Silk improved by spider silk protein gene and method for using spider silk protein gene to improve silk

Abstract

The present application discloses silk improved by a spider silk protein gene and a method for using a spider silk protein gene to improve silk. The silk improved by the spider silk protein gene comprises a silk protein light chain. The silk protein light chain is linked to a spider silk protein which is formed by fusion expression with the silk fibroin light chain. An amino acid sequence of the spider silk protein comprises a repeat region sequence having at least one spider silk protein repeat unit sequence. The present application achieves the expression of Nephila pilipes pyriform silk in Bombyx mori silk fibroin, implements formation of an intact spider silk protein on the silk light chain, and expands sites for Bombyx mori silk gland gene editing. Light-chain gene edited Bombyx mori and a heavy-chain gene edited silkworm can be hybridized, thereby providing technical support for further selective breeding and optimization of fiber performance.

Description

Silk improved by spider silk protein gene and method for improving silk by spider silk protein gene

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the Chinese patent application No. 202410524916.0, filed on April 28, 2024, and entitled "Silk improved by spider silk protein gene and method for improving silk by spider silk protein gene", the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present application relates to the field of biotechnology, in particular to a silk improved by spider silk protein gene and a method for improving silk by spider silk protein gene. BACKGROUND

[0004] Spider silk is a kind of protein fiber secreted by the silk gland of spiders, which is used by spiders to build spider webs or nests, capture and package prey, and make egg cases. Spiders in the new spider suborder can generally secrete more than 6 types of spider silk, each with different functions: Major ampullate silk (MaSp) serves as the framework and "rebar structure" of the spider web, with super strength. Minor ampullate silk (MiSp) serves as a scaffold for spiders to rest on the spider web, balancing strength and ductility. Flagelliform silk (Flag) is used to capture prey by adhesive proteins glue, which can provide very high ductility and will not easily break when stretched several times its length. Attenuated spidroin (AcSp) is used to wrap captured prey, providing high toughness. Tubuliform silk (TuSp) is the silk thread used by spiders to wrap egg capsules, which has high hardness and certain waterproof properties. Finally, at the base of the ampullate silk attached to the environment, or at the junction of the major ampullate silk thread, there is a piriform silk (PySp) that is used as an adhesive between spider silks in nature, with high toughness and high elasticity.

[0005] Different spider silk proteins have excellent properties, for example, the most studied major ampullate spidroin (MaSp) in the field of spider silk can reach 1.6 GPa in strength and 354 MJ / m-3 in toughness, which is 7 times that of Kevlar 49 fiber, and can be applied to high-tensile force scenarios such as outdoor equipment, body armor, parachutes, etc. The rest of the spider silk is also concerned because of its excellent ductility, toughness, elasticity and other properties. However, because spiders are carnivorous and cannibalistic, it is very difficult to carry out large-scale breeding. And different spider silk is produced on the spider web at the same time and the yield is different, it is difficult to separate different types of spider silk fibers, which greatly affects the production capacity of spider silk fibers. In the past 20 years, people have used genetic engineering technology to produce recombinant spider silk proteins using Escherichia coli, Saccharomyces cerevisiae and other microbial bottom cells, and these proteins can also be used to spin silk. But microorganisms are difficult to express more than 60KDa of protein due to their own expression system limitations, while the size of natural spider silk protein is generally more than 300KDa. Among natural silk proteins, a basic common sense is that the larger the protein, the more repetitive regions, the better the physical properties. Therefore, these recombinant expression produced "mini spider silk" cannot achieve similar performance to natural silk thread, and it is also difficult to scale up production.

[0006] The domestic silkworm (Bombyx mori) is a native silkworm in China that has been domesticated for tens of thousands of years, and is a biological organism with a mature textile industry system and the ability to carry out large-scale silk production. Using gene editing technology, the domestic silkworm can be used as an excellent chassis for producing recombinant spider silk proteins. For example, the prior art has used the piggyBac transposase system to express part of the repetitive sequences of major ampullate spidroin (MaSp), grapevine spidroin (AcSp) and pyriform silk (PySp) in the domestic silkworm and achieved improved fiber performance. However, this expression method expresses only mini spider silk proteins or partial spider silk proteins that are less than 100kDa, and the final produced silk thread is in a state of spider silk-silk blending, with an average spider silk content of less than 10%. The transposase system randomly inserts spider silk sequences into the genome, which makes this gene editing trait at risk of loss.

[0007] Compared with the instability of transposase, gene editing tools represented by TALEN and CRISPR-cas9 can accurately edit the genome of the silkworm, thereby producing stable traits. The silk protein includes a heavy chain (~ 390 kDa), a light chain (~ 26 kDa) and a glycoprotein P25, wherein the heavy chain and the light chain exist in a ratio of 1:1. However, since the light chain is very short, its fusion with the longer complete spider silk may affect the structure of the silk, so the existing gene editing technology for silk-spider silk fusion is completed on the heavy chain of the silk, for example, there is a report that using CRISPR-cas9 gene editing technology, a smaller MiSp complete sequence (5.3 kb, about 170 Kda) derived from the large abdomen garden spider is inserted into the heavy chain sequence to obtain a high-toughness spider silk material. However, there is still a lack of related technology for fusion of silk light chain and spider silk protein.

[0008] In addition, in the current research on expression of recombinant spider silk by gene editing transgenic silkworm, the research mainly focuses on the large vase gland silk (MaSp) and the small vase gland silk (MiSp), and lacks research on complete expression of the pear-shaped silk (PySp). The pear-shaped silk was first regarded as a kind of sericin-like protein, and in recent years, it has been shown that the recombinant pear-shaped silk can be made into a silk thread, and has higher ductility (can be stretched by 70%-200%) and higher toughness than other types of spider silk. If complete pear-shaped silk protein can be produced and made into a silk thread, super mechanical properties will be obtained. SUMMARY

[0009] The purpose of the present application is to provide an improved silk with spider silk protein fused and expressed on the light chain of the silk protein. The present application is implemented by using the following technical solutions:

[0010] An improved silk with spider silk protein, comprising a light chain of silk protein, wherein the light chain of silk protein is connected with spider silk protein fused and expressed to form a spider silk protein.

[0011] The amino acid sequence of the spider silk protein comprises a repeat region sequence having at least one spider silk protein repeat unit sequence.

[0012] Optionally, the amino acid sequence of the spider silk protein comprises, in sequence, a spider silk protein N-terminal sequence, a repeat region sequence having at least one spider silk protein repeat unit sequence, and a spider silk protein C-terminal sequence.

[0013] Optionally, the spider silk protein is a Nephila clavipes pear-shaped gland silk protein.

[0014] The spider silk protein N-terminal sequence is the amino acid sequence shown in SEQ ID NO. 1, or an amino acid sequence having at least 90% similarity with SEQ ID NO. 1.

[0015] The spider silk protein repeat unit sequence is the amino acid sequence shown in SEQ ID NO. 2, or an amino acid sequence with at least 90% similarity to SEQ ID NO. 2.

[0016] The spider silk protein C-terminal sequence is the amino acid sequence shown in SEQ ID NO. 3, or an amino acid sequence with at least 90% similarity to SEQ ID NO. 3.

[0017] Optionally, the repeat region sequence is connected to the N-terminal sequence of the spider silk protein through an N-terminal linker sequence; the N-terminal linker sequence is the amino acid sequence shown in SEQ ID NO. 4, or an amino acid sequence with at least 90% similarity to SEQ ID NO. 4.

[0018] The repeat region sequence is connected to the C-terminal sequence of the spider silk protein through a C-terminal linker sequence; the C-terminal linker sequence is the amino acid sequence shown in SEQ ID NO. 5, or an amino acid sequence with at least 90% similarity to SEQ ID NO. 5.

[0019] Optionally, the amino acid sequence of the spider silk protein is the amino acid sequence shown in at least one of SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, or a sequence with at least 90% similarity to at least one of SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8.

[0020] Optionally, the nucleic acid sequence of the spider silk protein gene is the amino acid sequence shown in at least one of SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11, or a sequence with at least 90% similarity to at least one of SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11.

[0021] A method for improving silk using a spider silk protein gene, comprising the following steps:

[0022] Step 1) constructing a Donor DNA vector for making silkworm express a silk protein light chain-spider silk protein fusion gene on a vector with a silk protein light chain gene homologous arm; wherein the amino acid sequence of the spider silk protein comprises a repeat region sequence with at least one spider silk protein repeat unit sequence;

[0023] Step 2) introducing the Donor DNA vector into silkworm eggs, and editing the gene encoding the silk protein light chain in the genome of the silkworm eggs into a silk protein light chain-spider silk protein fusion gene through gene editing technology.

[0024] Step three) hatching, screening and culturing the silkworm eggs after gene editing, to obtain the silkworm silk improved by the spider silk protein gene.

[0025] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is selected as a nucleotide sequence containing all exons of the silk protein light chain.

[0026] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence from which at least one intron is removed.

[0027] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence from which all introns are removed.

[0028] The nucleotide sequence of the Donor DNA vector in step one) comprises, in order, a light chain L1 N-terminal sequence, a light chain exon fusion sequence, a spider silk protein gene sequence, a silk light chain terminator, and a light chain C-terminal homologous arm.

[0029] The light chain L1 N-terminal sequence is shown in SEQ ID NO. 12; the light chain exon fusion sequence is shown in SEQ ID NO. 13; the silk light chain terminator sequence is shown in SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is shown in SEQ ID NO. 15.

[0030] Optionally, in step two), the gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using a first target site sequence and a second target site sequence.

[0031] The first target site sequence is GTAACCACATAACATCAGGT, and the second target site sequence is TTAGAACTCACATCTCAAGG.

[0032] Optionally, the nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a complete silk protein light chain sequence containing all exons and introns.

[0033] Optionally, the nucleotide sequence of the Donor DNA vector in step one) comprises, in order, an L2 signal peptide and light chain N-terminal sequence, a spider silk protein gene sequence, a silk light chain 3'UTR sequence, a silk light chain terminator, and a light chain C-terminal homologous arm sequence.

[0034] The L2 signal peptide and light chain N-terminal sequence comprises silk protein light chain exon 6, silk protein light chain intron 6, and silk protein light chain exon 7.

[0035] The L2 signal peptide and the N-terminal sequence of the light chain are shown in SEQ ID NO. 16; the silk light chain 3'UTR sequence is shown in SEQ ID NO. 17; the silk light chain terminator sequence is shown in SEQ ID NO. 14; and the C-terminal homologous arm sequence of the light chain is shown in SEQ ID NO. 15.

[0036] Optionally, the gene encoding the silk protein light chain in the genome of the silkworm egg is cleaved and edited using the first target site sequence and the second target site sequence in step ii);

[0037] The first target site sequence and the second target site sequence are the same, both being TTAGAACTCACATCTCAAGG.

[0038] Optionally, the CRISPR-cas9 system is used for gene editing in step ii), and the gene editing is performed by injecting a Donor DNA vector, a ptarget plasmid containing the first target site sequence and the second target site sequence, and a pCas9 plasmid for expressing cas9 into the silkworm egg;

[0039] Optionally, the nucleotide sequence of the Donor DNA vector further has a selection sequence between the silk light chain terminator and the C-terminal homologous arm sequence of the light chain; and the selection sequence comprises a nucleic acid sequence encoding a fluorescent protein.

[0040] Optionally, in step iii), the silkworm eggs are hatched to obtain G0 generation silkworm eggs; the G0 generation silkworm eggs are bred, self-crossed, and the silkworm eggs are collected to obtain G1 generation silkworm eggs; the end points of the silkworm eggs are observed under a fluorescence microscope, and the eggs emitting fluorescence are cultured; the selected silkworms are bred to the third instar stage, the heads of the silkworms are observed under a fluorescence microscope, and it is detected whether the silkworms emit fluorescence; the G1 generation silkworm eggs that are detected positive are cultured into adult silkworms, and self-crossed, and the silkworm eggs are collected to obtain G2 generation silkworm eggs; the G2 generation silkworms are cultured into adult silkworms, and the positive marker silkworms are selected for self-crossing, and the homozygous G3 generation silkworms are selected, and the silkworm silk improved by the spider silk protein gene is obtained by using the G3 generation silkworms.

[0041] Compared with the prior art, the present application has the following advantages and effects:

[0042] The present application realizes the expression of the Nephila clavata ampullate gland silk in the Bombyx mori silk fibroin, realizes the formation of complete spider silk protein on the silk light chain, and expands the site of gene editing of the Bombyx mori silk gland. This light chain edited silkworm can be crossed with a gene edited silkworm of the heavy chain to provide technical support for further breeding and optimizing the fiber performance.

[0043] The application can produce fibers with complete spider piriform gland silk structure. By testing different length sequences, it is verified that full-length spider silk insertion can improve the performance of silk. The application obtains the fiber woven by the fusion protein of Bombyx mori light chain No. 7 exon and Nephila clavipes piriform gland silk, and the mechanical properties of the fiber are significantly improved compared with the control spider silk: the strength of the final fiber can reach 773.10 MPa, which is 2.16 times that of the control, the elongation of the fiber can reach 28.17%, which is 1.59 times that of the control, and the toughness can reach 3.36 times that of the control silk. These performance data are very close to the performance of natural spider silk, greatly improving the performance and application range of gene edited silk. The application innovatively fuses the exons of the light chain together, and fuses Nephila clavipes piriform gland silk, and the mechanical properties of the fiber are significantly improved compared with the control spider silk: the strength of the final fiber can reach 525.60 MPa, which is 1.47 times that of the control, the elongation of the fiber can reach 30.78%, which is 1.73 times that of the control, and the toughness can reach 2.59 times that of the control silk. These performance data show that the fusion expression replacement method can also achieve a substantial improvement in the performance of silk. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1 is a schematic diagram of the fusion of silk light chain protein and spider silk protein; Figure 1A is a diagram of the overall design strategy of the fusion protein; Figure 1B is a diagram of the structure of silk protein, and Figure 1C is a diagram of the structure of the fusion expressed protein.

[0045] Figure 2 is a detection diagram of the genome of the gene edited silkworm moth of Example 1;

[0046] Figure 3 is a stress-strain curve diagram of the gene edited silkworm cocoon of Example 2;

[0047] Figure 4 is a fluorescence observation diagram of the cocoon of Example 2; Figure 4a is an observation photo of the control silk, Figure 4b is an observation photo of the FibL1-DsRed gene edited silk, Figure 4c is an observation photo of the control silk under excitation light, Figure 4d is an observation photo of the FibL1-DsRed gene edited silk under excitation light, Figure 4e is an enlarged observation photo of the cross section of the FibL1-DsRed gene edited silk, and Figure 4f is an enlarged observation photo of the cross section of the FibL1-DsRed gene edited silk under excitation light.

[0048] Figure 5 is a detection diagram of the genome of the gene edited silkworm moth of Example 3;

[0049] Figure 6 is a stress-strain curve diagram of the gene edited silkworm cocoon of Example 3;

[0050] Figure 7 is a comparison diagram of silkworm pupae and silkworm cocoons; Figure 7A is a comparison diagram of silkworm pupae, Figure 7B is a comparison diagram of silkworm cocoons, Figure 7C is a comparison diagram of the weight of silkworm cocoons, and Figure 7D is a comparison diagram of the diameter of silkworm silk. DETAILED DESCRIPTION

[0051] In order to make the purpose, technical scheme of the present application more clear, the present application is further described in detail. The experimental methods described in the following examples are all conventional methods, unless otherwise specified. The specific techniques or conditions not specified in the examples are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents and materials described are commercially available, unless otherwise specified.

[0052] The present application provides a spider silk protein gene modified silk, which comprises a silk protein light chain, and a spider silk protein fused and expressed on the silk protein light chain.

[0053] The amino acid sequence of the spider silk protein comprises a repeat region sequence having at least one spider silk protein repeat unit sequence.

[0054] Further, the amino acid sequence of the spider silk protein comprises a spider silk protein N-terminal sequence, a repeat region sequence having at least one spider silk protein repeat unit sequence, and a spider silk protein C-terminal sequence in sequence. That is, the spider silk protein is a complete spider silk protein comprising an N-terminal and a C-terminal.

[0055] The spider silk protein is specifically a Nephila clavata salivary gland silk protein.

[0056] The spider silk protein N-terminal sequence is shown in SEQ ID NO. 1. The spider silk protein repeat unit sequence is shown in SEQ ID NO. 2. The spider silk protein C-terminal sequence is shown in SEQ ID NO. 3. The repeat region sequence is connected to the spider silk protein N-terminal sequence through an N-terminal linker sequence. The N-terminal linker sequence is shown in SEQ ID NO. 4. The repeat region sequence is connected to the spider silk protein C-terminal sequence through a C-terminal linker sequence. The C-terminal linker sequence is shown in SEQ ID NO. 5.

[0057] The present application specifically provides amino acid sequences of the repeat region sequence having 3, 6, and 13 repeat units, respectively. The amino acid sequence of the Nephila clavata salivary gland silk protein having 3 repeat units is shown in SEQ ID NO. 6, and the corresponding nucleic acid sequence is shown in SEQ ID NO. 9. The amino acid sequence of the Nephila clavata salivary gland silk protein having 6 repeat units is shown in SEQ ID NO. 7, and the corresponding nucleic acid sequence is shown in SEQ ID NO. 10. The amino acid sequence of the Nephila clavata salivary gland silk protein having 13 repeat units is shown in SEQ ID NO. 8, and the corresponding nucleic acid sequence is shown in SEQ ID NO. 11.

[0058] According to the common knowledge in the art, the sequence of the amino acid repeat region of spider silk protein has certain variability, that is, as long as the similarity of the core sequence of spider silk is about 90%, similar performance of the sequence of spider silk can be obtained in most literatures and patents. We claim that the sequence and the sequence with similarity of more than 90% are protected by the present patent.

[0059] Figure 1 shows the design schematic of the fusion of silk light chain protein and spider silk protein. Figure 1A is a diagram of the overall design strategy of the fusion protein. The silk light chain protein has 7 exons, and the protein structure is shown in Figure 1B. The N-terminal, repeat region, and C-terminal of the spider silk protein are directly fused to the silk light chain. The predicted fusion structure is shown in Figure 1C. The predicted structure shows that the structure of the N-terminal of the silk light chain and the spider silk protein does not change, and the N-terminal leader peptide of the spider silk forms a natural linker to separate the two proteins, which have relatively independent structures, and the performance can be predicted to remain consistent.

[0060] The present application also proposes a method for improving silk using spider silk protein genes, comprising the following steps:

[0061] Step 1) Constructing a Donor DNA vector for expressing a silk light chain-spider silk protein fusion gene in silkworms on a vector with homologous arms of the silk light chain gene;

[0062] Two construction methods are proposed in the present application. One is to retain all exons and introns of the silk light chain gene, and the other is to modify the silk light chain gene by removing at least one intron. In order to be used for screening silkworms, there is a screening sequence for coding fluorescent protein between the silk light chain terminator and the C-terminal homologous arm sequence in the nucleotide sequence of the Donor DNA vector.

[0063] Step 2) The gene of the silkworm is cut using the CRISPR-cas9 system in the present application, and the linearized Donor DNA and the gene editing plasmid are mixed and injected into the eggs of the silkworm. The pCas plasmid used in the present application is from the literature DOI: 10.1038 / srep04489, and in fact any cas9 expression vector suitable for silkworms or lepidopteran insects can be used in this scenario. Since cutting requires targeting 2 target sites, in addition to the vector coding cas9, we also need to synthesize ptarget vector. In fact, as long as the cutting at the target DNA is completed, any gene editing method can achieve this function. For example, TALEN nuclease, or ZFN zinc finger enzyme, or other DNA cutting methods (cas12a, Ago, etc.) can achieve the breakage of the target DNA. Once the DNA breakage at the corresponding site is completed, the Donor DNA can replace the original sequence by homologous recombination to complete the gene editing.

[0064] Step three) hatching the eggs to obtain G0 generation of silkworm eggs; feeding the G0 generation of silkworm eggs, self-crossing, collecting the eggs to obtain G1 generation of silkworm eggs, observing the end point of the eggs under a fluorescence microscope, and culturing the eggs emitting fluorescence; feeding the hatched silkworms to the third instar stage, observing the head of the silkworm under a fluorescence microscope, and testing whether the silkworm emits fluorescence; culturing the G1 generation of silkworm eggs that are tested positive into adult silkworms, self-crossing, collecting the eggs to obtain G2 generation of silkworm eggs; culturing the G2 generation of silkworms into adult silkworms, and self-crossing the positive marker silkworms to obtain G3 generation of silkworms that are homozygous, and obtaining the silkworm silk improved by the spider silk protein gene by using the G3 generation of silkworms.

[0065] Example 1

[0066] In this embodiment, a specific scheme of the construction strategy of the fusion gene retaining all exons and introns of the silk light chain gene is given, and the operation steps are as follows:

[0067] By using PCR technology, the genomic DNA of Nephila pilipes is used as a template, and specific primers of the pyriform gland silk protein (Pysp) gene with a restriction endonuclease Bsmb I enzyme cutting site are used to amplify Pysp with different repeat units, including 3 repeat unit structures, 6 repeat unit structures, and 13 repeat unit structures. The above different repeat unit Pysp is cut and connected to a plasmid containing left and right homologous arms, a green fluorescent gene expression frame started by a 3xP3 promoter, partial Bombyx mori fibroin light chain protein (FibL) exon 6, FibL intron 6, and FibL exon 7, to construct a Donor DNA vector plasmid.

[0068] The Donor DNA is synthesized in the following order: MluI-L2 signal peptide and light chain N-terminal sequence-PySp spider silk sequence-silk light chain 3'UTR-silk light chain terminator-screening sequence-light chain C-terminal homologous arm-MluI. MluI represents an MluI site. The L2 signal peptide and light chain N-terminal sequence is shown in SEQ ID NO. 16; the silk light chain 3'UTR sequence is shown in SEQ ID NO. 17; the silk light chain terminator sequence is shown in SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is shown in SEQ ID NO. 15.

[0069] The screening sequence contains a 3xP3 promoter, a green fluorescent protein, and an SV40 terminator, which is used to screen whether the transgenic silkworm completes gene editing. The sequence is shown in SEQ ID NO. 18. If the sequence is successfully inserted after completing gene editing, the silkworm moth is placed under green fluorescent excitation light to observe, and obvious green fluorescence will be displayed at the eyes of the silkworm moth.

[0070] PySp spider silk nucleic acid sequences containing 3, 6, 13 repeat units are shown in SEQ ID NO. 9, SEQ ID NO 10, SEQ ID NO. 11, respectively. The above-mentioned Donor DNA sequence is synthesized by BGI.

[0071] The sequence synthesized on the ptarget plasmid is shown in SEQ ID NO. 19, which contains a BmU6 promoter sequence, a light chain L2 cleavage target site sequence, a gRNA scaffold sequence, and a polyT. Both target site sequences are TTAGAACTCACATCTCAAGG. The above-mentioned ptarget plasmid is synthesized by BGI.

[0072] Operation steps:

[0073] I. Preparation of microinjected DNA

[0074] 1. Synthesis of plasmids by the company: pCas9, ptarget1, ptarget2, Donor DNA

[0075] 2. Transformation: 5 μL of plasmid was transferred into 50 μL of DH5α competent cells (TransGen). After ice bath for 30 min, heat shock for 60 s, and ice rest for 5 min, 300 μL of antibiotic-free LB medium was added in a clean bench, tightly covered and cultured in a shaker for 1 h at 37°C and 200 rpm. Then 100 μL of culture medium was spread on an Amp-resistant LB plate and cultured overnight in a 37°C incubator.

[0076] 3. The next day, the plate was taken out and a single colony was picked into a 1.5 mL EP tube and cultured in a 37°C, 200 rpm shaker for 5-6 h.

[0077] 4. The above-mentioned bacterial solution was taken for PCR, and the PCR product was detected by agarose gel electrophoresis to determine the bacterial solution with the expected band, and the bacteria were expanded. An appropriate amount of 10 mL centrifuge tube was added with 4 mL of Amp-resistant LB liquid medium, and 20 μL of bacterial solution was inoculated into 10 mL centrifuge tube, respectively, and cultured in a 37°C, 200 rpm shaker for 16 h.

[0078] 5. Use endotoxin-free plasmid kit (TIANGEN) according to the instructions to extract plasmid, and the concentration is more than 700 ng / μL. (When mixing plasmids, the volume ratio of ptarget: Cas9: Donor DNA is 1:2:2)

[0079] II. Obtaining and preparing silkworm eggs

[0080] 1. Incubate Nistarli silkworm eggs, and carefully feed the ants after they come out. The temperature during the 1-2 instar stage is controlled at 26-27°C, and the humidity is 80%-90%; the temperature during the 3-4 instar stage is controlled at 25-26°C, and the humidity is 70%-75%; the temperature during the 5 instar stage is 23-24°C, and the humidity is about 70%. When the silkworms are put on the cocoon, they are placed on the cocoon frame, and they naturally spin silk and cocoon.

[0081] 2. On the fifth day, the cocoon shell can be cut open, and male and female silkworm pupae can be distinguished and placed separately until they emerge as moths.

[0082] 3. Brush the kraft paper with paste, and dry it.

[0083] 4. Place the moth circle on the kraft paper, and put the male and female moths into the moth circle to mate with each other for 4-6 hours in a bright environment at about 25°C. After separating the pairs, let the female moths lay eggs in a dark environment, and use the fresh silkworm eggs laid within 2-8 hours.

[0084] 5. Dip the kraft paper with fresh silkworm eggs in clean water to make it wet, and use tweezers to take out a single egg and arrange it on a glass slide. Arrange 6x12 or 6x13 eggs, and use tweezers to pick up the eggs without turning them over. If the adhesion is not enough, rub the kraft paper back and forth a few times while picking up the eggs. Arrange the eggs vertically according to their elliptical shape or in a "D" shape.

[0085] 6. Microinject the arranged silkworm eggs.

[0086] Four, selection and cultivation of G0 generation silkworms

[0087] 1. Put a wet and clean paper towel or cotton ball in the box to maintain humidity, and place it in the incubator to develop. Set the incubator conditions: 12 hours of light and 12 hours of darkness per day; temperature 26.5°C, humidity 80%.

[0088] 2. Check the silkworm egg status every day, and disinfect the silkworm eggs with 75% alcohol in a timely manner if there are signs of mold.

[0089] 3. Collect ants, and feed the hatched ants with leaves (choose the most tender and high-moisture mulberry leaves) in a timely manner, and also mark and record on the box.

[0090] 4. Carefully feed until cocooning on the cocoon frame, and allow them to mate and lay eggs after emerging as moths to obtain G1 generation.

[0091] Five, selection of G1 generation silkworms

[0092] The G0 generation of silkworm eggs were incubated at 25°C and 85% humidity, and the silkworms were fed to the adult stage to obtain the G1 generation. After the G1 generation of transgenic silkworms were hatched, the expression of the fluorescent protein marker gene was observed by fluorescence microscopy (Leica, LMD6, Germany) (or the silkworm eggs can also be observed), and the transgenic positive silkworms expressing the fluorescent protein marker gene were selected and fed to the adult stage. The transgenic silkworms were self-crossed and passed on to the G2 generation. The gene edited silkworms from the G2 generation were self-crossed and passed on, and the gene edited silkworms expressing the EGFP marker gene were selected by fluorescence microscopy during the egg stage, and the silkworms were fed to the adult stage and mated in the same area to make the Pysp gene homozygous, and then the G3 and G4 generations were obtained.

[0093] At the G3 generation, the silkworm moth genomic DNA was taken as a template, and the target gene Pysp and the flanking homologous arms were detected by PCR amplification. The amplified fragments were cloned and sequenced (as shown in FIG. 2). The results showed that Pysp had been successfully inserted into the genome of the silkworm.

[0094] Six, detection of the physical and chemical properties of the transgenic silkworm silk fiber

[0095] The silkworm silk samples of the Pysp gene homozygous silkworms of the above-mentioned 3 repeat regions, 6 repeat regions and 13 repeat regions were obtained, respectively, and were denoted as 3-FibL2-Pysp, 6-FibL2-Pysp and FibL2-Pysp, respectively.

[0096] Preparation of transgenic silkworm silk: After the stored and dried silkworm cocoons were degummed (0.02M sodium bicarbonate or sodium carbonate, bath ratio 2.5g:1L, in a 100°C boiling water bath for 5-10min), the transgenic silkworm silk was obtained by reeling (reeling machine).

[0097] Sample preparation method: A hollow square paper frame was made of A4 paper, and the inner frame was 2cm long and wide. Single fibers were fixed on the paper frame with a 1cN tension clamp, and were fixed with glue. After the upper and lower clamps fixed the paper frame, the crease of the paper was cut and stretched. The mechanical properties of the silk fiber were tested using a universal tensile testing machine (Instron 5967 / 3365, USA). The test environment temperature was 24°C, the relative humidity was 50%, the stretching distance was 20mm, the stretching speed was 20mm / min, and the tension was 0.5N. Each group of 150 parallel samples was tested, and at least 100 valid data were obtained to calculate the average value and standard deviation of the stress and strain after stretching.

[0098] The mechanical property measurement results of the gene edited silkworm silk are shown in FIG. 3. Compared with the wild type silkworm variety Nistari which was not introduced with any plasmid and helper plasmid for comparison, the mechanical properties were significantly improved.

[0099] Table 1: Mechanical property measurement results of the gene edited silkworm cocoon silk of Example 1

[0100] In summary, the results prove that the Pysp gene has been inserted into the chromosomes of the genome of the gene-edited silkworm and can be synthesized and secreted in the silk gland cells of the silkworm, and the protein can enter the cocoon along with the behavior of silk knot, this trait has been stably inherited and expressed, and the mechanical properties of the gene-edited silkworm silk have been significantly improved. The strength of the final fiber can reach 773.10 MPa, which is 2.16 times that of the control, the elongation of the fiber can reach 28.17%, which is 1.59 times that of the control, and the toughness can reach 3.36 times that of the control silk. These performance data have been very close to the performance of natural spider silk, and the performance of silk has been greatly improved.

[0101] Example 2:

[0102] In this embodiment, a specific scheme of a fusion gene construction strategy for removing the intron in the light chain of silk protein is proposed, and the operation steps are as follows:

[0103] First, the silk protein light chain exon light chain fusion gene is constructed and verified, including the following steps:

[0104] 1. According to the reported red fluorescent protein (DsRed2) sequence as shown in SEQ ID NO. 20, the gene is artificially synthesized and cloned into a plasmid containing left and right homologous arms, an expression frame of exons 1-7 of silk fibroin light chain (FibL), to construct pMD4-FibL1-DsRed.

[0105] Specifically, the Donor DNA is synthesized in the following order: MluI-light chain L1 N-terminal sequence-light chain exon 1-7 fusion sequence-red fluorescent protein sequence-silk light chain terminator-C-terminal homologous arm-MluI. MluI represents the MluI site. Among them, the light chain L1 N-terminal sequence is as shown in SEQ ID NO. 12; the light chain exon fusion sequence is as shown in SEQ ID NO. 13; the silk light chain terminator sequence is as shown in SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is as shown in SEQ ID NO. 15.

[0106] The ptarget plasmid includes a first ptarget site and a second ptarget site. The sequence synthesized on the first ptarget site is shown in SEQ ID NO. 21, including a BmU6 promoter sequence, a target site sequence for L1 cleavage of the light chain, a gRNA scaffold sequence, and a polyT, and the target site sequence is GTAACCACATAACATCAGGT. The sequence synthesized on the second ptarget site is shown in SEQ ID NO. 22, including a BmU6 promoter sequence, a target site sequence for L1 cleavage of the light chain, a gRNA scaffold sequence, and a polyT, and the target site sequence is TTAGAACTCACATCTCAAGG. The ptarget plasmid described above is synthesized by BGI.

[0107] 2. The Donor DNA plasmid, Cas9 plasmid, and ptarget plasmid are mixed at a molar ratio of 2:2:1 to prepare a microinjection solution with a final concentration of 200-350 ng / μL for the Donor DNA plasmid and Cas9 plasmid and a concentration of 100-150 ng / μL for the ptarget plasmid, and then the microinjection method is used to introduce the microinjection solution into newly laid eggs of the wild-type silkworm variety N4. The microinjected eggs are reared at 25°C and 85% humidity until the adult silkworms are obtained, which are then crossed with the wild-type silkworm to obtain the G1 generation.

[0108] 3. The G1 generation of gene-edited silkworm cocoon silk is selected, and the cocoon silk is observed by a stereomicroscope (Nikon, SMZ18, Japan), and the results show that, compared with the wild-type silkworm variety N4 used as a control and not introduced with any plasmid and auxiliary plasmid, red fluorescence is observed in the gene-edited cocoon silk. As shown in FIG. 4.

[0109] Based on the above results, it is proved that the DsRed2 gene has been inserted into the chromosome of the genome of the gene-edited silkworm and can be synthesized and secreted in the silk gland cells of the silkworm, and the protein can enter the cocoon along with the behavior of the silk knot. The trait has been stably inherited and expressed, and red fluorescence can be observed in the gene-edited silkworm silk. The results show that, in addition to adding the exogenous protein directly to the 7th exon of the original silkworm light chain, the entire light chain exon can also be used to replace the original silkworm light chain sequence. This method also enables the gene-edited silkworm to normally spit out silkworm silk and retain the activity of the exogenous protein in the fusion silk protein, thereby providing a new strategy for silkworm light chain gene editing.

[0110] Based on the above-described exon fusion sequence, the embodiment provides a fusion gene construction strategy for removing the intron in the silkworm silk protein light chain, and the specific process is as follows:

[0111] The full-length Pysp sequence is amplified by PCR technology using the genomic DNA of Nephila pilipes as a template and specific primers of the Pysp gene with an MluI enzyme cutting site. The Pysp sequence is connected to a plasmid containing left and right homologous arms, a 3xP3 promoter-driven green fluorescent gene expression frame, and FibL exon 1-7 of the silk fibroin light chain protein (FibL) to construct a gene editing plasmid PMD4-FibL1-Pysp.

[0112] The donor DNA is synthesized in the following order: MluI-light chain L1 N-terminal sequence-light chain CDS-PySp spider silk sequence-silk light chain terminator-screening sequence-C-terminal homologous arm-MluI. The light chain L1 N-terminal sequence is shown as SEQ ID NO. 12; the light chain exon fusion sequence is shown as SEQ ID NO. 13; the silk light chain terminator sequence is shown as SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is shown as SEQ ID NO. 15.

[0113] The screening sequence contains a 3xP3 promoter, a green fluorescent protein, and an SV40 terminator, which is used to screen whether the transgenic silkworm has completed gene editing. If the sequence is successfully inserted, the silkworm moth is placed under green fluorescent excitation light, and obvious green fluorescence will be displayed at the eyes of the silkworm moth. The sequence is shown as SEQ ID NO. 18.

[0114] The PySp spider silk nucleic acid sequence containing 13 repeat units is shown as SEQ ID NO. 11. The donor DNA sequence is synthesized by BGI.

[0115] The ptarget plasmid includes a first ptarget site and a second ptarget site. The sequence synthesized on the first ptarget site is shown as SEQ ID NO. 21, containing a BmU6 promoter sequence, a target site sequence for light chain L1 cleavage, a gRNA scaffold sequence, and a polyT, and the target site sequence is GTAACCACATAACATCAGGT. The sequence synthesized on the second ptarget site is shown as SEQ ID NO. 22, containing a BmU6 promoter sequence, a target site sequence for light chain L1 cleavage, a gRNA scaffold sequence, and a polyT, and the target site sequence is TTAGAACTCACATCTCAAGG. The ptarget plasmid is synthesized by BGI.

[0116] The transgenic silkworm is bred according to the above method.

[0117] At G3 generation, the silkworm moth genomic DNA was taken as a template, PCR amplification was used to detect the target gene Pysp and the flanking homologous arms, the amplified fragments were cloned and sequenced, as shown in Figure 5, the results showed that Pysp had been successfully inserted into the genome of the domestic silkworm.

[0118] The gene edited silkworm silk FibL1-Pysp was obtained, and the mechanical property determination results are shown in Figure 6 and Table 2. Compared with the wild type silkworm variety Nistari which did not introduce any plasmid and helper plasmid for control, the mechanical properties were significantly improved. The strength of the final fiber can reach 525.60 MPa, which is 1.47 times that of the control, the elongation of the fiber can reach 30.78%, which is 1.73 times that of the control, and the toughness can reach 2.59 times that of the control. These performance data show that the fusion expression replacement method can also greatly improve the performance of silkworm silk.

[0119] Table 2 Mechanical property determination results of gene edited silkworm cocoon silk in Example 2

[0120] The above results prove that the Pysp gene has been inserted into the chromosome of the genome of the gene edited silkworm, and can be synthesized and secreted in the silk gland cells of the domestic silkworm. The protein can enter the cocoon along with the behavior of silk knot, and this trait has been stably inherited and expressed. The mechanical properties of the gene edited silkworm silk have been significantly improved.

[0121] Two silkworm pupae and cocoon samples in Example 1 and Example 2 were taken respectively for observation, as shown in Figure 7, wherein WT represents the control group without transgenic treatment, and the appearance of the silkworm pupae and cocoon has no obvious change compared with the transgenic ones, indicating that the silkworm silk improved by the spider silk gene in the present application has no obvious change in appearance, and the mechanical properties are greatly improved.

[0122] In addition, it should be noted that the above is only the preferred embodiment of the present application, and is not limited to the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacements to part of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A silk modified with a spider silk protein gene, characterized by, The improved silk using the spider silk protein gene comprises a silk protein light chain, and a spider silk protein fused and expressed with the silk protein light chain; The amino acid sequence of the spider silk protein comprises a repeat region sequence having at least one spider silk protein repeat unit sequence.

2. The silk improved with a spider silk protein gene according to claim 1, characterized in that, The amino acid sequence of the spider silk protein comprises, in sequence, a spider silk protein N-terminal sequence, a repeat region sequence having at least one spider silk protein repeat unit sequence, and a spider silk protein C-terminal sequence.

3. The silk improved with a spider silk protein gene according to claim 2, characterized in that, The spider silk protein is a Nephila clavipes ampullate gland silk protein; The spider silk protein N-terminal sequence is the amino acid sequence shown in SEQ ID NO. 1, or an amino acid sequence having at least 90% similarity with SEQ ID NO. 1; The spider silk protein repeat unit sequence is the amino acid sequence shown in SEQ ID NO. 2, or an amino acid sequence having at least 90% similarity with SEQ ID NO. 2; The spider silk protein C-terminal sequence is the amino acid sequence shown in SEQ ID NO. 3, or an amino acid sequence having at least 90% similarity with SEQ ID NO.

3.

4. The silk improved with a spider silk protein gene according to claim 3, characterized by, The repeat region sequence is connected to the spider silk protein N-terminal sequence through an N-terminal linker sequence; the N-terminal linker sequence is the amino acid sequence shown in SEQ ID NO. 4, or an amino acid sequence having at least 90% similarity with SEQ ID NO. 4; The repeat region sequence is connected to the spider silk protein C-terminal sequence through a C-terminal linker sequence; the C-terminal linker sequence is the amino acid sequence shown in SEQ ID NO. 5, or an amino acid sequence having at least 90% similarity with SEQ ID NO.

5.

5. The silkworm silk improved with a spider silk protein gene according to claim 1, characterized by, The amino acid sequence of the spider silk protein is the amino acid sequence shown in at least one of SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, or a sequence having at least 90% similarity with at least one of SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO.

8.

6. The silkworm silk improved with a spider silk protein gene according to claim 1, characterized by, The nucleic acid sequence of the spider silk protein gene is the amino acid sequence shown in at least one of SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11, or a sequence having at least 90% similarity with at least one of SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO.

11.

7. A method for improving silk by using a spider silk protein gene, characterized by, The method comprises the following steps: Step 1): constructing a Donor DNA vector for enabling a silkworm to express a silk protein light chain-spider silk protein fusion gene on a vector with a silk protein light chain gene homologous arm; wherein the amino acid sequence of the spider silk protein comprises a repeat region sequence having at least one spider silk protein repeat unit sequence; Step 2): introducing the Donor DNA vector into a silkworm egg, and editing a gene encoding a silk protein light chain in the genome of the silkworm egg into a silk protein light chain-spider silk protein fusion gene through a gene editing technology; Step three) after the silkworm eggs after gene editing are hatched, screened, and cultivated, the silkworm silk improved by the spider silk protein gene is obtained.

8. The method for improving silk using a spider silk protein gene according to claim 7, characterized by, The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is selected as a nucleotide sequence containing all exons of the silk protein light chain.

9. The method for improving silk using a spider silk protein gene according to claim 8, characterized in that, The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence from which at least one intron is removed.

10. The method for improving silk using a spider silk protein gene according to claim 9, characterized in that, The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a silk protein light chain sequence from which all introns are removed. The nucleotide sequence of the Donor DNA vector in step one) comprises, in sequence, a light chain L1 N-terminal sequence, a light chain exon fusion sequence, a spider silk protein gene sequence, a silk light chain terminator, and a light chain C-terminal homologous arm. The light chain L1 N-terminal sequence is shown in SEQ ID NO. 12; the light chain exon fusion sequence is shown in SEQ ID NO. 13; the silk light chain terminator sequence is shown in SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is shown in SEQ ID NO.

15.

11. The method for improving silk using a spider silk protein gene according to claim 9, characterized in that, The gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using a first target site sequence and a second target site sequence in step two). The first target site sequence is GTAACCACATAACATCAGGT, and the second target site sequence is TTAGAACTCACATCTCAAGG.

12. The method for improving silk using a spider silk protein gene according to claim 8, characterized in that, The nucleotide sequence expressing the silk protein light chain in the silk protein light chain-spider silk protein fusion gene is a complete silk protein light chain sequence containing all exons and introns.

13. The method for improving silk using a spider silk protein gene according to claim 12, characterized in that, The nucleotide sequence of the Donor DNA vector in step one) comprises, in sequence, an L2 signal peptide and a light chain N-terminal sequence, a spider silk protein gene sequence, a silk light chain 3' UTR sequence, a silk light chain terminator, and a light chain C-terminal homologous arm sequence. The L2 signal peptide and the light chain N-terminal sequence comprise a silk protein light chain exon 6, a silk protein light chain intron 6, and a silk protein light chain exon 7. The L2 signal peptide and the light chain N-terminal sequence are shown in SEQ ID NO. 16; the silk light chain 3' UTR sequence is shown in SEQ ID NO. 17; the silk light chain terminator sequence is shown in SEQ ID NO. 14; and the light chain C-terminal homologous arm sequence is shown in SEQ ID NO.

15.

14. The method for improving silk using a spider silk protein gene according to claim 12, characterized in that, The gene encoding the silk protein light chain in the genome of the silkworm egg is cut and edited using a first target site sequence and a second target site sequence in step two). The first target site sequence and the second target site sequence are the same and are both TTAGAACTCACATCTCAAGG.

15. The method for improving silk using a spider silk protein gene according to claim 9 or 12, characterized in that, The nucleotide sequence of the Donor DNA vector further comprises a selection sequence between the silk light chain terminator and the light chain C-terminal homologous arm sequence; and the selection sequence comprises a nucleic acid sequence encoding a fluorescent protein.

16. The method for improving silk by using a spider silk protein gene according to claim 15, characterized in that, The silkworm eggs are hatched in step three) to obtain G0 generation silkworm eggs; the G0 generation silkworm eggs are bred, cultured into adult silkworms, and self-crossed to collect silkworm eggs to obtain G1 generation silkworm eggs, and the end points of the silkworm eggs are observed under a fluorescence microscope, and the eggs emitting fluorescence are cultured; the selected silkworms are bred to the third instar stage after hatching, the heads of the silkworms are observed under a fluorescence microscope, and whether the silkworms emit fluorescence is tested; the G1 generation silkworm eggs detected as positive are cultured into adult silkworms, and self-crossed to collect silkworm eggs to obtain G2 generation silkworm eggs; the G2 generation silkworms are cultured into adult silkworms, and the positive marker silkworms are selected for self-crossing to select G3 generation silkworms that are homozygous, and the G3 generation silkworms are used to obtain silkworm silk improved by using spider silk protein genes.

Images