Crispr / cas9-mediated exon-skipping for USH2a-associated usher syndrome

Abstract

Described herein are nucleic acids comprising sequences encoding a Cas9 protein, a first gRNA, and a second gRNA, wherein the first and second gRNAs are targeted to sequences flanking one or more exons of an usherin (USH2A) gene of the subject, preferably wherein the target sequence of the first gRNA is in the 3' 1500 base pairs (bp) of a first intron, and the target sequence of the second gRNA is in the 5' 1500bp of a second intron of the USH2A gene, wherein the first intron is 5' of the second intron, and preferably wherein the exon is not, or is not only, exon 13, or wherein the exon is an exon shown in Table 1, optionally exon 16, 17, 18, 20, 21, 24, 28-29, 38, 43, 45, or 50, and methods of use thereof to treat subjects who have a disease associated with a mutation in USH2A.

Description

[0001] Attorney Docket No.00633-0383WO1 / MEEI 2023-330 CRISPR / Cas9-Mediated Exon-Skipping for USH2A-Associated Usher Syndrome CLAIM OF PRIORITY This application claims priority under 35 USC §119(e) to U.S. Provisional Patent Application Serial No.63 / 638,839, filed on April 25, 2024. The entire contents of the foregoing are hereby incorporated by reference. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named 00633-0383WO1_SL_ST26.xml. The XML file, created on April 24, 2025, is 727,410 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. EY033107 awarded by the National Institutes of Health. The Government has certain rights in the invention. TECHNICAL FIELD Described herein are compositions for use in treating subjects with USH2A-associated vision and / or hearing loss that result from mutations in the in-frame exons (exon list in Table 1) of the USH2A gene by deletion or skipping of a target exon from the USH2A gene or transcripts, and methods of use thereof, as well as genetically modified animals and cells. BACKGROUND Adeno-associated virus (AAV)-mediated gene augmentation is currently the most effective approach for treating recessive inherited retinal degenerations (IRDs) [1]. However, due to the limited capacity of AAV vectors, gene augmentation currently is not possible for the one third of IRD patients whose disease is caused by mutations in large genes (CDS>4.5kb) [1-3]. This includes some of the most common causes of IRDs, such as ABCA4, USH2A, and CEP290, which are frequent causes of Stargardt disease, retinitis pigmentosa (RP) or Usher Syndrome (USH), and Leber congenital amaurosis (LCA), respectively [2, 3]. Mutations in just these three genes account for over 15% of all cases of IRDs. Currently, with Attorney Docket No.00633-0383WO1 / MEEI 2023-330 no clear treatment strategy available, the unmet medical need of patients with IRD due to mutations in large genes is compelling [4, 5]. USH2A is one of the largest known human genes, with a coding sequence of 15.6 kb. Mutations in USH2A are the most common cause of a) Usher syndrome type II (USH2), a syndromic form of retinitis pigmentosa with a moderate to severe hearing impairment from birth and progressive vision impairment in their second decade of life; and b) autosomal recessive retinitis pigmentosa (arRP), an isolated retinitis pigmentosa with vision loss and normal hearing (Hartong, D.T., E.L. Berson, and T.P. Dryja, Retinitis pigmentosa. Lancet, 2006.368(9549): p.1795-809; Saihan, Z., et al., Update on Usher syndrome. Curr Opin Neurol, 2009.22(1): p.19-27). Many single mutations in USH2A have been associated with both USH2 and arRP. The impairment of both vision and hearing in Usher syndrome results in a reduced ability of the individual to perceive, communicate, and extract vital information from the environment (Lentz, J. and B. Keats, Usher Syndrome Type II, in GeneReviews®, R.A. Pagon, et al., Editors.1993, University of Washington, Seattle: Seattle WA.). Longitudinal regression analysis has showed that the disease course for patients with USH2A mutations can be rapidly progressive, particularly with respect to losing visual field and mobility (Sandberg, M.A., et al., Invest Ophthalmol Vis Sci, 2008.49(12): p.5532-9). A nature history study of USH2A associated USH2 or arRP (RUSH2A) has reported that structural / functional assesments, such as total hill of vision (VTOT) measured using static perimetry (SP), could be used to monitor disease progression or treatment effectiveness (Duncan, J. L., et al., Am J Ophthalmol.2020.219: p87–100). SUMMARY The present disclosure presents methods to ameliorate, if not eliminate, Usher Syndrome Type 2A and / or autosomal recessive retinitis pigmentosa associated with pathogenic mutations in one or more in-frame exons (exon list in Table 1) of the USH2A gene. These treatments can be effective with a single treatment or a small number of treatments. Provided herein are nucleic acids comprising sequences encoding a Cas9 protein, a first gRNA, and a second gRNA, wherein the first and second gRNAs are targeted to sequences flanking one or more exons of an usherin (USH2A) gene of the subject, preferably wherein the target sequence of the first gRNA is upstream, e.g., in the 5’ 1000 base pairs (bp) of a flanking intron or target exon itself, and the target sequence of the second gRNA is in the target exon itself or the downstream flanking intron of the USH2A gene, e.g., 3’ 1000bp of a Attorney Docket No.00633-0383WO1 / MEEI 2023-330 second, wherein the first intron is upstream of the second intron, and preferably wherein the exon is not, or is not only, exon 13, or wherein the exon is an exon shown in Table 1, optionally exon 16, 17, 18, 20, 21, 24, 28-29, 38, 45, or 50. In some embodiments, the first gRNA comprises a target sequence shown in Table 2 to 4, and / or wherein the second gRNA comprises a target sequence shown in Table 2 to 4. In some embodiments, the nucleic acid encodes S. pyogenes or S. aureus Cas9 or another Cas variant. In some embodiments, the Cas9 comprises a nuclear localization signal, optionally a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal; and / or wherein the sequences encoding Cas9 comprises a polyadenylation signal. In some embodiments, the gRNA is a unimolecular S. pyogenes or S. aureus gRNA or a two-part modular S. pyogenes or S. aureus gRNA. In some embodiments, the nucleic acid comprises a viral delivery vector, optionally AAV. In some embodiments, the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, or hGRKl promoter. In some embodiments, the viral delivery vector comprises an adeno-associated virus (AAV) vector. In some embodiments, the nucleic acid comprises: (i) a first guide RNA comprising a targeting domain sequence selected from the group listed in Table 2 to 4 and a second guide RNA comprising a targeting domain sequence selected from the group listed in Table 2 to 4, preferably wherein the target sequence of the first gRNA is in the 3’ 1000 base pairs (bp) of a first intron or the target exon, and the target sequence of the second gRNA is in the target exon or 5’ 1000bp of a second intron of the USH2A gene, wherein the first intron is 5’ of the second intron, and preferably wherein the exon is not, or is not only, exon 13, or wherein the exon is an exon shown in Table 1, optionally exon 16, 17, 18, 20, 21, 24, 28-29, 38, 43, 45, or 50; (ii) a first and a second inverted terminal repeat sequence (ITR); and (iii) a promoter for driving expression of the Cas9 selected from the group consisting of a CMV, an EFS, or an hGRKl promoter. Also provided herein are the nucleic acids described herein for use in therapy; for use in preparation of a medicament; or for use in a method of treating a subject who has a condition associated with a mutation in USH2A. In some embodiments, the condition is Usher Syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP). Attorney Docket No.00633-0383WO1 / MEEI 2023-330 In some embodiments, the nucleic acid is delivered to a retina of a subject by injection, such as by subretinal injection, or is delivered to the inner ear of a subject by injection, preferably through the round window. Additionally provided herein are methods of treating a subject who has a condition associated with a mutation in USH2A. The methods comprise administering to the subject a therapeutically effective amount of a nucleic acid as described herein. In some embodiments, the condition is Usher Syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP). In some embodiments, the nucleic acid is delivered to a retina of a subject by injection, such as by subretinal injection, or is delivered to the inner ear of a subject by injection, preferably through the round window. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIGs.1A-B. Generation and validation of exon-deleted Ush2a mouse lines. A Schematics of generation of Ush2a exon-deleted mouse models using CRISPR / Cas9 gene editing. B. Sanger sequencing results confirming the deletion of targeted mouse Ush2a in- frame exon 15, 17, 20, 37, 42, 44 and out-of-frame exon 5 and 19 in genomic DNA, which corresponding to human USH2A in-frame exon 16, 18, 21, 38, 43, 45 and out-of-frame exon 6 and 20 in genomic DNA of the mouse Ush2a gene and the expression. The sequences of the junctions of upstream and downstream introns in exon-deleted mice shown in FIG.1B are as follows: ∆Exons Sequence SEQ ID NO: Attorney Docket No.00633-0383WO1 / MEEI 2023-330 mUsh2a-∆Ex15 TACCCTTTGTGAGAGGAAAGCCG 799 mUsh2a-∆Ex17 CCCCAAAACAAATTTGTGGAAGAG 800 deleted mouse lines. RT-PCR product from the retinas of homozygous or heterozygous Ush2a-∆Exons mouse lines using primers binding flanking exons showed a smaller band for exon-deleted allele than that for wt allele from wt / wt mice. FIG.3A-E. Expression and localization of Ush2a, Vlgr1 and cone opsin proteins in the retinas of heterozygous ∆Ex / ko mouse lines. A. The expression of exon-deleted Ush2a alleles were examined on Ush2a null background by crossing homozygous ∆Ex / ∆Ex mice with ko / ko mice to generate ∆Ex / ko mice. Immunostaining using Ush2a antibody showed that no expression of Ush2a protein was detected in Ush2a ko / ko mice. Various levels of usherin expression (indicated by the signal intensity) were restored with one copy of Ush2a-∆Ex15, -∆Ex20, -∆Ex37, and -∆Ex44 alleles. However, out-of-frame Ush2a-∆Ex5, and in-frame Ush2a-∆Ex42 alleles did not restore the expression of usherin in the Ush2a null background, indicating that exons 42 is not dispensable. B. Usherin expression level (signal intensity) of each exon-deleted alleles varies, ranging from 20% (∆Ex20) to 90% (∆Ex44) of that from wt allele. C. The expression of Usher II complex protein VLGR1 were assessed in ∆Ex / KO mice by immunostaining using anti-VLGR1 antibody. In consistent with usherin, no expression of VLGR1 protein was detected in Ush2a ko / ko, ∆Ex5 / ko and ∆Ex42 / ko mouse retinas. Various levels of VLGR1 expression were restored with one copy of Ush2a-∆Ex15, Ush2a-∆Ex17, -∆Ex37, and -∆Ex44 alleles, as shown in wild type mice. Minimal expression of VLGR1 was observed in -∆Ex20 / KO retinas. D. Localization of cone opsin in heterozygous ∆Ex / KO mouse lines. Retinal sections were stained with cone opsin in 4- month-old mice. None to minimal cone opsin mislocalization was detected in Ush2a wt / ko, ∆Ex15 / ko, ∆Ex17 / ko and ∆Ex44 / ko, as shown in wt / ko retina. However, significant mislocalization of cone opsin was observed in ∆Ex42 / ko mouse retinas, as that shown in ko / ko, as well as in ∆Ex5 / ko and ∆Ex19 / ko out-of-frame control mice. ∆Ex21 / ko and Attorney Docket No.00633-0383WO1 / MEEI 2023-330 ∆Ex37 / ko showed low level of mislocalization of cone opsin. Arrows indicate the mislocalized cone opsin in the inner segments and cell bodies. E, quantitative measurement of the mislocalized cone opsin in heterozygous wt / ko and ∆Ex / ko mouse retinas from D. FIGs.4A-B. Generation of humanized Ush2a-hEx16, Ush2a-hEx18, Ush2a- hEx21, Ush2a-hEx38, and Ush2a-hEx45 mouse lines. A. Design of donor template containing a wild-type human exon of target, 5’- and 3’- flanking intronic sequences, and 150bp homology arms of mouse introns. B. Sanger sequencing showed the correct replacement and incorporation of human sequences into the mouse Ush2a genome in the Ush2a-hEx16, Ush2a-hEx18, Ush2a-hEx21, Ush2a-hEx38, and Ush2a-hEx45 mice. Sequences of upstream and downstream junction of mouse intron and human intron in humanized USH2A mice shown in FIG.4B are as follows: upstream junction SEQ ID downstream junction SEQ ID sequence NO: sequence NO: FIGs.5A-C. Representative sanger sequencing results confirming dual gRNAs- mediated exon deletion for (A) Exon 17, (B) Exon 24 and (C) Exon 28-29 in human HEK293 cells. The sequences shown in FIGs.5A-C are as follows: Name   Sequence  SEQ ID NO:  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Ex24_24i_Sa_3 target  CACTAAACCAATCCCTAGATATTCATAGATGAATAA 820  region  AATGTGGTCTTTATCACA  DETAILED DESCRIPTION Multiple approaches have been and are being tested to deliver large genes to the retina, including use of modified AAV, lentiviral, and adenoviral vectors, as well as compacted DNA nanoparticles [2, 6-8]. Alternative approaches are also being evaluated, including mini genes, antisense oligonucleotides (ASOs)-mediated splice correction or exon- skipping to treat USH2A-associated disorders (Lu, B., et al., Invest Ophthalmol Vis Sci, 2010.51(4): p.2269-76; Slijkerman, R.W., et al., Mol Ther Nucleic Acids, 2016.5(10): p. e381) [9-13]. The usherin protein is a transmembrane protein containing ~34 Fibronectin type 3 (FN3) and 10 Laminin epidermal growth factor (LE) domains (Yu et al., Comput Struct Biotechnol J.2020; 18: 1363–1382). It is encoded by 71 coding exons, 25 of which are in in- frame phase (see Example 1). It is predicted that when an in-frame exon of USH2A containing truncating nonsense or frame-shift mutations is removed, the open reading frame (ORF) of USH2A mRNA transcript will be restored, which can lead to correct splicing of the two adjacent exons and production of a slightly shortened usherin that possesses a complete or enough biological function [14, 15]. The is especially true when such in-frame exons happen to encode one or more repetitive domains, removal of which may have minimal adverse effects on the protein function. Recent studies have shown that removal or skipping of exon 13 of the USH2A gene could effectively restore the vision and hearing loss in animal models [9]

[0010] and in human retinal organoid

[0016] . Moreover, improvements in visual acuity were announced from ProQR phase I / II clinical trial of an ASO-based exon skipping approach for early to advanced RP and USH patients due to hetero- or homozygous c.2299delG mutation in exon 13, which accounts for 24-48% of all USH2A cases in Europe and the U.S. [17-22]. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Described herein is the use of exon deletion or skipping as a treatment approach for USH2A-associated disease due to mutations in dispensable in-frame exons of the USH2A gene (Table 1). Exon deletion or exon skipping of these in-frame exons can be achieved by ASO or CRISPR / Cas9 gene editing technology. This exon skipping method can be broadly applicable to other genes that encode multiple repetitive-domain proteins (USH1B, USH1D, USH1F, USH2C and USH2D), making this approach translatable to potentially other types of Usher Syndrome. Described herein is the use of exon skipping as a treatment approach for USH2A- associated disease due to mutations in dispensable in-frame exons, and the use of one or dual guides to induce exon skipping. The removal of an exon is achieved via NHEJ-based Cas9 gene editing using two gRNAs to target sites located at flanking intronic sequence, or one intronic and one exonic site, respectively; or using one gRNA to target the intron-exon junction to disrupt the donor or acceptor splicing sites of the target in-frame exon. This approach allows for optimization of gRNAs in terms of higher editing efficiency and lower or no off-target effects in a large range of sequence. This method overcomes the limitations of ASO-mediated exon-skipping that required continuous treatment. This method can be broadly applicable to other genes that encode multiple repetitive-domain proteins (USH1B, USH1D, USH1F, USH2C and USH2D), making this approach translatable to potentially other types of Usher Syndrome. In some embodiments, an USH2A nucleic acid molecule includes a nucleotide sequence that is at least about 85% or more identical to the entire length of a sequence provided in Table A. In some embodiments, the nucleotide sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence provided in Table A. Table A. Exemplary human USH2A sequences NM_007123.6 NP_009054.6 usherin isoform A precursor ic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least Attorney Docket No.00633-0383WO1 / MEEI 2023-330 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. In another embodiment, the percent identity of two amino acid sequences can be assessed as a function of the conservation of amino acid residues within the same family of amino acids (e.g., positive charge, negative charge, polar and uncharged, hydrophobic) at corresponding positions in both amino acid sequences (e.g., the presence of an alanine residue in place of a valine residue at a specific position in both sequences shows a high level of conservation, but the presence of an arginine residue in place of an aspartate residue at a specific position in both sequences shows a low level of conservation). For purposes of the present invention, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. Methods of Treatment The methods described herein include methods for the treatment of disorders associated with mutations in the USH2A gene. In some embodiments, the disorder is Usher syndrome, e.g., type 2 Usher syndrome. Subjects with type 2 Usher syndrome typically have moderate to severe hearing loss at birth, and vision that becomes progressively impaired starting in adolescence. In some embodiments, the disorder is autosomal recessive retinitis pigmentosa (arRP). Generally, the methods include administering a therapeutically effective amount of a genome editing system as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. The term "genome editing system" refers to any system having RNA- guided DNA editing activity. Genome editing systems of the present disclosure include at least two components adapted from naturally occurring CRISPR systems: a gRNA or a pair of gRNAs and an RNA-guided nuclease. These two components form a complex that is capable of associating with a specific nucleic acid sequence in a cell and editing the DNA in or around that nucleic acid sequence, for example by making one or more of a single-strand Attorney Docket No.00633-0383WO1 / MEEI 2023-330 break (an SSB or nick), a double-strand break (a DSB) and / or a base substitution. See, e.g., WO2018 / 026976 for a description of exemplary genome editing systems. As used in this context, to “treat” means to ameliorate at least one symptom of the disorder associated with a mutation in the USH2A gene. Often, these mutations result in hearing loss and / or loss of sight; thus, a treatment comprising administration of a therapeutic gene editing system as described herein can result in a reduction in hearing impairment and / or visual impairment; a reduction in the rate of progression of hearing loss and / or vision loss; and / or a return or approach to normal hearing and / or vision. Hearing and vision can be tested using known methods, e.g., electroretinogram, optical coherence tomography, video nystagmography, and audiology testing. The methods can be used to treat any subject (e.g., a mammalian subject, preferably a human subject) who has a mutation in the USH2A gene, e.g., in one or both alleles of USH2A. As used herein, an “allele” is one of a pair or series of genetic variants of a polymorphism (also referred to as a mutation) at a specific genomic location. As used herein, “genotype” refers to the diploid combination of alleles for a given genetic polymorphism. A homozygous subject carries two copies of the same allele and a heterozygous subject carries two different alleles. Methods for identifying subjects with such mutations are known in the art; see, e.g., Yan et al., J Hum Genet.2009 Dec; 54(12): 732–738; Leroy et al., Exp Eye Res.2001 May;72(5):503-9; or Consugar et al., Genet Med.2015 Apr;17(4):253-261. For example, gel electrophoresis, capillary electrophoresis, size exclusion chromatography, sequencing, and / or arrays can be used to detect the presence or absence of the allele or genotype. Amplification of nucleic acids, where desirable, can be accomplished using methods known in the art, e.g., PCR. In one example, a sample (e.g., a sample comprising genomic DNA), is obtained from a subject. The DNA in the sample is then examined to identify or detect the presence of an allele or genotype as described herein. The allele or genotype can be identified or determined by any method described herein, e.g., by Sanger sequencing or Next Generation Sequencing (NGS). Other methods can include hybridization of the gene in the genomic DNA, RNA, or cDNA to a nucleic acid probe, e.g., a DNA probe (which includes cDNA and oligonucleotide probes) or an RNA probe. The nucleic acid probe can be designed to specifically or preferentially hybridize with a particular mutation (also referred to as a polymorphic variant). Other methods of nucleic acid analysis can include direct manual sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995 (1988); Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977); Beavis et al., U.S. Pat. No.5,288,644); automated Attorney Docket No.00633-0383WO1 / MEEI 2023-330 fluorescent sequencing; single-stranded conformation polymorphism assays (SSCP) (Schafer et al., Nat. Biotechnol.15:33-39 (1995)); clamped denaturing gel electrophoresis (CDGE); two-dimensional gel electrophoresis (2DGE or TDGE); conformational sensitive gel electrophoresis (CSGE); denaturing gradient gel electrophoresis (DGGE) (Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236 (1989)); denaturing high performance liquid chromatography (DHPLC, Underhill et al., Genome Res.7:996-1005 (1997)); infrared matrix-assisted laser desorption / ionization (IR-MALDI) mass spectrometry (WO 99 / 57318); mobility shift analysis (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770 (1989)); restriction enzyme analysis (Flavell et al., Cell 15:25 (1978); Geever et al., Proc. Natl. Acad. Sci. USA 78:5081 (1981)); quantitative real-time PCR (Raca et al., Genet Test 8(4):387-94 (2004)); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)); RNase protection assays (Myers et al., Science 230:1242 (1985)); use of polypeptides that recognize nucleotide mismatches, e.g., E. coli mutS protein; allele-specific PCR, and combinations of such methods. See, e.g., Gerber et al., U.S. Patent Publication No.2004 / 0014095 which is incorporated herein by reference in its entirety. In certain aspects, the present disclosure provides AAV vectors encoding CRISPR / Cas9 genome editing systems, and on the use of such vectors to treat USH2A associated disease. Exemplary AAV vector genomes are described in WO2019 / 183641, which illustrates certain fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or two gRNA sequences and promoter sequences to drive their expression, a Cas9 coding sequence and another promoter to drive its expression (an exemplary construct for use in the methods described herein could include, for example 2 gRNA or only 1 gRNA and U6). Each of these elements is discussed in detail herein. A single vector can be used to deliver a SaCas9 and two gRNAs, or a plurality of vectors can be used, e.g., wherein one vector is used to deliver whole Cas9, and another vector or vectors is used to deliver one or more gRNAs (e.g., one vector for one gRNA, one vector for two gRNAs, or two vectors for each of two gRNAs). Other arrangements are also possible, including splitting the Cas9 across two AAVs and each of the split Cas9 vectors contain one or more gRNAs. Guide RNAs In some embodiments, the gRNAs used in the present disclosure can be unimolecular or modular. Exemplary gRNAs that can be used in the present methods are provided in Tables 1-4. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 AAV Delivery Systems The methods include delivery of a CRISPR / Cas9 genome editing system, including a Cas9 nuclease and one or two guide RNAs, to a subject in need thereof. The delivery methods can include, e.g., viral delivery, e.g., preferably using an adeno-associated virus (AAV) vector that comprises sequences encoding the Cas9 and guide RNA(s). Adeno- associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al., Curr. Topics in Micro and Immunol.158:97-129 (1992)). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther.2009 Aug; 11(4): 442–447; Asokan et al., Mol Ther.2012 April; 20(4): 699–708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. For example, AAV2, AAV5, AAV2 / 5, AAV2 / 8 and AAV2 / 7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al., Vision Research 2008, 48(3):377-385; Khani et al., Invest Ophthalmol Vis Sci.2007 Sep;48(9):3954-61; Allocca et al., J. Virol.2007 81(20):11372-11380). The PHP.eB vector can also be used. In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in PCT / US2014 / 060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT / US2014 / 060163, and a Cas9 sequence and guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. In some embodiments, the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018 / 026976. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Cas9 expression is driven by a promoter known in the art. In some embodiments, expression is driven by one of three promoters: cytomegalovirus (CMV), elongation factor-1 (EFS), Cbh, or human g-protein receptor coupled kinase-1 (hGRKl), which is specifically expressed in retinal photoreceptor cells. Nucleotide sequences for each of these promoters are provided in Table 5 of WO 2018 / 026976. Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure. Expression of the gRNAs in the AAV vector is driven by a promoter known in the art. In some embodiments, a polymerase III promoter, such as a human U6 promoter. An exemplary U6 promoter sequence is presented below: AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATA TACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAG ATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTT TTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG ATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC. (SEQ ID NO:1). In some embodiments, the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with one of the nucleic acids or AAV vectors recited above. The AAV genomes described above can be packaged into AAV capsids (for example, AAV5 capsids), which capsids can be included in compositions (such as pharmaceutical compositions) and / or administered to subjects. An exemplary pharmaceutical composition comprising an AAV capsid according to this disclosure can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants (e.g., Tween 20) and / or a thermosensitive or reverse-thermosensitive polymer (e.g., pluronic). Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described here. Compositions comprising AAV vectors according to this disclosure can be administered to subjects by any suitable means, including without limitation injection, for example, subretinal injection or injection through the round window. The concentration of AAV vector within the composition is selected to ensure, among other things, that a sufficient AAV dose is administered to the retina or inner ear of the subject, taking account of dead volume within the injection apparatus and the relatively limited volume that can be safely administered. Suitable doses may include, for example, 1x1011viral genomes (vg) / mL, Attorney Docket No.00633-0383WO1 / MEEI 2023-330 2x1011viral genomes (vg) / mL, 3xl011viral genomes (vg) / mL, 4x1011viral genomes (vg) / mL, 5xl011viral genomes (vg) / mL, 6x1011viral genomes (vg) / mL, 7x1011viral genomes (vg) / mL, 8xl011viral genomes (vg) / mL, 9x1011viral genomes (vg) / mL, 1x1012vg / mL, 2xl012viral genomes (vg) / mL, 3xl012viral genomes (vg) / mL, 4xl012viral genomes (vg) / mL, 5xl012viral genomes (vg) / mL, 6xl012viral genomes (vg) / mL, 7xl012viral genomes (vg) / mL, 8xl012viral genomes (vg) / mL, 9xl012viral genomes (vg) / mL, lx1013vg / mL, 2xl013viral genomes (vg) / mL, 3xl013viral genomes (vg) / mL, 4xl013viral genomes (vg) / mL, 5xl013viral genomes (vg) / mL, 6xl013viral genomes (vg) / mL, 7xl013viral genomes (vg) / mL, 8xl013viral genomes (vg) / mL, or 9xl013viral genomes (vg) / mL. Any suitable volume of the composition may be delivered to the subretinal or cochlear space. In some instances, the volume is selected to form a bleb in the subretinal space, for example 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, etc. Other methods of delivering the CRISPR / Cas9 genome editing system, including a Cas9 nuclease and one or two guide RNAs, can also be used, including delivering ribonucleoprotein (RNP) complexes comprising the nuclease protein and gRNAs in complex, or mRNA encoding the nuclease, with the gRNAs, e.g., in lipid nanoparticles (LNPs). In some embodiments, the LNPs comprise the following components: ionizable lipids, helper lipids, cholesterol, and polyethylene glycol (PEG)-lipids (see, e.g., refs 38 and 39). When mRNA encoding the cas9 is used, preferably the mRNA is modified, e.g., capped and / or polyadenylated. See Refs.40-45. Methods of Delivery Any region of the retina may be targeted, though the fovea (which extends approximately 1 degree out from the center of the eye) may be preferred in certain instances due to its role in central visual acuity and the relatively high concentration of cone photoreceptors there relative to peripheral regions of the retina. Alternatively or additionally, injections may be targeted to parafoveal regions (extending between approximately 2 and 10 degrees off center), which are characterized by the presence of all three types of retinal photoreceptor cells. In addition, injections into the parafoveal region may be made at comparatively acute angles using needle paths that cross the midline of the retina. For instance, injection paths may extend from the nasal aspect of the sclera near the limbus through the vitreal chamber and into the parafoveal retina on the temporal side, from the temporal aspect of the sclera to the parafoveal retina on the nasal side, from a portion of the sclera located superior to the cornea to an inferior parafoveal position, and / or from an inferior Attorney Docket No.00633-0383WO1 / MEEI 2023-330 portion of the sclera to a superior parafoveal position. The use of relatively small angles of injection relative to the retinal surface may advantageously reduce or limit the potential for spillover of vector from the bleb into the vitreous body and, consequently, reduce the loss of the vector during delivery. In other cases, the macula (inclusive of the fovea) can be targeted, and in other cases, additional retinal regions can be targeted, or can receive spillover doses. For delivery to the inner ear, injection to the cochlear duct, which is filled with high potassium endolymph fluid, could provide direct access to hair cells. However, alterations to this delicate fluid environment may disrupt the endocochlear potential, heightening the risk for injection- related toxicity. The perilymph-filled spaces surrounding the cochlear duct, scala tympani and scala vestibuli, can be accessed from the middle ear, either through the oval or round window membrane (RWM). The RWM, which is the only non-bony opening into the inner ear, is relatively easily accessible in many animal models and administration of viral vector using this route is well tolerated. Administration through the oval window or across the tympanic membrane can also be used. See, e.g., WO2017100791 and US7206639. For pre-clinical development purposes, systems, compositions, nucleotides and vectors according to this disclosure can be evaluated ex vivo using a retinal explant system, or in vivo using an animal model such as a mouse, rabbit, pig, nonhuman primate, etc. Retinal explants are optionally maintained on a support matrix, and AAV vectors can be delivered by injection into the space between the photoreceptor layer and the support matrix, to mimic subretinal injection. Tissue for retinal explanation can be obtained from human or animal subjects, for example mouse. Explants are particularly useful for studying the expression of gRNAs and / or Cas9 following viral transduction, and for studying genome editing over comparatively short intervals. These models also permit higher throughput than may be possible in animal models, and can be predictive of expression and genome editing in animal models and subjects. Small (mouse, rat) and large animal models (such as rabbit, pig, nonhuman primate) can be used for pharmacological and / or toxicological studies and for testing the systems, nucleotides, vectors and compositions of this disclosure under conditions and at volumes that approximate those that will be used in clinic. Because model systems are selected to recapitulate relevant aspects of human anatomy and / or physiology, the data obtained in these systems will generally (though not necessarily) be predictive of the behavior of AAV vectors and compositions according to this disclosure in human and animal subjects. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Materials and Methods The following materials and methods were used in this example. Ush2a-∆exon mouse lines. The human USH2A and mouse Ush2a gene share a similar exon-intron structural organization. We generated 6 experimental exon-deleted (Ush2a- ∆exon) mouse lines for in-frame exons 15, 17, 20, 37, 42, 44, (the ortholog of human exon 16, 18, 21, 38, 43 and 45) (FIG.1). Two control Ush2a-∆exon mouse lines were also generated by deleting mouse exon 5 and 19, which are out of frame. The resulting Ush2a- ∆exon5 and Ush2a-∆exon19 lines thus provide a negative control for studies of exon-deleted Ush2a gene expression and protein function in retina. To generate these Ush2a-∆exon mouse lines, gene editing was performed in mouse zygotes using the same techniques employed for generating Ush2a-∆exon12 mice

[0010] . Briefly, multiple Cas9 / sgRNAs were designed to target the flanking intronic sites within 500 bp to the exon and test their cleavage efficiencies on plasmid templates. sgRNAs with highest efficiencies for up- and down-stream intron were selected and paired. sgRNAs were in vitro transcribed to mRNA and mixed with purified Cas9 protein as a ribonucleoprotein (RNP) for microinjection into the pronuclei of C57BL / 6J mouse zygotes. Genotyping of founder mice was performed using primer sets outside or between the sgRNA target sites in the introns. The genomic modifications (e.g. deletion of target exon and its flanking intronic sequences) that occurred in each line were determined by Sanger sequencing (FIG.1). Characterization of Ush2a-∆exon mice. Homozygous Ush2a-∆exon mice for each generated line, along with their wild type and heterozygous littermates, were characterized. Deletion of target exon in Ush2a transcripts and the expression levels of Ush2a-ΔExon mRNA were determined using RT-PCR and Sanger sequencing (FIG.2). The expression and localization of Ush2a-∆exon proteins was further assessed in retinas using immunostaining assay, and compared with wild type, out-of-frame Ush2a-ΔExon5 or 19, and Ush2a knock out mice (FIG.3A). Determine which Ush2a-∆exon alleles can restore Usherin function in Ush2a null mice. To evaluate the function of Ush2a-∆exon proteins, in vivo complementation studies to rescue the retinal and cochlear phenotypes in Ush2a ko mice were performed. The Ush2a- ∆exon homozygous mice were crossed with Ush2a ko mice to generate experimental Attorney Docket No.00633-0383WO1 / MEEI 2023-330 heterozygous Ush2a∆Exon / komice. The restoration of expression and localization of exon deleted usherin proteins was assessed in retinas using immunostaining assay, and compared with wild type, out-of-frame Ush2a-ΔExon5 or 19, and Ush2a knock out mice (FIG.3A). The relative expression level of usherin protein in the retinas was quantified by assessing the immunostaining signal intensity of frozen retinal sections of all the heterozygous Ush2a- ΔEx / ko lines on the same slides with wt and control knockout retinal sections ((FIG.3B). Morphological analysis of cochlear hair cells in neonatal mice. The earliest phenotypes detected in the Ush2a ko mice are in the inner ear. The distribution of Ush2a- ∆exon protein in hair cells will be examined and the morphology of stereocilia bundles in P0–P3 Ush2a∆exon / kohemizygous and control mice studied by immunostaining with anti- USH2A antibody and phalloidin fluorescent conjugate, which mark both the cell body and stereocilia of inner hair cells and outer hair cells. FM 1–43 dye (1 μM FM1-43FX) uptake experiments are performed to assess if hair cells possess mechanotransduction channels [10, 23, 24]. Acoustic testing and morphological examination in adult mice. Cochlear function were measured by Auditory brainstem response (ABR) and distortion product otoacoustic emissions (DPOAE) recording in mice at 2 and / or 4 months of age according to established protocols[10, 25, 26]. Loss of hearing in the KO mice was restored to normal level with one copy of Ush2a-∆Ex15, -∆Ex20, and -∆Ex44 alleles. However, Ush2a-∆Ex42 allele was not able to rescue the auditorial function in the Ush2a-∆Ex42 / KO mice. Immunohistochemistry for retina. An early effect of Usherin deficiency in the retina is the disruption of USH2 protein complex in photoreceptors

[0027] . The expression of VLGR1 protein coded by USH2C gene is lost in the retina of Ush2a knockout mice. The restoration of expression and localization of VLGR1 protein in was assessed in retinas of heterozygous Ush2a∆Exon / komice using immunostaining assay, and compared with wild type, out-of-frame Ush2a-ΔExon5 or 19, and Ush2a knock out mice (FIG.3C). The progressive disruption of cone outer segments and the aberrant localization of cone opsin is also an early indicator of ongoing retinal degeneration. The mislocalization of cone opsin to the inner segments and synaptic regions was determined by immunostaining in mice at 4-5 months old (Figs.3D-E).[10, 26]. Retinal histology and functional analysis. In contrast to early onset manifestation of hearing loss, reduction of retinal function in Ush2a ko mice is not evident until 20 months of age

[0026] . For this reason, the retina-specific functional outcomes of removing an exon at 20 Attorney Docket No.00633-0383WO1 / MEEI 2023-330 months is tested using full field electroretinography (ERG). The retinal histology will be analyzed by light microscopy and transmission electron microscopy [26, 28]. Example 1. Selection of exons to be studied. The “pathogenic” and “likely pathogenic” USH2A variants reported in the LOVD database

[0029] were analyzed. Out of 1054 unique variants, 705 are labeled “pathogenic”, “likely pathogenic – UV3”, or “certainly pathogenic – UV4”, including 430 nonsense, 230 missense and 45 large deletion or duplications. The unique mutations and their reported frequencies in each of the 25 in-frame exons are listed in Table 1. 6 single exons (exon 16, 18, 21, 38, 43 and 45) were selected as initial targets for testing exon-deletion approach. Exon 32 was excluded because deletion of this exon has been reported to be pathogenic (Bonnet, C., et al., Eur J Hum Genet, 2016.24(12): p.1730-1738). When the neighboring exons are both in-frame, they can be skipped together. Table 1. Single in-frame exons selected for targeting by exon-skipping approaches Total  Total  Exon  Stop / fs  Nonsense  Stop / fs  Nonsense  nonsense  nonsense  y    Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Total  Total  Exon  Stop / fs  Nonsense  Stop / fs  Nonsense  nonsense  nonsense  Exon  length  t ti mutation  Mutation  ll l allele   Allele  y  Example 2. Identification of sgRNAs that produce efficient exon-skipping in cultured cells 1) Design and construct of sgRNAs: To perform dual-guide exon-skipping, two sgRNAs were used: one sgRNA targets the upstream intron of exon-of-interest and a second sgRNA targets the downstream intron or the exon-of-interest. All sgRNAs were designed using CRISPOR (crispor.tefor.net / ) or UCSC genome browser. A list of SpCas9 sgRNAs for targeting exon 16, 18, 21, 38 and 45 was generated, ranked from high to low MIT specificity score (Table 2). The higher the MIT specificity score, the fewer off-target effects are expected for the corresponding guide. Table 2. Protospacers of SpCas9 sgRNAs for targeting exon 16, 18, 21, 38 and 45 gRNA ID  Protospacer (5'‐3')  SEQ ID NO:  gRNA ID  Protospacer (5'‐3')  SEQ ID NO:  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN15_6  AAACTGCGTCTGCACCCGGA  7.   EX16_6  GTAAACTGTAAGTAAGCCAG  779.  IN15_7  ATATAGCGCAAGAGTTGAAC  8.   EX16_7  TAAGTAAGCCAGTGGGCATT  780.  IN15_8  CAACTCTTGCGCTATATACC  9.   EX16_8  GTCCTCTGGGCGGAGGTTGC  781.   gRNA ID  Protospacer (5'‐3') SEQ ID NO: gRNA ID  Protospacer (5'‐3') SEQ ID  NO:  3.  5.  7.  9.  1.  3.  5.  7.  9.  1.   Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN16_11  AAAGATCCGTACCCCAACCA  72.   IN17_11  TTTGACTGTGTCACAAGTTA  73.  IN16_12  CTGTAGTTGAGGAAGCGTGA  74.   IN17_12  AGTTTAGTAATCTAGATGAC  75.  IN16_13  TTTTGACGATTGCACTAATA  76.   IN17_13  AGACAAAGGGGTTACTTTAG  77.  9.  1.  3.  5.  7.  9.  1.  3.  5.  7.  9.  01.  03.  05.  07.  09.  11.  13.  15.  17.  19.  21.  23.  25.  27.  29.  31.  33.  35.  37.  39.  41.  43.  45.  47.  49.  51.   gRNA ID  Protospacer (5'‐3')  SEQ ID NO:  gRNA ID  Protospacer (5'‐3')  SEQ ID NO: Exon 18  Intron 18  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 EX18_17  ATGGTTGTCATTGTTTGAGG  184.   IN18_17  GTCAAGTTTAGATCAGGGTT  185.  EX18_18  TGCCTGGGTCTCAGAAAGAA  186.   IN18_18  TTTCCACTCCTGAAGTGGAT  187.  EX18_19  GAGTTTTTCAGAGCAGTGGT  188.   IN18_19  GCTCTATTATTTGTCCAAGA  189.   gRNA ID  Protospacer (5‐3)  S Q    O:  gRNA ID  Protospacer (5‐3)  S Q    O: Intron 20  Exon 21  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN20_23  TCGTAGGTTGTCCCATATGG  268.   EX21_23  GTCTGTATTGACTGGGTGAG  269.  IN20_24  TTACCACTAATGCATAGGGC  270.   EX21_24  TTGATTCCTTTAACCAGAGG  271.  IN20_25  TTAGTTGTAGCGTGACTCCA  272.   EX21_25  TTGACTGGGTGAGTGGAGCT  273.                             : Intron 21  Intron 37                              Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN21_29  GAAAGCATTTAGCTCCGACA  360.   IN37_29  CTCTGGGAAAACCCGCCAGT  361.  IN21_30  AGTTCCAAGGTTTCCGCCTA  362.   IN37_30  GCGTGTCAGATATACTGCAT  363.  IN21_31  TTTTACCCTCGTAGTACAGG  364.   IN37_31  GGGTTAGAGCATACCATCAT  365.                      Exon 38    Intron 38   EX38 1 TTGGGTGCTCATCGATGGGC 404 IN38 1 GCAGCAATGGATGATATCGG 405 Attorney Docket No.00633-0383WO1 / MEEI 2023-330         IN38_35  TTAGGATTTCAACGCTTAAT  456.          IN38_36  TCTTTTATCAGCAATCCGAA  457.          IN38_37  ATCTTTTATCAGCAATCCGA  458.                                                                                             gRNA ID  Protospacer (5'‐3')  SEQ ID NO: Intron 44  Exon 45 IN44 1  GGTCATTATTGATCATCGGC  472.   EX45 1  GGACTCACCCCCATCGCAAG  473.   Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN44_41  GTCGTAGTGCCAAAACATAT  531.          IN44_42  GCATTAGTCCAAGGATTGGG  532.          IN44_43  TGTCTTACTGCATGATATGG  533.                                                            D NO: Intron 45  541.  IN45_1  AAACAAAAGGTGCCGACCTT  542.   Attorney Docket No.00633-0383WO1 / MEEI 2023-330 IN45_47  TTAGTATTTAGGTTTAGCAA  588.  IN45_48  GTCTGTAGTCCTCTGTAAAT  589.  IN45_49  ATAAGTGTTAGTGGTGCAGA  590.  d with higher MIT and Doench’16 scores and located within 1kb to the target exon for all 22 in-frame exons except exon 8, 13 and 32 (Table 3). sgRNAs containing SNPs with higher than 1% frequency (based on dbSNP153 database on UCSC) are excluded. To generate U6-promoted sgRNA expression vectors, a pair of complimentary 20bp or 21bp oligos for each sgRNA sequence was annealed and cloned. Table 3. Selected sgRNAs for deleting in-frame exons of USH2A gene Targeted  IntrogRNA ID  gRNA sequence (5'‐3')  SEQ ID NO:  PAM Exon  n  16 15i Ex16 15i Sp a ATGCTTAATGTAAACTATGG 592. TGG T   T T T T T  T T T T    T T T   T T T   Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Ex21_20i_Sa_c  gCTTCATTACCCATTGGTTGGC  626.   ACGGAT Ex21_20i_Sa_d  gCGGGCACAGAAACTGGGCCAT  627.   TGGGGT Ex21 20i Sa e  gTAGAAAACACCTGTTATATTC  628.   AAGAAT T     T T T  T    T T     T  T   T T T T T T   Attorney Docket No.00633-0383WO1 / MEEI 2023-330 30i  Ex31_30i_Sp_a  GGTTCCACATATAGTTCGTG  677.   AGG Ex31_30i_Sa_a  GAAGTGTTACACGTGGAAGTA  678.   TTGAAT Ex31 30i Sa b  gTTCTCCCATTAAAATGGGGA  679.   GGGGGT T T T T T   T  T    T T T T T        T  T T  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Ex50_50i_Sa_e  AGGTCTACCTTTCAGTAGATG  728.   GAGGAT Ex50_50i_Sa_j  gAATAACAATAAGTATCATTGA  729.   ATGAAT Ex50 50i Sa k  gTAGCTTAATACAGTAGAATAA  730.   GGGAGT T    T T   T T  T T  T      T T   T T  T  2) Cutting efficiency of individual sgRNA: 11 in-frame exon(s) were first selected for testing the editing efficiencies of single SaCas9 sgRNAs based on their high mutation Attorney Docket No.00633-0383WO1 / MEEI 2023-330 frequency among in-frame exons in human USH2A gene. These include Exon 16, 17, 18, 21, 24, 28-29, 38, 43, 45, and 50. Intron 28 is only 127bp, so it was decided to skip Exon 28 and 29 together, as both are in-frame. Due to the smaller size of SaCas9 and its capacity to be packaged into single AAV vector, SaCas9 sgRNAs were prioritized for the initially individual screening (Table 4). After preparation of plasmids, individual sgRNA was co-transfected with WT-SpCas9 or WT-SaCas9 into HEK293 cells seeded in 96-well plate. Each sgRNA was tested in triplicates. Transfected cells were collected 48 hours after transfection. Cell gDNA were extracted from bulk unsorted cells. A PCR amplifying region containing sgRNA cut site was performed, followed by T7E1 assay. Individual sgRNA cutting efficiency was determined byequation: cutting efficiency (%) = 100 x (1 - ^^1 െ ^^^^^^^^^ ), where fcut = (b + c) / (a + b + c),as a is the integrated intensity of the integrated intensities of each cleavage product (Ran 2308). Table 4. Individual SaCas9 sgRNA cutting efficiency in bulk cells  Target Intron  gDNA ID  gDNA sequence (5Effieicncy  Exon '‐3')  SEQ ID NO:  PAM (%)  Ex16 15i S TGTCTTCTTGATAAAGCAATC 593 CTGAAT 629                                  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Ex24_23i_Sa_g  CCCCCTAAGTACTCTAGAGGG  641  ATGAAT  2.74 Ex24_23i_Sa_h  ATCATTCCAACATCATGATGC  642  TGGGAT  12.54 Ex24_24i_Sa_e  CCAATCCCTAGATATTCATAG  646  ATGAAT  22.37                              3) xon de e ng e c ency o a red sg s: op sg (s) w e g es cutting efficiency targeting 5’ and 3’ flanking introns were selected and paired for testing dual-guide exon-skipping efficiency (Table 5). Each pair of sgRNAs was co-transfected with WT-SaCas9 at a molar ratio of 1:1:1 into HEK293 cells. Each paired sgRNAs was tested in triplicates. PCR amplifying both exon-skipped and full-length products were performed using the primers outside the targeting region. Twenty-five circles of PCR was performed to minimized the preference to short exon-deleted product. Dual-guide exon-deleting efficiency was estimated by equation: exon-deleting efficiency = y / (x + y), where x is the relative amount DNA of exon-skipped product and y is the relative amount DNA of full-length PCR product. The top paired sgRNA with the highest exon-deleting efficiency for each target exon was identified. Table 5. Exon deletion efficiency of paired gRNAs in HEK293 cells Targeted  gRNA pairs upstream sgRNA  downstream sgRNA  Exon‐skipping  Attorney Docket No.00633-0383WO1 / MEEI 2023-330 Δ16‐Sa_pair5  Ex16_15i_Sa_e  597  Ex16_16i_Sa_b  601  30.77%  8.02% Δ16‐Sa_pair6  Ex16_15i_Sa_e  597  Ex16_16i_Sa_c  602  30.30%  5.46% DEL17  Δ17‐Sa_pair3  Ex17_16i_Sa_h  609  Ex17_17i_Sa_h  612  72.28%  3.45% % % % % % % % % % % % % % % % % % % % %  by dual gRNA cutting, the PCR product was sequenced. For all the targeted exons, the majority of PCR amplicons showed a deletion of the target exon and a direct end joining of the two double-stranded breaks at the flanking introns. Representative sequences for exon 17, exon 24 and exon 28-29 were shown in FIGs.5A-C. Example 3. Generation of exon-deleted Ush2a-∆exon mouse models. When the mouse zygotes received RNP microinjection, two double-stranded breaks (DSBs) were created in the mouse introns flanking the exon of target, and the targeted exon could be permanently excised via NHEJ-based genome editing. 1) Design and selection of gRNAs to target mouse genome: In order to remove mouse exons from the genome to generate Ush2a-∆exon mouse models, 2-4 pairs of SpCas9 sgRNAs were designed and constructed to target the 5’ and 3’ flanking introns of mouse exons 5, 15, 17, 19, 20, 37, 42 and 44 of mouse Ush2a gene. Mouse exon 5 and 19 (homologous human exon 6 and 20) is an out-of-frame exon and was included as a control. The efficiency of sgRNAs was then evaluated using two different assays. a. Individual sgRNA were tested to cut the synthesized DNA templates in tubes to identify the best sgRNAs; b. Paired sgRNA to delete exon of interest in mouse embryo were evaluated through microinjection of RNP. Highlighted sgRNAs with the highest cutting or exon- deleting efficiency were selected to generate Ush2a-∆exon and Ush2a-hExon mouse models. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 2) Generation of Ush2a-∆exon mouse lines: Selected pairs of sgRNAs for removal of targeted mouse exon (5, 15, 17, 19, 20, 37, 42 and 44) were mixed with purified Cas9 protein as a ribonucleoprotein (RNP) for microinjection into the pronuclei of C57BL / 6J mouse zygotes. Genotyping of the founder mice were performed using primers that primes outside of two cut sites. All proposed Ush2a-∆exon alleles were obtained in the F0 generation. The exon-deletion efficiencies achieved in founder mice for exons 5, 15, 17, 19, 20, 37, 42 and 44 were 25.2%, 18.8%, 34.5%, 29.5%, 36.8%, 15.2%, 28.9% and 27.3%, respectively. We further validated the genomic sequence of positive founder mouse from each of the exon-deleted lines and germline transmission was confirmed in F1 and F2 mice by Sanger sequences (FIG.1). 3) Expression of exon-deleted Ush2a-∆exon in mouse retinas: To evaluate whether deletion of exons from the mouse genome could lead to the expression of a shortened Ush2a- ∆exon transcripts and protein, we performed RT-PCR and immunohistochemistry using retinas from Ush2a-∆exon mice. A shortened PCR amplicon missing the target exon was detected for each of the lines (FIG.2). Immunostaining of Ush2a and VLGR1 proteins in the retinas showed that restoration of usherin and VLGR1 in heterozygous ∆Exon / KO mouse lines, in which various levels of usherin expression were restored with one copy of Ush2a- ∆Ex15, -∆Ex20, -∆Ex37, and -∆Ex44 alleles. Cone opsin mislocalization was also rescued in Ush2a-∆Ex15, -∆Ex17, and -∆Ex44 mice (FIG.3A-E). Example 4. Generation of humanized Ush2a-hExon mouse models The sgRNA pairs identified in vitro will be packed into AAV vectors and assessed in vivo in humanized mouse models to determine their efficiency, specificity and efficacy to restore vision and hearing function. 1) Design of donor human exon templates: To generate humanized Ush2a-hExon mouse models, the mouse exon and portions of flanking introns were replaced with corresponding human USH2A sequences by co-injecting a donor template with the RNP that were used to generate the Ush2a-∆exon mice. We designed ssDNA donor constructs based on the recognition sites of sgRNAs identified cultured cells for each human USH2A exon. Our previous work in generation of Ush2a-hExon13 mice has shown abnormal splicing between the flanking mouse exons with the human exon, which leads to the skipping of human exon 13 in 66% of the Ush2a transcripts. Therefore, we modified the donor construct by replacing the splice sites of human exons with the splice sites of homologous mouse exons. For each of the dispensable human exons (exon 16, 18, 21, 38 and 45), we designed two ssDNA donor Attorney Docket No.00633-0383WO1 / MEEI 2023-330 constructs containing the orthologous wild type human exon and a mutant exon that carries the most frequent nonsense or frameshift mutation (FIG.4). 2) Generation of Ush2a-hExon wt or mutant mouse lines: The wild type and mutant ssDNA donor constructs were co- or separately injected with selected paired sgRNAs into mouse embryos. Genotyping of the founder mice was performed by PCR using human exon specific primers as well as the same primer sets for Ush2a-∆exon mice. All proposed Ush2a-hExon alleles were obtained in the F0 generation. The efficiencies of human exon sequence replacement in founder mice were 14.6%, 13.2%, 26.3%, 6.5% and 12.1% for human Exon 16, 18, 21, 38 and 45, respectively. The genomic sequence of positive founder mice was further validated from each of the humanized lines by Sanger sequencing. Sequencing results showed a complete replacement of targeted mouse exons and flanking intronic regions with human exon and flanking intronic sequences (FIG.4B). Colonies for each of the exon-humanized mouse models have been established, and the AAV mediated dual gRNA exon skipping therapy is being tested in each of the humanized mouse models. References 1. Ong, T., et al., Adeno-Associated Viral Gene Therapy for Inherited Retinal Disease. Pharm Res, 2019.36(2): p.34. 2. Trapani, I., Adeno-Associated Viral Vectors as a Tool for Large Gene Delivery to the Retina. Genes (Basel), 2019.10(4). 3. Tornabene, P. and I. Trapani, Can Adeno-Associated Viral Vectors Deliver Effectively Large Genes? Hum Gene Ther, 2020.31(1-2): p.47-56. 4. Daiger, S.P., S.J. Bowne, and L.S. Sullivan, Perspective on genes and mutations causing retinitis pigmentosa. Archives Ophthalmology, 2007.125(2): p.151-158. 5. Kumaran, N., et al., Leber congenital amaurosis / early-onset severe retinal dystrophy: clinical features, molecular genetics and therapeutic interventions. Br J Ophthalmol, 2017. 101(9): p.1147-1154. 6. Puppo, A., et al., Retinal transduction profiles by high-capacity viral vectors. Gene Ther, 2014.21(10): p.855-65. 7. Hirsch, M.L., S.J. Wolf, and R.J. Samulski, Delivering Transgenic DNA Exceeding the Carrying Capacity of AAV Vectors. Methods Mol Biol, 2016.1382: p.21-39. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 8. Adijanto, J. and M.I. Naash, Nanoparticle-based technologies for retinal gene therapy. Eur J Pharm Biopharm, 2015.95(Pt B): p.353-67. 9. Dulla, K., et al., Antisense oligonucleotide-based treatment of retinitis pigmentosa caused by USH2A exon 13 mutations. Mol Ther, 2021. 10. Pendse, N.L., V.; Maeder, L. M.; Pawlyk; B.; Gloskowski, S.; Pierce, E. A.; Chen, Z- Y; Liu, Q., Exon 13-skipped USH2A protein retains functional integrity in mice, suggesting an exon skipping therapeutic approach to treat USH2A-associated disease. bioRxiv, 2020. 11. Sanjurjo-Soriano, C., et al., Genome Editing in Patient iPSCs Corrects the Most Prevalent USH2A Mutations and Reveals Intriguing Mutant mRNA Expression Profiles. Molecular Therapy-Methods & Clinical Development, 2020.17: p.156-173. 12. Fuster-Garcia, C., et al., USH2A Gene Editing Using the CRISPR System. Mol Ther Nucleic Acids, 2017.8: p.529-541. 13. Liu, X., et al., Generation and Genetic Correction of USH2A c.2299delG Mutation in Patient-Derived Induced Pluripotent Stem Cells. Genes (Basel), 2021.12(6). 14. Chamberlain, J.R. and J.S. Chamberlain, Progress toward Gene Therapy for Duchenne Muscular Dystrophy. Mol Ther, 2017.25(5): p.1125-1131. 15. Zhao, J., et al., Dystrophin contains multiple independent membrane-binding domains. Hum Mol Genet, 2016.25(17): p.3647-3653. 16. Dilmac, N., Haider, N., Desrosiers, B.,Pattali, R,, Jin, S., Albright C.,. CRISPR gene editing rescues deficits in human USH2A mutant retinal organoids.2021; Available from: https: / / www.editasmedicine.com / wp-content / uploads / 2021 / 04 / ARVO-2021_Optic- cups_13Apr21_FINAL.pdf. 17. Aller, E., et al., The USH2A c.2299delG mutation: dating its common origin in a Southern European population. Eur J Hum Genet, 2010.18(7): p.788-93. 18. Blanco-Kelly, F., et al., Clinical aspects of Usher syndrome and the USH2A gene in a cohort of 433 patients. JAMA Ophthalmol, 2015.133(2): p.157-64. 19. Dreyer, B., et al., Spectrum of USH2A mutations in Scandinavian patients with Usher syndrome type II. Hum Mutat, 2008.29(3): p.451. 20. Le Quesne Stabej, P., et al., Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study. J Med Genet, 2012.49(1): p. 27-36. 21. Pennings, R.J., et al., USH2A mutation analysis in 70 Dutch families with Usher syndrome type II. Hum Mutat, 2004.24(2): p.185. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 22. Seyedahmadi, B.J., et al., Comprehensive screening of the USH2A gene in Usher syndrome type II and non-syndromic recessive retinitis pigmentosa. Exp Eye Res, 2004. 79(2): p.167-73. 23. Strassmaier, M. and P.G. Gillespie, The hair cell's transduction channel. Current opinion in neurobiology, 2002.12(4): p.380-386. 24. Géléoc, G.S. and J.R. Holt, Developmental acquisition of sensory transduction in hair cells of the mouse inner ear. Nature neuroscience, 2003.6(10): p.1019. 25. Gao, X., et al., Treatment of autosomal dominant hearing loss by in vivo delivery of genome editing agents. Nature, 2018.553(7687): p.217-221. 26. Liu, X., et al., Usherin is required for maintenance of retinal photoreceptors and normal development of cochlear hair cells. Proc Natl Acad Sci U S A, 2007.104(11): p. 4413-8. 27. Yang, J., et al., Ablation of whirlin long isoform disrupts the USH2 protein complex and causes vision and hearing loss. PLoS Genet, 2010.6(5): p. e1000955. 28. Liu, Q., et al., Expression of wild-type Rp1 protein in Rp1 knock-in mice rescues the retinal degeneration phenotype. PLoS One, 2012.7(8): p. e43251. 29. Fokkema, I.F., et al., LOVD v.2.0: the next generation in gene variant databases. Hum Mutat, 2011.32(5): p.557-63. 30. Yang, J., et al., Current understanding of usher syndrome type II. Front Biosci (Landmark Ed), 2012.17: p.1165-83. 31. Michalski, N., et al., Molecular characterization of the ankle-link complex in cochlear hair cells and its role in the hair bundle functioning. J Neurosci, 2007.27(24): p.6478-88. 32. Zou, J., et al., Deletion of PDZD7 disrupts the Usher syndrome type 2 protein complex in cochlear hair cells and causes hearing loss in mice. Human molecular genetics, 2014.23(9): p.2374-2390. 33. van Wijk, E., et al., The DFNB31 gene product whirlin connects to the Usher protein network in the cochlea and retina by direct association with USH2A and VLGR1. Hum Mol Genet, 2006.15(5): p.751-65. 34. Chen, Q., et al., Whirlin and PDZ domain-containing 7 (PDZD7) proteins are both required to form the quaternary protein complex associated with Usher syndrome type 2. J Biol Chem, 2014.289(52): p.36070-88. Attorney Docket No.00633-0383WO1 / MEEI 2023-330 35. Zou, J., et al., Whirlin replacement restores the formation of the USH2 protein complex in whirlin knockout photoreceptors. Investigative ophthalmology & visual science, 2011.52(5): p.2343-2351. 36. Yang, J., D. Yu, and J. Zou, Identification of USH2A- and ADGRV1-interacting proteins in photoreceptors. Investigative Ophthalmology & Visual Science, 2019.60(9): p. 3990-3990. 37. Bhattacharya, G., et al., Localization and expression of usherin: a novel basement membrane protein defective in people with Usher's syndrome type IIa. Hear Res, 2002. 163(1-2): p.1-11. 38. Albertsen, C. H. et al. The role of lipid components in lipid nanoparticles for vaccines and gene therapy. Adv. Drug Deliv. Rev.188, 114416 (2022). 39. Shi, Y., Shi, M., Wang, Y. et al. Progress and prospects of mRNA-based drugs in pre- clinical and clinical applications. Sig Transduct Target Ther 9, 322 (2024). 40. Qin, S., Tang, X., Chen, Y. et al. mRNA-based therapeutics: powerful and versatile tools to combat diseases. Sig Transduct Target Ther 7, 166 (2022). 41. Ying Tu, Akashaditya Das, Chileab Redwood-Sawyerr, Karen M. Polizzi. Capped or uncapped? Techniques to assess the quality of mRNA molecules, Current Opinion in Systems Biology, Volume 37, 2024, 100503. 42. Wang et al., Developing mRNA Nanomedicines with Advanced Targeting Functions. Nanomicro Lett.2025 Feb 21;17:155. 43. Wang, YS., Kumari, M., Chen, GH. et al. mRNA-based vaccines and therapeutics: an in-depth survey of current and upcoming clinical applications. J Biomed Sci 30, 84 (2023). 44. Lin S and Kuang M, RNA modification-mediated mRNA translation regulation in liver cancer: mechanisms and clinical perspectives. Nat Rev Gastroenterol Hepatol.2024 Apr;21(4):267-281. doi: 10.1038 / s41575-023-00884-y. Epub 2024 Jan 19. 45. Pan S, Fan R, Han B, Tong A, Guo G. The potential of mRNA vaccines in cancer nanomedicine and immunotherapy. Trends Immunol.2024 Jan;45(1):20-31. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.00633-0383WO1 / MEEI 2023-330 WHAT IS CLAIMED IS:

1. A nucleic acid comprising sequences encoding a Cas9 protein, a first gRNA, and a second gRNA, wherein the first and second gRNAs are targeted to sequences flanking one or more exons of an usherin (USH2A) gene of the subject, preferably wherein the target sequence of the first gRNA is in the 5’ 1000 base pairs (bp) of a flanking intron or target exon, and the target sequence of the second gRNA is in the target exon or the 3’ 1000bp of a second flanking intron of the USH2A gene, wherein the first intron is 5’ of the second intron, and preferably wherein the exon is not, or is not only, exon 13, or wherein the exon is an exon shown in Table 1, optionally exon 16, 17, 18, 20, 21, 24, 28-29, 38, 43, 45, or 50.

2. The nucleic acid of claim 1, wherein the first gRNA comprises a target sequence shown in Table 2 to 4, and / or wherein the second gRNA comprises a target sequence shown in Table 2 to 4, preferably wherein the pair is listed in Table 5.

3. The nucleic acid of claims 1 or 2, wherein the nucleic acid encodes S. pyogenes or S. aureus Cas9 or another Cas variant.

4. The nucleic acid of claim 3, wherein the Cas9 comprises a nuclear localization signal, optionally a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal; and / or wherein the sequences encoding Cas9 comprises a polyadenylation signal.

5. The nucleic acid of any of claims 1-4, wherein the gRNA is a unimolecular S. pyogenes or S. aureus gRNA or a two-part modular S. pyogenes or S. aureus gRNA.

6. The nucleic acid of claims 1 to 5, which comprises a viral delivery vector, optionally AAV.

7. The nucleic acid of claim 6, wherein the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, or hGRKl promoter.

8. The nucleic acid of claim 6, wherein the viral delivery vector comprises an adeno- associated virus (AAV) vector.Attorney Docket No.00633-0383WO1 / MEEI 2023-330 9. The nucleic acid of claims 6 to 8, which comprises: (i) a first guide RNA comprising a targeting domain sequence selected from the group listed in Table 2 to 4 and a second guide RNA comprising a targeting domain sequence selected from the group listed in Table 2 to 4, preferably wherein the target sequence of the first gRNA is in the 3’ 1000 base pairs (bp) of a first intron or the target exon, and the target sequence of the second gRNA is in the target exon or 5’ 1000bp of a second intron of the USH2A gene, wherein the first intron is 5’ of the second intron, and preferably wherein the exon is not, or is not only, exon 13, or wherein the exon is an exon shown in Table 1, optionally exon 16, 17, 18, 20, 21, 24, 28-29, 38, 43, 45, or 50, preferably wherein the first and second gRNA are listed in Table 5; (ii) a first and a second inverted terminal repeat sequence (ITR); and (iii) a promoter for driving expression of the Cas9 selected from the group consisting of a CMV, an EFS, or an hGRKl promoter.

10. The nucleic acid of any of claims 1 to 9, for use in therapy.

11. The nucleic acid of any of claims 1 to 9, for use in preparation of a medicament.

12. The nucleic acid of any of claims 1 to 9, for use in a method of treating a subject who has a condition associated with a mutation in USH2A.

13. The nucleic acid for the use of claim 12, wherein the condition is Usher Syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).

14. The nucleic acid for the use of claim 12 or 13, wherein the nucleic acid is delivered to a retina of a subject by injection, such as by subretinal injection, or is delivered to the inner ear of a subject by injection, preferably through the round window.

15. A method of treating a subject who has a condition associated with a mutation in USH2A, the method comprising administering to the subject a therapeutically effective amount of the nucleic acid of any of claims 1 to 9.

16. The method of claim 15, wherein the condition is Usher Syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).Attorney Docket No.00633-0383WO1 / MEEI 2023-330 17. The method of claim 15 or 16, wherein the nucleic acid is delivered to a retina of a subject by injection, such as by subretinal injection, or is delivered to the inner ear of a subject by injection, preferably through the round window.

Images