DNM1 replacement genes, including RNAi-resistant forms, to restore normal DNM1 function.
The approach significantly reduces endogenous DNM1 variant expression and promotes the expression of functional DNM1, leading to improved survival and functional correction of neuronal phenotypes in mouse models of DEE, with potential therapeutic benefits for human patients.
Smart Images

Figure IMGF000022_0001 
Figure IMGF000023_0001 
Figure IMGF000024_0001
Abstract
Description
[0001] PRODUCTS AND METHODS TO INHIBIT EXPRESSION OF DYNAMIN-1 VARIANTS AND REPLACE DYNAMIN-1
[0002] STATEMENT OF U.S. GOVERNMENT INTEREST
[0003] [1] This invention was made with government support under NS031348 and NS111808 awarded by The National Institutes of Health. The government has certain rights in the invention.
[0004] INCORPORATION BY REFERENCE OF THE SEQUENCE LISTING
[0005] [2] This application contains, as a separate part of disclosure, a Sequence Listing in computer-readable form (Filename: 70329_SeqListing.xml; Size: 64,215 bytes; Created: January 29, 2025) which is incorporated by reference herein in its entirety.
[0006] FIELD
[0007] [3] This disclosure relates to the field of gene therapy in the treatment of diseases or disorders associated with the expression of pathogenic variants of the dynamin-1 (DNM1) gene. RNA interference(RNAi)-based products to inhibit the expression of DNM1 pathogenic variants and DNA-based DNM1 gene replacement products are provided. The products include delivery vehicles, such as vectors, nanoparticles, extracellular vesicles, and / or exosomes to deliver DNAs encoding RNAs that inhibit expression of the DNM1 variants and DNAs encoding DNM1 genes, including, in some aspects, RNAi-resistant DNM1 genes for providing normal DNM1 expression. The methods treat DNM1 -related disorders including, but not limited to, DNM1 developmental and epileptic encephalopathies.
[0008] BACKGROUND
[0009] [4] DNM1 encodes a critical multimeric brain-specific GTPase, dynamin-1 , that localizes to the presynapse where it mediates endocytosis. Individuals with pathogenic DNM1 variants suffer from two of the most severe developmental and epileptic encephalopathy (DEE) syndromes, Lennox-Gastaut Syndrome and Infantile Spasms. The identification of affected individuals is likely to increase as DNM1 is now included on screening panels for severe childhood epilepsy. Children with DNM1 mutations suffer from intractable conditions manifesting as early-onset seizures, global developmental delay, profound intellectual disability, lack of speech, muscular hypotonia, dystonia and spasticity. Affected individuals do not respond well to anti-epileptic drugs, leaving >80% of patients with seizures, as is the case with many DEEs.
[0010] [5] Prior to the identification of pathogenic human variants, the first direct link between DNM1 and severe epilepsy was a spontaneous missense mutation in the mouse orthologue, termed “fitful” (gene symbol: Dnm1™) [Boumil etal., PLoS Genet., 6: e1001046 (2010)]. This mutation occurs in a mutually-exclusive alternate exon in the middle domain of Dnm1 that defines Dnm 1a - which along with Dnm 1b comprises two functionally semi-redundant isoforms of Dnm1. Peptides encoded by these very highly conserved exons form part of the assembly domain that is critical for oligomerization of dynamin monomers into ring structures that carry out endocytosis [von Spiczak et al., Neurology, 89: 385-394 (2017) and Boumil, supra].
[0011] [6] Whereas Dnm1™ / +heterozygous mice show only mild spontaneous and handling- induced seizures from 2 to 3 months of age and have a normal lifespan, Dnm 7Ftfl / Ftflhomozygotes show a DEE-like phenotype with severe ataxia, developmental delay, and fully penetrant lethal seizures by the end of the third postnatal week. While Dnmlb is expressed predominantly during gestation and expression wanes during early postnatal development, Dnmla expression increases during early postnatal development and peaks during the second postnatal week, becoming the predominant isoform of adulthood. However, neither Dnmla nor Dnmlb isoform-specific homozygous knockout mice Dnm 7Aa / Aaor Dnm 7Ab / Ab) show seizures or other overt phenotypic characteristics associated with the Dnm1FWallele [Asinof et al., PLoS Genet., 11: e1005347 (2015) and Asinofet al., Neurobiol. Dis., 95: 1-11 (2016)]. These and other in vivo and in vitro studies suggest that Dnm1nrexerts a dominantnegative effect on protein function, as was modeled or predicted for all DNM1 pathogenic variants [Dhindsa et al., Neurol. Genet., 1: e4 (2015); Asinof (2016), supra; and von Spiczak, supra].
[0012] [7] DNM1 encodes dynamin-1 , a large GTPase that catalyzes endocytosis and synaptic vesicle recycling (Dhindsa et al., Neurol Genet, 2015. 1 (1 ): p. e4; Ferguson et al., Nat Rev Mol Cell Biol, 2012. 13(2): p. 75-88; van der Bliek et al., J Cell Biol, 1993. 122(3): p. 553-63). DNM1 is expressed exclusively in the CNS, localizing to the neuron presynaptic terminal (Dhindsa et al., Neurol Genet, 2015. 1 (1): p. e4; Ferguson et al., Science, 2007. 316(5824): p. 570-4; Marks et al., Nature, 2001. 410(6825): p. 231-5; Powell et al., Neuroscience, 1995. 64(3): p. 821-33). To date, more than 50 patients have been identified with de novo pathogenic variants in DNM1 . Mutations reside in the GTPase and middle domains of the protein, driving severe developmental and epileptic encephalopathy (DEE) [Asinof et al., PLoS Genet, 2015. 11 (6): p. e1005347; von Spiczak et al., Neurology, 2017. 89(4): p. 385- 394; Brereton et al., Mol Genet Genomic Med, 2018. 6(2): p. 294-300; Kolnikova et al., Seizure, 2018. 56: p. 31 -33; Li et al., Front Pharmacol, 2019. 10: p. 1454; Choi et al., Neurol Genet, 2021 . 7(5): p. e618). As a clinical group, DEE is primarily attributed to genetic causes and is distinct from epileptic encephalopathies (EE) in that genetic impact contributes to severe cognitive and developmental impairments (Scheffer et al., Eur J Paediatr Neurol, 2020. 24: p. 11-14; Raga et al., Epileptic Disord, 2021 . 23(1 ): p. 40-52; Happ et al., Epilepsy Curr, 2020. 20(2): p. 90-96). In this way, DEE disease encompasses a more clinically complex, therapeutically challenging diagnosis, including and beyond seizures in children. Clinical features are relatively homogenous with affected children exhibiting intractable seizures starting within the first year of life, severe to profound intellectual disability, developmental delay, and muscular hypotonia (von Spiczak et al., Neurology, 2017. 89(4): p. 385-394; Brereton et al., Mol Genet Genomic Med, 2018. 6(2): p. 294-300; Kolnikova et al., Seizure, 2018. 56: p. 31 -33). As is the case with many DEEs, patients typically have intractable epilepsy with limited efficacy of antiepileptic medications (von Spiczak et al., supra), making DNM1 DEE a prime target for exploring gene therapy for restoration of dynamin-1 function.
[0013] [8] The first evidence for a direct role for dynamin-1 in genetic epilepsy came in 2010 from the spontaneous mouse “fitful” (DnmI Ftfl) mutation
[0016] . Although heterozygous fitful mice have recurrent non-lethal seizures without other overt features, homozygotes suffer a more severe, earlier DEE-like phenotype characterized by ataxia, neurosensory deficits, and severe seizures that result in death (Asinof et al., PLoS Genet, 2015. 11 (6): p. e1005347; Boumil et al., PLoS Genet, 2010. 6(8); and Asinof et al., Neurobiol Dis, 2016. 95: p. 1-11 ). The underlying missense mutation is exclusive to an alternate exon (exon 10a, encoding Dnmla) leaving intact a mutually alternative spliced exon (exon 10b, Dnmlb). Although there is overlap in expression, Dnml b is expressed highest during early neuronal development and Dnmla increases postnatally to become the predominant adult isoform (Boumil et al., PLoS Genet, 2010. 6(8)). However, homozygous mice lacking Dnmla or Dnmlb isoforms exhibit neither seizures nor other overt abnormalities associated with DnmI Ftfl allele (Asinof et al., PLoS Genet, 2015. 11 (6): p. e1005347; and Asinof et al., Neurobiol Dis, 2016. 95: p. 1-11), reflecting both functional redundancy and the dominantnegative nature of the pathogenic variant.
[0014] [9] Exploiting the dominant-negative effect, a prior study employed Dnm1 Ftfl / Dnm1 null- cKO compound heterozygotes and neuron subtype-specific Ore driver strains to reveal that the severe seizure phenotype is associated exclusively with dynamin-1 deficiency in inhibitory neurons (PMID: 26125563). More recently, in their pioneering use of DnmI Ftfl to test gene therapy, in 2020 Aimiuwu and colleagues (Aimiuwu et al., Mol Ther, 2020. 28(7): p. 1706-1716) demonstrated successful RNAi mitigation of key disease features whereby a single neonatal dose delivered converted a 100% lethal, severe seizure phenotype to a milder disease, including 75% survival until at least postnatal day 30. These results showed the potential for treatment of heretofore intractable DNM1 DEE and possibly broader application to other genetic DEEs.
[0010] Despite the progress of research, treatment of DEEs is currently limited to treatment of symptoms, primarily by use of antiepileptic drugs. The drugs do not address the underlying genetic defect and thus offer no hope of stopping or slowing disease progression and, when given for long durations, can result in loss of efficacy.
[0015]
[0011] There thus exists a need in the art for products and methods for treatment of DEEs as provided herein.
[0016] SUMMARY
[0017]
[0012] The disclosure provides products, methods, and uses for inhibiting expression of pathogenic DNM1 variants and for treating, ameliorating, delaying the progression of, and / or preventing a developmental and epileptic encephalopathy (DEE) syndrome associated with the expression of a pathogenic DNM1 variant.
[0018]
[0013] The disclosure provides a nucleic acid comprising
[0019] (a) a polynucleotide sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1 -16;
[0020] (b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the DNM1 artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17-32, or
[0021] (c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48.
[0022]
[0014] In some aspects, the nucleic acid further comprises a polynucleotide sequence encoding an exogenous DNM1 replacement gene.
[0023]
[0015] In some aspects, the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1 ) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.
[0024]
[0016] In some aspects, the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene.
[0017] In some aspects, the exogenous DNM1 replacement gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1 ) polynucleotide sequence of SEQ ID NO: 49 or 50 or a functional fragment thereof.
[0025]
[0018] The disclosure provides a nucleic acid comprising
[0026] (a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or
[0027] (b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
[0028]
[0019] The disclosure provides, in some aspects, a nucleic acid as described herein further comprising a promoter or multiple promoters. In some aspects, the promoter(s) is a U6 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter. In some aspects, the promoter(s) is a U6 promoter and / or a synapsin promoter.
[0029]
[0020] The disclosure provides a nanoparticle, extracellular vesicle, exosome, or vector comprising any of the nucleic acids described herein or a combination of any one or more thereof. In some aspects, the vector is a viral vector. In some aspects, the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector. In some aspects, the vector is an AAV vector. In some aspects, the AAV vector lacks rep and cap genes. In some aspects, the AAV vector is a recombinant AAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a single-stranded recombinant AAV (ssAAV) vector. In some aspects, the AAV has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66.
[0021] The disclosure provides a composition comprising any of the nucleic acids, nanoparticles, extracellular vesicles, exosomes, or vectors described herein and a pharmaceutically acceptable carrier.
[0030]
[0022] The disclosure provides a method of reducing the endogenous expression of a variant dynamin-1 (DNM1) gene in a cell and expressing an exogenous replacement DNM1 gene in the cell, the method comprising administering to the cell:
[0031] (i) a nucleic acid that reduces endogenous expression of a variant DNM1 gene comprising:
[0032] (a) a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1 -16;
[0033] (b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17-32, or
[0034] (c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48 or the complement thereof; and
[0035] (ii) a polynucleotide sequence encoding the exogenous replacement DNM1 gene.
[0036]
[0023] In some aspects, the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.
[0037]
[0024] In some aspects, the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene. In some aspects, the exogenous replacement DNM1 gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises:
[0038] (a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or
[0039] (b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
[0040]
[0025] In some aspects, the variant dynamin-1 (DNM1) gene is a variant of a DNM1 gene comprising a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the polynucleotide sequence of SEQ ID NO: 51 or 52.
[0041]
[0026] In some aspects, the nucleic acid that reduces endogenous expression of a variant DNM1 gene further comprises a promoter or multiple promoters.
[0042]
[0027] In some aspects, the nucleic acid that encodes the exogenous replacement DNM1 gene further comprises a promoter or multiple promoters.
[0043]
[0028] In some aspects, the nucleic acid that reduces endogenous expression of a variant DNM1 gene and the nucleic acid that encodes the exogenous replacement DNM1 gene are provided together in a single nucleic acid.
[0044]
[0029] In some aspects, the promoter(s) is a U6 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter. In some aspects, the promoter(s) is a U6 promoter and / or a synapsin promoter.
[0045]
[0030] In some aspects, the nucleic acid is administered to the cell in a nanoparticle, extracellular vesicle, exosome, or vector. In some aspects, the vector is a viral vector. In some aspects, the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector. In some aspects, the vector is an AAV vector. In some aspects, the AAV vector lacks rep and cap genes. In some aspects, the AAV vector is a recombinant AAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a single-stranded recombinant AAV (ssAAV) vector. In some aspects, the AAV vector has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV- PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV- PHP.eB, or AAVv66.
[0046]
[0031] In some aspects, the cell is a neuron. In some aspects, the cell is in a human subject.
[0047]
[0032] The disclosure provides a method of treating a subject suffering from or at risk of suffering from a dynamin-1 (D / V / W7)-related disorder, the method comprising administering to the subject an effective amount of:
[0048] (i) a nucleic acid that reduces endogenous expression of a variant DNM1 gene comprising:
[0049] (a) a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1 -16;
[0050] (b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17-32, or
[0051] (c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48 or the complement thereof; and
[0052] (ii) a polynucleotide sequence encoding the exogenous replacement DNM1 gene.
[0053]
[0033] In some aspects, the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.
[0054]
[0034] In some aspects, the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene. In some aspects, the exogenous replacement DNM1 gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises:
[0055] (a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or
[0056] (b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
[0057]
[0035] In some aspects, the variant dynamin-1 (DNM1) gene is a variant of a DNM1 gene comprising a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the polynucleotide sequence of SEQ ID NO: 51 or 52.
[0058]
[0036] In some aspects, the nucleic acid that reduces endogenous expression of a variant DNM1 gene further comprises a promoter or multiple promoters.
[0059]
[0037] In some aspects, the nucleic acid that encodes the exogenous replacement DNM1 gene further comprises a promoter or multiple promoters.
[0060]
[0038] In some aspects, the nucleic acid that reduces endogenous expression of a variant DNM1 gene and the nucleic acid that encodes the exogenous replacement DNM1 gene are provided together in a single nucleic acid.
[0061]
[0039] In some aspects, the promoter(s) is a U6 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter. In some aspects, the promoter(s) is a U6 promoter and / or a synapsin promoter.
[0062]
[0040] In some aspects, the nucleic acid is administered to the cell in a nanoparticle, extracellular vesicle, exosome, or vector. In some aspects, the vector is a viral vector. In some aspects, the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector. In some aspects, the vector is an AAV vector. In some aspects, the AAV vector lacks rep and cap genes. In some aspects, the AAV vector is a recombinant AAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a single-stranded recombinant AAV (ssAAV) vector. In some aspects, the AAV vector has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV- PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV- PHP.eB, or AAVv66.
[0063]
[0041] In some aspects, the DNM 1 -related disorder is developmental and epileptic encephalopathy (DEE). In some aspects, the DEE is Lennox-Gastaut Syndrome or infantile spasms. In some aspects, the subject is a human subject.
[0064]
[0042] The disclosure provides uses of the nucleic acids of the disclosure; the nanoparticles, extracellular vesicles, exosomes, or vectors of the disclosure; and / or the compositions of the disclosure for the preparation of a medicament for reducing the endogenous expression of a variant dynamin-1 (DNM1) gene in a cell and expressing an exogenous replacement DNM1 gene in the cell. In some aspects, the cell is a neuron. In some aspects, the cell is a human cell. In some aspects, the cell is in a human subject.
[0065]
[0043] The disclosure provides uses of the nucleic acids of the disclosure; the nanoparticles, extracellular vesicles, exosomes, or vectors of the disclosure; and / or the compositions of the disclosure in treating a subject comprising a variant dynamin-1 (DNM1) gene. In some aspects, the subject is a human subject. In some aspects, the subject suffers from or is at risk of suffering from a DNM1-re\aled disorder. In some aspects, the DNM1-re\aled disorder is developmental and epileptic encephalopathy (DEE). In some aspects, the DEE is Lennox- Gastaut Syndrome or infantile spasms.
[0066]
[0044] The disclosure provides the nucleic acids of the disclosure; the nanoparticles, extracellular vesicles, exosomes, or vectors of the disclosure; the compositions of the disclosure, the methods of the disclosure, and the uses of the disclosure, wherein the nucleic acids, nanoparticles, extracellular vesicles, exosomes, vectors, compositions, or medicaments are formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebral delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.
[0067]
[0045] Other features and advantages of the disclosure will be apparent from the following description of the drawing and the detailed description. It should be understood, however, that the drawing, detailed description, and the examples, while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent from the drawing, detailed description, and the examples. BRIEF DESCRIPTION OF THE DRAWINGS
[0068]
[0046] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0069]
[0047] Fig. 1 shows that Dnml0359* conditional knock-in mice were generated by replacing endogenous Dnm1 genomic DNA with a fragment spanning intron 5 to intron 9, including left and right homology arms and a stop cassette. The insert contains an adenovirus splice acceptor (SA), eGFP gene, a neomycin gene, a bGH polyA signal and mutant exon 8, creating a null allele when deleted with Cre recombinase leads to expression of the G359A missense variant. The G359A DNM1 mutant has been described in humans with DEE, and this figure shows a strategy to recapitulate the G359A mutation, and associated epileptic phenotypes including seizures, in a mouse model.
[0070]
[0048] Fig. 2 shows four week growth curves for mutant and control littermates by Cre driver strain. Genotype indicated by solid line (G359A / +) or dotted line (- / +). Cre driver strain indicated by color (Gad2 — Cre black, Nestin-Cre blue, Nkx2.1-Cre green, Pvalb-Cre purple, Sox2-Cre red). Sample sizes and results of repeated measures MANOVA noted in the text. Weighing was terminated for Gad2-Cre mice after 18 days as most of the G359A / + mice had succumbed to lethal seizure. Fig. 2 shows the establishment of phenotypes useful for testing gene therapy in mice expressing the human G359A DNM1 mutant. In particular, expression of G359A in Gad2 positive interneurons produced the most robust phenotypes, namely, fully- penetrant severe seizures and delayed growth by 4 weeks of age.
[0071]
[0049] Fig. 3 shows the design and components of the construct called “miDnml -1869” comprising the mil 869 DNM1 miRNA and the codon-optimized mouse DNM1 for in vivo delivery in mice. “miDnml -1869” was selected for in vivo studies, because it silenced both human DNM1 and mouse Dnm1 by >60% (N=3, P<0.0001 , One-way ANOVA, Dunnett’s Multiple Comparison Test) and was ineffective against the modified Dnm1 cDNA (N=3, P=0.9105, One-way ANOVA, Dunnett’s Multiple Comparison Test) (miDnml -1869). miDnml -1869 and the RNAi-resistant, codon-optimized Dnm1 cDNA were synthesized in an AAV9 vector, respectively driven by a U6 promoter or human synapsin 1 (Syn1) promoter. Both promoters are in the construct, with LI6 driving miDnml transcription and Syn1 driving codon-optimized Dnm1 cDNA.
[0072]
[0050] Fig. 4A-F shows growth curves and survival across gene therapy vectors of individual Gad2-Cre, G359A / + (solid lines) or - / + littermates (dotted lines) pups. All treatments were at PND 1 with the noted treatment shown at the top of each of panels 4A-F. Pups were weighed approximately every three days, with intervening weights interpolated linearly, prior to analysis. Lines that terminate prior to PND 28 mark the last day a pup was seen alive. The numbers at the top of each panel show the number of pups found dead over the total number for each group. Fig. 4A-F shows that treatment improved survival well beyond the natural history of the model. In particular, after culling some animals early for molecular validations, at 7.2 x 1010 vg / pup, 3 mice lived to at least 60 days, 4 further mice lived to at least 90 days and 4 more mice lived until at least 6 months; at the 3.6 x 1O10vg / pup dose, 6 mice lived until at least 40 days and 5 mice lived to at least 7 months; at the 7.2 x 1011vg / pup dose, 3 mice lived until at least 70 days, 4 mice lived to at least 100 days and 1 mouse lived to at least 150 days.
[0073]
[0051] Fig. 5A-B shows repeated measures MANOVA analysis of body weight over the first four weeks (Fig. 5A) and then over weeks 5-12 (Fig. 5B). In Fig. 5A, pup body weights were measured approximately every 3 days; intervening day weights were interpolated linearly prior to analysis. A Bonferroni adjustment was applied to P-values for pairwise comparisons in Fig. 5A. Fig. 5A-B shows that the body weight of treated G359A mice lagged behind that of controls over time.
[0074]
[0052] Fig. 6 shows transcript counts for exogenous and endogenous Dnm1 transcript following bivalent vector treatment. Fig. 6 shows that the Dnm1 knockdown and replacement strategy is working as expected at the molecular level.
[0075]
[0053] Fig. 7A-D shows gene ontology (GO) functional annotation clustering for transcripts in treated and untreated mutant and littermate pups. Fig. 7A-D shows that treatment significantly corrected functions related to the known mechanism of dynamin-1 in neurons by 5.5 to 12 orders of magnitude.
[0076]
[0054] Fig. 8 shows modest prolonged survival of Gad2-Cre:G359A / + pups on a C57BL / 6J strain background. Newborn pups were treated with 7.2 x 1010vg of bivalent vector. Fig. 8 shows that expression of G359A in interneurons caused greater lethality when inbred onto the C57BL / 6J genetic background, and that rescue of survival phenotypes was still significant with treatment although less robust.
[0077] DETAILED DESCRIPTION
[0078]
[0055] The disclosure provides a novel strategy to accomplish repressing or inhibiting expression of a variant dynamin-1 (DNM1) gene and administering a replacement DNM1 gene, i.e., a functional or normal DNM1 gene. Thus, the disclosure provides products and methods for knockdown and replacement therapy as it relates to an abnormal or variant DNM1 gene that results in the manifestation of DNM1 -related disorders.
[0056] The products and methods described herein are used in the treatment of DNM1- related disorders associated with a pathogenic DNM1 isoform. Such disorders or diseases associated with an abnormal or variant DNM1 include, but are not limited to, DNM1 developmental and epileptic encephalopathy (DEE). DNM1 developmental and epileptic encephalopathy (DEE). DEE is characterized by severe to profound intellectual disability, hypotonia, movement disorder, and refractory epilepsy, typically presenting with infantile spasms. DEE includes, but is not limited to, Lennox-Gastout Syndrome and Infantile Spasms.
[0079]
[0057] DNM1 encodes dynamin-1 , a large GTPase that catalyzes endocytosis and synaptic vesicle recycling. DNM1 is expressed exclusively in the CNS, localizing to the neuron presynaptic terminal. To date, more than 50 patients have been identified with de novo pathogenic variants in DNM1. Mutations reside in the GTPase and middle domains of the protein, driving severe developmental and epileptic encephalopathy (DEE). As a clinical group, DEE is primarily attributed to genetic causes and is distinct from epileptic encephalopathies (EE) in that genetic impact contributes to severe cognitive and developmental impairments. In this way, DEE disease encompasses a more clinically complex, therapeutically challenging diagnosis, including and beyond seizures in children. Clinical features are relatively homogenous with affected children exhibiting intractable seizures starting within the first year of life, severe to profound intellectual disability, developmental delay, and muscular hypotonia. As is the case with many DEEs, patients typically have intractable epilepsy with limited efficacy of antiepileptic medications, making DNM1 DEE a prime target for exploring gene therapy for restoration of dynamin-1 function.
[0080]
[0058] At least twenty heterozygous de novo variants identified in thirty-three patients predominantly in the critical GTPase and the middle domains of the DNM1 are described in EuroEPINOMICS-RES Consortium, Am. J. Hum. Genet., 100: 179 (2017); Asinof (2015), supra; von Spiczak, supra; Brereton et a!., Mol. Genet. Genomic Med., 6: 294-300 (2018); Kolnikova et al., Seizure, 56: 31-33 (2018); and Li et al., Front. Pharmacol., 10: 1454, (2019). A “variant DNM1 gene” includes a DNM1 gene that has one or more mutations and is considered an aberrant or abnormal DNM1 gene.
[0081]
[0059] The first evidence for a direct role for dynamin-1 in genetic epilepsy came in 2010 from the spontaneous mouse “fitful” (Dnm1 Ftfl) mutation (Boumil, R.M., et al., PLoS Genet, 2010. 6(8).) Although heterozygous fitful mice have recurrent non-lethal seizures without other overt features, homozygotes suffer a more severe, earlier DEE-like phenotype characterized by ataxia, neurosensory deficits, and severe seizures that result in death (Asinof et al., PLoS Genet, 2015. 11 (6): p. e1005347; Boumil, supra; Asinof et al., Neurobiol Dis, 2016. 95: p. 1-11). The underlying missense mutation is exclusive to an alternate exon (exon 10a, encoding Dnmla) leaving intact a mutually alternative spliced exon (exon 10b, Dnmlb). Although there is overlap in expression, Dnmlb is expressed highest during early neuronal development and Dnmla increases postnatally to become the predominant adult isoform (Boumil, supra). However, homozygous mice lacking Dnmla or Dnmlb isoforms exhibit neither seizures nor other overt abnormalities associated with Dnm1 Ftfl allele (Asinof, 2015, supra; Asinof 2016, supra, reflecting both functional redundancy and the dominantnegative nature of the pathogenic variant.
[0082]
[0060] A nucleic acid encoding human DNM1 is set forth in SEQ ID NO: 51 . Various products and methods of the disclosure can target variants of the human DNM1 nucleotide sequence set forth in SEQ ID NO: 51 . The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 51 . In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant.
[0083]
[0061] Human DNM1 cDNA (no UTRs) (SEQ ID NO: 51)
[0084] ATGGGCAACCGCGGCATGGAAGATCTCATCCCGCTGGTCAACCGGCTGCAAGACGCC TTCTCTGCCATCGGCCAGAACGCGGACCTCGACCTGCCGCAGATCGCTGTGGTGGGC GGCCAGAGCGCCGGCAAGAGCTCGGTGCTCGAGAATTTCGTAGGCAGGGACTTCTTG CCTCGAGGATCTGGCATTGTCACCCGACGTCCCCTGGTCTTGCAGCTGGTCAATGCAA CCACAGAATATGCCGAGTTCCTGCACTGCAAGGGAAAGAAATTCACCGACTTCGAGGA GGTGCGCCTTGAGATCGAGGCCGAGACCGACAGGGTCACCGGCACCAACAAGGGCAT CTCGCCGGTGCCTATCAACCTCCGCGTCTACTCGCCGCACGTGCTGAACCTGACCCTG GTGGACCTGCCCGGAATGACCAAGGTCCCGGTGGGGGACCAACCTCCCGACATCGAG TTCCAGATCCGAGACATGCTTATGCAGTTTGTCACCAAGGAGAACTGCCTCATCCTGGC CGTGTCCCCCGCCAACTCTGACCTGGCCAATTCTGACGCCCTCAAGGTCGCCAAGGAG GTGGACCCCCAGGGCCAGCGCACCATCGGGGTCATCACCAAGCTGGACCTGATGGAC GAGGGCACAGATGCCCGTGATGTGCTGGAGAACAAGCTGCTCCCCCTGCGCAGAGGC TACATTGGAGTGGTGAACCGGAGCCAGAAGGACATTGATGGCAAGAAGGACATTACCG CCGCCTTGGCTGCTGAACGAAAGTTCTTCCTCTCCCATCCATCTTATCGCCACTTGGCT GACCGTATGGGCACGCCCTACCTGCAGAAGGTCCTCAATCAGCAACTGACGAACCACA TCCGGGACACACTGCCGGGGCTGCGGAACAAGCTGCAGAGCCAGCTACTGTCCATTG AGAAGGAGGTGGAGGAATACAAGAACTTCCGCCCTGATGACCCAGCTCGCAAGACCAA GGCCCTGCTGCAGATGGTCCAGCAGTTCGCCGTAGACTTTGAGAAGCGCATTGAGGG CTCAGGAGATCAGATCGACACCTACGAACTGTCAGGGGGAGCCCGCATTAACCGAATC TTCCACGAGCGCTTCCCTTTCGAGCTGGTCAAGATGGAGTTTGATGAGAAGGAACTCC GAAGGGAGATCAGCTATGCTATCAAGAATATCCATGGCATTAGAACGGGGCTGTTTACC CCAGACATGGCCTTTGAGACCATTGTGAAAAAGCAGGTGAAGAAGATCCGAGAACCGT GTCTCAAGTGTGTGGACATGGTTATCTCGGAGCTAATCAGCACCGTTAGACAGTGCAC CAAGAAGCTCCAGCAGTACCCGCGGCTACGGGAGGAGATGGAGCGCATCGTGACCAC CCACATCCGGGAGCGCGAGGGCCGCACTAAGGAGCAGGTCATGCTTCTCATCGATATC GAGCTGGCTTACATGAACACCAACCATGAGGACTTCATAGGCTTTGCCAATGCTCAGCA GAGGAGCAACCAGATGAACAAGAAGAAGACTTCAGGGAACCAGGATGAGATTCTGGTC ATCCGCAAGGGCTGGCTGACTATCAATAATATTGGCATCATGAAAGGGGGCTCCAAGG AGTACTGGTTTGTGCTGACTGCTGAGAATCTGTCCTGGTACAAGGATGATGAGGAGAAA GAGAAGAAATACATGCTGTCTGTGGACAACCTCAAGCTGCGGGACGTGGAGAAGGGCT TTATGTCGAGCAAGCATATCTTTGCCCTCTTTAACACGGAGCAGAGGAATGTCTACAAG GATTATCGGCAGCTGGAGCTAGCCTGTGAGACACAGGAGGAGGTGGACAGCTGGAAG GCCTCCTTCCTGAGGGCTGGCGTGTACCCTGAGCGTGTTGGGGACAAAGAGAAAGCC AGCGAGACCGAGGAGAATGGCTCCGACAGCTTCATGCATTCCATGGACCCACAGCTGG AACGGCAAGTGGAGACCATCCGGAATCTTGTGGACTCATACATGGCCATTGTCAACAA GACCGTGAGGGACCTCATGCCCAAGACCATCATGCACCTCATGATTAACAATACCAAG GAGTTCATCTTCTCGGAGCTGCTGGCCAACCTGTACTCGTGTGGGGACCAGAACACGC TGATGGAGGAGTCGGCGGAGCAGGCACAGCGGCGCGACGAGATGCTGCGCATGTAC CACGCACTGAAGGAGGCGCTCAGCATCATCGGCGACATCAACACGACCACCGTCAGC ACGCCCATGCCCCCGCCCGTGGACGACTCCTGGCTGCAGGTGCAGAGCGTACCGGCC GGACGCAGGTCGCCCACGTCCAGCCCCACGCCGCAGCGCCGAGCCCCCGCCGTGCC CCCAGCCCGGCCCGGGTCGCGGGGCCCTGCTCCTGGGCCTCCGCCTGCTGGGTCCG CCCTGGGGGGGGCGCCCCCCGTGCCCTCCAGGCCGGGGGCTTCCCCTGACCCTTTC GGCCCTCCCCCTCAGGTGCCCTCGCGCCCCAACCGCGCCCCGCCCGGGGTCCCCAG AATCACTATCAGTGACCCCTGA
[0085]
[0062] A nucleic acid encoding mouse DNM1 is set forth in SEQ ID NO: 52. Various products and methods of the disclosure can target variants of the nucleotide sequence set forth in SEQ ID NO: 52. The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 52. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant.
[0086]
[0063] Mouse Dnm1 cDNA (no UTRs) (SEQ ID NO: 52)
[0087] ATGGGCAACCGCGGCATGGAAGACCTCATCCCGCTGGTTAACCGGTTACAGGACGCCT TCTCCGCCATCGGCCAGAACGCGGACCTCGACCTGCCGCAGATCGCCGTGGTAGGCG GCCAGAGCGCCGGCAAGAGCTCGGTGCTGGAGAATTTCGTGGGCAGGGACTTCTTGC CCCGAGGATCTGGCATCGTCACCCGGCGTCCCCTGGTCCTGCAGCTGGTTAATTCTAC CACAGAATATGCCGAGTTCCTGCACTGCAAGGGGAAGAAATTCACCGACTTCGAGGAG GTGCGCCTGGAGATCGAGGCTGAGACCGATCGAGTCACCGGCACCAACAAGGGCATT TCGCCAGTGCCCATCAACCTGCGGGTCTACTCGCCCCATGTGCTGAACCTGACTCTAG TGGACCTGCCAGGAATGACCAAGGTCCCAGTTGGGGACCAACCTCCTGATATCGAGTT CCAGATCCGGGACATGCTTATGCAGTTCGTCACTAAGGAGAACTGCCTTATCCTGGCT GTGTCCCCTGCCAACTCGGATTTGGCCAACTCTGATGCCCTCAAGATCGCTAAGGAGG TGGACCCCCAGGGTCAGCGCACCATTGGGGTCATCACCAAGTTGGACCTGATGGACG AGGGCACAGATGCGCGGGACGTGCTAGAGAACAAGCTGCTCCCTTTGCGCAGAGGTT ACATCGGCGTGGTGAACCGGAGCCAGAAGGACATAGACGGCAAGAAGGACATCACAG CCGCCTTGGCTGCAGAGCGCAAATTCTTCCTCTCTCACCCATCCTACCGCCACTTGGCT GACCGCATGGGCACACCCTACCTGCAGAAGGTCCTCAATCAGCAATTGACCAACCACA TCCGGGACACACTGCCGGGACTTCGGAACAAGCTGCAGAGCCAGCTGCTGTCCATTGA GAAGGAGGTGGACGAGTACAAGAACTTCCGACCGGATGACCCAGCGCGCAAGACCAA GGCCCTGCTGCAGATGGTCCAGCAGTTTGCAGTGGACTTCGAGAAGCGCATCGAGGG TTCTGGAGACCAGATTGACACTTACGAGCTGTCAGGTGGAGCCCGCATTAACCGGATC TTCCATGAACGCTTCCCCTTTGAGCTGGTTAAGATGGAGTTTGATGAGAAGGAACTGCG AAGGGAGATCAGCTATGCTATCAAAAATATCCATGGCATCAGGACGGGCCTCTTCACAC CTGACCTCGCTTTTGAAGCCACAGTGAAAAAGCAGGTGCAGAAGCTCAAAGAGCCCAG TATCAAGTGTGTGGACATGGTAGTCAGTGAACTCACGTCCACCATCAGAAAGTGTAGTG AAAAGCTGCAGCAATACCCGCGTCTGCGGGAGGAGATGGAGCGAATTGTGACCACCC ACATCCGGGAACGTGAGGGCCGCACCAAGGAGCAGGTCATGCTTCTCATCGACATTGA GCTGGCTTACATGAATACCAACCACGAAGACTTCATAGGCTTTGCCAATGCTCAGCAGA GAAGCAACCAGATGAACAAGAAGAAGACTTCAGGGAACCAGGATGAGATTCTGGTCAT TCGAAAGGGGTGGTTGACCATCAACAACATCGGCATCATGAAGGGAGGCTCCAAGGAG TACTGGTTTGTGCTGACTGCTGAGAATCTGTCCTGGTACAAGGATGATGAGGAGAAAGA GAAGAAGTACATGCTGTCTGTGGACAATCTGAAGCTGCGTGATGTGGAGAAGGGCTTC ATGTCAAGCAAGCATATTTTTGCCCTCTTCAACACAGAGCAGAGGAATGTCTACAAGGA TTACCGGCAGCTGGAACTGGCCTGTGAGACACAGGAGGAGGTGGACAGTTGGAAGGC TTCCTTCCTGAGGGCTGGCGTGTACCCTGAGCGTGTTGGGGACAAAGAGAAAGCCAGT GAGACCGAGGAGAACGGCTCTGACAGCTTCATGCACTCGATGGACCCTCAGCTGGAG CGCCAGGTGGAGACCATCCGGAACCTGGTAGACTCGTACATGGCCATTGTCAACAAGA CTGTGCGGGACCTCATGCCCAAGACCATCATGCACCTCATGATCAACAACACCAAGGA GTTTATCTTCTCTGAGCTGCTGGCCAACCTGTACTCTTGCGGGGACCAGAACACACTGA TGGAAGAATCGGCCGAGCAGGCTCAGCGGCGCGACGAGATGCTGCGCATGTACCACG CACTGAAGGAGGCGCTCAGTATTATCGGCGACATCAACACGACCACCGTCAGCACGCC CATGCCCCCGCCCGTGGACGACTCCTGGCTGCAGGTGCAGAGCGTACCGGCCGGAC GCAGATCGCCCACGTCCAGCCCCACGCCGCAGCGCCGAGCCCCCGCCGTGCCCCCA GCCCGGCCCGGATCGCGGGGCCCTGCTCCTGGGCCTCCGCCTGCTGGATCCGCCCT GGGGGGGGCGCCCCCCGTGCCCTCCAGGCCGGGGGCTTCCCCTGACCCCTTTGGCC CCCCTCCCCAGGTGCCCTCGCGCCCCAACCGCGCCCCGCCTGGGGTCCCCAGAATCA CTATCAGTGACCCCTGA
[0088]
[0064] The disclosure includes the use of RNA interference to inhibit or interfere with the expression of DNM1 to ameliorate and / or treat subjects with diseases or disorders resulting from overexpression or aberrant expression of DNM1. RNA interference (RNAi) is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by inhibitory RNAs. The inhibitory RNAs are small (21-25 nucleotides in length), noncoding RNAs that share sequence homology and base-pair with cognate messenger RNAs (mRNAs). The interaction between the inhibitory RNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs. The RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science+Business Media, LLC (2010).
[0089]
[0065] As an understanding of natural RNAi pathways has developed, researchers have designed artificial inhibitory RNAs for use in regulating expression of target genes for treating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells [Davidson et al., Nat. Rev. Genet., 72:329-40 (2011); Harper, Arch. Neurol., 66:933-938 (2009)]. Artificial inhibitory RNAs expressed in vivo from plasmid- or virus-based vectors and may achieve long term gene silencing with a single administration, for as long as the vector is present within target cell nuclei and the driving promoter is active [Davidson et al., Methods Enzymol., 392:145-73, (2005)]. Importantly, this vector-expressed approach leverages the decades-long advancements already made in the muscle gene therapy field, but instead of expressing protein coding genes, the vector cargo in RNAi therapy strategies are artificial inhibitory RNAs targeting disease genes-of-interest.
[0066] An shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover, but it requires use of an expression vector. Once the vector has transduced the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III, depending on the promoter choice. The product mimics pri-microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by Exportin 5. This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing.
[0090]
[0067] The products and methods provided herein, in some aspects, comprise miRNA shuttles to modify DNM1 expression (e.g., knockdown or inhibit expression). Like shRNAs, miRNA shuttles are expressed intracellularly from DNA transgenes. miRNA shuttles typically contain natural miRNA sequences required to direct correct processing, but the natural, mature miRNA duplex in the stem is replaced by the sequences specific for the intended target transcript e.g., see U.S. Publication No. US2022 / 0333115). Following expression, the artificial miRNA is cleaved by Drosha and Dicer to release the embedded siRNA-like region. Polymerase III promoters, such as U6 and H1 promoters, and polymerase II promoters are also used to drive expression of the miRNA shuttles.
[0091]
[0068] The disclosure provides nucleic acids comprising polynucleotide sequences encoding DNM1 microRNAs (miD / V / W7s) to inhibit the expression of the DNM1 gene. The disclosure provides a nucleic acid comprising a polynucleotide sequence encoding a dynamin-1 (DNM1) artificial inhibitory RNA (i.e., a m\DNM1) comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1-16. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0092]
[0069] The disclosure provides a nucleic acid comprising a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA (i.e., a m\DNM1) comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the DNM1 artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17-32.
[0093]
[0070] The disclosure provides a nucleic acid comprising a polynucleotide sequence encoding a m\DNM1 processed antisense guide strand comprising at least about, at least, or about 70%, 75, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NOs: 33-48. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0094]
[0071] The disclosure provides a nucleic acid encoding a m\DNM1 comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -16. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0095]
[0072] Exemplary m\DNM1s comprise the polynucleotide sequence set out in any one or more of SEQ ID NOs: 17-32, or a variant thereof comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs 17-32. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0096]
[0073] Final processed guide strand sequences corresponding to SEQ ID NOs: 33-48 are respectively set out in SEQ ID NOs: 33-48. Such exemplary guide strands comprise the polynucleotide sequence set out in any one or more of SEQ ID NOs: 33-48, or a variant thereof comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs: 33-48, or the complementary sequence thereof. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0097]
[0074] The disclosure additionally provides a nucleic acid comprising (i) a nucleotide sequence comprising the miD / W / V7-encoding microRNAs, a nucleotide sequence encoding the miDMNI RNAs, and a nucleotide sequence encoding the antisense guide strands as described in U.S. Publication No. US2022 / 0333115 and variants thereof comprising at least about, at least, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence comprising the miD / W / VI-encoding microRNAs, the nucleotide sequence encoding the miDMNI RNAs, and the nucleotide sequence encoding the antisense guide strands as described in U.S. Publication No. US2022 / 0333115, and (ii) a nucleotide sequence encoding a replacement nucleotide sequence as set out in SEQ ID NO: 49 or 50, or a variant thereof as described herein. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the nonvariant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, various other flanking sequences are also included.
[0098]
[0075] The disclosure herein provides products and methods to specifically induce silencing of deleterious DNM1 isoforms by RNA interference (RNAi) using vectors expressing artificial inhibitory RNAs targeting the DMN1 mRNA. The artificial DMN1 inhibitory RNAs contemplated include, but are not limited to, small interfering RNAs (siRNAs) (also referred to as short interfering RNAs, small inhibitory RNAs or short inhibitory RNAs), short hairpin RNAs (shRNAs) and miRNA shuttles (artificial miRNAs) that inhibit expression of pathogenic DNM1 isoforms. The artificial inhibitory RNAs are referred to as m\DNM1s herein. The m\DNM1s are small regulatory sequences that act post-transcriptionally by targeting, for example, a coding region or 3’UTR of DNM1 mRNA in a reverse complementary manner resulting in reduced DNM1 mRNA and protein levels. Use of the methods and products is indicated, for example, in preventing or treating DEE.
[0099]
[0076] DNM1 inhibitory RNAs are provided as well as polynucleotides encoding one or more of the RNAs. Exemplary DNM1 inhibitory RNAs provided are miRNAs that target nucleotides 249-270, 624-645, 900-921 , 1073-1094, 1156-1177, 1473-1494, 1505-1526, 1535-1556, 1608-1629, 1869-1890, 1883-1904, 2035-2056, 2098-2119, 2174-2195, 2186- 2207, and 2522-2543 of the human dyamin-1 sequence comprising the nucleotide sequence of SEQ ID NO: 51 . Exemplary DNM1 inhibitory RNAs provided are miRNAs that target nucleotides 249-270, 624-645, 900-921 , 1073-1094, 1156-1177, 1473-1494, 1505-1526, 1535-1556, 1608-1629, 1869-1890, 1883-1904, 2035-2056, 2098-2119, 2174-2195, 2186- 2207, and 2522-2543 of the human dyamin-1 sequence comprising the nucleotide sequence of SEQ ID NO: 51 and the mouse dynamin-1 sequence comprising the nucleotide sequence of SEQ ID NO: 52.
[0100]
[0077] Provided herein in Table 1 below are the following exemplary miRNAs (i.e., m\DNM1s) and their respective encoding sequences.
[0101] Tablel . Exemplary DNM1 miRNAs and their relevant sequences.
[0102]
[0078] The disclosure provides nucleic acids comprising RNA-encoding template DNA sequences comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence set forth in any one of SEQ ID NOs: 1 -16. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions. In some aspects, various other flanking sequences are also included.
[0103]
[0079] Exemplary m\DNM1s comprise the full-length sequences set out in any one of SEQ ID NOs: 17-32 or variants thereof comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 17-32. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions. In some aspects, various other flanking sequences are also included.
[0104]
[0080] Corresponding final processed antisense guide strand sequences are respectively set out in SEQ ID NOs: 33-48, or are variants thereof comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 33-48, or the complement thereof. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non- variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions. In some aspects, various other flanking sequences are also included. The processed antisense guide strand is the strand of the mature miRNA duplex that becomes the RNA component of the RNA induced silencing complex ultimately responsible for sequence-specific gene silencing.
[0105]
[0081] m\DNM1s can specifically bind to a segment of a messenger RNA (mRNA) encoded by a human DNM1 gene, including but not limited to, the human DNM1 gene set forth in SEQ ID NO: 51.
[0106]
[0082] In some aspects, m\DNM1s can specifically bind to a segment of a messenger RNA (mRNA) encoded by a mouse / murine DNM1 gene, including but not limited to, the mouse DNM1 gene set forth in SEQ ID NO: 52.
[0083] For example, a miDNMI of the disclosure can specifically bind a mRNA segment that is encoded by the nucleotide sequence of SEQ ID NO: 51 or 52 or a variant thereof comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the sequence set forth in SEQ ID NO: 51 or 52. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full- length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant.
[0107]
[0084] The disclosure also provides DNM1 cDNA sequences for restoring normal expression of DNM1 after variant DNM1 is knocked down or repressed by the DNM1 microRNAs of the disclosure. Such DNM1 cDNA is administered as an “exogenous replacement DNM1 gene” or “replacement DNM1 gene”. Such replacement DNM1 gene includes any known DNM1 gene in the art. This DNM1 gene encodes a member of the dynamic subfamily of GTP- binding proteins. The encoded protein possesses unique mechanochemical properties used to tubulate and sever membranes, and is involved in clathrin-mediated endocytosis and other vesicular trafficking processes. Actin and other cytoskeletal proteins act as binding partners for the encoded protein, which can also self-assemble leading to stimulation of GTPase activity. More than sixty highly conserved copies of the 3' region of this gene are found elsewhere in the genome, particularly on chromosomes Y and 15. Thus, in some aspects, the replacement DNM1 gene or normal DNM1 gene is the nucleotide sequence found as Gene ID 1759 in the National Library of Medicine (ncbi.nlm.nih.gov / gene / 1759). Such replacement DNM1 gene or normal DNM1 gene used in the therapeutic aspects of the disclosure also includes functional fragments of a DNM1 that are sufficient to allow for the production of DNM1 by the cells or the subject in which it is transfected or transduced.
[0108]
[0085] In some aspects, the normal or replacement DNM1 gene used in the replacement therapy aspects of the disclosure is a codon-optimized gene. In some aspects, the DNM1 gene is codon-optimized so that it is resistant to the m\DNM1 that are administered to knockdown the variant DNM1 gene present in the cell or in the cells of the subject. In some aspects, such normal or replacement DNM1 gene is a nucleic acid comprising a nucleotide sequence comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the sequence set forth in SEQ ID NO: 49 or 50. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the sequence identity is over the full- length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions. In some aspects, various other flanking sequences are also included.
[0109]
[0086] Thus, in some aspects, the replacement DNM1 gene of the disclosure is a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 49 (human codon-optimized DNM1) or SEQ ID NO: 50 (mouse codon-optimized DNM1) are provided in the disclosure and are set out in Table 2 below. These exemplary RNA-resistant DNM1 cDNA sequences are codon-optimized cDNAs and contain wobble mutations to make them resistant to the miRNA sequences designed to knockdown expression of the variant DNM1 gene.
[0110]
[0087] Table 2. Exemplary RNA-resistant codon-optimized DNM1 cDNA sequences with wobble mutations in miRNA binding sites.
[0111]
[0088] In some aspects, the normal or replacement DNM1 gene used in the replacement therapy aspects of the disclosure is a human or mouse DNM1 gene (cDNA without UTRs) as set forth in SEQ ID NO: 51 or 52. In some aspects, such normal or replacement DNM1 gene is a nucleic acid comprising a nucleotide sequence comprising at least, at least about, or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the sequence set forth in SEQ ID NO: 51 or 52. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions. In some aspects, various other flanking sequences are also included.
[0112]
[0089] The disclosure includes various nucleic acids comprising, consisting essentially of, or consisting of the various nucleotide sequences described herein. In some aspects, the nucleic acid comprises the nucleotide sequence. In some aspects, the nucleic acid consists essentially of the nucleotide sequence. In some aspects, the nucleic acid consists of the nucleotide sequence.
[0113]
[0090] The disclosure includes a nucleic acid comprising a polynucleotide sequence encoding one or more DNM1 microRNA sequence(s) and a polynucleotide encoding a recombinant DNM1 sequence. In some aspects, the polynucleotide encoding one or more DNM1 microRNA sequence(s) is under the control of one promoter and the polynucleotide encoding the recombinant DNM1 sequence is under the control of another promoter. Thus, in some aspects, the nucleic acid comprises two promoter sequences, one promoter controlling the expression of the polynucleotide sequence encoding one or more DNM1 microRNA sequence(s) and another promoter controlling the expression of the recombinant DNM1 sequence. In some other aspects, the promoter is the same promoter. Thus, in some aspects, the promoter controlling the expression of the polynucleotide sequence encoding one or more DNM1 microRNA sequence(s) and the promoter controlling the expression of the recombinant DNM1 sequence is the same promoter. In some aspects, the same promoter is a neuron-specific promoter.
[0114]
[0091] Thus, in some aspects, a nucleic acid of the disclosure comprises one or more promoters to be used with the nucleic acids provided herein. In various aspects, a polymerase II promoter or a polymerase III promoter is used. In some aspects, the promoter is a U6 promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, a Schwann cell-specific promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an H19 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), a tMCK promoter, a minimal MCK promoter, the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene (MLC250) promoter, cardiac troponin T (cTnT) promoter, an a-myosin heavy chain (a-MHC) promoter, or a desmin promoter. In some aspects, the neuron-specific promoter is a synapsin promoter, a Ca2+ / calmodulin-dependent kinase subunit a (CaMKII) promoter, a neuron-specific enolase (NSE) promoter, or a synapsin I with a minimal CMV sequence (Synl-minCMV) promoter.
[0115]
[0092] In some aspects, the promoter controlling the expression of the polynucleotide sequence encoding one or more DNM1 microRNA sequence(s) is a LI6 or a neuron-specific promoter and the promoter controlling the expression of the recombinant DNM1 sequence is a neuron-specific promoter. In some aspects, the neuron-specific promoter is a synapsin promoter. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence encoding a DNM1-miRNA under the control of a LI6 promoter and a nucleotide sequence encoding a recombinant DNM1 sequence under the control of a neuron-specific promoter. In some aspects, the nucleotide sequence encoding the recombinant DNM1 sequence is codon-optimized and designed to be resistant to miRNA degradation. Thus, in some aspects, such nucleotide sequence designed to replace the DNM1 sequence being knocked down is a nucleotide sequence as set out in SEQ ID NO: 49 or 50, or a functional variant thereof comprising DNM1 activity. Such nucleotide sequence has been designed to be resistant to DNM1 microRNAs which are used to knockdown the expression of variant or aberrant DNM1.
[0116]
[0093] The disclosure therefore includes nucleic acids comprising polynucleotides encoding one or more copies of these DNM1 microRNA sequences and recombinant DNM1 sequences combined into a single delivery vehicle, such as a vector, nanoparticle, extracellular vesicle, or endosome. Thus, the disclosure includes a vector, nanoparticle, extracellular vesicle, or endosome comprising a nucleic acid of the disclosure or a combination of nucleic acids of the disclosure.
[0117]
[0094] Delivery of DNA encoding m\DNM1s and the replacement DNM1 cDNAs can be achieved using a delivery vehicle that delivers the DNA(s) to a cell. In various aspects, the DNA is delivered via a vector or via a non-vectorized delivery vehicle, such as a nanoparticle, lipid nanoparticle, extracellular vesicle, exosome, or viral-like particle (VLP).
[0118]
[0095] In some aspects, therefore, such non-vectorized delivery includes the use of nanoparticles, extracellular vesicles, exosomes, or VLPs comprising the nucleic acids of the disclosure. Nanoparticles offer unprecedented opportunities for cell-specific, controlled delivery. In some aspects, such nanoparticles include, but are not limited to, microcapsules, liposomes, and micelles. Extracellular vesicles can be used for treatment of diseases or disorders by targeting pathological recipient cells for delivery of the nucleic acids. Exosomes are excellent carriers with the advantages of low immunogenicity and low toxicity (Ohno et al., Methods Mol Biol. 2016:1448:261-70. doi: 10.1007 / 978-1 -4939-3753-0_19). Viral vectors, such as an adeno-associated virus (AAV) vector, have been used to deliver nucleic acids to target cells, including but not limited to, neurons, the brain, muscle cells, muscle, or other target cells or tissues in vivo, ex vivo, or in vitro. The disclosure also includes compositions comprising any of the vectorized or non-vectorized constructs described herein alone or in combination.
[0119]
[0096] In some embodiments, the disclosure provides a composition or compositions comprising a nucleic acid or a vector, e.g., such as a viral vector, as described herein. In some embodiments, the disclosure provides a composition or compositions comprising a nucleic acid, vector, e.g., such as a viral vector, nanoparticle, extracellular vesicle, or exosome comprising the nucleic acids of the disclosure. Thus, compositions comprising delivery vehicles (such as rAAV, nanoparticles, extracellular vesicles, or exosomes) described herein are provided. In various aspects, such compositions also comprise a pharmaceutically acceptable carrier. In general, as used herein, "pharmaceutically acceptable carrier" means all aqueous and non-aqueous solutions, sterile solutions, solvents, buffers, e.g. phosphate buffered saline (PBS) solutions, water, suspensions, emulsions, such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media and coatings, which are compatible with pharmaceutical administration, in particular with parenteral administration. The use of such media and agents in pharmaceutical compositions is well known in the art, and the compositions comprising such carriers can be formulated by well-known conventional methods.
[0120]
[0097] In some embodiments, therefore, the disclosure includes a vector comprising any of the nucleic acids described herein, either alone or in combination. Thus, in some aspects, a combination of nucleic acids delivering various miRNAs are used together to more effectively inhibit the expression of the variant DNM1 gene. Thus, embodiments of the disclosure utilize vectors (for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.
[0121]
[0098] In some embodiments, the vector is an AAV vector. In some aspect, the vector is a recombinant AAV (rAAV) vector. In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded recombinant vector (ssAAV). In some aspects, the rAAV vector lack rep and cap genes. The AAV vector possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
[0122] The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hardy virus. It easily withstands the conditions used to inactivate adenovirus (56o to 65oC for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.
[0123]
[0099] Thus, in some aspects, the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 capsid proteins), AAV-anc80 (i.e., an AAV containing AAV-anc80 capsid proteins), AAV-B1 (i.e., an AAV containing AAV-B1 capsid proteins), AAV.PHP.EB (i.e., an AAV containing AAV- PHP.EB capsid proteins), or AAVv66 (i.e., an AAV containing AAVv66 capsid proteins), and accordingly the same with AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV- PHP.S, AAVv66, AAVMYO, MYOAAV, MY0AAV1A, MY0AAV2A, MY0AAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66.
[0124]
[0100] In some aspects, the AAV is a modified AAV (mAAV) capsid polypeptide as disclosed by Solid Biosciences Inc. in International Publication No. WO 2021 / 072197, which is incorporated herein by reference in its entirety. WO 2021 / 072197 provides a modified VP1 capsid enabling preferential targeted expression of a gene of interest in muscle tissues, as well as recombinant adeno-associated virus (rAAV) with the gene of interest packaged with the modified VP1 capsids, and uses thereof. More specifically, in some aspects, a nucleic acid of the disclosure further comprises a nucleotide sequence encoding a modified AAV9 (mAAV9) capsid polypeptide or an AAV-SLB101 capsid polypeptide of WO 2021 / 072197.
[0125]
[0101] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56eto 65eC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.
[0126]
[0102] In some embodiments, DNA plasmids of the disclosure are provided which comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art.
[0127]
[0103] In some embodiments, the subject rAAV is produced based on the helper-virus-free transient transfection method, with all cis and trans components (vector plasmid and packaging plasmids, along with helper genes isolated from adenovirus) in suitable host cells such as 293 cells. The transient-transfection method is simple in vector plasmid construction and generates high-titer AAV vectors that are free of adenovirus. The modified VP1 capsid proteins can be encoded by one of the plasmids used in transient transfection of the producer cell line.
[0128]
[0104] In some embodiments, the subject rAAV is produced using a recombinant herpes simplex virus (rHSV)-based AAV production system, which utilizes rHSV vectors to bring the AAV vector and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention) into the producer cells. The modified cap gene can be present in the rHSV vector that may also hosts the rAAV genome.
[0129]
[0105] In some embodiments, the subject rAAV is produced using a baculovirus system that requires simultaneous infection of insect cells with several baculovirus vectors to deliver the AAV vector cassette and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention).
[0130]
[0106] In some embodiments, the subject rAAV is produced based on certain AAV producer cell lines derived from, e.g., HeLa or A549 or HEK293 cells, which stably harbored AAV Rep / cap genes (i.e., the modified VP1 capsid gene of the invention). The AAV vector cassette can either be stably integrated in the host genome or be introduced by an adenovirus that contained the cassette.
[0131]
[0107] In some embodiments, production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MY0AAV1 A, MY0AAV2A, MY0AAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66. In some aspects, the ITRs in the AAV are from a different AAV serotype. In some aspects, the AAV comprises an ITR or capsid protein which is from a different serotype, i.e., a different serotype than the rest of the vector. For example, in some aspects, AAV2 or AAV2-based ITRs are used in various AAV vectors, not only serotypes which are AAV2 or AAV2-based. In some aspects, various ITRs are interchangeable among the different serotypes of AAV. For example, in some aspects, AAV2 ITRs are interchangeable among the different serotypes of AAV. Thus, in some aspects, AAV2 ITRs are used in a different serotype of AAV vector including, but not limited to, for example, AAV9. In some aspects, AAV2 Rep helper genes are used.
[0132]
[0108] In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV- PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV- PHP.eB, or AAVv66. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11 ): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.
[0133]
[0109] AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV- PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66. As set out herein above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
[0110] DNA plasmids of the disclosure comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. In some aspects, the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66. In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.
[0134]
[0111] Provided herein are rAAV, each encoding a m\DNM1. Also provided are rAAV encoding one or more m\DNM1s. A rAAV (with a single-stranded genome, scAAV) encoding one or more m\DNM1s can encode one, two, three, four, five, six, seven or eight m\DNM1s. A scAAV encoding one or more m\DNM1s can encode one, two, three or four m\DNM1s.
[0135]
[0112] In some embodiments, packaging cells are provided. Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors
[0136]
[0113] For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081 ), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.
[0137]
[0114] In some embodiments, therefore, a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081 ), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy et al., 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.
[0138]
[0115] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbiol, and Immunol. 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol., 63:3822- 3828 (1989); U.S. Patent No. 5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Human Gene Therapy, 4:609-615 (1993); Clark et al., Gene Therapy, 3:1124-1132 (1996); U.S. Patent. No. 5,786,211 ; U.S. Patent No. 5,871 ,982; U.S. Patent. No. 6,258,595; and McCarty, Mol. Then, 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of various types of rAAV are specifically contemplated and exemplified.
[0139] Recombinant AAV ( / .e., infectious encapsidated rAAV particles) are thus provided herein. In some aspects, genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).
[0140]
[0116] The disclosure thus provides in some embodiments packaging cells that produce infectious rAAV. In one embodiment, packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
[0141]
[0117] The rAAV, in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Then, 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98 / 09657.
[0142]
[0118] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of the disease or disorder, the administration is prophylactic. If the dose is administered after the development of the disease or disorder, the administration is therapeutic. In embodiments of the disclosure, an effective dose or a therapeutically effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disease or disorder being treated, that slows or prevents progression of the disease or disorder, that slows or prevents progression of the disease or disorder, that diminishes the extent of the disease or disorder, that results in remission (partial or total) of the disease or disorder, and / or that prolongs survival.
[0143]
[0119] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
[0144]
[0120] Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x106, about 1 x107, about 1 x108, about 1 x109, about 1x1010, about 1x1011, about 1 x1012, about 1 x1013, about 1x1014, about 1x1015, about 1 x1016, to about 1 x1017or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) (e.g., 1 x107vg, 1 x108vg, 1 x109vg,
[0145] 1 x1010vg, 1x1011vg, 1 x1012vg, 1 x1013vg, 1 x1014vg, 1 x1015vg, 1 x1016vg, and 1 x1017vg, respectively). In some aspects, dosages are expressed in units of viral genomes (vg) per kilogram (kg) body weight (e.g., 1 x107vg / kg, 1x108vg / kg, 1x109vg / kg, 1x101° vg / kg, 1x1011vg / kg, 1x1012vg / kg, 1x1013vg / kg, 1 x1014vg / kg, 1x1015vg / kg, 1 x1016vg / kg, and 1 x1017vg / kg, respectively). Additional information regarding an effective dose, or a therapeutically effective dose, as used herein, is provided herein below.
[0146]
[0121] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids of the disclosure. Thus, the disclosure provides methods of delivering or therapeutically administering the nucleic acids encoding m\DNM1 and nucleic acids encoding the replacement / normal DNM1 gene to a cell or to a subject comprising a mutation in the DNM1 gene associated with the expression of a DNM1 variant and resulting in a DNM 1 -related disorder.
[0147]
[0122] Provided herein are methods of preventing or inhibiting expression of the DNM1 variant gene in a cell comprising contacting the cell with a delivery vehicle comprising a nucleic acid of the disclosure encoding a m\DNM1 and contacting the cell with a nucleic acid encoding a replacement DNM1 gene which restores the normal expression or at least a functional level of a DNM1 gene (i.e., not a variant DNM1 gene) to allow for the inhibition of aberrant DNM1 expression and the expression of normal DNM1 gene in a cell or in the cells of a subject. Thus, the disclosure provides methods of knocking-down the aberrant gene and replacing the aberrant gene with a normal / wild-type / functional replacement DNM1 gene.
[0148]
[0123] In the methods, expression of the duplicated and / or mutant DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent. In the methods, expression of the wild-type DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent. In the methods, expression of the duplicated and / or mutant DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent. In the methods, expression of the normal or replacement DNM1 gene is increased by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
[0149]
[0124] The disclosure also provides methods of delivering DNA encoding a m\DNM1 to knockdown expression of the variant DNM1 gene and delivering DNA encoding a replacement DNM1 gene, e.g., a nucleotide sequence of SEQ ID NO: 51 or 52, or a variant thereof, or in some aspects delivering DNA encoding a replacement DNM1 gene which is modified to be resistant to the DNM1 microRNA, e.g., a nucleotide sequence of SEQ ID NO: 49 or 50, or a variant thereof, to a subject in need thereof, comprising administering to the subject a delivery vehicle comprising DNA encoding one or more m\DNM1 of the disclosure and delivering a DNA encoding a replacement DNM1 gene which restores the normal expression or at least a functional level of expression of a DNM1 gene (i.e., not a variant DNM1 gene) to allow for the inhibition of aberrant DNM1 expression and the expression of normal DNM1 gene in a cell or in the cells of a subject. Thus, the disclosure provides methods of knocklng-down the aberrant gene and replacing the aberrant gene with a normal / wild-type / functional or miRNA-resistant replacement DNM1 gene.
[0150]
[0125] Methods are also provided of preventing or treating DEE comprising administering a delivery vehicle comprising DNA encoding a m\DNM1 and a DNM1 replacement gene. The methods result in restoration of DNM1 expression to at least 25 percent, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent or more, of normal DNM1 expression in an unaffected subject.
[0126] The disclosure provides a composition comprising the nucleic acids described herein and a pharmaceutically acceptable carrier. The disclosure provides a composition comprising a nanoparticle, extracellular vesicle, exosome, or vector comprising the nucleic acids described herein, and / or a combination of any one or more thereof and a pharmaceutically acceptable carrier.
[0151]
[0127] The disclosure provides a composition comprising a delivery vehicle capable of delivering to cells a nucleic acid encoding a m\DNM1, wherein the m\DNM1 binds a segment of a mRNA encoded by a human DNM1 gene (wherein the segment either does or does not encode sequence comprising a mutation associated with DEE); wherein the segment is conserved relative to the wild-type mouse DNM1 gene, and, optionally, a pharmaceutically acceptable carrier. The human DNM1 gene can comprise the sequence of SEQ ID NO: 51 , or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 51 . The mouse DNM1 gene can comprise the sequence of SEQ ID NO: 52, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the nonvariant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. A m\DNM1 specifically binds, for example, a mRNA segment that is complementary to a sequence within nucleotides as shown in Table 1 of SEQ ID NO: 51 or 52 (the nucleotides bound by, for example, by the miDNMIs of Table 1).
[0152]
[0128] In some aspects, the disclosure provides a delivery vehicle in the compositions that is a viral vector. The viral vector in the compositions can be, for example, an adeno- associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus. The viral vector can be an AAV. The AAV lacks rep and cap genes. The AAV can be a recombinant AAV (rAAV) or a self- complementary recombinant AAV (scAAV). The AAV is or has a capsid serotype selected from, for example, AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74. The AAV can be or can have a capsid serotype of AAV-9. The AAV can be a pseudotyped AAV, such as AAV2 / 8 or AAV2 / 9.
[0129] The disclosure provides methods of delivering to a neuron comprising a duplicated and / or mutant DNM1 gene: (a) a nucleic acid comprising a template nucleic acid encoding a miDNMI comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -16; a nucleic acid encoding a full length m\DNM1 sequence as set out in any one of SEQ ID NOs: 17-32, or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to the sequence set forth in any one of SEQ ID NOs: 17-32; or a nucleic acid encoding a m\DNM1 processed antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 33-48; (b) a vector comprising any one or more of the nucleic acids described herein; or (c) a composition comprising any one or more of the nucleic acids or vectors described herein.
[0153]
[0130] The disclosure further provides a method of delivering to a neuron a nucleic acid comprising a nucleotide sequence encoding a replacement or normal DNM1 gene to restore DNM1 expression in the neuron. In some aspects of the method, such nucleotide sequence is part of the same nucleic acid which comprises the sequence encoding the m\DNM1. In some aspects, the nucleic acid encoding the exogenous replacement DNM1 gene is a wildtype gene or comprises a nucleotide sequence of SEQ ID NO: 51 or 52 or a variant thereof. In some aspects, the nucleic acid encoding the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene. In some aspects, the nucleic acid encoding the exogenous replacement DNM1 gene is a nucleic acid comprising (a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a variant, or a functional fragment thereof; or (b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a variant, or a functional fragment thereof. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non- variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the nucleic acid delivered comprises both the nucleotide sequence encoding the m\DNM1 and the nucleotide sequence encoding the replacement DNM1 gene.
[0154]
[0131] The disclosure provides a method of treating a subject suffering from a duplicated and / or mutant DNM1 gene, the method comprising administering to the subject(a) a nucleic acid comprising a template nucleic acid encoding a m\DNM1 comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1-16; a nucleic acid encoding the full length m\DNM1 sequences set out in any one of SEQ ID NOs: 17-32 or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 17-32; or a nucleic acid encoding a m\DNM1 processed antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 33-48; (b) a vector comprising any one or more of the nucleic acids described herein; or (c) a composition comprising any one or more of the nucleic acids or vectors described herein. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the nonvariant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. The disclosure further provides a method of treating a subject in need thereof comprising administering an effective amount of a nucleic acid encoding replacement or normal DNM1 gene to restore DNM1 expression in the neuron. In some aspects, the nucleic acid encoding the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene. In some aspects, the nucleic acid encoding the exogenous replacement DNM1 gene is a nucleic acid comprising (a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or (b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof. In some aspects, percent identity is percent sequence identity. In some aspects, identity or percent identity is over the full-length nucleotide sequence. In some aspects, identity or percent identity is over a portion of the sequence. In some aspects, the variant comprises the same biological activity as the non-variant polynucleotide sequence and, thus, functions the same as the non-variant. In some aspects, the variant or nucleotide sequence variant exhibits functional activity which differs from the variant. In some aspects, the nucleic acid administered to the subject comprises both the nucleotide sequence encoding the m\DNM1 and the nucleotide sequence encoding the replacement DNM1 gene.
[0155]
[0132] The disclosure contemplates the subject treated by methods herein suffers from a DNM 1 -related disorder. In some aspects, the DNM 1 -related disorder is developmental and epileptic encephalopathy (DEE). In some aspects, the DEE is Lennox-Gastaut Syndrome or infantile spasms. The disclosure also includes treatment of a subject that is at risk for DEE due to a mutation of the DNM1 gene. The subject, in various aspects, is a mammalian animal. The subject, in some aspects, is a human subject.
[0156]
[0133] The disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for, or in treating a subject suffering from, a pathogenic DNM1 gene variant.
[0157]
[0134] The disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for or in treating DEE in a subject in need thereof.
[0158]
[0135] Compositions comprising the nucleic acids and viral vectors of the disclosure are provided. Compositions comprising delivery vehicles (such as rAAV) described herein are provided. Such compositions also comprise a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants. Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
[0136] For CSF delivery including but not limited to intrathecal delivery, compositions provided herein can comprise a pharmaceutically acceptable aqueous excipient containing a non-ionic, low-osmolar compound or contrast agent such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, where the aqueous excipient containing the non-ionic, low-osmolar compound can have one or more of the following characteristics: about 180 mgl / mL, an osmolality by vapor-pressure osmometry of about 322mOsm / kg water, an osmolarity of about 273mOsm / L, an absolute viscosity of about 2.3cp at 20°C and about 1 .5cp at 37°C, and a specific gravity of about 1 .164 at 37°C. Exemplary compositions comprise about 20 to 40% non-ionic, low-osmolar compound or about 25% to about 35% non-ionic, low-osmolar compound. An exemplary composition comprises scAAV or rAAV viral particles formulated in 20mM Tris (pH8.0), 1 mM MgCl2, 200mM NaCI, 0.001% poloxamer 188 and about 25% to about 35% non-ionic, low-osmolar compound. Another exemplary composition comprises scAAV formulated in and 1 X PBS and 0.001 % Pluronic F68.
[0159]
[0137] Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1 x106, about 1 x107, about 1 x108, about
[0160] 1 x109, about 1 x1010, about 1 x1011, about 1 x1012, about 1 x1013, about 1 x1014, about 1 x1016, or more DNase resistant particles (DRP) per ml. Dosages may be expressed in units of viral genomes (vg). Dosages contemplated herein include about 1x107vg, about 1x108vg, about 1x109vg, about 5x109vg, about 6 x109vg, about 7x109vg, about 8x109vg, about 9x109vg, about 1x101° vg, about 2x101°vg, about 3x101° vg, about 4x101°vg, about 5x101° vg, about 1 x1011vg, about 1 .1 x1011vg, about 1.2x1011vg, about 1.3x1011vg, about 1.2x1011vg, about 1.3x1011vg, about 1.4x1011vg, about 1.5x1011vg, about 1.6x1011vg, about 1.7x1011vg, about 1.8x1011vg, about 1.9x1011vg, about 2x1011vg, about 3x1011vg, about 4x1011vg, about 5x1011vg, about 1x1012vg, about 1x1013vg, about 1.1 x1013vg, about 1.2x1013vg, about 1.3x1013vg, about 1.5x1013vg, about 2 x1013vg, about 2.5 x1013vg, about 3 x 1013vg, about 3.5 x 1013vg, about 4x 1013vg, about 4.5x 1013vg, about 5 x 1013vg, about 6x1013vg, about 1x1014vg, about 2 x1014vg, about 3 x 1014vg, about 4x 1014vg, about 5x1014vg, about 1 x1015vg, to about 1 x1016vg, or more total viral genomes. Dosages of about 1 x109vg to about 1 x101° vg, about 5x 109vg to about 5 x101° vg, about 1x101° vg to about 1x 1011vg, about 1x1011vg to about 1 x1015vg, about 1 x1012vg to about 1 x1015vg, about 1 x1012vg to about 1 x1014vg, about 1 x1013vg to about 6x1014vg, and about 6x1013vg to about 1 .0x1014vg, 2.0x1014vg, 3.0x1014vg, 5.0x1014are also contemplated. For example, CSF doses can range between about 1x1013vg / patient to about 1 x1015vg / patient based on age groups. For example, intravenous delivery doses can range between 1 x1013vg / kilogram (kg) body weight and 2 x1014vg / kg.
[0161]
[0138] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. The in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to an subject (including a human patient) in need thereof. If the dose is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival. An example of a disease contemplated for prevention or treatment with methods of the invention is a DEE. DEE include, but are not limited to, Lennox-Gastaut Syndrome and Infantile Spasms. In families known to carry pathological DNM1 gene variants, the methods can be carried out before the onset of disease. In other patients, the methods are carried out after diagnosis.
[0162]
[0139] For intrathecal administration, the subject can be held in the Trendelenburg position (head down position) after injection of the rAAV (e.g., for about 5, about 10, about 15 or about 20 minutes). For example, the patient may be tilted in the head down position at about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.
[0163]
[0140] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the methods. Outcome measures are described, for example, in Aimiuwu et al., Mol. Then, 28(7): 1706-1716 (2020). Outcome measures include, but are not limited to, one or more of the reduction or elimination of mutant DNM1 mRNA or protein in affected tissues, DNM1 gene knockdown, increased survival, increased growth, and decreased seizures. Others include, but are not limited to, improved nerve histology (axon number, axon size and myelination), improved motor function, improved grip strength, reduction in gliosis and neurodegeneration in the brain, and improved metabolic activity.
[0164]
[0141] In the methods of the disclosure, expression of variant DNM1 in a subject is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent compared to expression in the subject before treatment.
[0142] Combination therapies are also contemplated by the invention. Combination as used herein includes both simultaneous treatment and sequential treatments. Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated.
[0165]
[0143] Administration" to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, buccal, nasal, pulmonary, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intravascular, intra-arteriole, intradermal, intraventricular, intracranial, intracerebral, intracerebroventricular, intrathecal, intraosseous, intraocular, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. "Systemic administration" refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject's body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, "local administration" refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes self-administration and the administration by another.
[0166]
[0144] Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the invention are chosen and / or matched by those skilled in the art taking into account the infection and / or disease state being treated and the target cells / tissue(s) that are to express the miRNAs.
[0167]
[0145] In particular, actual administration of delivery vehicle (such as the vector, nanoparticle, endosome, or vesicle) may be accomplished by using any physical method that will transport the delivery vehicle into a target cell of a subject. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be coadministered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the invention. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
[0168]
[0146] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
[0169]
[0147] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0170]
[0148] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
[0171]
[0149] A “pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
[0172]
[0150] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. In some aspects, proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0173]
[0151] In some aspects, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient which protects the formulation from adverse conditions, such as those which occur during heating or freezing, and / or prolongs the stability or shelf-life of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars, such as sucrose, lactose and mannose; sugar alcohols, such as mannitol; amino acids, such as glycine or glutamic acid; and proteins, such as human serum albumin or gelatin.
[0174]
[0152] In some aspects, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance which is added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated puncture of the vial or container being used. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.
[0175]
[0153] Transduction of cells such as neurons with rAAV provided herein results in sustained expression of DNM1 miRNAs. The present invention thus provides methods of administering / delivering rAAV which express DNM1 miRNAs to a subject, preferably a human being. These methods include transducing cells and tissues (including, but not limited to, central nervous system neurons) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements.
[0176]
[0154] The term “transduction” is used to refer to, as an example, the administration / delivery of m\DNM1s to a target cell either in vivo or in vitro, via a replicationdeficient rAAV described herein resulting in the expression of m\DNM1s by the target cell (e.g., neurons).
[0177]
[0155] Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) or effective amount of rAAV described herein to subject in need thereof.
[0178]
[0156] “ Effective amount” of an agent or composition of the disclosure refers to a sufficient amount of the agent or composition to provide a desired effect. The amount of agent or composition that is "effective" will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified "effective amount." However, an appropriate "effective amount" in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an "effective amount" of an agent or composition can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An "effective amount" of an agent or composition necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0179]
[0157] In some embodiments, the dose or effective dose of rAAV administered is about
[0180] 1 .0x1010vg / kg to about 1 .0x1016vg / kg. In some aspects, 1 .0x1010vg / kg is also designated 1.0 E10 vg / kg, which is simply an alternative way of indicating the scientific notation. Likewise, 1011is equivalent to E11 , and the like. In some aspects, the dose of rAAV administered is about 1.0x1011vg / kg to about 1.0x1015vg / kg. In some aspects the dose of rAAV is about 1 .0x1010vg / kg, about 2.0x1010vg / kg, about 3.0x1010vg / kg, about 4.0x1010vg / kg, about 5.0x1010vg / kg, about 6.0x1010vg / kg, about 7.0x1010vg / kg, about 8.0x1010vg / kg, about 9.0x1010about 1.0x1011vg / kg, about 2.0x1011vg / kg, about 3.0x1011vg / kg, about 4.0x1011vg / kg, about 5.0x1011vg / kg, about 6.0x1011vg / kg, about 7.0x1011vg / kg, about 8.0x1011vg / kg, about 9.0x1011vg / kg, about 1 .0x1012vg / kg, about 2.0x1012vg / kg, about 3.0x1012vg / kg, about 4.0x1012vg / kg, about 5.0x1012vg / kg, about 6.0x1012vg / kg, about 7.0x1012vg / kg, about 8.0x1012vg / kg, about 9.0x1012vg / kg, about 1 .0x1013vg / kg, about 2.0x1013vg / kg, about 3.0x1013vg / kg, about 4.0x1013vg / kg, about 5.0x1013vg / kg, about 6.0x1013vg / kg, about 7.0x1013vg / kg, about 8.0x1013vg / kg, about 9.0x1013vg / kg, about 1 .0x1014vg / kg, about 2.0x1014vg / kg, about 3.0x1014vg / kg, about 4.0x1014vg / kg, about 5.0x1014vg / kg, about 6.0x1014vg / kg, about 7.0x1014vg / kg, about 8.0x1014vg / kg, about 9.0x1014vg / kg, about 1 .0x1015vg / kg, about 2.0x1015vg / kg, about 3.0x1015vg / kg, about 4.0x1015vg / kg, about 5.0x1015vg / kg, about 6.0x1015vg / kg, about 7.0x1015vg / kg, about 8.0x1015vg / kg, about 9.0x1015vg / kg, or about 1 .0x1016vg / kg.
[0181]
[0158] In some aspects, an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.
[0182]
[0159] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human subject or patient or veterinary subject or patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.
[0183]
[0160] "Treating" includes ameliorating or inhibiting one or more symptoms of a DNM1- related disorder. Treating or “treatment refers to refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder. “Preventing” includes blocking the occurrence or inhibiting the onset or development of one or more symptoms of a DNM1- related disorder. Such symptoms include, but are not limited to, infantile spasms, generalized tonic clonic seizures, also called grand mal seizures (in which the body, arms, and legs extend, then contract and shake), absence seizures, or episodes consisting of staring, tonic (stiffening) seizures, focal seizures, and atonic seizures. Such DNM1-re\aled disorder includes, but is not limited to, Lennox-Gastaut syndrome. Lennox-Gastaut syndrome is a severe condition characterized by repeated seizures (epilepsy) that begin early in life. Affected individuals have multiple types of seizures, developmental delays, and particular patterns of brain activity measured by a test called an electroencephalogram (EEG).
[0184]
[0161] The disclosure also provides a kit comprising a nucleic acid, vector, nanoparticle, extracellular vesicle, exosome or composition of the disclosure or produced according to a process of the disclosure. In the context of the disclosure, the term "kit" means two or more components, one of which corresponds to a nucleic acid, vector, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise. A kit, therefore, in various aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.
[0185]
[0162] The kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above). The kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and / or means for diluting the nucleic acid, vector, or composition.
[0186]
[0163] In some aspects, the kit comprises a label and / or instructions that describes use of the reagents provided in the kit. The kits also optionally comprise catheters, syringes or other delivering devices for the delivery of one or more of the compositions used in the methods described herein.
[0164] The disclosure also provides kits for a single dose of administration unit or for multiple doses. In some embodiments, the disclosure provides kits containing singlechambered and multi-chambered pre-filled syringes.
[0187]
[0165] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed with "a" or "an," it should be understood that these terms mean "one or more" unless context unambiguously requires a more restricted meaning.
[0188]
[0166] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the disclosure.
[0189]
[0167] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term."
[0190]
[0168] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 10 includes 10.
[0191]
[0169] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having."
[0192]
[0170] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.
[0193]
[0171] In each instance herein any of the terms "comprising", "consisting essentially of' and "consisting of" may be replaced with either of the other two terms.
[0172] It should be understood that this disclosure is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the subject matter of the disclosure, which is defined solely by the claims.
[0194]
[0173] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.
[0195]
[0174] A better understanding of the disclosure and of its advantages will be obtained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
[0196] EXAMPLES
[0197]
[0175] Aspects and exemplary embodiments of the invention are illustrated by the following examples.
[0198] Example 1
[0199] Design and in vitro testing of miDNMI targeting DNM1
[0200]
[0176] To knock down Dnm1 expression, microRNAs were designed to specifically and efficiently target various regions of the Dnm1 gene, including regions of the gene that share homology between the mouse and human.
[0201]
[0177] Artificial miRNAs are based on the natural mir-30, maintaining important structural and sequence elements required for normal miRNA biogenesis but replacing the mature mir- 30 sequences with 22-nt of complementarity with the DNM1 gene.
[0202]
[0178] 16 microRNAs targeting Dnmla were designed and cloned into a mir-30 based construct with expression driven by the U6 promoter, as previously described in Wallace et al., Mol. Ther. J. Am. Soc. Gene Then, 20: 1417-1423 (2012). The miDNMI sequences were generally designed according to Boudreau et al., Chapter 2 of Harper (Ed.), RNA Interference Techniques, Neuromethods, Vol. 58, Springer Science+Business Media, LLC (2011). The sequences of the 16 DNM1 microRNAs designed and created are set out in Table 1 .
[0203]
[0179] The activity of the 16 miRNAs was tested in vitro using a dual luciferase reporter assay. The luciferase assay requires development of a dual reporter plasmid containing 2 different luciferase genes from firefly and Renilla reniformis, respectively. DNM1 gene sequences are inserted as the 3’ UTR of Renilla luciferase, while firefly luciferase serves as an internal control. }Q.m'\DNM1 plasmids are co-transfected into HEK293 cells with the dual luciferase plasmid. DNM1 gene knockdown is determined by measuring activity of Renilla luciferase tagged with DNM1 sequences, relative to the control firefly luciferase activity.
[0204] Example 2
[0205] Development of new mouse model for DNM1 DEE
[0206]
[0180] Animals and identification. All procedures involving mice were approved by Columbia University Institutional Animal Care and Use Committee and carried out in accordance with the National Institute of Health Guide for the care and use of laboratory animals. Dnm1 G359A-cKI mice were generated by Leveragen Inc. using a knockout first approach. Briefly, a floxed gene trap cassette was inserted in front of the target exon while replacing the target exon with engineered mutant exon containing the desired point mutation. This orientation created a knockout allele that can be turned into the point mutation allele by Cre-mediated deletion of the gene trap cassette. Homologous recombination was used to target this construct to the Dnm1 locus in mouse embryonic stem cells derived from 129S6 and B6NTac inbred strains. Founder Dnm1G359A / + mice were continually crossed to C57BL / 6J (JAX Stock No. 664) to produce congenic B6J-Dnm1G359A / + mice, or crossed to FVB / NJ (JAX Stock No. 1800) to produce heterozygous F1 hybrid progeny for mating to B6J -Cre driver strains to generate N2 hybrids used in most experiments.
[0207]
[0181] Newborn mice paw pads were tattooed for identification from PND 0 - PND 10 by the AIMS pup tattoo identification system using Ketchum Animal Tattoo Ink (#329AA) and ear notched at PND 10 for subsequent identification. Mice were weighed frequently from PND 0 to PND 150 and never separated from their home cage for extended amounts of time. During handling, mice were observed for handling-induced tonic-clonic seizures and monitored for recovery before being returned to their home cage.
[0208]
[0182] N1 hybrid mice carrying the Dnm1G359Aconditional mutation were crossed to the following Cre driver strains for experiments: Sox2-Cre, Nestin-Cre, Emx1-Cre, Gad2-Cre, Nkx2.1 -Cre and Pvalb-Cre (The Jackson Laboratory). Genotyping for the G359A encoding mutant allele was achieved by PCR using primers 5’-ACG AAG TTA TTA GGT CTG AAG AGG-3’ (SEQ ID NO: 53) and 5’-CTT GTA GTT GCC GTC GTC CT-3’ (SEQ ID NO: 54) to produce a 562bp band. Alternatively, the G359A containing mutant allele can also be detected by primers 5’- TGC TAT ACG AAG TTA TTA GGT CTG A-3’ (SEQ ID NO: 55) and 5’-GTG GAA GAT CCG CCA TGT CA-3’ (SEQ ID NO: 56) to produce a 233bp band.
[0209]
[0183] AAV vectors for gene therapy. Cloning and production of ssAAV9-U6-miDnm1- 1869 -Syn promoter-co-Dnm1-V5 was carried out according to previously described protocols in (Wallace et al., Mol Ther, 2012. 20(7): p. 1417-23). Briefly, full length human DNM1 and mouse Dnm1 sequences were input into the Harper miRNA shuttle predictor version 1.0 (Wallace et al, PMID: 29387734). Perfect 22 nt sequence-matched miRNAs (including G:ll wobble base pairs) were selected for in vitro testing. Predicted sequences were cloned into the U6T6 backbone (Boudreau et al., (2011) “Rapid Cloning and Validation of MicroRNA Shuttle Vectors: A Practical Guide.” RNA Interference Methods. Ed. S.Q. Harper. Humana Springer Press, 2011 , pages 19-37). The AAV vector expressing the codon-optimized Dnm1-V5 alone was generated by replacing a human DNM1 cDNA driven by Syn1 with the codon optimized Dnm1 sequence by cloning into Nhel / Kpnl flanking sites. For the purpose of quantifying transgenic expression in vivo, a V5 tag was added onto the end of the codon-optimized Dnm1 with PCR using primers 5’ - AAAAGGATCCTCAGCTCGAAAGAC (SEQ ID NO: 57) and 3’ - TTTTGGTACCTTACGTAGAATCGAGCCCGAGGAGAGGGTTAGGGATAGGCTTCCCGGG ATCGGAGATGGTGATG (SEQ ID NO: 58) and then cloning into the BamHI / Kpnl sites. Lead candidate U6.miDnm1 -1869 and the Synapsin promoter-coDnml cDNA cassettes were inserted into a ssAAV9 proviral backbone in toe-to-toe orientation so that the miRNA T6 termination sequence was positioned adjacent to the Dnm1 poly A signal. The miRNA knockdown-only control vector was generated by removing the Syn1 promoter sequence with Spel and Nhel. AAV9 vectors were generated and quantified for titer by Andelyn Biosciences (Columbus, OH).
[0210]
[0184] Intracerebroventricular injection. Intracerebroventricular delivery of vector was carried out at postnatal day (PND) 0 according to methods described in (Kim et al., J Vis Exp, 2014(91 ): p. 51863). Briefly, mice were anesthetized by hypothermia and injected with 5 pl to 10 pl depending on the dose. Injections were carried out free-hand using 10uL Hamilton Neuros Syringe (#65460-06) at approximately 2 / 5th distance from the lambda suture to each eye. Following treatment pups were monitored for growth, overall survival, and any over features such as handling-associated seizures.
[0211]
[0185] Bulk RNA sequencing and analysis. Cortex and hippocampus hemispheres were sampled together from PND15-PND16 mice in triplicate, snap-frozen and delivered to Columbia’s Molecular Pathology Shared Resource core for RNA preparation. The purified RNA was provided to Columbia’s Sulzberger Genomics Core for paired-end sequencing. Between 47M and 70M reads per sample were aligned to the reference mouse genome GRCm39.110 to which a sequence was added for the codon-optimized, RNAi-resistant Dnm1 cDNA. Count estimates were obtained after reads were mapped to the reference genome using the STAR aligner (PMID: 23104886) and differential gene expression analysis was performed using DESeq2 (PMID: 25516281) at the GenePattern server (PMID: 16642009). Results were filtered at q<0.05 and subsequent gene ontology (GO) functional annotation clustering analysis was done using VLAD (PMID: 26047590).
[0212]
[0186] Histology. Three mice from each group (Dnm1 genotype, treatment) were perfused with 4% paraformaldehyde (PFA) for immunohistochemical assessment at PND 21-30. Brains were dissected from the skull and postfixed in 4% PFA overnight at 4°C. Free- floating 100-pm sections were collected using a vibratome (Leica VT1000S). The sections were permeabilized and blocked with 5% normal goat serum and 0.3% Triton X in PBS for 1 h at room temperature. Slices were incubated with either NeuN antibody (1 :500, Sigma, St. Louis, MO, USA; Cat. No. #MAB 377) or parvalbumin antibody (1 :100, Synaptic Systems, Gothenburg, Germany; cat no #195004) with V5 tag antibody (1 :200, Cell Signaling Technologies, Danvers, MA; Cat. No. #13202) in blocking buffer (5% normal donkey serum in 0.01% Triton-X in PBS) for 2 hours in room temperature. Afterward, sections were washed in PBS for 10 min three times and incubated in Alexa Fluor secondary 555 (1 :1 ,000, Thermo Fisher Scientific, Waltham, MA, USA; Ref. No. A21428), Alex Fluor secondary 595 (1 :1 ,000, Thermo Fisher Scientific, Waltham, MA, USA; Ref. No. A11076), Alex Fluor secondary 488 (1 :1 ,000, Thermo Fisher Scientific, Waltham, MA, USA; Ref. No. A11008, A28175) with DAPI (1 :1000) and for 2 h at room temperature. Sections were mounted on slides and cover slipped with fluoromount-G (Southern Biotech, Birmingham, AL, USA; Cat. No. 0100-01).
[0213]
[0187] Image Processing and Analysis. Image processing and analysis was carried out using the Python programming language using OpenCV, NumPy, and Matplotlib libraries.
[0214]
[0188] Image Loading and Thresholding. Images were loaded using the OpenCV library (cv2.imread() function) and converted to grayscale using the cv2.imread() function with the 0 flag. Thresholding was applied to the grayscale images using a specified threshold value (as determined by the user). The thresholding operation creates binary masks where pixels with intensities above the threshold are set to white (255) and pixels below the threshold are set to black (0).
[0215]
[0189] Image Analysis and Metrics Calculation. The following metrics are given as output after Image thresholding: Area: The total number of white (foreground) pixels in the binary masks; Total: The total number of pixels in the images (height multiplied by width).
[0190] Statistical analysis. Statistical analysis was performed using GraphPad Prism 9 software. Growth was analyzed using repeated measures Mixed-effects model, with the Geisser-Greenhouse correction followed by Sidak’s correction for multiple comparisons. Survival Kaplan-Meier curves and Over Seizure Onset curves were analyzed by log-rank Mantel-cox test for two groups and log-rank Gehan-Breslow-Wilcoxon test for comparing three or more groups. P-values are reported using APA style for significance (*p < 0.05, **p < 0.01 , *** p < 0.001).
[0216]
[0191] Results. Growth delay, poor survival and severe seizures were observed in a new conditional knock-in mouse model for DNM1 DEE, i.e., Dnm1 G359A mice. The new mouse model of DNM1 DEE is based on the G359A variant using CRISPR / Cas9. Because heterozygous null Dnm1 mice are not impaired, in order to circumvent the anticipated poor husbandry and survival of Dnm1G359A / + heterozygotes, a Dnm1G359A conditional mutation was generated using the “knockout-first” approach by inserting a gene trap cassette flanked by loxp sites engineered to carry a point mutation (c.1076G>C) in exon 8. The targeted allele is converted to mutant upon Cre-mediated deletion of the gene trap cassette, resulting in a glycine-to-alanine substitution at dynamin-1 amino acid residue 359 (G359A) (Fig. 1).
[0217]
[0192] To establish phenotypes suitable for testing gene therapy, G359A was initially expressed broadly from the early embryo stage by crossing to Sox2-Cre driver mice. Sox2- Cre:G359A mice were weighed and observed for overt behavioral abnormalities and survival until postnatal day 30 (i.e., PND30). Almost 50% of the mice died of indeterminate cause from as early as a few days postnatal. However, while surviving heterozygotes showed significant growth deficits from PND 5 (p=1 .1 x 10-10; n=15 G359A / +, n=20 - / +) (Fig. 2), no overt abnormal behaviors or seizures were observed. Nestin-Cre:G359A mice were next examined to determine if mutant Dnm1 expression in all neurons yielded a better model for testing. Nestin-Cre G359A mutants showed some lethality later in adulthood, with 75% having non-lethal handling-associated seizures. These mice also had significant growth deficits (p=3.3 x 10-8; n=14 G359A / +, n=14 - / +) (Fig. 2). While more suitable, the incomplete penetrance and delayed seizure onset of Nestin-Cre G359A mice were not pragmatic for therapy testing.
[0218]
[0193] Following a prior study of DnmI Ftfl mice (PMID: 26125563), the G359A genotype was then examined in interneurons. Activation in all interneurons by crossing Gad2-Cre driver mice resulted in 100% lethal seizures starting as early as PND 12, fully penetrant by 3 weeks (n=9) (Fig. 2) with less severe growth defects in the first two weeks than Sox2-Cre. Use of Nkx2.1-Cre resulted in no significant growth deficits (G359A / + n=11 , - / + n=19) (Fig. 2), and few overt seizures until adulthood. Pvalb-Cre: G359A mutant mice did not show any significant early growth deficits (G359A / + n=20, - / + n=27) and a few lethal seizures late in adulthood. On balance, because it had the most robust phenotypes, namely, fully-penetrant severe seizures and delayed growth and each readily assessed by 4 weeks of age, the Gad2-Cre:G359A model was chosen for testing gene therapy.
[0219]
[0194] Thus, this new mouse model of DNM1 DEE, encoding the G359A variant that was identified in at least two DEE patients (Euro, E.-R.E.S.C., P. Epilepsy Phenome / Genome, and K.C. Epi, Am J Hum Genet, 2014. 95(4): p. 360-70) was created. Like fitful, G359A maps to the DNM1 middle domain and also encodes a dominant-negative effect that impairs endocytosis (Dhindsa et al., Neurol Genet, 2015. 1 (1 ): p. e4). However, as with many other pathogenic human variants, G359A resides on an exon common to both Dnml a and Dnml b isoforms. Anticipating that mutant heterozygotes would be more severe than Dnm1 Ftfl including compromised husbandry, a conditional knock-in mutation was generated to both examine cellular etiology and to explore a new approach to therapy.
[0220]
[0195] The new mouse model, designed to conditionally encode the pathogenic amino acid substitution G359A, was then used to explore a powerful approach to gene therapy that is potentially broadly applicable to any pathogenic variant of a gene as described herein in the Examples below.
[0221] Example 3
[0222] Bivalent AAV vector to deliver RNAi and cDNA gene therapy
[0223]
[0196] Given the challenges of efficiently and selectively targeting the G359A G>C transversion mutation, a knockdown and replace strategy was carried out. Specifically, an AAV9 vector co-expressing an artificial miRNA engineered to direct RNAi against Dnm1 , and an RNAi-resistant, codon-optimized cDNA containing wobble mutations in the miRNA binding site was designed and made.
[0224]
[0197] To generate effective miRNAs (i.e., referred to herein as “m\Dnm1s”), a bioinformatic screen was first used to identify putative artificial miRNAs targeting mouse Dnm1 and human DNM1 mRNAs (PMID 29387734; Boudreau et al., (2011) “Rapid Cloning and Validation of MicroRNA Shuttle Vectors: A Practical Guide.” RNA Interference Methods. Ed. S.Q. Harper. Humana Springer Press, 2011 , pages 19-37). Sequences (i.e., 16 DNM1 miRNA sequences, as described herein above, e.g., SEQ ID NOs: 1-16) containing 22 nucleotides of antisense base pairing (e.g., SEQ ID NOs: 33-48) with human and mouse mRNAs (including G:ll RNA base pairing) were selected and cloned each as a DNA expression template into a U6 promoter plasmid (U6T6) (Boudreau et al., supra).
[0225] Potential miDnml candidates were the screened using a dual luciferase assay in HEK293 cells transfected with UQ.m'\DNM1 plasmids, or controls, and a dual luciferase reporter plasmid (psiCheck2-D / V / W7) containing full-length DNM1 cDNA as the 3’ untranslated region of Renilla luciferase, and a separate firefly luciferase cassette as a transfection control. Compared to the U6T6 empty control, all 17 UQ.DNM1 constructs triggered silencing of the heterologous Renilla \uc\f erase- DNM1 reporter. Five of the 16 constructs (i.e., designated as mi249, mil 156, mil 505, mil 869, and mi2186 (Table 1 and Fig. 3) were selected for confirmatory studies against mouse Dnm1 targets. Specifically, two additional psiCheck2 plasmids containing a wild-type mouse Dnm1 cDNA or a codon-optimized mouse Dnm1 cDNA with wobble mutations in miRNA binding sites were designed and generated, and each of the five constructs were tested against each reporter construct.
[0226]
[0198] All five miDNMI constructs tested were able to achieve silencing of the wild-type mouse Dnm1 reporter. These constructs also showed reduced silencing against the codon- optimized Dnm1 target. Next, the miRNA construct designated “miDnm1-1869” was selected for in vivo studies, because it silenced both human DNM1 and mouse Dnm1 by >60% (N=3, P<0.0001 , One-way ANOVA, Dunnett’s Multiple Comparison Test) and was ineffective against the modified Dnm1 cDNA (N=3, P=0.9105, One-way ANOVA, Dunnett’s Multiple Comparison Test) (miDnm1 -1869, Fig 3). miDnm1-1869 and the RNAi-resistant, codon-optimized Dnm1 cDNA were synthesized in an AAV9 vector, respectively driven by a U6 promoter or human synapsin 1 (Syn1) promoter (Fig 3). For a knockdown-only control, a version of the vector that lacks the Syn1 promoter was constructed for use as a replacement-only control and it comprised the modified cDNA (Table 4).
[0227] Table 4. Components of the Bivalent Vector, CO-only Vector, and RNAi-only Vector.
[0228] Stock
[0229] AAV9 RNAi cDNA titer
[0230] Vector Component Promoter Component Promoter (vg / ml) name Bivalent miDnml U6 C0-mDnm1b hSYN1 7.2 x 1013
[0231] CO only — — CO-mDnm1b hSYN1 6.7 x 1013
[0232] RNAi only miDnml U6 C0-mDnm1b AhSYNI 7.2 x 1013
[0233]
[0199] Viral vector, i.e., 7.2 x 1011 viral genomes (vg) of ssAAV9-U6-miDnm1-hSyn1-CO- mDnm1 b-V5 to PND0-PND1 was delivered to Gad2-Cre: G359A pups by intracerebroventricular injection. The dose delivered was considered to be a maximum dose based on the virus concentration and a practical upper limit of approximately 10 pl per newborn pup. Thereafter, every 2-3 days until at least 4 weeks of age, body weight, survival, and any seizures observed during handling were monitored. At this high dose, about half of the animals eventually succumbed to a terminal seizure by 4 weeks, but this was irrespective of Dnm1 genotype, i.e. the rate of lethality was the same for - / + littermates (Fig 4A, 4B). At this dose, for animals that reached 4 weeks body weight never reached that of untreated - / +. Next, a half dose (3.6 x 1011 vg) and a one-tenth dose (7.2 x 1010 vg) were administered to additional pups. At the half dose, body weight was further improved although it still lagged behind that of untreated - / + animals, although only one of the 12 treated heterozygotes died by 4 weeks (Fig 4C). At a dose of 7.2 x 1010 vg, only one of 15 treated heterozygotes died by 4 weeks, but after an initial lag the growth curve neared that of untreated 7+ animals by 4 weeks (P=0.14, Fig 4D, Fig 5A). In a limited number of pups, the dose delivered was lowered further to 3.6 x 1010, and all but one pup died before 4 weeks of age (data not shown).
[0234]
[0200] Although the nominal survival endpoint was 4 weeks of age, and some survivors were utilized for molecular validations, the remaining treated G359A / + mice survived indefinitely. Thus, after 4-weeks, at a dose of 7.2 x 1010vg / pup, 3 mice lived until at least 60 days, 4 further mice lived to at least 90 days, and 4 more mice lived until at least 6 months; at a dose of 3.6 x 1010vg / pup, 6 mice lived until at least 40 days, and 5 mice lived to at least 7 months; at a dose of 7.2 x 1011vg / pup dose, 3 mice lived until at least 70 days, 4 mice lived to at least 100 days, and 1 mouse lived to at least 150 days.
[0235]
[0201] The 7.2 x 1010vg dose was very effective to prevent severe seizures and prolong survival, but post-hoc observations suggested the survivors were not completely normal. First, by 12 weeks, the body weight of treated heterozygotes still lagged behind that of treated - / + by over 4 g (P=0.02, Fig, 5B). In addition, older treated G359A / + male mice exhibited aggression, e.g. fighting with male littermates. Also, while each of four treated G359A / + females bred with a wildtype partner to produce several litters each, only two successfully and consistently raised their pups. The rescue was less effective when Gad2- Cre: G359A was tested on the inbred C57BL / 6J strain background, compared with the hybrid background which had been chosen to maximize litter and pup size and overall health. Thus, while G359A / + pups treated with a dose of 7.2 x 1010vg bivalent vector survived significantly longer than untreated mice (p<0.002), with two treated G359A / + mice living to at least 160 days, most mice succumbed to a lethal seizure prior to 4 weeks of age.
[0236]
[0202] To determine whether the RNAi and the cDNA replacement features are both necessary and sufficient for these significant improvements in phenotype, Gad2-Cre G359A mice were tested for the effect of RNAi knockdown with and without cDNA replacement, and vice versa. Although one of the eight Gad2-Cre G359A / + mice treated with only the replacement co- Dnm1 cDNA survived until at least 80 days, neither knockdown-only nor replacement-only control came close to the success of the bivalent vector comprising both RNAi knockdown and cDNA replacement, indicating that both RNAi and cDNA are required for the most successful treatment (Fig. 4A-F). Additionally, the results from these studies resulted in the use of the 7.2 x 1010vg / pup dose of the bivalent vector for further cellular and molecular level assessments.
[0237]
[0203] Knockdown-replace is a logical and global strategy for gain-of-function variants and is particularly helpful for heterozygous dominant-negative variants which inherently represent imbalanced expression between mutant and wildtype alleles. The bivalent vector design employed in this study utilized tried-and-true U6 and hSYN1 promoter-enhancers suitable for the respective RNA cargo. Because of the cargo size limit of AAV, to include both these genes and promoters in a single efficient vector required the single strand AAV genome for expression, which, after cell transduction can take a week or longer than self-complementary AAV to produce the first strand RNA a double-stranded DNA template suitable for transcription (PMID: 20538857). In this respect, it was surprising that transduction of mouse pups even within one day of birth was early enough for a disease that, in mouse, has a readily detectable phenotype - growth delay - before the end of the first week. Indeed, across the 20-fold range of doses used in the study, around the beginning of week two, there was a noticeable growth rate depression that preceded a modest acceleration. This lag-and- recovery corresponds to robust early knockdown of endogenous Dnm1 mRNA followed by eventual full expression of the exogenous Dnm1 mRNA.
[0238]
[0204] It is also possible that mutants on the less successful C57BL / 6J inbred strain background, which are smaller to begin with, suffer from such a lag. Although the effective window for therapy is, in absolute terms, vastly wider in humans, further optimization of expression level and timing in viral vectors may lead to improved pre-clinical effectiveness in more severely impaired mouse models.
[0239] Example 4
[0240] Molecular assessment of transduction
[0241]
[0205] Bulk RNA sequencing (RNAseq) and quantitative PCR (qPCR) were performed on combined cortex-hippocampus tissue RNA from PND15-PND16 pups. qPCR was also performed on the knockdown-only and replacement-only controls Endogenous Dnm1 mRNA counts in treated G359A / + pups were at 78% of the level of untreated - / +, illustrating the impact of the RNAi knockdown averaged across the selected brain regions. Although treated - / + mice expressed only 61 % of endogenous Dnm1 compared to untreated mice, prior to Cre recombination all cells would be heterozygous for the transcriptional stop and hemizygous for Dnm1 . We also observed that the exogenous, codon-optimized, RNAi- resistant Dnm1 mRNA was expressed at 80% of the level of endogenous Dnm1 mRNA of - / + mice, suggesting that Dnm1 expression in Gad2 neurons is restored to at least this level. Analysis of protein from the same tissue supports these conclusions. From qPCR comparisons of knockdown-only and replacement-only experiments, the respective levels were similar to those conferred by the bivalent vector.
[0242]
[0206] It should be noted that these measures reflect tissue-wide, not single cell, averages. In order to estimate the fraction of neurons transduced, AAV9 transduction was visualized by co-staining for the V5 epitope tag on the cDNA and for parvalbumin neurons, chosen because they are sparse enough to readily count cell bodies but represent a large fraction of the inhibitory neuron population in the forebrain. In the cerebral cortex, across both genotypes and replicates an estimated 18% (± 0.1 sd) of all parvalbumin neurons were transduced, and 18% (± 0.1 sd) of all transduced cells were parvalbumin neurons. In the hippocampus, 25% (± 0.1 sd) of all parvalbumin neurons were transduced, although only 10% of all transduced cells were parvalbumin neurons These results suggest that only a fraction of cortical and hippocampal neurons need to be transduced to deliver the rescue that was observed, while confirming that transduction was widespread.
[0243] Example 5
[0244] Impact of G359A and gene therapy on the transcriptome
[0245]
[0207] Although dynamin-1 protein is not known to have a direct role in gene expression, given the severe condition of Gad2-Cre:G359A / + pups, a measurable impact on the transcriptome was anticipated. If so, it follows that some correction should accompany successful gene therapy. From the RNAseq experiment carried out, 539 genes were significantly downregulated in the G359A / + mutant compared to - / +, and 472 genes were significantly upregulated (q<0.05), with the largest change being 4.6-fold in either direction. In contrast, treatment alone on - / + pups yielded only 19 downregulated genes, including Dnm1 , and 29 upregulated genes with the largest change being 3.5-fold in either direction. The latter, comparatively modest changes in - / + suggest that treatment per se does not lead to a significantly altered transcriptome.
[0246]
[0208] To assess the impact of the bivalent vector on the transcriptome of Dnm1 G359A / + and - / + pups, we examined functional annotation enrichment, comparing the degree of clustering for gene ontology (GO) terms. Down-regulated genes and up-regulated genes were analyzed separately to optimize the power of this approach. For the 539 down regulated genes, highly significant clustering was observed for GO Biological Process terms that would be expected mechanistically for impaired dynamin-1 function; groups such as Synaptic Signaling,” “Modulation of Chemical Synaptic Transmission,” Regulation of Trans- Synaptic Signaling” and others (Fig. 7A). For GO Cell Compartment terms even more significant clustering was seen for terms such as “Synapse,” Neuron Projection, and others (Fig. 7B). These results served as a baseline against which to compare the effect of treatment in mutant pups. Indeed, when comparing treated G359A / + to untreated - / +, the clustering for the most significant groups was decreased by 5.5 orders of magnitude (GO Biological Process) or 12 orders of magnitude (GO Cell Compartment), suggesting significant correction in functions reflecting the known mechanism of dynamin-1 . The 472 up- regulated genes also showed significant clustering (Fig. 7C-D), but a lesser extent and for very different GO Biological Process terms, perhaps reflecting physiological response to the pathogenic mechanism. But even in these categories clustering was significantly reduced following treatment, although to a lesser extent than it was for down-regulated genes.
[0247]
[0209] Interestingly, a greater number of gene expression differences were observed between treated and untreated G359A / + pups compared to those between treated and untreated - / + (down-regulated 364 genes vs. 19 genes; up-regulated 408 genes vs. 29 genes, respectively). These differences are comparably reflected in GO Cell Compartment clustering as 4 orders-of-magnitude spikes in groups representing neuronal projections and synapses (Fig. 7B and 7D). Further studies will be needed to determine the degree to which these differences represent residual Gad2-Cre: G359A pathologies or features that emerge from the treatment.
[0248]
[0210] The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.
[0249]
[0211] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise” and variations such as “comprises” and “comprising” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0250]
[0212] Throughout the specification, where compositions are described as including components or materials, it is contemplated that the compositions can also consist essentially of, or consist of, any combination of the recited components or materials, unless described otherwise. Likewise, where methods are described as including particular steps, it is contemplated that the methods can also consist essentially of, or consist of, any combination of the recited steps, unless described otherwise. The invention illustratively disclosed herein suitably may be practiced in the absence of any element or step which is not specifically disclosed herein.
[0251]
[0213] The practice of a method disclosed herein, and individual steps thereof, can be performed manually and / or with the aid of or automation provided by electronic equipment. Although processes have been described with reference to particular embodiments, a person of ordinary skill in the art will readily appreciate that other ways of performing the acts associated with the methods may be used. For example, the order of various of the steps may be changed without departing from the scope or spirit of the method, unless described otherwise. In addition, some of the individual steps can be combined, omitted, or further subdivided into additional steps.
[0252]
[0214] All patents, publications and references cited herein are hereby fully incorporated by reference. In case of conflict between the present disclosure and incorporated patents, publications and references, the present disclosure should control.
Claims
Claims\Ne claim:1 . A nucleic acid comprising(a) a polynucleotide sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1-16;(b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the DNM1 artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17- 32, or(c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48.
2. A nucleic acid comprising(a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or(b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
3. The nucleic acid of claim 1 further comprising a polynucleotide sequence encoding an exogenous DNM1 replacement gene.
4. The nucleic acid of claim 3, wherein the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.
5. The nucleic acid of claim 3 or 4, wherein the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene.
6. The nucleic acid of claim 5, wherein the exogenous DNM1 replacement gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 49 or 50 or a functional fragment thereof.
7. The nucleic acid of claim any one of claims 1 -6 further comprising a promoter or multiple promoters.
8. The nucleic acid of claim 7, wherein the promoter(s) is a U6 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter.
9. The nucleic acid of claim 8, wherein the promoter(s) is a U6 promoter and / or a synapsin promoter.
10. A nanoparticle, extracellular vesicle, exosome, or vector comprising the nucleic acid of any one of claims 1-9 or a combination of any one or more thereof.11 . The vector of claim 10, wherein the vector is a viral vector.
12. The vector of claim 11 , wherein the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector.
13. The vector of claim 11 or 12, wherein the vector is an AAV vector.
14. The vector of claim 12 or 13, wherein the AAV vector lacks rep and cap genes.
15. The vector of any one of claims 12-14, wherein the AAV vector is a recombinant AAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a single-stranded recombinant AAV (ssAAV) vector.
16. The vector of any one of claims 12-15, wherein the AAV has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof.
17. The vector of any one of claims 12-16, wherein the AAV has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66.
18. A composition comprising(a) the nucleic acid of any one of claims 1 -9;(b) the nanoparticle, extracellular vesicle, exosome, or vector of claim 10; or(c) the vector of any one of claims 11 -17; and a pharmaceutically acceptable carrier.
19. A method of reducing the endogenous expression of a variant dynamin-1 (DNM1) gene in a cell and expressing an exogenous replacement DNM1 gene in the cell, the method comprising administering to the cell:(i) a nucleic acid that reduces endogenous expression of a variant DNM1 gene comprising:(a) a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1 -16;(b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%identity to the artificial inhibitory RNA polynucleotide sequence of any one of SEQ IDNOs: 17-32, or(c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48 or the complement thereof; and(ii) a polynucleotide sequence encoding the exogenous replacement DNM1 gene.
20. The method of claim 19, wherein the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.21 . The method of claim 19 or 20, wherein the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene.
22. The method of claim 21 , wherein the exogenous replacement DNM1 gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises:(a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or(b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
23. The method of any one of claims 19-22, wherein the variant dynamin-1 (DNM1) gene is a variant of a DNM1 gene comprising a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the polynucleotide sequence of SEQ ID NO: 51 or 52.
24. The method of any one of claims 19-23, wherein the nucleic acid that reduces endogenous expression of a variant DNM1 gene further comprises a promoter or multiple promoters.
25. The method of any one of claims 19-23, wherein the nucleic acid that encodes the exogenous replacement DNM1 gene further comprises a promoter or multiple promoters.
26. The method of any one of claims 19-25, wherein the nucleic acid that reduces endogenous expression of a variant DNM1 gene and the nucleic acid that encodes the exogenous replacement DNM1 gene are provided together in a single nucleic acid.
27. The method of any one of claims 24-26, wherein the promoter(s) is a LI6 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter.
28. The method of any one of claims 19-22, wherein the promoter(s) is a LI6 promoter and / or a synapsin promoter.
29. The method of any one of claims 19-28, wherein the nucleic acid is administered to the cell in a nanoparticle, extracellular vesicle, exosome, or vector.
30. The method of claim 29, wherein the vector is a viral vector.31 . The method of claim 29 or 30, wherein the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector.
32. The method of any one of claims 29-31 , wherein the vector is an AAV vector.
33. The method of claim 31 or 32, wherein the AAV vector lacks rep and cap genes.
34. The method of any one of claims 31 -33, wherein the AAV vector is a recombinantAAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a singlestranded recombinant AAV (ssAAV) vector.
35. The method of any one of claims 31 -34, wherein the AAV vector has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 ,AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV- PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof.
36. The method of any one of claims 31 -35, wherein the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66.
37. The method of any one of claims 19-36, wherein the cell is a neuron.
38. The method of any one of claims 19-37, wherein the cell is in a human subject.
39. A method of treating a subject suffering from or at risk of suffering from a dynamin-1 (DNM 1) -related disorder, the method comprising administering to the subject an effective amount of:(i) a nucleic acid that reduces endogenous expression of a variant DNM1 gene comprising:(a) a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the dynamin-1 (DNM1) artificial inhibitory RNA-encoding polynucleotide sequence of any one of SEQ ID NOs: 1 -16;(b) a polynucleotide sequence encoding a DNM1 artificial inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the artificial inhibitory RNA polynucleotide sequence of any one of SEQ ID NOs: 17-32, or(c) a polynucleotide sequence encoding a DNM1 antisense guide strand comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence of any one of SEQ ID NO: 33-48 or the complement thereof; and(ii) a polynucleotide sequence encoding the exogenous replacement DNM1 gene.
40. The method of claim 39, wherein the polynucleotide sequence encoding the exogenous DNM1 replacement gene comprises at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a dynamin-1 (DNM1) polynucleotide sequence of any one of SEQ ID NOs: 49-52 or a functional fragment thereof.41 . The method of claim 39 or 40, wherein the exogenous replacement DNM1 gene is resistant to artificial inhibitory RNA targeting the variant DNM1 gene.
42. The method of claim 41 , wherein the exogenous replacement DNM1 gene resistant to artificial inhibitory RNA targeting the variant DNM1 gene comprises:(a) a polynucleotide sequence encoding a codon-optimized human dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence of SEQ ID NO: 49 or a functional fragment thereof; or(b) a polynucleotide sequence encoding a codon-optimized mouse dynamin-1 (DNM1) cDNA sequence comprising at least or about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the mouse dynamin-1 (DNM1) polynucleotide sequence of SEQ ID NO: 50 or a functional fragment thereof.
43. The method of any one of claims 39-42, wherein the variant dynamin-1 (DNM1) gene is a variant of a DNM1 gene comprising a polynucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the polynucleotide sequence of SEQ ID NO: 51 or 52.
44. The method of any one of claims 39-43, wherein the nucleic acid that reduces endogenous expression of a variant DNM1 gene further comprises a promoter or multiple promoters.
45. The method of any one of claims 39-43, wherein the nucleic acid that encodes the exogenous replacement DNM1 gene further comprises a promoter or multiple promoters.
46. The method of any one of claims 39-45, wherein the nucleic acid that reduces endogenous expression of a variant DNM1 gene and the nucleic acid that encodes the exogenous replacement DNM1 gene are provided together in a single nucleic acid.
47. The method of any one of claims 44-46, wherein the promoter(s) is a 116 promoter, a synapsin promoter, a U7 promoter, an H19 promoter, a neuron-specific promoter, and / or a Schwann cell-specific promoter.
48. The method of any one of claims 44-47, wherein the promoter(s) is a LI6 promoter and / or a synapsin promoter.
49. The method of any one of claims 39-48, wherein the nucleic acid is administered to the cell in a nanoparticle, extracellular vesicle, exosome, or vector.
50. The method of claim 49, wherein the vector is a viral vector.51 . The method of claim 49 or 50, wherein the vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus vector.
52. The method of any one of claims 49-51 , wherein the vector is an AAV vector.
53. The method of claim 51 or 52, wherein the AAV vector lacks rep and cap genes.
54. The method of any one of claims 51 -53, wherein the AAV vector is a recombinant AAV (rAAV) vector, a self-complementary recombinant AAV (scAAV) vector, or a singlestranded recombinant AAV (ssAAV) vector.
55. The method of any one of claims 51 -54, wherein the AAV vector has a capsid serotype of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV13, AAVanc80, AAVrh.74, AAVrh.8, AAVrh.10, AAV2 / 1 , AAV2 / 8, AAV2 / 9, AAV- PHP.B, AAV-PHP.eB, AAV-PHP.S, AAVv66, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any other myotropic serotype, or any derivative thereof.
56. The method of any one of claims 51 -55, wherein the AAV vector has a capsid serotype of AAV9, AAVrh.10, AAV-PHP.eB, or AAVv66.
57. The method of any one of claims 39-56, wherein the DNM1-re\ated disorder is developmental and epileptic encephalopathy (DEE).
58. The method of claim 57, wherein the DEE is Lennox-Gastaut Syndrome or infantile spasms.
59. The method of any one of claims 39-58, wherein the subject is a human subject.
60. Use of(a) the nucleic acid of any one of claims 1 -9;(b) the nanoparticle, extracellular vesicle, exosome, or vector of claim 10;(c) the vector of any one of claims 11 -17; or(d) the composition of claim 18 for the preparation of a medicament for reducing the endogenous expression of a variant dynamin-1 (DNM1) gene in a cell and expressing an exogenous replacement DNM1 gene in the cell..61 . The use of claim 60, wherein the cell is a neuron.
62. The use of claim 60 or 61 , wherein the cell is a human cell.
63. The use of any one of claims 60-62, wherein the cell is in a human subject.
64. Use of(a) the nucleic acid of any one of claims 1 -9;(b) the nanoparticle, extracellular vesicle, exosome, or vector of claim 10;(c) the vector of any one of claims 11 -17; or(d) the composition of claim 18 in treating a subject comprising a variant dynamin-1 (DNM1) gene.
65. The use of claim 64, wherein the subject is a human subject.
66. The use of claim 64 or 65, wherein the subject suffers from or is at risk of suffering from a DNM 1 -related disorder.
67. The use of claim 66, wherein the DNM1-re\ated disorder is developmental and epileptic encephalopathy (DEE).
68. The use of claim 67, wherein the DEE is Lennox-Gastaut Syndrome or infantile spasms.
69. The(a) nucleic acid of any one of claims 1 -9;(b) nanoparticle, extracellular vesicle, exosome, or vector of claim 10;(c) vector of any one of claims 11-17;(d) composition of claim 18;(e) method of any one of claims 19-59; or(f) use of any one of claims 60-68, wherein the nucleic acid, nanoparticle, extracellular vesicle, exosome, vector, composition, or medicament is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebral delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.
Citation Information
Patent Citations
Products and methods for inhibition of expression of dynamin-1 variants
US20220333115A1
Production of recombinant adeno-associated virus vectors
US5173414A
Generation of high titers of recombinant AAV vectors
US5658776A
Adeno-associated virus materials and methods
US5786211A
Hybrid adenovirus-AAV virus and methods of use thereof
US5871982A