AAV capsids for delivery to microglia

Abstract

Provided herein are engineered AAV capsids with improved biodistribution and transduction efficiency in microglia, e.g., in the brain, compositions comprising the capsids, and methods of using the same.

Description

[0001]Attorney Docket No.29539-0667WO1 / MGH 2023-153 AAV Capsids for Delivery to Microglia CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Patent Application Serial No.63 / 637,722, filed on April 23, 2024. The entire contents of the foregoing are hereby incorporated by reference. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named “29539-0667WO1_SL_ST26.XML.” The XML file, created on April 22, 2025, is 52,590 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant Nos. DC017117 and CA232103 awarded by the National Institutes of Health. The Government has certain rights in the invention. TECHNICAL FIELD Provided herein are engineered AAV capsids with improved biodistribution and transduction efficiency in microglia, e.g., in the brain, compositions comprising the capsids, and methods of using the same. BACKGROUND Inflammatory diseases such as Alzheimer’s disease that affect microglia in the brain are devastating, owing to their debilitating effects on quality of life as well as lack of effective treatments. Gene therapy for the central nervous system (CNS) using adeno-associated virus (AAV) vectors has risen to the forefront with promising clinical data showing efficacy of therapy targeting the CNS and spinal cord1, 2. Many of these approaches use systemic delivery of AAV serotypes such as AAV9 which can cross the blood-brain barrier, with reasonable distribution of transgene expression in neurons throughout the brain and spinal cord, but with little transduction of microglia. Attorney Docket No.29539-0667WO1 / MGH 2023-153 SUMMARY Described herein are engineered capsids, including AAV capsid proteins comprising an amino acid sequence that comprises at least four, at least five, at least six, or all seven contiguous amino acids from the sequence IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7 SEQ ID NO:29), or another amino acid sequence described herein, e.g., in Table 1. In some embodiments, the AAV is AAV9, e.g., AAV9 VP1, VP2, or VP3. In some embodiments, the sequence is inserted in a position corresponding to between amino acids 588 and 589 of the AAV9 capsid (numbering is from VP1 amino acid 1). The peptide is displayed on the surface of the capsid on the VP3 protein. Also provided herein are nucleic acids encoding the AAV capsid proteins described herein, optionally as recombinant episomes or viral vectors. Further, provided herein are AAV comprising a capsid protein as described herein, and preferably not comprising a wild type VP1, VP2, or VP3 capsid protein. In some embodiments, the AAV further comprises a transgene, preferably a therapeutic transgene, e.g., a protein coding sequence or inhibitory nucleic acid as listed in Table A. Additionally, provided herein are methods for delivering a transgene to a cell. The methods comprise contacting the cell with an AAV comprising a capsid protein as described herein. In some embodiments, the cell is a microglial cell or macrophage. In some embodiments, the cell is in a living subject, e.g., a mammalian subject. In some embodiments, the cell is in a tissue selected from the brain, spinal cord, dorsal root ganglion, and a combination thereof. In some embodiments, the subject has a disease listed in Table A, and the methods include delivering an AAV comprising a capsid protein as described herein and a protein coding sequence or inhibitory nucleic acid as listed in Table A. In some embodiments, the cell is in the brain of the subject, and the AAV is administered by intrathecal delivery. In some embodiments, the intrathecal delivery is via lumbar injection, cisternal magna injection, or intraparenchymal injection. In some embodiments, the AAV is delivered by parenteral delivery, preferably via intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular delivery. Attorney Docket No.29539-0667WO1 / MGH 2023-153 Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIGs.1A-F. Overview of microglia-transducing AAV capsid selection method. A, schematic illustration of first round AAV-CBA-Cre-Cap9 construct. B, schematic illustration of first round of selection, using ICV injection of CX3CR1-GFP mice with AAV-CBA-Cre-Cap9 peptide display library. C, GFP+ microglia were flow sorted and peptide insert regions recovered for NGS and library generation for R2. D, R1 rescued inserts were cloned into AAV-CD68-Cre-Cap backbone (a schematic illustration of which is shown) and a library was produced. E, schematic illustration of second round of selection, using ICV injection into Ai9CAG-FS-tdt x CX3CR1-GFP mice; F, tdTomato / GFP+ microglia were flow sorted and peptide insert regions recovered for NGS and candidate selection. Negative selection by NGS was also done on GFP negative cells. FIGs.2A-B. A, schematic illustration of a candidate microglia selective AAV expression cassette. Promoters can include CD68, TMEM119, and HEXB, and genes of interest can include a Cre, which allows testing in Ai9 (e.g., CAG-floxed-stop- tdTomato) mice for the most sensitive analysis of transduction; tdTomato is the standard fluorescent for testing in non-transgenic animals. B, Example AAV plasmid for microglia expression: pAAV-ins-CD68p-Cre-WPRE-miR9-SV40pA. This plasmid can also include 5’ and 3’ flanking ITRs, e.g., pAAV-ITR-ins-CD68p-Cre-WPRE- miR9-SV40pA-ITR. FIG.3. Schematic illustration of experiments for flow based detection of transduced microglia. AAV9-hexbpromoter-tdTomato was injected into striatum of Attorney Docket No.29539-0667WO1 / MGH 2023-153 CX3CR1-GFP mice, and one week later brains were dissociated and flow cytometry used to analyze GFP + microglia and any transduction of these cells (tdTomato+). FIGs.4A-B. Results of experiments illustrated in FIG.3. A, flow results from cells from uninjected CX3CR1-GFP mouse, showing little to no cells in the relevant area. B, flow results from cells from AAV9-hexbpromoter-tdT injected CX3CR1-GFP mouse, showing transduces “other cells” in the P2 area, and a significant number of transduced microglia in the Double + area. FIGs.5A-J. Confocal microscopy experiments performed to compare MC1, MC4, MC5 qualitatively to AAV and MG1.2. A, AAV-MC.1-hexbp-Tdt mediates selective microglia transduction in murine brain (ICV injection). B, AAV-MC.1- hexbp-Tdt mediates selective microglia transduction in murine brain (striatal injection). C, AAV-MC.4-hexbp-Tdt mediates selective microglia transduction in murine brain (ICV injection). D, AAV-MC.4-hexbp-Tdt mediates selective microglia transduction in murine brain (striatal injection). E, AAV-MC.5-hexbp-Tdt mediates selective microglia transduction in murine brain (ICV injection). F, AAV-MC.5- hexbp-Tdt mediates selective microglia transduction in murine brain (striatal injection). G, AAV-MG1.2-hexbp-Tdt mediates selective microglia transduction in murine brain (ICV injection). H, AAV-MG1.2-hexbp-Tdt mediates selective microglia transduction in murine brain (striatal injection). I, AAV-9-hexbp-Tdt mediates selective microglia transduction in murine brain (ICV injection). J, AAV-9-hexbp-Tdt mediates selective microglia transduction in murine brain (striatal injection). FIG.6. AAV-MC5-mIba1-GFP transduces microglia after intrastriatal injection in adult C57BL / 6 mice. Confocal imaging of brain sections of mice injected with the AAV vector were immunostained for Iba1 and GFP. White signal indicates colocalization of GFP with Iba1 (arrowheads). FIGs.7A-B. AAV-MC5-mIba1-GFP transduces microglia after ICV injection in adult C57BL / 6 mice. A, Confocal imaging of brain sections of mice injected with the AAV vector were immunostained for Iba1 and GFP at the top. White arrow heads point to Iba1 colocalized with GFP immunostaining. Arrow with asterisk points to GFP positive cell not colocalized with Iba1. B. magnification of merged image. FIGs.8A-B. A, Schematic of the experiment. A microglia selective transgene expression cassette from Okada et al. with a mouse Iba1 promoter was utilized and packaged into AAV9 or MC5. Adult C57BL / 6 mice (n=4-5 per group) were injected Attorney Docket No.29539-0667WO1 / MGH 2023-153 ICV with either vector. B, Transduction efficiency of microglia for each capsid. Individual brain sections containing the lateral ventricle (two per mouse) are shown as individual data points. Error bars represent standard deviation of the mean. *p=0.015. FIGs.9A-C. Transduction of microglia by MC5, AAV9, and MG1.2 in the hippocampus after direct injection of the highest dose tested (2.1x109vg). A, Transduction efficiency of microglia in the hippocampus by each capsid. MC5 vs. AAV9 *,p=0.0216; MC5 vs. MG1.2 *,p= 0.0192. B, Transduction specificity for microglia of each capsid. MC5 vs. AAV9, *, p=0.0248; MC5 vs. MG1.2, *, p= 0.0137. C, Transduction specificity of microglia (Iba1+) and other cells (Iba1−) cells for each capsid in the hippocampus. MC5 vs. AAV9,**, p=0.0067; MC5 vs. MG1.2, **, p=0.0026. FIGs.10A-C. MC5 mediates enhanced transduction efficiency and specificity towards microglia after intracranial injection in hippocampus (1.0x109vg). A. Transduction efficiency of microglia in the hippocampus by each capsid. ***,p=0.001. B. Transduction specificity for microglia of each capsid. *,p=0.0363; ***, p=0.001. C. Transduction specificity of microglia (Iba1+) and other cells (Iba1−) cells for each capsid in the hippocampus. *,p=0.012; ***, p=0.001. FIGs.11A-C. Transduction of microglia by MC5 in the hippocampus after direct injection at three tested doses. A, Transduction efficiency of microglia in the hippocampus by MC5. ***, p=0.001. B, Transduction specificity for microglia of MC5. *, p= 0.0142. C, Transduction specificity of microglia (Iba1+) and other cells (Iba1−) cells for MC5 in the hippocampus. **, p=0.0028. FIG.12. MC5 transduces microglia in APP / PS1 mice with amyloid β plaques. At 7 days post-injection, GFP-positive plaque-associated microglia were observed throughout the cortex in 8-month-old APP / PS1 mice. Image is an 8-micron thick z- projection image. Scale bar= 20 μm. DETAILED DESCRIPTION Microglia are implicated in a plethora of CNS pathologies involving neuroinflammation, including Alzheimer’s Disease. To date, no delivery systems, including AAV vectors, that efficiently express transgenes in these cells have been developed. The ability to genetically modulate microglia would have a huge impact on the ability to treat these neuroinflammatory diseases. Even the ability to target Attorney Docket No.29539-0667WO1 / MGH 2023-153 murine microglia in vivo would be a significant advancement as it would enable testing of AAV-based therapies targeted to this cell type. With this in mind, we developed an in vivo selection strategy with an AAV9 peptide display library (referred to herein as iTransduceM) that allows selection of transduction competent AAV capsids that provide for transduction of microglial cells, based on our earlier work (Hanlon et al., Mol Ther Methods Clin Dev, 2019.15: p. 320-332). We performed two rounds of in vivo selection in mice after intracerebroventricular injection of the AAV peptide display library. In the second round, we utilized iTransduce to isolate AAV variants that led to functional transduction in microglia. We then identified capsids that outperformed AAV9 and MG1.2 (Lin et al., Nat Methods.2022 Aug;19(8):976-985) in terms of biodistribution and transduction efficiency in microglia. We chose to target microglia via injection into cerebral spinal fluid (CSF) over systemic injection. Direct CSF injection requires far lower dosing compared to the intravenous route and also avoids systemic exposure of vector to the peripheral immune system which has led to severe adverse events (SAEs) in some clinical trials using high-dose AAV vectors (4-7). The concentrations of anti-AAV antibodies are also generally lower in the CSF than the blood, which increases the number of patients eligible for dosing (8). Compared to direct intraparenchymal injection, CSF injection leads to greater vector dispersion, although deeper brain structures such as the striatum are not transduced as efficiently (9). We compared MC5 with AAV9 for transduction of microglia after lateral ventricle injection. MC5 improved the efficiency by ~4-fold over AAV9 and most transduced microglia were observed lining the ventricles and in the proximal areas of the corpus callosum and cortex. This was performed with one dose and at 7 days post injection. In the future testing different doses and extending the in-life period out to several weeks may improve the detection of more transduced microglia throughout the brain. Interestingly, in addition to its enhanced transduction via ICV injection, MC5 was efficient at transduction of microglia after direct intraparenchymal injection in the hippocampus. In a recent study, Lin et al. used a directed evolution approach to select AAV capsids that could transduce microglia in mice after direct intracranial injection (2). While very promising, the capsids MG1.1 and MG1.2 were shown to transduce microglia in transgenic mice (e.g., CX3cr1CreER) that expressed Cre only in Attorney Docket No.29539-0667WO1 / MGH 2023-153 microglia and in which the AAV transgene was Cre-inducible (AAV-SFFV promoter- DIO-mScarlet). When MG capsids packaging the Cre inducible reporter were co- injected with AAV packaging a Cre cassette under control of a strong promoter, neurons and astrocytes were transduced by this capsid (and not microglia). Thus, while MG capsids seem to be valuable tools to study microglia biology in transgenic mice, their use as a therapeutic delivery vehicle that can selectively transduce microglia was currently untested. A study by Okada et al. demonstrated that AAV9 can transduce microglia after direct intracranial injection in mice if the transgene expression cassette is designed with a microglia selective promoter (Iba1) combined with miRNA seed sequences (pAAV-Iba1-GFP-miR9T-miR129-2-3pT) that allow degradation of vector expressed transgene mRNA in non-target cells (e.g. neurons)(1). They found that microglia-selective transduction was dose dependent and increasing the dose changed the profile to primarily neuronal transduction. In our current study, we performed a head-to-head comparison of AAV9, MC5, and MG1.2 capsids all packaging the Okada et al. pAAV-Iba1-GFP-miR9T-miR129-2-3pT genome and injected them in parallel directly into the murine hippocampus. We confirmed the dose-dependent results of Okada et al. that doses above a certain threshold yield significant neuronal transduction and lowering the dose was required for selective microglia transduction for all capsids (see FIGs.9A-C, 10A-C, 11A-C). MC5 was more selective and had higher transduction efficiency of microglia compared to both AAV9 and MG1.2, and at the optimal dosed reached over 80% transduction efficiency and 90% specificity for microglia (see FIGs.10A-C, 11A-C). These data provide evidence that both physical targeting and transgene expression cassette design (i.e. transcriptional targeting) are important in obtaining the most efficient and selective AAV capsids for in vivo microglia transduction. Based on Okada et al. data, it was not surprising that at the highest dose tested there was more neuronal transduction by MC5 compared to the lower doses tested (see FIGs.9A-C). However, what was intriguing was that microglia transduction efficiency was doubled when decreasing the dose of MC5, which would initially seem counterintuitive (FIG.11A). This may indicate that at higher doses, AAV capsids may activate microglia leading to either transcriptional shutdown of transgene expression or degradation of capsids and / or vector genomes. In fact, in pilot studies with high titer, undiluted stocks of MC5, we observed transduced microglia with an ameboid Attorney Docket No.29539-0667WO1 / MGH 2023-153 shape, which is an indication of activation. There is evidence that suggests that AAV genomes stimulate a TLR9-dependent activation of cytokine release in innate immune cells such as plasmacytoid dendritic cells which is driven by CpG motifs in the AAV vector (10, 11). This can even occur in the brain as it has been reported that intracranially injected AAV can lead to reduce dendritic complexity in transduced neurons and this can be rescued by blocking TLR9 activation with the antagonist oligonucleotide (ODN) 2088 (12). As innate immune cells themselves, microglia express TLR9 and activation of this pathway can mediate pro-inflammatory activation (13, 14). Thus, it is quite plausible that at certain dose thresholds, the AAV genome may stimulate TLR9 activation in microglia leading to a variety of effects which may impact AAV mediated transgene expression. For example, inflammatory cytokine release has been shown to reduce transgene expression by AAV vectors (15). In the future, immunosuppressive strategies co-administered with AAV should be tested which may improve transduction efficiency at higher doses, allowing more microglia transduced in larger brain regions. Syndecans are transmembrane heparan sulfate proteoglycans that interact with a variety of ligands, including integrins, EGFR, and HER2 (16). Interestingly, the region of syndecan-4 (SDC4) that the MC5 possibly mimics is within the extracellular domain sometimes called the “cell binding domain” as it allows attachment of several cell types (17, 18) (FIG.7A-B). This region, including the NXIPEX motif (part of the region that MC5 has homology to), has been previously identified as highly conserved across mammals(19). Interestingly, changing Ile89 (contained in the IRENAQP motif of MC5, SEQ ID NO:32) to alanine in a peptide mimetic of SDC4 reduced SDC4 binding activity to EGFR by 10-fold (19). This motif was also important in binding to α3β1 integrins(19). Since the putative SDC4 motif of the MC5 peptide is in the extracellular region of SDC4, it seems likely that it is engaging a ligand on the surface of microglia, perhaps EGFR and / or α3β1 integrins. It will be interesting in future studies to test MC5 binding to these ligands. The MC57-mer ligand may be suitable for affinity maturation / mutagenesis with the aim to improve selectivity of the capsid for microglia. Using the humanized version of the MC5 peptide (FIGs.7A-B) as well as the affinity maturation process, we may also be able to develop a translational capsid that may function well in vivo in non-human primates and human microglia. Attorney Docket No.29539-0667WO1 / MGH 2023-153 In this study we used the published AAV expression construct by Okada et al. which has an Iba1 promoter, and miR9 and miR129-2-3p target sites. As the field develops, more restrictive promoters and enhancers may be used to further limit expression in neurons. Recently, a preprint described the use of miR124 target sites and the use of a truncated human IBA1 promoter to restrict transduction to microglia (20). As our experiments with MC5 were done in healthy adult mice, we also wanted to test whether the ability of the capsid to transduce microglia was maintained in relevant disease models. We found in a commonly used mouse model of AD, MC5 transduced microglia surrounding or within Aβ plaques (FIG.12). Thus the MC5 capsid may be useful for studying disease biology and gene therapy strategies targeted at microglia in these models. Overall, this study demonstrates that the MC5 capsid can be used to transduce microglia in mice and provides a useful gene delivery vector. Thus, described herein are capsids with enhanced biodistribution and transduction of microglia compared to AAV9 and MG1.2. The capsids described herein, including IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7 SEQ ID NO:29), as well as other capsids described herein, e.g., listed in Table 1, can be used for gene delivery in subjects with spinal cord injury and disease. Engineered AAV capsid proteins The present methods identified peptide sequences that enhance biodistribution and transduction of spinal cord of an AAV when inserted into the capsid of the AAV, e.g., into AAV1, AAV2, AAV6, AAV8, or AAV9, or another AAV known in the art or listed herein. The insertion point is in the VR-VIII loop of the capsid at the 3-fold axis of symmetry. This corresponds to insertion between amino acids 588 and 589 (numbered from VP1 of AAV9 capsid). In some embodiments, the peptides comprise sequences of at least 7 amino acids. In some embodiments, the amino acid sequence comprises at least 4, e.g., 5, 6, or 7 contiguous amino acids of the sequences IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ Attorney Docket No.29539-0667WO1 / MGH 2023-153 ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7 SEQ ID NO:29), as well as other capsids listed herein, e.g., in Table 1. Peptides including reversed sequences can also be used, wherein the N- terminal to C-terminal order of the amino acid residues is reversed, such that the order of amino acid residues from the N terminus to the C terminus of the original peptide becomes the order of amino acid residues from the C-terminus to the N-terminus in the modified peptide. AAVs Viral vectors for use in the present methods, kits and compositions include recombinant adeno-associated virus (AAV) comprising a capsid peptide as described herein and optionally a transgene for expression in a target tissue. AAV are a preferred viral vector system for delivery of nucleic acids. AAV is a tiny non-enveloped virus having a 25 nm capsid. No disease is known or has been shown to be associated with the wild type virus. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit long-term episomal transgene expression, and AAV has demonstrated excellent transgene expression in the brain, particularly in neurons. Space for exogenous DNA is limited to about 4.7 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol.5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol.2:32-39 (1988); Tratschin et al., J. Virol.51:611-619 (1984); and Flotte et al., J. Biol. Chem.268:3781-3790 (1993). There are numerous alternative AAV variants (over 100 have been cloned), and AAV variants have been identified based on desirable characteristics. In some embodiments, the AAV is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AV6.2, AAV7, AAV8, rh.8, AAV9, rh.10, rh.39, rh.43 or CSp3; for CNS use, in some embodiments the AAV is AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, or AAV9. As one example, AAV9 has been shown to somewhat efficiently cross the blood-brain barrier. Using the present methods, the AAV capsid can be genetically engineered to enhance biodistribution and transduction of spinal cord, by insertion of a peptide sequence as described herein into the capsid protein, e.g., into the AAV9 capsid protein VP1 between amino acids 588 and 589. Attorney Docket No.29539-0667WO1 / MGH 2023-153 An exemplary wild type AAV9 capsid protein VP1 (Q6JC40-1) sequence is as follows: 10 20 30 40 50 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY 60 70 80 90 100 KYLGPGNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF 110 120 130 140 150 QERLKEDTSF GGNLGRAVFQ AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP 160 170 180 190 200 QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE SVPDPQPIGE PPAAPSGVGS 210 220 230 240 250 LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI TTSTRTWALP 260 270 280 290 300 TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR 310 320 330 340 350 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY 360 370 380 390 400 QLPYVLGSAH EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF 410 420 430 440 450 PSQMLRTGNN FQFSYEFENV PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT 460 470 480 490 500 INGSGQNQQT LKFSVAGPSN MAVQGRNYIP GPSYRQQRVS TTVTQNNNSE 510 520 530 540 550 FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS LIFGKQGTGR 560 570 580 590 600 DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG 610 620 630 640 650 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK 660 670 680 690 700 NTPVPADPPT AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ 710 720 730 YTSNYYKSNN VEFAVNTEGV YSEPRPIGTR YLTRNL (SEQ ID NO:1) Thus provided herein are AAV that include one or more of the peptide sequences described herein, e.g., an AAV comprising a capsid protein comprising a sequence described herein, e.g., an AAV9 VP1 capsid protein wherein a peptide sequence described herein has been inserted into the sequence, e.g., between amino acids 588 and 589 (in bold above). The AAV can be, e.g., recombinant episomal AAV. The AAV sequences can be, e.g., at least 80, 85, 90, 95, 97, or 99% identical to a reference AAV sequence set forth herein, e.g., can include variants, preferable that do not reduce the ability of the AAV to mediate transgene expression in a cell. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can Attorney Docket No.29539-0667WO1 / MGH 2023-153 be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. Transgenes In some embodiments, the AAV also includes a transgene sequence (i.e., a heterologous sequence), e.g., a transgene encoding a therapeutic agent, e.g., as described herein or as known in the art, or a reporter protein, e.g., a fluorescent protein, an enzyme that catalyzes a reaction yielding a detectable product, or a cell surface antigen. The transgene is preferably linked to sequences that promote / drive expression of the transgene in the target tissue (e.g., microglia specific promoters). Exemplary transgenes for use as therapeutics include ApoE2 (e.g., ) and TREM2. Other transgenes can include small or inhibitory nucleic acids that alter / reduce expression of a target gene, e.g., siRNA, shRNA, miRNA, antisense oligos, or long Attorney Docket No.29539-0667WO1 / MGH 2023-153 non-coding RNAs that alter gene expression (see, e.g., WO2012087983 and US20140142160), e.g., miRNA targeting CD33. Other transgenes can include genome editing reagents including CRISPR proteins such as CRISPR-Cas9, -Cas12a nucleases and nickases, cytosine base editors (CBEs), adenine base editors (ABEs), CRISPR prime editors (PEs), variants thereof, and optionally their associated guide RNAs, that target CD33, or that target critical viral genes and / or excise integrated viruses, e.g., human immunodeficiency virus (HIV) provirus, hepatitis B virus (HBV) or human papillomavirus (HPV), in microglia, e.g., as described in Zhang and Li, Front Cell Dev Biol.2021; 9: 716344 and references cited therein, including Hu et al., BioMed. Res. Internat.2014:612823; Yin et al., Nat. Biotechnol.351179–1187.10.1038 / nbt.4005 (2017); Mangeot et al., Nat. Comm.10:45 (2019); Gupta et al., Nature 568244–248 (2019); Lin et al., Cell Reports Medicine 2021:100245.10.1016 / j.xcrm.2021.100245; Lin et al., Mole. Ther. Nucleic Acids 3:e186.10.1038 / mtna.2014.38 (2014); see, e.g., Table 1 of Zhang and Li. The virus can also include one or more sequences that promote expression of a transgene, e.g., one or more promoter sequences; enhancer sequences, e.g.5’ untranslated region (UTR) or a 3’ UTR; a polyadenylation site; and / or insulator sequences. In some embodiments, the promoter is a brain tissue specific promoter, e.g., a neuron-specific or glia-specific promoter, or a microglia specific promoter. In some embodiments, the promoter is a microglia specific promoter, e.g., a promoter of a gene selected from: Iba1, CD68, TMEM119, and HEXB; exemplary sequences are provided below and / or are known in the art (see, e.g., Serrano et al., Version 1. bioRxiv. Preprint.2023 Dec 13. doi: 10.1101 / 2023.12.12.571321, human Iba1 sequence). In some embodiments, the promoter is a pan-cell type promoter, e.g., cytomegalovirus (CMV), beta glucuronidase, (GUSB), ubiquitin C (UBC), or rous sarcoma virus (RSV) promoter. The woodchuck hepatitis virus posttranscriptional response element (WPRE) can also be used. microRNA (miRNA)-dependent post-transcriptional suppression of transgene expression can be used to increase specificity of vector-mediated transgene expression. MicroRNAs typically regulate gene expression by binding to sequences in the 3’ untranslated region (UTR) of the mRNA. To control exogenous transgene expression, tandem repeats of artificial microRNA target sites (also referred to as Attorney Docket No.29539-0667WO1 / MGH 2023-153 targets) can be incorporated into the 3’ UTR of the ENPP1 transgene expression cassette, leading to subsequent degradation of transgene mRNA in cells expressing the corresponding microRNA, thereby decreasing expression, e.g., as shown in FIG. 16. See, e.g., Geisler and Fechner, World J Exp Med.2016 May 20;6(2):37-54. Artificial miR-target for miRs useful in the present constructs can include miR9, mir129-2-3, or miR124. In some embodiments, miR9 target sites can be incorporated into the 3’ UTR. Methods of Use The methods and compositions described herein can be used to deliver any composition, e.g., a deoxyribonucleic acid sequence of interest to a tissue, e.g., to microglia, e.g., in the spinal cord, central nervous system (brain), or to macrophages, e.g., in the peripheral nervous system (e.g., dorsal root ganglion or peripheral nerves). In some embodiments, the methods include delivery to specific brain regions, e.g., cortex, cerebellum, hippocampus, substantia nigra, amygdala. In some embodiments, the methods include intrathecal delivery. In some embodiments, the methods include delivery cells in the spinal cord or the peripheral nerves. In some embodiments, the methods and compositions, e.g., AAVs, described herein are used to deliver a nucleic acid sequence to a subject who has a disease, e.g., a disease of the CNS; see, e.g., US9102949; US 9585971; and US20170166926. In some embodiments, the subject has a condition listed in Table A; in some embodiments, the vectors are used to deliver a therapeutic agent (e.g., sequence encoding the target (gene addition therapy) or inhibitory nucleic acid that reduces expression of the target) listed in Table A for treating the corresponding disease listed in Table A. The therapeutic agent can be delivered as a nucleic acid, e.g., via a viral vector, wherein the nucleic acid encodes a therapeutic protein or an inhibitory nucleic acid such as an antisense oligo, siRNA, shRNA, or artificial miRNA that reduces expression of the target, and so on; or as a fusion protein / complex with a peptide as described herein. The methods and compositions described herein can be used to treat these conditions in a subject in need thereof, by administration of a therapeutically effective amount of an AAV carrying a therapeutic transgene, sufficient to ameliorate, reduce risk of, or delay onset of one or more symptoms of the condition. Attorney Docket No.29539-0667WO1 / MGH 2023-153 Table A. CNS and peripheral nerve targets Disease Target Modality Target Reference genes cells / tissues Alzheimer’s Disease CD33, CD33: Microglia in Brain nucleic acid 2013; APOE: gene al., TREM2 addition therapy BACE: inhibitory nucleic acid against base or encoded anti- BACE1 TREM2: gene addition therapy Viral diseases, e.g., Proviral Excise viral genes Zhang HIV, HBV, genes, integrated into Front conserved genome regions, The methods described herein include the use of pharmaceutical compositions comprising the AAVs as an active ingredient. Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intraarterial, subcutaneous, intraperitoneal, intrathecal, intramuscular, or injection or infusion administration. Delivery can thus be systemic or localized. For example, for delivery into the inner ear, delivery into the cochlea through application over or through the round window membrane, through a surgically drilled cochleostomy adjacent to the round window, a fenestra in the bony oval window, or a semicircular canal can be used (see, e.g., Kim et al., Mol Ther Methods Clin Dev.2019 Jan 11;13:197-204; Ren et al., Front Cell Neurosci.2019; 13: 323); for delivery into the retina, subretinal or intravitreal injections can be used (see, e.g., Ochakovski et al., Front Neurosci.2017; 11: 174; Xue et al., Eye (Lond). 2017 Sep;31(9):1308-1316). Attorney Docket No.29539-0667WO1 / MGH 2023-153 Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin. Attorney Docket No.29539-0667WO1 / MGH 2023-153 Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. In one embodiment, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811. The pharmaceutical compositions can be included in a kit, container, pack, or dispenser together with instructions for administration. For example, the kit can include compositions comprising an AAV comprising a peptide as described herein. Exemplary sequences In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein is at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to a sequence set forth herein. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison Attorney Docket No.29539-0667WO1 / MGH 2023-153 purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions or deletions as compared to a sequence set forth herein. In some embodiments, the substitutions are conservative substitutions. Exemplary Microglia selective promoter sequences hCD68 promoter sequence tcatttcttacctccccttccctctcccacctgctactgggtgcatctctgctcccc ccttccccagcagatggttacctttgggctgttgctttcttgtcaccatctgagttc tcagacgctggaaagccatgttctcggctctgtgaatgacaatgctgactggagtgc tgcccctctgtaaagggctgggtgtggatggtcacaagcccctcacatgcctcagcc aagaggaagtagtacaggggtcagcccagaggtccaggggaaaggagtggaaaccga tttccccaccaagggaggggcctgtacctcagctgttcccatagctacttgccacaa ctgccaagcaagtttcgctgagtttgacacatggatccctgtggatcaactgcccta ggactccgtttgcacccatgtgacactgttgactttgccctgatgaagcagggccaa cagtcccctaacttaattacaaaaactaatgactaagagagaggtggctagagctga ggcccctgagtcaggctgtgggtgggatcatctccagtacaggaagtgagactttca tttcctcctttccaagagagggctgagggagcagggttgagcaactggtgcagacag cctagctggactttgggtgaggcggttcagcc (SEQ ID NO:2) Attorney Docket No.29539-0667WO1 / MGH 2023-153 TMEM119 promoter sequence gttctcggagcccttgacctgacccctttctgtttggcaaaaaagtaatttacctcg gtgtccttctccctggtagtctgtgagctccccaaggctgggctgtgcctgattcac ctctggaacttgcttagcacagtgcgtggcctgctgcaggtgttcattgagcacttg ccgaatgaatgcatgaatgaatgaatgaatgaatgaatgcaaggggctgctaatcca caggactcctcaggtcagccagacgtcccggttccaaggcctgccactgactcacct caggaccctgcttgaaccattagaactcaccctgcctcactttccccctctgtgaaa tggggctccaactcctattcaagctactatcatttgggggcattgtgaggccacaga tcccagaacatcagagtcagaggtagcccagaaagcttcccacccatccctacaaat gggaaactgaggtctggagagggaagggcagagttgggctccctgtctcaggctcgg acccaccatcaggcctgtctctaaaacgaatcccagctcccacgctgcaccctgagc ctggaagcctgagccacacaaggacggggaattttccttcccacttccagaggcctc tgaacctccctgagcttgtcccctttggagggtattgggcagcagcgtgggcagaac cccagctcactgtctgggggagcgctgcaggacagccttgtctgtctgtctcagcct gccctggggacccgaggtcagggaggaagtgccgcatctggtcttccccagagcgag agtgtgagcaagggtgggattgcgtgtggcccgagagtagcccctcccctccccctg tccccaccccaaaccctcttaatgaaatcaagctggccctgcggcccagccggggag ggaggaaggaggagggacgggaggagggacgggaggagggagggcgggcaggcgcca gcccagagcagccccgggcaccagcacggactctctcttccagcccaggtgcccccc actctcgctccattcggcgggagcacccagtcctgtacgccaaggaactggtgagtc ctggggtcccctcctctgtcctgagagcctggagctatcttggagcttagggactgg ggactgttggagcactctggggggcctctctaagtgtgtgtgggctttgagtgtgtg tttggtgttgtgtgcatgagtgtggtggaatctgagtcccgtgt (SEQ ID NO:3) HEXB promoter sequence CGGGAGGTTTTATCAATCAGAGTCCACCACCGTCAGATTTAGTGACAAAAACACTAC CTGAAGAGTGGAGGAAGAGACAGGTCTTGCCTGTCAGTGGGCTGCACAAACAAGTTC CTCAGGCGTGACAGGCGTGAGCCACACCCCAGCATCCCGGCTAGAGCGCGACCGCCT CTGCACCGAGCCTGCCCCCAATTTCCGGGCCAATCCCCTCTCGGAGGCGGAGCCCGG GCGGGGAGCTCGGTCATCTGACTTGGTGACCCGGGCACGGATGCTTTCTTCCCAGCG ACCCAGACTGGAAGGTTGGTCCAAAGACTGCCTAGCCAGACTCGC (SEQ ID NO:4) Mouse Iba1 sequence TACTATAGGATGCATCGTGAAAACCTCGTTTCCACCAGGAACTGAGGTTGCTGCTGG AGGAAATCTCCCATGAAGAGCTGTTAACTGGGGAACTGGTTGGATCCAGCTCCTACA AGCTCTCCTTTAATTTCCATACACATGCCAAGCTGTGAACACCTGCACACACAGTAC AAATAAAACAGTAGAAATGAAATGAAAATTAAAACAAAAACAGCATACTTTCTCCTT TCTACCCACATATCTCCTGCATCCCTGAGAGCAATTTCTTGGCCATCTTCCATAATC ATGCTATTCAAACCTGCCCTCTAAGTACAGAGCTCTGAATGGAGACCACGGGAGCAG ACTTTTCATCTGTTGGCTCCCTGGGCCTAGCAGTGTACCCTGCAAACAGGAAACCTT CGCTCATCATTTATCACATGAATGTGGCTAGAGAACTGTCCCCACCAGACACTGAGA GCCTCTCACAGGGCCAGAGGGTGGCTGCCTCAAAGGCAGGCGAGAGGCTGCAGTCTT CTGCAGAGTGGACAGATACTGCCTGCCATACAAGGGGACATAGCCTGGGGCGGGGGG CACAAGGGAAGGGGCCTGAGTGCATTGGAGTCACAGCCCTCCCTCCCCTGGTGACCC AGTGACTGAGGGGACCAAGGCTATCCCTGGTATGAGGGGAGGGCATTTGCATGAGTT AGACCCCTGACAGCCCATGGTGGGGACAGGAAGTAGCTCTGTCTACTGTCTCTTTCA GTCTCACTTTCTGTTCCTCCAAAGTGTCTCTTCAAACTCTCAAATGACTTTGTAGAT TCAGCCTAAGATCTCAAAGCAGGTGAGGCAGGAGGCTGGCACTCAAGAGCCTGACGA ACACAAACCCAAGTCCTTCTGGGACATGTCTCCATGTGTCCCCAGTGCTCCTCTGTA Attorney Docket No.29539-0667WO1 / MGH 2023-153 GCCCCTGAGAGAGGTTTCTTTCCTTTCCAGGGCGCTAGGCTCAGCTCACCCCATTCC TGGAGCAGCCTGCAGACTTCATCCTCTCTCTTCCATCCCGGGGAAAGTCAGCCAGTC CTCCTCAGCTGCCTGTCTTAACCTGCATCATGAAGCCTGAGGAGATTTCAAGTAAAC CCTCCCAAGCCCCACCTCAGGATCTGGGGAAAGCCACTGTCTACCGCATCCTTGGTT TGAGACAGGTTCTTACTGTGTTGGCCTGGCTGGGTTCCAACTCCCAGGATCCTCTAG CCTCAGCCTCTCTTAGGTGCTAGATTGCAGGCCTAGGGTATCACGCTCGGTCCCTCA GATCCTGGTGCCTTTCCACACCTCCGGGAGCTGATCTAAGTCTTTCTCCCACGTACA GTCTGCTTCTTTGGAGGAGCTGTGTGGAGCTAGGTGTGTTACAGGGCTGTAGCTCCA GCCATCTGGGAGGCTGAGGCAGGATGGCTACTTCAATTCTCAAGAGCCTGGATAGGA GACCCTGCCCCCACCCCACCCCCAAAGTAATTTTTCAGCACATTACTTCTTCATCTC CTCTCTCAACCCGTTCTGCCTTCTCCTGGGGTGCTGGTGTCAGCAGAAGCTGATGTG GAAGTGATGCCTGGGAGTTAGCAAGGGAATGAGTGGAAAGGGGAAGTGTGAGAACGG TCCCAGAAGAGACTGGGGAGCTGGTGGAGAGAGGACCCAGCGGACAGACTGCCAGCC TAAGACAACCAGCGTCTGAGGAGCC (SEQ ID NO:5) human IBA1 promoter seqeunce TAAGTACCACTTTCAGTTCCTCCAAAGAATCTACTTAAACTCTTAAATTCCTGATCT CTATAGATTTTACTAAAGATTTCAAAGGAGATAAGATGAGAGGGTTACGTTGCACAT TCTAAAGCAAACAAATTAAAATGTTTTGTTAGACATTTCCATATTTTTAAGGGCCTC CTTGGAGCTGCCAGGCTGGGAGTGAGGTTTCTCTCCCTTTCTAAACCCTGTGCCCAT CTTGTCACCCTCCTGGAGCTGCCAGCAGACTTCAGATTCTTCTCCGATCTACAGAGC AGAAAAATTCAGCCAGCCCTTCCTTGTCTTCCTATCCACAGCTGCCTGCCCAGACTC ATGAAACCTGACAAAATGCAAGGTCTTATCATTACCTGAACCTTGGACCTGTTCAAA AATACTAGTTCCTGAGAATAAATATCCCTGGTGTCTTCCTGCCCTTCCTGCACACCT CCAGTGGCTTATCAAAATATTTGTTTCATGCGCACACTGGGCTCTCATTTAAGAGGA ATTTGGGAGAATGTTATTTTCTAATCTGCATTTCACACCAGGCTCCCCCTCCTTCCT GGGGTGCTAGTGTCAGCAGAACCTGATGGGGAAGTGAGGTCTGGGAGGCAGAGGAGG AAGGAATGAGGGGAAAGGGGAAGTTTGGGAGGAAGGCTTCTGAGAAGACTGGTGGGA GAGAAGGAGAGCCTGCAGACAGAGGCCTCCAGCTTGGTCTGTCTCCCCACCTCTACC AGCATCTGCTGAGCT (SEQ ID NO:6) EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Methods The following materials and methods were used in the Examples below. Animal experiments Animal studies were performed according to animal use guidelines and approved procedures. CX3CR1-GFP mice or C57BL / 6 mice were injected ICV with constructs as described. Cells. 293T cells were purchased from American Type Culture Collection (ATCC). Cells were cultured in high glucose Dulbecco’s modified Eagle’s medium containing Attorney Docket No.29539-0667WO1 / MGH 2023-153 HEPES (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) (Sigma, St. Louis, MO) and 100 U / mL penicillin, 100 βg / mL streptomycin (Invitrogen) in a humidified atmosphere supplemented with 5% CO2 at 37 °C. Cells were checked regularly for mycoplasma infections using the PCR Mycoplasma Detection Kit (G238; ABM, New York, NY). AAV library construction and production: The iTransduce library has been previously described (3, 21). We replaced the broadly active CBA promoter with a CD68 (myeloid cell-selective promoter) driving Cre in the iTransduce plasmid pAAV-CBA-Cre-p41-Cap9 to generate the plasmid pAAV-CD68-Cre-p41-Cap9. Briefly, pUC57-Cap9-XbaI / KpnI / AgeI served as template to amplify the AAV9 cap DNA and insert random 21-mer sequences using a forward and reverse primer. Primer information: XF-extend (5’GTACTATCTCTCTAGAACTATTAACGGTTC3’ (SEQ ID NO:7)) and reverse primer 588iRev (5’ GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMN NMNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG 3’ (SEQ ID NO:8)) in which the MNN repeat refers to the randomized 21-mer nucleotides (purchased from IDT, M=A / C; N=A / C / G / T). The 447 bp PCR product was digested with XbaI and AgeI overnight at 37°C and then we gel-purified the product (Qiagen). Similarly, pAAV-CBA-Cre-p41-Cap9 or pAAV-CD68-Cre-Cap9 was digested with XbaI and AgeI and gel purified. Next, a ligation reaction (1h at room temperature) with T4 DNA ligase (NEB) was performed using a 3:1 cap insert to vector molar ratio. The subsequent ligated plasmid was called pAAV-CBA-Cre-p41-Cap9-7mer or pAAV-CD68-Cre-p41-Cap9-7mer and contained a pool of plasmids with random 7- mer peptides inserted in the cap gene between nucleotides encoding 588 and 589 of AAV9 VP3. We produced the library as previously described (3). Briefly, 293T cells were transfected using PEI MAX®solution (Polysciences, Warrington, PA) with pAAV- CBA-Cre-p41-Cap9-7mer (Round 1 of selection) or pAAV-CD68-Cre-p41-Cap9- 7mer (Round 2 of selection), the adenovirus helper plasmid (pAdΔF6, 26 μg per plate), and rep plasmid (pAR9-Cap9-stop / AAP / Rep, 12 μg per plate) to induce production of AAV. AAV was purified from the cell lysate and polyethylene glycol- precipitated media using iodixanol density-gradient ultracentrifugation. Buffer Attorney Docket No.29539-0667WO1 / MGH 2023-153 exchange to PBS was done using ZEBA spin columns (7K MWCO; Thermo Fisher Scientific) and further concentration was performed using Amicon Ultra 100kDa MWCO ultrafiltration centrifugal devices (Millipore). Vectors were stored at −80 °C until use. We quantified AAV genomic copies (vg) in AAV preparations using TaqMan qPCR with ITR-sequence specific primers and probes (22, 23). In vivo library selection: For the first round, we ICV injected the AAV9 peptide display library into two CX3CR-1GFPmale mice (3.05x108vg for a 9-month old mouse and 6.1x108vg for a 5 month old mouse). Five weeks later, we harvested mouse brains and flow sorted GFP+microglia. To do this, mice were anesthetized with an overdose of ketamine / xylazine and transcardially perfused with phosphate-buffered saline (PBS). Brains were immediately dissociated using the Miltenyi Neural Tissue Dissociation kit (Miltenyi Biotec, Auburn, CA). We slightly modified the original protocol to remove the excess of myelin while maintaining cell viability. Briefly, we placed every brain in one C tube and added the Miltenyi Enzyme P with PBS. For rapid homogenization, the brain was cut into smaller fragments before running the Miltenyi GentleMACS dissociator (Miltenyi Biotec). After three sequential runs of dissociation, we added the previously diluted Miltenyi Enzyme A into Buffer Y. After incubation at 37 °C for 10 min, we added four volumes of 0.5% w / v BSA dissolved in PBS and transferred the brain suspension through a 100 μm cell strainer. Myelin was rapidly removed with Miltenyi Myelin removal beads and EasySep Magnets (Miltenyi Biotec). After the last step of myelin removal using LS columns (Miltenyi Biotec), the cell suspension was immediately sorted for GFP+microglia setting the gates with a freshly processed brain cell suspension of a C57BL / 6J mouse. After sorting, the GFP- positive cells were immediately pelleted by centrifugation, and DNA was extracted using the ARCTURUS PicoPure DNA extraction kit (ThermoFisher). After DNA extraction, the Cap9 DNA flanking the 21mer inserts was amplified using the following primers: Cap9_Kpn / Age_For: 5’-AGCTACCGACAACAACGTGT-3’ (SEQ ID NO:9) and Cap9_ Kpn / Age_Rev: 5’-GAAGGGTGAAAGTTGCCGT-3’ (SEQ ID NO:10) and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI, and AgeI and the Cap9 KpnI-AgeI fragments (144 bp) were agarose gel purified before ligation in the pUC57-Cap9- XbaI / AgeI / KpnI plasmid (digested with KpnI and AgeI). The ligation product was Attorney Docket No.29539-0667WO1 / MGH 2023-153 transformed into electrocompetent DH5alpha bacteria (New England Biolabs) and the entire transformation was grown overnight in LB-ampicillin medium. pUC57-Cap9- XbaI / AgeI / KpnI plasmid was purified by maxi prep (Qiagen). Plasmid was digested by XbaI / AgeI to release the 447 bp cap fragment which was gel purified and ligated with similarly cut pAAV-CD68-Cre-mut / p41-Cap9-7mer for the next round of AAV library production. For round two we performed a selection to identify capsids capable of transducing microglia. CX3CR1GFPx Ai9 mice were injected ICV with the round 2 library (1010vg) and two weeks later, brain was dissociated and GFP+ / tdTomato+microglia were flow sorted. We also collect the GFP+ / tdTomato−fraction to assess the peptide profile in this population. Capsid DNA was rescued by PCR amplification and next generation sequencing (NGS) performed by the Massachusetts General Hospital DNA Core to analyze the diversity of 7mer peptide inserts. For each round of selection vector DNA corresponding to the insert- containing region was amplified by PCR using either Phusion High-Fidelity enzyme or Q5 polymerase (both from New England Biolabs using Forward primer: 5’- AATCCTGGACCTGCTATGGC-3’ (SEQ ID NO:11), and reverse primer: 5’- TGCCAAACCATACCCGGAAG-3’ (SEQ ID NO:12)). PCR products were purified using a QIAquick PCR Purification Kit (Qiagen). Unique barcode adapters were annealed to each sample, and samples were sequenced on an Illumina MiSeq (150bp reads) at the Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core. Approximately 50,000-100,000 reads per sample were analyzed. Sequence output files were quality-checked initially using FastQC (bioinformatics.babraham.ac.uk / projects / fastqc / ) and analyzed on a program custom- written in Python. Briefly, sequences were binned based on the presence or absence of insert; insert-containing sequences were then compared to a baseline reference sequence and error-free reads were tabulated based on incidences of each detected unique insert. Inserts were translated and normalized. AAV vector production: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV / mIba1.GFP.WPRE.miR-9.T.miR-129-2- 3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163; n2t.net / addgene:190163 ; RRID:Addgene_190163)(1). Attorney Docket No.29539-0667WO1 / MGH 2023-153 This plasmid was purified by Alta Biotech (Aurora, CO). The plasmid was digested with SmaI restriction enzyme (New England Biolabs, Ipswich, MA) at room temperature for one hour to confirm ITR integrity. Oxford Nanopore complete plasmid sequencing was performed by the MGH DNA Core to confirm plasmid sequence integrity. We used the following three capsids for these studies: AAV9 which was encoded in the pAR9 rep / cap vector kindly provided by Dr. Miguel Sena-Esteves at the University of Massachusetts Medical School, (Worcester, MA). The MG1.2 capsid is a previously described engineered AAV9-based capsid(2). rAAV2 / MG1.2 was a gift from Minmin Luo (Addgene plasmid # 184541 ; n2t.net / addgene:184541 ; RRID:Addgene_184541). MC5 was generated by digesting pAR9 BsiWI and BaeI which removes a fragment flanking the VP3 amino acid 588 site for peptide sequence insertion. Next, we ordered a 997 bp dsDNA fragment from Integrated DNA Technologies (IDT, Coralville, IA), which contains overlapping Gibson homology arms with the BsiWI / BaeI cut AAV9 as well as the 21-mer nucleotide sequence encoding the peptide of interest in frame after amino acid 588 of VP3. Last, we performed Gibson assembly using the Gibson Assembly®Master Mix (NEB, Ipswich, MA) to ligate the peptide containing insert into the AAV9 rep / cap plasmid. After transformation into competent bacteria, we picked single colonies and isolated DNA using minipreps (Qiagen). Complete plasmid sequencing was performed to verify the insert sequence at the MGH DNA core. AAV production was performed as previously described (24). Briefly, 293T cells were triple transfected using PEI MAX®solution (Polysciences, Warrington, PA) with (1) AAV-rep / cap plasmid (either AAV9, MG1.2, or MC5) (2) an adenovirus helper plasmid, pAdΔF6, and (3) ITR-flanked AAV transgene expression plasmid (pAAV / mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA). Cell lysates and polyethylene glycol-precipitated media containing vector were harvested 68-72 h post transfection and purified by ultracentrifugation of an iodixanol density gradient. Iodixanol was removed and buffer exchanged to phosphate buffered saline (PBS) containing 0.001% v / v Pluronic F68 (Gibco™, Grand Island, NY) using 7 kDa molecular weight cutoff Zeba™desalting columns, (Thermo Scientific). Vector was concentrated using Amicon®Ultra-2100 kDa MWCO ultrafiltration devices (Millipore Sigma). Vector titers in vg / ml were determined by Taqman qPCR in an Attorney Docket No.29539-0667WO1 / MGH 2023-153 ABI Fast 7500 Real-time PCR system (Applied Biosystems) using probes and primers to the ITR sequence and interpolated from a standard curve made with a restriction enzyme linearized AAV plasmid. Vectors were pipetted into single-use aliquots and stored at −80°C until use. Mice: All animal experiments were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care following guidelines set forth by the National Institutes of Health Guide for the Care and Use of Laboratory Animals. We used adult age (8-10 week old) C57BL / 6J (strain # 000664), B6.129P2(Cg)- Cx3cr1tm1Litt / J (common name CX3CR-1GFP, strain 005582), and B6.Cg- Gt(ROSA)26Sortm9(CAG-tdTomato)Hze(common name Ai9, strain 007909), all from The Jackson Laboratory, Bar Harbor, ME. We crossed homozygous Ai9 with homozygous CX3CR-1GFPto yield Ai9: CX3CR-1GFPprogeny for the round 2 selection process. We also used APP / PS1 mice (B6;C3-Tg(APPswe,PSEN1dE9)85Dbo / Mmjax; Stock 034829-JAX). Intracranial injection of AAV vectors. Intracerebroventricular injections into the lateral ventricle. Adult mice were anesthetized using isoflurane and analgesia achieved with buprenorphine (0.15 mg / kg) and local scalp administration of lidocaine (5mg / kg). Once deeply anesthetized, mice were placed into a Just For Mouse Stereotaxic Frame with an integrated animal warming base (Stoelting, Wood Dale, IL). Adult mice (n=5 / group) were stereotactically injected bilaterally into the left and right lateral ventricles at the dose described in the figure legend of each vector preparation in a volume of 5 μl using the following coordinates from bregma in mm: anterior / posterior, AP −0.4; medial / lateral, ML + / −1.0; dorsal / ventral, DV −1.7. Vectors were infused at a rate of 1.0 μl / min using a Quintessential Stereotaxic Injector pump (Stoelting) to drive a gas-tight Hamilton Syringe (Hamilton, NV) attached to a 10 μl 33-gauge NEUROS model syringe (Hamilton, NV). After injection, the needle was left in place for two minutes to allow the vector solution to disperse and not backflow up the cannula. Buprenorphine (0.15 mg / kg) was injected subcutaneously twice a day for two days after the surgery for analgesia. The in-life portion of the study is indicated in the figure legends. Attorney Docket No.29539-0667WO1 / MGH 2023-153 Intra-hippocampus vector injection. AAV vectors (AAV9, MC5, MG1.2) were prepared at different concentrations to deliver three doses of each (0.5×109vg; 1.0×109vg, MC 2.1×109vg) in 1.2 μl PBS. C57BL / 6 mice (4-month-old, male, n = 3 mice) were anesthetized with oxygenated isoflurane (3% for induction, 1.5% for maintenance) and mounted on a stereotaxic frame. The scalp was prepared using alcohol swabs (BD, US). After 1% lidocaine infiltration, a midline incision was made using mini scissors. Mini-craniotomy was made at the designated coordinates (AP 2 mm, ML 2 mm). Using a thin glass pipette loaded on Nanoject III (Drummond, US), a total volume of 1.2 μl virus was slowly injected into the hippocampus at the depth of 1.5 mm and 2.0 mm. The needle was left in situ for 10 minutes after the injection to minimize backflow of virus during needle retraction. Skin was closed using 4-0 polypropylene suture (Oasis, US). Animals were kept on a warm pad and returned to home cage after full recovery from anesthesia. Intracortical vector injection in APP / PS1 mice. Alternatively, intra-cortical injections in APP / PS1 mice, were similarly performed under isoflurane anesthesia using a 33-gauge Hamilton syringe. Mice received 8.3x108vg of MC5 in 1 μl which was directly injected into the cortex overlying the hippocampus at a depth of 0.3 mm. Post-operative warming and buprenorphine analgesia was performed as described above. Immunofluorescence staining and Microscopy and Image analysis. ICV injected mice. Mice were deeply anesthetized with an overdose of ketamine / xylazine and transcardially perfused with phosphate buffered saline (PBS) followed by 4% v / v formaldehyde in 1x PBS. Brains were post-fixed in 4% formaldehyde diluted in PBS for 48 h, followed by 30% (w / v) sucrose for cryopreservation for another 48-72 h after which brains were embedded and frozen in Tissue-Tek®O.C.T. compound (Sakura Finetek USA, Torrance, CA). Coronal floating sections (40 μm) were cut using a NX50 CryoStar Cryostat (Thermo Scientific). After rinsing off the sucrose in PBS, the brain sections were treated for immunofluorescence or mounted on glass slides for imaging. For immunofluorescence, the cryosections were permeabilized with 0.5% v / v Triton™X-100 (Millipore Sigma) in PBS for 2 h and blocked with 5% v / v normal Attorney Docket No.29539-0667WO1 / MGH 2023-153 goat serum (NGS) in PBS for 1h. Permeabilization and blocking steps were performed while gentle shaking (30 rpm) at room temperature (RT) in 12-well plates. Brain sections with primary antibodies diluted in 1.5% v / v NGS were incubated at 4°C for 24 h on a platform orbital shaker set at 60 rpm. After three washes with PBS, coronal sections and secondary antibodies diluted in 1.5% v / v NGS were incubated for 1h at RT 60 rpm. Three PBS washes were performed prior mounting of stained sections on glass slides for microscopy. Primary antibodies for staining of AAV transduced cells (GFP) and microglia were chicken anti-GFP (GFP-1020, Aves, Davis, CA) and rabbit anti-Iba1 (019-19741, Fujifilm Wako Chemicals USA), respectively, both at working dilutions of 1:100 in 1.5% v / v normal goat serum (NGS). Secondary antibodies were goat anti-chicken Alexa Fluor 488 for GFP (Thermo Scientific) and goat anti-rabbit Alexa Fluor 647 for Iba1 (Thermo Scientific) both at working dilutions of 1:1000 in 1.5% v / v NGS. Sections were mounted with Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA) and, imaging was performed with a NIKON CSU-W1 spinning disk confocal microscope. Intra-hippocampus injected mice. On day 22 after virus injection, mice were sacrificed and perfused with ice- cold PBS followed by 4% PFA. Mice brains were extracted and fixed in 4% PFA for additional 2 days at 4°C. Brains were sectioned using a vibratome (Leica, VT1000) at 50mm thickness and the slices covering the hippocampus were collected. The slices were blocked with 5% Bovine Serum Albumin (Boston Bioproducts, USA) and permeabilized with 0.5% Triton™X-100 (Millipore Sigma) in PBS, followed by primary antibodies rabbit anti-Iba1(1: 1000) and secondary antibody goat anti-rabbit Cy3 (1: 1000, Jackson ImmunoResearch, USA). The brain slices were subsequently mounted onto slides with DAPI and imaged using a confocal microscope (NIKON AXR, Japan). Interest areas were scanned with a 20x objective, data were analyzed using ImageJ (NIH). Both the injector of the vectors, the imager of the sections, and the analyzer were performed in a group blinded fashion. Intra-cortical injected APP / PS1 mice. At 7 days, brains were collected, fixed in 4% paraformaldehyde for 48 hours and then equilibrated in 30% sucrose in PBS. After 24 hours, 40-micron thick tissue sections were collected on a freezing microtome, labeled for amyloid β (1:500, Attorney Docket No.29539-0667WO1 / MGH 2023-153 RRID:AB_2797642) overnight at 4C, then rinsed and coverslipped with Fluoromount G with DAPI (Southern Biotech, cat no.0100-20). Imaging was performed using an Olympus FV3000 confocal and 63x oil immersion lens. Statistics. We used GraphPad Prism 9.0 for PC for statistical analysis. To compare means of two groups, we used an unpaired two tailed t-test; p values <0.05 were accepted as significant. For comparison of transduction of AAV9, MG1.2, and MC5 we used a one-way ANOVA followed by a šídák's multiple comparisons test. Example 1. In vivo intracerebroventricular injection AAV library selection strategy in mice We have previously reported on the use of the iTransduce AAV peptide display library. The AAV genomes consists of a promoter driving a Cre-recombinase cassette as well as p41 promoter driven AAV9 capsid with 7-mer peptide inserts between amino acids 588-589 of VP1. This allows surface display of 50 copies of peptides on VP3 on the capsid surface (and 5 copies each on internally localized VP1 and VP2 proteins). For round one of our in vivo selection strategy in mice, we produced the AAV peptide display library and injected it intracerebroventricularly into CX3CR1-GFP mice (Fig.1A). Next, AAV genome DNA was recovered by PCR from flow sorted GFP+ microglia and subjected to next generation sequencing (NGS) to analyze the content of the 7-mer encoding inserts (FIGs.1B-C). These capsid inserts were recovered by PCR, and Illumina sequenced to assess peptide profile. In addition, a round of negative selection was done by NGS on inserts recovered from GFP negative cells (neurons etc). Table 1 provides a list of peptides enriched after round 1. The results had excellent read quality, and many peptides appeared enriched over unselected library (over 1000-fold). The top peptides were packaged into a selected spinal cord library for use in round 2 (Fig.1D). For the second selection round, we used CX3CR1-GFP x floxed-STOP tdTomato mice, bred by crossing CX3CR1-GFP with Ai9 mice. The progeny express GFP in microglia and Cre-activatable CAG-Floxed-STOP-tdTomato in all cells. A high titer prep of library for R2 was produced: AAV-CD68-Cre-Cap9 frag R1 mic: 4.97e12 vg / ml, 6.95e11 vg total. NGS of the vector matched the original recovered library. The AAV were injected into CX3CR1-GFP x Ai9 mice, and then the microglia were sorted and capsid DNA was isolated about two weeks later. Cells were Attorney Docket No.29539-0667WO1 / MGH 2023-153 sorted into GFP+ / tdTomato+; GFP+ / tdTomato-; and GFP- / tdTomato-. 4 independent PCRs were performed per sample to ensure read accuracy from GFP+ / tdTomato+ cells and GFP+ / tdTomato- cells. The top 10 variants were selected based on the following criteria: A = Highest average frequency of variant recovered from GFP+ tdTomato+ cells B = Highest average frequency of variant recovered from GFP+ tdTomato- cells C = Highest ratio of variant frequency R2 / variant frequency R1 D= Highest ratio of variant frequency (GFP+ tdTomato+ cells) / (GFP+ tdTomato- cells) Next generation sequencing (NGS) was used to analyze the content of the 7- mer encoding inserts (FIGs.1E-F). Once the peptide inserts were analyzed by NGS, candidate AAV capsids were chosen for further characterization. Table 2 provides the top 7 variants selected. Interestingly, three out of the top seven included one or more “QS” or “SQ” motifs (shown in bold in Table 2). Table 1. Peptides enriched after R1 DNA sequence # Peptide # Read Count Frequency 8 15231 2 6 8 2 1 9 4 Attorney Docket No.29539-0667WO1 / MGH 2023-153 TATACTCCGAAGGGGTCTCTT 48. YTPKGSL 26 3253 0.02865903ACGCCTGCTTATCCGCTTTAT 49. TPAYPLY273041 0.0267913 72 Sequence SEQ ID NO: Capsid ID ADNVPRL 13 MC1 Example 2. Development and testing of microglia selective transgene expression cassettes To provide selective expression in microglia and dampen off target expression in neurons we designed three different AAV plasmids with the following elements: Either CD68, TMEM119, or Hexb promoters; miR9 seed sequence repeats in 3’ UTR; and “insulator” sequences upstream of the microglia promoter to prevent transcription from the ITR. A WPRE was also included 5’ of the transgene, just before a miRNA target sequences and the polyA sequence, as shown in FIG.2A; an exemplary plasmid is shown in FIG.2B. The AAV9-hexbpromoter-tdTomato constructs were then injected into the striatum of CX3CR1-GFP mice. One week later, the brains were dissociated and flow cytometry was used to analyze GFP + microglia and any transduction of these cells (tdTomato+) (FIG.3A). The results showed little to no cells in the relevant area in uninjected CX3CR1-GFP mouse (FIG.4A), but a significant number of transduced microglia in the Double + area (FIG.4B). Attorney Docket No.29539-0667WO1 / MGH 2023-153 Example 3. Microglia targeted AAVs in vivo: 2-photon imaging of AAV9 with microglia selective promoters To assess microglia-specific expression of the capsids, female C57bl / 6 mice from Jackson labs aged about 5 weeks were injected with the candidate constructs. 5mm cranial windows (stacked coverglass) were created and 1 of 3 different AAV9 vectors was injected into dorsal cortex: AAV9-Hexb-TdTom (2 / 27); n=2 mice AAV9-TMEM-TdTom (2 / 28); n=2 mice AAV9-CD68-TdTom (3 / 1); n=2 mice Then, tdTom expression was imaged at 1050 nm using a Bruker 2P + Insight X3 laser. The results showed that the Hex2b promoter gave the most robust expression and transduced the most cells with microglia morphology of the three tested promoters. Transduction of microglia was best in dorsal areas, while in the deeper areas it appeared that more neuronal transduction might have occurred. This experiment is repeated using CX3CR1-GFP mice to co-localize GFP and tdTomato expression. Example 4. Screening candidate capsids against benchmark capsids A set of constructs including candidate capsids were screened against benchmark capsids, as shown in Table 3. Table 3. Benchmark and candidate capsids Capsid Transgene Titer (vg / ml) Yield (vg) Notes Attorney Docket No.29539-0667WO1 / MGH 2023-153 MC7 AAV-hexbp-tdT-miR 1.13e12 2.15e11 Candidate capsid parenchymal injections. The mice were sacrificed one week later, and the brains were sections and stained for IbaI. The brains were examined for transduction of microglia via either route, and the capsids ranked based on IbaI / tdTomato colocalization with either route of administration. Based on epifluorescence microscopy, MC1, MC4, MC5 were the most promising candidates with the best expression via both routes and colocalization with IbaI staining. MC1, MC4, MC5 were compared qualitatively to AAV and MG1.2 using confocal microscopy. The results, shown in FIGs.5A-J, demonstrated clear co- localization of tdT with IbaI IFA for MC1, MC4, MC5, and MG1.2, but less for AAV9. Example 5. MC5-Iba1-GFP-miR transductions of microglia after ICV and striatal injection MC5-Iba1-GFP-miR constructs were injected into Adult C57BL / 6 mice intracranially into striatum or ICV into lateral ventricle. The constructs used MC5 capsid packaging AAV genome from Addgene plasmid #190163, pAAV / mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA.1 week later, the brains were processed and stained for GFP and for Iba1. The results, shown in FIGs.6 and 7A-B, showed that AAV-MC5-mIba1-GFP transduced microglia after intrastriatal or ICV injection in adult C57BL / 6 mice. MC5 capsid packaging AAV-Iba1-GFP-miR construct resulted in clear transduction of microglia with classic ramified morphology. In contrast, the Hexb promoter resulted in transduction of microglia with an activated / amoeboid morphology. Example 6. MC5 mediates higher transduction efficiency than AAV9 after ICV injection in mice. One candidate peptide was chosed for further testing: IRENAQP (name=MC5, SEQ ID NO:32). MC stands for “microglia capsid.” This peptide was in the top 5 peptides in the following categories: 1) enrichment between rounds 1 and 2 (2.3-fold), 2) highest percentage in tdT+ cells (5%), and 3) highest tdT / GFP ratio (0.05). A peptide database search revealed that MC5 (IRENAQP, SEQ ID NO:32) shared high homology, 86%, with a motif within mouse syndecan 4 (SDC4), IPENAQP, SEQ ID Attorney Docket No.29539-0667WO1 / MGH 2023-153 NO:34. The residues in the same region of human SDC4 are 43% (3 / 7 residues) homologous to the MC5 peptide and 57% homologous to murine SDC4. Our next objective was to compare the ability of MC5 vs AAV9 (the parental capsid) to transduce microglia after ICV injection in adult mice. The nucleotide sequences encoding IRENAQP (SEQ ID NO:32) were individually cloned into an AAV9 rep / cap plasmid after amino acid 588 of VP1. For the transgene expression cassette, we used the pAAV-Iba1-GFP-miR9T-miR129-2-3pT construct from Okada et al, which allows for microglia transduction (1) (FIG.8A). Adult female C57BL / 6 mice (n=5 / capsid) were injected bilaterally with 1.6x1010vg / ventricle of each capsid. One week post injection mice were euthanized and brains harvested for cryosectioning and immunofluorescence staining for GFP and for the microglia marker, Iba1. For both groups, we observed intense immunostaining for GFP which co-localized with Iba1 immediately around the ventricles. GFP+ / Iba1+ cells were also observed in the corpus callosum and cortex near the ventricles. Next, we performed quantitation of the percentages of Iba1+ microglia transduction by each capsid in the cortex and area surrounding the ventricle in both groups. For each animal, we analyzed five sections adjacent to the ventricle. AAV9 transduced an average of 5.2% (range 2.5-9.9%) of Iba1+ microglia while MC5 transduced an average of 20.7% (range 9.6-63.55%) of Iba1+microglia, a 3.98-fold increase (p<0.015, FIG.8B). Example 7. MC5 mediates efficient transduction of microglia after direct injection into brain parenchyma. Recently an AAV9-based capsid displaying a unique 7-mer peptide called MG1.2 was demonstrated to transduce microglia after direct intraparenchymal injection in mice (2). Here we assessed the specificity and transduction efficiency of MC5 compared to AAV9 and MG1.2 all packaging the AAV-Iba1-GFP-miR9T- miR129-2-3pT genome after intra-hippocampus injection in adult C57B1 / 6 mice. Based on the results of Okada et al. which demonstrated that specificity of transduction of microglia with AAV9-Iba1-GFP-miR9T-miR129-2-3pT genome was dose dependent, we tested three doses, (2.1x109vg, 1.0x109vg, 0.52x109vg) injected in a 1.2μl volume in the hippocampus (n=3 mice / dose / capsid). Mice were killed 22 days post injection and intrinsic GFP was imaged along with Iba1 immunostaining by fluorescence microscopy. We quantitated the percentages of GFP+ microglia as well as the percentages of non-microglia such as neurons transduced by each capsid for the Attorney Docket No.29539-0667WO1 / MGH 2023-153 2.1x109vg, 1.0x109vg doses. We also compared MC5 transduction efficiency and specificity at all three doses. At the highest dose with all capsids, MC5 had approximately 3-fold more GFP positive microglia (41.3%) than AAV9 (13.3%) or MG1.2 (12.6%) (FIG.9A). MC5 also enabled greater selectivity (~3-4 fold) over non- microglial cells with 58.2% of transduced cells being microglia vs only 19.6% and 14.3% for AAV9 and MG1.2, respectively (FIG.9B). Transduced neurons in the CA1 region of the hippocampus were detected for all capsids although it was less pronounced for MC5 (FIG.9B). The increased specificity was reflected in MC5 transducing the lowest percentage of Iba1−GFP+out of total GFP+cells as compared to AAV9 and MG1.2 capsids (FIG.9C). In contrast, at the mid dose, 1.0x109vg, the highest number of GFP positive cells were observed co-labeling with Iba1+microglia for all capsids. Transduced Iba1+ microglia were observed for AAV9, however intense labeling of neurons in the CA1 region was also observed. Furthermore, less neuronal transduction was observed for MC5 and MG1.2, suggesting higher specificity of these capsids compared to AAV9. High magnification imaging of the transduced microglia showed typical microglia morphology with fine processes clearly visible. The quantitation of the percentage of transduced microglia revealed that MC5 had the highest (85%), followed by MG1.2 (47%) and AAV9 (32%) (FIG.10A). We measured the specificity of microglia transduction for each capsid by measuring the percentage of GFP+microglia over all GFP positive cells. Remarkably, 93% of GFP+cells transduced by MC5 were microglia which was significantly higher as compared to MG1.2 (83%) and AAV9 (43%) (FIG.10B). We compared the percentages of GFP cells in either the Iba1+or Iba1−(e.g. neurons) cell populations. MC5 had the highest on-target specificity followed by MG1.2 and then AAV9 (FIG. 10C). The comparison of MC5 to itself at the three doses revealed a clear benefit of the mid dose for both the highest % of transduced microglia as well as selectivity over non-microglia cells (FIGs.11A-C). Example 8. MC5 transduces microglia in APP / PS1 mice with amyloid β plaques. To explore whether MC5 could transduce microglia in a mouse model of AD, APP / PS1 mice were injected into the cortex with 8.3x108vg of MC5- AAV-Iba1- GFP-miR9T-miR129-2-3pT. One week later, mice were sacrificed, and brains Attorney Docket No.29539-0667WO1 / MGH 2023-153 sectioned, labeled for amyloid beta (Aβ), and imaged by confocal microscopy. We observed GFP+microglia in the cortex, some of which were surrounding or within Aβ plaques (FIG.12). References 1. OkadaY, Hosoi N, MatsuzakiY, FukaiY, Hiraga A, Nakai J, Nitta K, ShinoharaY, Konno A, Hirai H. Development of microgliatargeting adeno-associated viral vectors as tools to study microglial behavior in vivo. Commun Biol. 2022;5(1):1224. 2. Lin R, ZhouY,Yan T,Wang R, Li H,Wu Z, Zhang X, Zhou X, Zhao F, Zhang L, et al. Directed evolution of adeno-associated virus for efficient gene delivery to microglia. Nat Methods.2022;19(8):976–85. 3. Hanlon KS, Meltzer JC, Buzhdygan T, Cheng MJ, Sena-Esteves M, Bennett RE, Sullivan TP, Razmpour R, GongY, Ng C, et al. Selection of an Efficient AAVVector for Robust CNS Transgene Expression. Mol Ther Methods Clin Dev. 2019;15:320–32. 4. Lek A,Wong B, Keeler A, Blackwood M, Ma K, Huang S, Sylvia K, Batista AR,Artinian R, Kokoski D, et al. Unexpected Death of a Duchenne Muscular Dystrophy Patient in an N-of-1 Trial of rAAV9-delivered CRISPR-transactivator. medRxiv.2023:2023.05.16.23289881 5. Wilson JM, Flotte TR. Moving Forward After Two Deaths in a Gene Therapy Trial of Myotubular Myopathy. Hum Gene Ther.2020;31(13-14):695–6. 6. Philippidis A. Fourth Boy Dies in Clinical Trial of Astellas’ AT132. Hum Gene Ther.2021;32(19-20):1008–10. 7. Salabarria SM, Corti M, Coleman KE,Wichman MB, Berthy JA, D’Souza P,Tifft CJ, Herzog RW, Elder ME, Shoemaker LR, et al. Thrombotic microangiopathy following systemic AAV administration is dependent on anti-capsid antibodies. J Clin Invest.2024;134(1). 8. Gray SJ, Nagabhushan Kalburgi S, McCown TJ, Jude Samulski R. Global CNS gene delivery and evasion of anti-AAV-neutralizing antibodies by intrathecal AAV administration in non-human primates. Gene Ther.2013;20(4):450–9. 9. Nakamura S, Osaka H, Muramatsu SI,Takino N, Ito M, Jimbo EF,Watanabe C, Hishikawa S, Nakajima T,Yamagata T. Intra-cisterna magna delivery of an AAV Attorney Docket No.29539-0667WO1 / MGH 2023-153 vector with the GLUT1 promoter in a pig recapitulates the physiological expression of SLC2A1. Gene Ther.2021;28(6):329–38. 10. Rogers GL, Shirley JL, Zolotukhin I, Kumar SRP, Sherman A, Perrin GQ, Hoffman BE, Srivastava A, Basner-Tschakarjan E,Wallet MA, et al. Plasmacytoid and conventional dendritic cells cooperate in crosspriming AAV capsid-specific CD8(+) T cells. Blood.2017;129(24):3184–95. 11. Alakhras NS, Moreland CA,Wong LC, Raut P, Kamalakaran S,WenY, Siegel RW, Malherbe LP. Essential role of pre-existing humoral immunity in TLR9- mediated type I IFN response to recombinant AAV vectors in human whole blood. Front Immunol.2024;15:1354055. 12. Suriano CM, Kumar N,Verpeut JL, Ma J, Jung C, Dunn CE, Carvajal BV, Nguyen AV, Boulanger LM.An innate immune response to adeno-associated virus genomes decreases cortical dendritic complexity and disrupts synaptic transmission. Mol Ther.2024;32(6):1721–38. 13. Benbenishty A, Gadrich M, Cottarelli A, Lubart A, Kain D,Amer M, Shaashua L, Glasner A, Erez N,Agalliu D, et al. Prophylactic TLR9 stimulation reduces brain metastasis through microglia activation. PLoS Biol. 2019;17(3):e2006859. 14. Maatouk L, Compagnion AC, Sauvage MC, Bemelmans AP, Leclere- Turbant S, CirotteauV,Tohme M, Beke A,Trichet M, BazinV, et al.TLR9 activation via microglial glucocorticoid receptors contributes to degeneration of midbrain dopamine neurons. Nat Commun.2018;9(1):2450. 15. Breous E, Somanathan S, Bell P,Wilson JM. Inflammation promotes the loss of adeno-associated virus-mediated transgene expression in mouse liver. Gastroenterology.2011;141(1):348–57, 57 e1-3. 16. Wang H, Jin H, Beauvais DM, Rapraeger AC. Cytoplasmic domain interactions of syndecan-1 and syndecan-4 with alpha6beta4 integrin mediate human epidermal growth factor receptor (HER1 and HER2)-dependent motility and survival. J Biol Chem.2014;289(44):30318–3. 17. McFall AJ, Rapraeger AC. Identification of an adhesion site within the syndecan-4 extracellular protein domain. J Biol Chem.1997;272(20):12901–4. Attorney Docket No.29539-0667WO1 / MGH 2023-153 18. McFall AJ, Rapraeger AC. Characterization of the high affinity cell- binding domain in the cell surface proteoglycan syndecan-4. J Biol Chem. 1998;273(43):28270–6. 19. Wang H, Jin H, Rapraeger AC. Syndecan-1 and Syndecan-4 Capture Epidermal Growth Factor Receptor Family Members and the alpha3beta1 IntegrinVia Binding Sites in Their Ectodomains: Novel Synstatins Prevent Kinase Capture and Inhibit Alpha6beta4-Integrin-Dependent Epithelial Cell Motility. J Biol Chem. 2015;290(43):26103–13. 20. Serrano C, Cananzi S, Shen T,Wang LL, Zhang CL. Simple and highly specific targeting of resident microglia with adeno-associated virus. iScience. 2024;27(9):110706. 21. Hanlon KS, Cheng M, Ferrer RM, Ryu JR, Lee B, De La Cruz D, Patel N, Espinoza P, Santoscoy MC, GongY, et al. In vivo selection in non-human primates identifies AAV capsids for on-target CSF delivery to spinal cord. Mol Ther.2024. 22. D’Costa S, BlouinV, Broucque F, Penaud-Budloo M, Francois A, Perez IC, Le Bec C, Moullier P, Snyder RO,Ayuso E. Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR. Mol Ther Methods Clin Dev.2016;5:16019. 23. Aurnhammer C, Haase M, Muether N, Hausl M, Rauschhuber C, Huber I, Nitschko H, Busch U, Sing A, Ehrhardt A, et al. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods.2012;23(1):18–28. 24. Ivanchenko MV, Hanlon KS, Devine MK,Tenneson K, Emond F, Lafond JF, Kenna MA, Corey DP, Maguire CA. Preclinical testing of AAV9-PHP.B for transgene expression in the non-human primate cochlea. Hear Res.2020;394:107930 OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.29539-0667WO1 / MGH 2023-153 WHAT IS CLAIMED IS:

1. An AAV capsid protein comprising an amino acid sequence that comprises at least four contiguous amino acids from the sequence IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7, SEQ ID NO:29).

2. The AAV capsid protein of claim 1, comprising an amino acid sequence that comprises at least five contiguous amino acids from the sequence IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7, SEQ ID NO:29).

3. The AAV capsid protein of claim 1, comprising an amino acid sequence that comprises at least six or all seven contiguous amino acids from the sequence IRENAQP (MC5, SEQ ID NO:32); ADNVPRL (MC1, SEQ ID NO:13); TTKQSHV (MC2, SEQ ID NO:14); SQNNNFA (MC3, SEQ ID NO:17); NVDSHTI (MC4, SEQ ID NO:22); PCMVVEI (MC6, SEQ ID NO:33); or QSDQSFP (MC7 SEQ ID NO:29).

4. The AAV capsid protein of claims 1-3, wherein the AAV is AAV9.

5. The AAV capsid protein of claims 1-4, comprising AAV9 VP1, VP2, or VP3.

6. The AAV capsid protein of claim 5, wherein the sequence is inserted in a position corresponding to amino acids 588 and 589 of AAV9 capsid protein VP1 (numbering is from VP1 amino acid number 1).

7. An AAV comprising the capsid protein of claims 1-6, and preferably not comprising a wild type VP1, VP2, or VP3 capsid protein.

8. The AAV of claim 7, further comprising a transgene, preferably a therapeutic transgene, optionally a transgene listed in Table A.Attorney Docket No.29539-0667WO1 / MGH 2023-153 9. The AAV of claim 8, wherein the transgene is linked to a promoter, optionally wherein the promoter is a microglia-specific promoter, optionally selected from the group consisting of an Iba1, CD68, TMEM119, and HEXB promoter, or a pan- cell type promoter, optionally selected from the group consisting of cytomegalovirus (CMV), beta glucuronidase, (GUSB), ubiquitin C (UBC), or rous sarcoma virus (RSV) promoter.

10. The AAV of claims 7-9, further comprising one or more of a pair of inverted terminal repeats (ITRs); an insulator that reduces expression from an ITR; a woodchuck hepatitis virus posttranscriptional response element (WPRE); and a polyadenylation sequence.

11. The AAV of claims 7-10, further comprising one or more miRNA target sites, optionally miR9 target sites, incorporated into the 3’ UTR.

12. A nucleic acid encoding the AAV capsid protein of claims 1-6 or the AAV of claims 7-11, optionally a recombinant episome.

13. A method of delivering a transgene to a cell, the method comprising contacting the cell with the AAV of claims 7-11.

14. The method of claim 13, wherein the cell is a microglial cell or macrophage.

15. The method of claim 14, wherein the cell is in a living subject.

16. The method of claims 14, wherein the subject is a mammalian subject.

17. The method of claims 13 to 16, wherein the cell is in a tissue selected from the brain, spinal cord, and a combination thereof.

18. The method of claim 17, wherein the subject has a disease listed in Table A.

19. The method of any of claims 13 to 18, wherein the cell is in the brain of the subject, and the AAV is administered by intracerebroventricular or intrathecal delivery.

20. The method of claim 19, wherein the intrathecal delivery is via lumbar injection, cisternal magna injection, or intraparenchymal injection.Attorney Docket No.29539-0667WO1 / MGH 2023-153 21. The method of claims 13 to 20, wherein the AAV is delivered by parenteral delivery, preferably via intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular delivery.

Images