Site-directed editing of RNA

Abstract

The present disclosure, in some aspects, relates to antisense oligonucleotides (ASO) for use in the prevention or treatment of a disease or a condition associated with low- density lipoprotein (LDL) in a subject. In some embodiments, the ASO effects site-directed adenosine-to-inosine (A-to-l) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that: a) the modified LDLR protein has: (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; (iv) increased LDLR protein expression; and / or (v) increased activity or function to take up LDL; and / or b) editing of the 3'-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression and / or stability.

Description

SITE-DIRECTED EDITING OF RNA RELATED APPLICATIONS

[0001] This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Application No.63 / 720,929, filed November 15, 2024, entitled “SITE-DIRECTED EDITING OF RNA,” and to U.S. Provisional Application No.63 / 744,457, filed January 13, 2025, entitled “SITE-DIRECTED EDITING OF RNA,” and claims the benefit under 35 U.S.C. §119(a) to International Patent Application No. PCT / EP2024 / 061940, filed April 30, 2024, entitled “SITE-DIRECTED EDITING OF RNA,” the contents of each of which are incorporated herein by reference in their entirety. REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (A146270000WO00-SEQ-ZJG.xml; Size 601,654 bytes; and Date of Creation: April 29, 2025) is herein incorporated by reference in its entirety. TECHNICAL FIELD

[0003] The present disclosure relates to the field of medicine, in particular to the field of site-directed RNA or DNA editing. The disclosure relates to antisense oligonucleotides (ASOs) for use in the prevention or treatment of a condition associated with low-density lipoprotein (LDL) involving low-density lipoprotein receptor (LDLR). BACKGROUND

[0004] The global burden of dyslipidaemias, particularly elevated plasma LDL-cholesterol (LDL-C) levels, has increased over the recent years. Dyslipidaemia refers to the elevation of plasma cholesterol, triglycerides (TGs), or both, or a low high-density lipoprotein cholesterol (HDL-C) level and presents a major risk factor for coronary atherosclerosis and cardiovascular diseases (CVD). Elevated plasma LDL-C levels are a major causal factor for ischaemic heart disease and ischaemic stroke in both the developed and the developing world. Both primary (genetic) and secondary (lifestyle) causes contribute to dyslipidaemias in varying degrees. Dyslipidaemia is generally associated with the accumulation of LDL- cholesterol (LDL-C) in the blood, whereby LDL-C specifically refers to the amount of cholesterol estimated to be contained within LDL particles. Among the different forms of dyslipidaemia, hypercholesterolaemia is the most prevalent form.

[0005] The classical genetic disorder is familial hypercholesterolemia (FH). FH was the first monogenic disorder shown to cause elevated plasma cholesterol levels due to mutations in the LDL-receptor (LDLR) gene. LDLR normally clears LDL from the plasma (Nabel, 2003). However, FH is characterized by reduced hepatic LDL clearance, elevated plasma cholesterol levels, and accelerated cardiovascular disease (CVD) (Sorrentino et al., 2013). The primary defect in FH is a deficit of LDLRs, and more than 600 mutations in the LDLR gene have been identified in patients with this disorder (Nabel, 2003; Raal et al., 2020). The different variants in the LDLR gene account for more than 90% of cases of familial hypercholesterolemia (FH). Other diseases associated with hypercholesterolemia are, e.g., autosomal dominant hypercholesterolemia type 4 (STAP1) or type 5 (APOE), Phytosterolemia (ABCG5 / ABCG8), Wolman disease (LIPA) (Dron and Hegele, 2016).

[0006] Notably, some forms of dyslipidaemias, such as hypertriglyceridemia, are associated with severe diseases in other organ systems, including non-alcoholic fatty liver disease (NAFLD) and acute pancreatitis. NAFLD is a multisystem disorder that is defined clinicopathologically by the accumulation of lipids in >5% of hepatocytes and the exclusion of secondary causes of fat accumulation. NAFLD has a global prevalence of approximately 25%, strongly linked to obesity, diabetes, and systemic dyslipidaemia. NASH is characterized by marked hepatic steatosis, lobular inflammation and hepatocyte ballooning (Kannt et al.2021). NAFLD describes a spectrum of liver abnormalities ranging from fatty liver or simple steatosis to non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, which can progress to cirrhosis and hepatocellular carcinoma. No treatments for NAFLD currently exist and there are no specific therapeutic treatment options for NASH. SUMMARY

[0007] The present disclosure, in some aspects, relates to oligonucleotides (or antisense oligonucleotides, ASO) for A-to-I editing for use in the prevention or treatment of a disease or a condition associated with low-density lipoprotein (LDL) in a subject. The problem solved lies in the provision of a new therapy for treating dyslipidaemia and approaches for targeting LDLR, e.g., by providing ASOs for use in the prevention or treatment of a disease or condition associated with LDL-C in a subject. In some embodiments, methods described herein involves specific site-directed editing of a sequence derived from an endogenous LDLR gene, wherein the editing causes a mutation in the LDLR protein. To date, this approach has not been utilised in the prior art.

[0008] The present disclosure, in some aspects, provide compositions and methods for to precisely block LDLR:IDOL protein interaction to stabilize and / or increase LDLR protein cell surface expression and reduce circulating levels of LDL. Specifically, sites for generatingmore stable LDLR protein variants and targeted approaches to stabilize LDLR encoding RNA in order to increase LDLR synthesis and LDLR cell surface expression are described.

[0009] The solution to the problem addressed by the instant application is achieved by the embodiments described herein and defined by the appended claims. Accordingly, some aspects of the present disclosure provide antisense oligonucleotide (ASO) and methods for effecting site-directed editing of a target RNA or DNA sequence derived from or coding for an endogenous LDLR.

[0010] In some aspects, the disclosure provides an antisense oligonucleotide (ASO) for use in the prevention or treatment of a disease or a condition associated with low-density lipoprotein (LDL) in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0011] In some aspects, the present disclosure provides antisense oligonucleotides (ASOs) comprising a sequence having at least 80% complementarity to a target RNA sequence derived from a sequence of an endogenous LDLR gene, optionally wherein the gene encodes LDLR comprising SEQ ID NO: 1, wherein the ASO mediates A-to-I editing of a target adenosine in the target RNA such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; (iv) increased in LDLR protein expression; and / or (v) increased activity or function to take up LDL; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0012] In some aspects, expression construct comprising a polynucleotide sequence encoding human LDLR are provided, wherein the nucleotide sequence is at least 60%, at least 70%, at least 80%, at least 90, at least 95% or is 100% identical to SEQ ID NO: 1.

[0013] In some aspects, host cells comprising an oligonucleotide or an expression construct described herein are provided.

[0014] In some aspects, the present disclosure provide LDLR polypeptides comprising an amino acid sequence that is at least 80% identical to an amino acid sequence derived from any one of the LDLR isoforms of Table A, wherein the LDLR polypeptide derived from: a) LDLR-208 comprises substitution N819D, S820G, and / or K830E or K830R; b) LDLR-201 comprises substitution N905D, S906G, and / or K916E, or K916R; c) LDLR-202 comprises substitution N651D, S652G, and / or K662E, or K662R; d) LDLR-203 comprises substitution N778D, S779G, and / or K789E, or K789R; e) LDLR-204 comprises substitution N641D,S642G, and / or K652E, or K652R; f) LDLR-207 comprises substitution N819D, S820G, and / or K830E, or K830R; or g) LDLR-212 comprises substitution N779D, S780G, and / or K790E, or K790R; optionally wherein the polypeptide is able to mediate a reduction in LDL- C.

[0015] In some aspects, the present disclosure provides LDLR polypeptides comprising an amino acid sequence that is at least 80% identical to an amino acid sequence of murine LDLR (mLDLR) of Table B. In some embodiments, the ASOs provided herein can edit mLDLR to results in substitution N821D, S822G, and / or K832E or K832R. mLDLR and variants are listed in Table 25.

[0016] In other aspects, compositions comprising an ASO or an expression construct, or a polypeptide described herein are provided.

[0017] In other aspects, the present disclosure provides methods for mutating an endogenous LDLR allele in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition comprising one of the following selected from: (i) CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR- associated 9) components; (ii) adenine base editors (ABE); (iii) transcription-activator like effector nucleases (TALEN); or (iv) Zinc-finger nucleases (ZFNs); (v) an expression construct of the disclosure; (vi) an oligonucleotide of the disclosure; (vii) a composition of the disclosure; and wherein the method introduces a mutation within one or more of the following regions: (a) IDOL-binding region; and / or (b) 3’-UTR.

[0018] Methods for the treatment or prevention of a disease or condition associated with LDL in a subject are also provided, such methods comprising administering to said subject a therapeutic that targets and disrupts the LDLR gene or transcript within the IDOL-binding region or 3’-UTR.

[0019] Further provided herein are expression constructs for use in the treatment or prevention of a disorder or condition associated with LDL in a subject, wherein the expression construct targets and disrupts the LDLR gene or transcript within the IDOL- binding region or the 3’-UTR.

[0020] Also provided herein are ASOs or compositions described herein for use in the treatment or prevention of a disorder or condition associated with LDL in a subject.

[0021] The present disclosure, in some aspects, provide antisense oligonucleotides (ASOs) for site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence encoded by a sequence of a low-density lipoprotein receptor (LDLR) gene, wherein the ASO comprises a nucleobase sequence substantially complementary to the target RNA sequence, wherein the ASO comprises a central base triplet (CBT) of 3 nucleosides (5’ - N+1 N0 N-1 - 3’) with a central nucleoside (N0) that is directly opposite to the target adenosine to be edited when the ASO is hybridized to the target RNA sequence.

[0022] In some embodiments, the ASO is capable of recruiting an endogenous ADAR enzyme, and does not comprise a loop-hairpin structured ADAR recruitment motif. In some embodiments, the ASO is 20-200 nucleosides in length, optionally wherein the ASO is 20- 50 nucleosides in length. In some embodiments, the ASO is asymmetrical. In some embodiments, the region 5’ to the CBT is 15-40 nucleosides in length, and the region 3’ to the CBT is 3-20 nucleosides in length. In some embodiments, the ASO has an asymmetry of: a) 25-1-8; b) 23-1-12; or c) 29-1-15; wherein the numbers from left to right represent nucleosides from 5’ to 3’, and wherein the 1 represents the N0 nucleoside of the CBT.

[0023] In some embodiments, the ASO comprises one or more modified nucleosides and / or one or more modified internucleoside linkages. In some embodiments, the one or more modified nucleosides comprise 2’-modified nucleosides, optionally wherein the one or more modified nucleosides is selected from: a 2’-deoxyribonucleode, a 2’-O-methly (2’-O- Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O-methoxyethyl (2 ’-MOE) modified nucleoside, a 2′-fluoro-arabinonucleic Acid (2’-FANA) modified nucleoside, bridged nucleic acid (BNA), locked nucleic acid (LNA), constrained ethyl nucleosides (cET), and combinations thereof. In some embodiments, the one or more modified nucleosides comprises an iso-uridine (SbU) modification. In some embodiments, the SbU is at N0. In some embodiments, each of the three nucleosides of the CBT is selected from: (i) a deoxyribonucleotide (DNA); (ii) 2’-MOE modified nucleoside; (iii) 2’-F modified nucleoside, and (iv) 2’-O-Me modified nucleoside. In some embodiments, (i) N+1 is 2’-F modified nucleoside, DNA, or 2’-MOE modified nucleoside; and / or (ii) N0 is DNA, optionally wherein N0 is deoxycytidine or deoxy-isouridine (SbU); and / or (iii) N-1 is DNA, optionally wherein N-1 is deoxyinosine or deoxycytidine.

[0024] In some embodiments, one or more of the nucleosides in the CBT is a 2’-O-Me modified nucleoside. In some embodiments, none of the nucleosides in the CBT is a 2’-O- Me modified nucleoside.

[0025] In some embodiments, no more than 6 consecutive nucleosides of the ASO have the same 2’-modification. In some embodiments, the 2’-modification is a 2’-F modification or a 2’-O-Me modification. In some embodiments, the regions 3’ and 5’ to the CBT do not contain more than a total of 6 deoxyribonucleosides.

[0026] In some embodiments, the one or more modified internucleoside linkage is selected from phosphorothioate (PS), 3'-methylenephosphonate, 5'- methylenephosphonate, 3'-phosphoroamidate, 2'-5'phosphodiester, methanesulfonyl (mesyl) and phosphoryl guanidine (PN), and combinations thereof. In some embodiments, the ASO comprises at least one methanesulfonyl (mesyl) linkage and / or at least one PS linkage. In some embodiments, at least 15%, preferably at least 30%, of theinternucleoside linkages in the ASO are modified internucleoside linkages. In some embodiments, the ASO comprises 1-5 unmodified phosphodiester internucleoside linkages.

[0027] In some embodiments, the target adenosine and / or target RNA sequence is in a translated region (TR) or a 3’-untranslated region (3’-UTR) of LDLR RNA. In some embodiments, the target adenosine and / or target RNA sequence is in the 3’-UTR of LDLR RNA. In some embodiments, the target adenosine and / or target RNA sequence is within the proximal region of the 3’-UTR of LDLR RNA. In some embodiments, one or more adenylate uridylate rich elements (AREs) are located 3’ and / or 5’ of the target adenosine to be edited. In some embodiments, each of the one or more AREs comprises a core sequence of AUUUA. In some embodiments, wherein the target adenosine is located within ARE1. In some embodiments, the target adenosine corresponds to the adenosine at position 98, 100, 111, 113, 115, or 119 in the 3’UTR as set forth in SEQ ID NO: 38, or to the adenosine at position 189, 191, or 197 in the 3’UTR as set forth in SEQ ID NO: 228. In some embodiments, the A to I editing results in a nucleobase substitution that corresponds to A98I, A100I, A111I, A113I, A115I, or A119I in the 3’UTR as set forth in SEQ ID NO: 38, or to A189I, A191I or A197I in the 3’UTR as set forth in SEQ ID NO: 228. In some embodiments, the ASO comprises at least 15 consecutive nucleobases of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, the ASO comprises the nucleobase sequence of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, the ASO is conjugated to a GalNAc moiety (e.g., at the 5’ end or the 3’ end). In some embodiments, the ASO is selected from: AI-1916, AI-1917, AI-1918, AI-2288, AI- 2289, AI-2290, AI-3483, AI-3118, AI-3484, AI-3476, AI-3477, AI-3481, AI-3487, AI-4167, AI- 4168, AI-4169, AI-4170, AI-4171, AI-4172, AI-4173, AI-4174, AI-1940, AI-1941, AI-1942, AI- 2260, AI-2268, AI-3127, AI-3478, AI-3480, AI-3838, AI-3829, AI-3837, AI-3838, and AI- 5040. In some embodiments, A to I editing in the 3’-UTR of LDLR RNA prevents or reduces negative regulation of the LDLR RNA and / or increases stability of LDLR RNA. In some embodiments, the A to I editing increases LDLR protein expression.

[0028] In some embodiments, the target adenosine and / or target RNA sequence is in a region of LDLR RNA that encodes an inducible degrader of LDLR protein (IDOL)-binding region of LDLR protein. In some embodiments, the target adenosine is a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as set forth in SEQ ID NO: 2, or to N821, S822, or K832 in the LDLR protein as set forth in SEQ ID NO: 175. In some embodiments, the A-to-I editing of the target adenosine results in an amino acid substitution in the LDLR protein, wherein the amino acid substitutioncorresponds to N819D, S820G, K830E and K830R in the LDLR protein as set forth in SEQ ID NO: 2, or to N821D, S822G, K832E and K832R in the LDLR protein as set forth in SEQ ID NO: 175. In some embodiments, the ASO comprises at least 15 consecutive nucleobases of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, the ASO comprises the nucleobase sequence of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, the ASO is conjugated to a GalNAc moiety (e.g., at the 5’ end or the 3’ end). In some embodiments, the ASO is selected from: AI-1904, AI-1905, AI-1906, AI- 1907, AI-1908, AI-1909, AI-1910, AI-1911, AI-1912, AI-1913, AI-1914, AI-1915, AI-1928, AI- 1929, AI-1930, AI-1931, AI-1932, AI-1933, AI-1934, AI-1935, AI-1936, AI-1937, AI-1938, AI- 1939, AI-2261, AI-2269, AI-3145, AI-3445, AI-3444, AI-2267, AI-3447, AI-3448, AI-3449, AI- 3450, AI-3451, AI-3455, AI-3456, AI-3469, AI-3474, AI-3841, AI-3840, AI-3839, AI-3833, AI- 3836, AI-3835, AI-3834, AI-3139, AI-3463, and AI-3464. In some embodiments, amino acid substitution prevents or reduces (a) interaction of LDLR with IDOL when compared to wild- type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation.

[0029] Composition comprising the ASO described herein are provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0030] Some aspects of the present disclosure provide single guide RNAs (sgRNAs) for site-directed editing by a Cas9-based adenosine base editor of a target adenosine in a low- density lipoprotein receptor (LDLR) gene, wherein the LDLR gene comprises a sense strand and a reverse complementary strand, wherein the sgRNA is capable of hybridizing to a target sequence on the reverse complementary strand, wherein the target sequence hybridizes to a sequence on the strand where the target adenosine is located. In some embodiments, the target adenosine is in a coding region or a sequence in the LDLR gene that encodes a 3’-untranslated region (3’-UTR) of LDLR RNA. In some embodiments, the target adenosine corresponds to the adenosine at position 98, 100, 111, 113, 115, or 119 of the 3’UTR as set forth in SEQ ID NO: 37, or to the adenosine at positions 191 or 197 of the 3’UTR as set forth in SEQ ID NO: 108. In some embodiments, editing of the target adenosine prevents or reduces negative regulation of the LDLR RNA and / or increases stability of LDLR RNA. In some embodiments, the editing of the target adenosine increases LDLR protein expression. In some embodiments, the target adenosine is in a region of LDLR gene that encodes an inducible degrader of the LDLR protein (IDOL)-binding region of LDLR protein. In some embodiments, the target adenosine is in a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as setforth in SEQ ID NO: 2. In some embodiments, editing of the target adenosine results in an amino acid substitution that prevents or reduces (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation.

[0031] Compositions comprising any one of the sgRNAs described herein are provided. In some embodiments, the composition further comprises a Cas9-based adenosine base editor or a nucleic acid sequence encoding a Cas9-based adenosine base editor. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0032] Further provided herein are methods of mutating an endogenous nucleic acid encoding LDLR in a cell, the method comprising contacting the cell with the ASO or the composition described herein.

[0033] Methods of increasing LDLR expression and / or activity in a cell are provided, the method comprising contacting the cell with the ASO or the composition described herein.

[0034] In some embodiments, the cell is in vitro. In some embodiments, the cell is in vivo in a subject.

[0035] Methods of treating a disorder or condition associated with LDL in a subject, the method comprising administering to the subject the ASO or the composition described herein.

[0036] Further provided herein are the ASO or the composition described herein for use in a method of treating a disorder or condition associated with LDL in a subject, the method comprising administering the ASO or the composition to the subject. In some embodiments, the subject is human. In some embodiments, the administration is subcutaneous. In some embodiments, the disorder or condition associated with LDL in a subject is hypercholesterolemia, hypertriglyceridemia, non-alcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis or hepatocellular carcinoma.

[0037] The present disclosure further provides methods for mutating an endogenous nucleic acid encoding LDLR in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition comprising one of the following selected from: (i) CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR- associated 9) components; (ii) adenine base editors (ABE); (iii) transcription- activator like effector nucleases (TALEN); (iv) Zinc-finger nucleases (ZFNs); (v) an ASO described herein; (vii) a composition described herein; and wherein the method introduces a mutation within one or more of the following regions: (a) IDOL binding region; and / or (b) 3’-UTR.

[0038] In some embodiments, the LDLR allele is to be mutated such that : a) the LDLR protein has: (i) reduced binding to the inducible degrader of the LDLR protein (IDOL);(ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0039] In some embodiments, the method comprises introducing into the cell: (i) one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to the LDLR protein coding sequence and comprise a binding site for a CRISPR associate (Cas) protein; (ii) a Cas nucleic acid sequence or a variant thereof that encodes the Cas protein that targets but does not cleave the target nucleic acid sequence; and wherein the coding sequence is to be edited such that: a) the LDLR protein has: (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0040] In some embodiments, the method for mutating the endogenous LDLR allele comprises delivery of mRNA. In some embodiments, the method for mutating the endogenous LDLR allele comprises gene therapy. BRIEF DESCRIPTION OF DRAWINGS

[0041] The Figures shown in the following are merely illustrative and shall describe the present disclosure in a further way. The Figures shall not be construed to limit the present disclosure thereto.

[0042] FIGs.1A-1E present: FIG.1A: a schematic showing the dual expression pcDNA5 plasmid encoding hLDLR or hLDLR variants together with hIDOL. The hLDLR CDS was placed under the control of the CMV promoter and IDOL CDS was placed under the control of the EF1a promoter; FIG.1B: detection of LDLR variants K830E and K830R in the presence of IDOL by capillary-based Western Blot Analysis; FIG.1C: a graph showing fold change of surface expression of LDLR variants K830E and K830R in the presence of IDOL. FIG.1D: detection of LDLR variants N819D and S820G in the presence of IDOL by capillary- based Western Blot Analysis; FIG.1E: a graph showing fold change of expression of LDLR N819D and S820G in the presence of IDOL.

[0043] FIGs.2A-2D present graphs showing the editing efficacy (%) of hLDLR targeting oligonucleotides in human hepatocytes. FIG.2A: LDLR N819D site. FIG.2B: LDLR S820G site. FIG.2C: LDLR K830E site. FIG.2D: LDLR K830R site.

[0044] FIGs.3A-3C present: FIG.3A: the 3’UTR expression plasmid. Different LDLR 3’UTRs were fused to the C-terminal end of the renilla luciferase coding sequence in the psiCHECK2.0 vector additionally containing firefly luciferase as internal control; FIG.3B: a graph showing the fold change of normalized luciferase signal (renilla / firefly) of constructswith mutated LDLR 3’-UTR over the construct with wild-type LDLR 3’-UTR; FIG.3C: a graph showing the fold change of normalized luciferase signal (renilla / girefly) of construct with mutated LDLR 3’-UTR over the construct with the wild-type LDLR.

[0045] FIGs.4A-4D represents graphs showing the editing efficacy (%) of different oligonucleotides targeting the 3’-UTR of endogenous LDLR in human hepatocytes. FIG.4A: AI-1916 to AI-1918 targeting the A111 site. FIG.4B: AI-2288 targeting the A133 site. FIG. 4C: AI-2289 targeting the A115 site. FIG.4D: AI-2290 targeting the A119 site.

[0046] FIG.5 represents a graph showing the fold LDL uptake of LDLR variants in the presence of IDOL compared to wild-type LDLR.

[0047] FIG.6 depicts the results of a Clustal Omega sequence alignment of human ARE1 regions from different LDLR isoforms.

[0048] FIGs.7A-7B represent: FIG.7A: a bar graph showing the editing efficacy (%) of oligonucleotides targeting the murine A191 site in 3’UTR mLDLR in primary mouse hepatocytes in vitro; and FIG.7B: a bar graph showing the editing efficacy (%) of oligonucleotides targeting the murine A197 site in 3’UTR mLDLR in primary mouse hepatocytes in vitro.

[0049] FIGs.8A-8B represent: FIG.8A: a graph showing the editing efficacy (%)of oligonucleotides targeting hLDLR 3’-UTR sites A111, A113, A115 and A119 in human hepatocytes in vitro 48 hrs following oligonucleotide transfection; and FIG.8B: a graph showing the LDLR protein expression (pg / ml) as determined by ELISA assay.

[0050] FIGs.9A-9C represents graphs showing: FIG.9A: the study outline in C57BL / 6 mice; FIG.9B: fold change in LDLR expression in vivo; and FIG.9C: Western Blot Analysis of mLDLR expression.

[0051] FIGs.10A-10B represents graphs showing: FIG.10A: the study outline in C57BL / 6 mice; and FIG.10B: the change in non-HDL cholesterol in C57BL / 6 mice injected with the respective ASOs.

[0052] FIGs.11A-11D represents graphs showing: FIG.11A: the study outline in transgenic (Tg) mice with human APOB / CETP expression; FIG.11B: editing efficacy (%); FIG.11C: LDLR to total protein expression (ng / mg) in the liver as determined by ELISA; and FIG.11D: LDL-C levels (mg / dl) in the blood with an oligonucleotide targeting 3’-UTR site A197.

[0053] FIGs.12A-12B show graphs of: FIG.12A: the editing efficacy (%) of mLDLR targeting oligonucleotides in murine hepatocytes in vitro; and FIG.12B: the editing efficacy (%) of hLDLR targeting oligonucleotides in Huh7 cells in vitro.

[0054] FIG.13 shows a graph of the editing efficacy (%) of hLDLR targeting oligonucleotides in Huh7 cells in vitro.

[0055] FIGs.14A-14C show: FIG.14A: a graph of the editing efficacy (%) of hLDLR 3’- UTR targeting oligonucleotides in Huh7 cells in vitro; FIG.14B a graph of the editing efficacy (%) of hLDLR 3’-UTR targeting oligonucleotides in human hepatocytes in vitro; and FIG. 14C: a schematic of the conservation around the LDLR ARE1 region (adapted from: Adachi, S., et.al; Nucleic Acids Research, 2014).

[0056] FIGs.15A-15B show graphs of: FIG.15A: the editing efficacy (%) of mLDLR S822G targeting oligonucleotides with and without LNAs at the end in vitro; and FIG.15B: the editing efficacy (%) of mLDLR S822G targeting oligonucleotides with LNAs at the ends in vitro.

[0057] FIG.16 shows a graph of the editing efficacy (%) of mLDLR K832R targeting oligonucleotides with and without truncated 3’ ends in vitro.

[0058] FIGs.17A-17B show graphs of: FIG.17A: the editing efficacy (%) of mLDLR S822G targeting oligonucleotides in vitro; and FIG.17B: the editing efficacy (%) of mLDLR K832R targeting oligonucleotides in vitro.

[0059] FIGs.18A-18B show graphs of: FIG.18A: the editing efficacy (%) of mLDLR 3’- UTR A191 targeting oligonucleotides in vitro; and FIG.18B: the editing efficacy (%) of mLDLR 3’-UTR A197 targeting oligonucleotides in vitro.

[0060] FIGs.19A-19B show graphs of: FIG.19A: the editing efficacy (%) of mLDLR 3’- UTR A191 targeting oligonucleotides in vitro; and FIG.19B: the editing efficacy (%) of mLDLR 3’-UTR A197 targeting oligonucleotides in vitro.

[0061] FIGs.20A-20B show: FIG.20A: a schematic of sgRNA3; FIG.20B: the mean fluorescence intensity (MFI) of LDL uptake in hepa1-6 cells treated with adenine base editor ABE8e and sgRNA3 compared to control.

[0062] FIGs.21A-21C show graphs of: FIG.21A: the editing efficacy (%) of GalNAc conjugated ASO AI-5040 targeting mLDLR 3’-UTR A197 in vitro; FIG.21B: LDLR protein levels in the liver of mice treated with AI-5040; and FIG.21C: the level of non-HDL cholesterol in mice treated with AI-5040. DETAILED DESCRIPTION

[0063] LDLR, also known as FH, FHC, LDLCQ2, belongs to the Low density lipoprotein receptor gene family and is a mosaic protein of about 840 amino acids (after removal of signal peptide) that mediates the endocytosis of cholesterol-rich LDL (LDL-C). It is a cell- surface receptor that recognizes the apoprotein B100 (ApoB100), which is embedded in the phospholipid outer layer of LDL particles. The receptor also recognizes the ApoE protein found in chylomicron remnants and VLDL remnants (IDL). LDLR complexes are present in clathrin-coated pits on the cell surface, which when bound to LDL-cholesterol via adaptin, are pinched off to form clathrin-coated vesicles inside the cell. This allows LDL-cholesterol to be bound and endocytosed and prevents the LDL diffusing around the membrane surface. This process mainly occurs in the liver, which removes ~70% of LDL from the circulation. Synthesis of receptors in the cell is regulated by the level of free intracellular cholesterol. This means that if there is an excess in LDLR for the needs of the cell then the transcription of the receptor gene will be inhibited.

[0064] LDL internalization, degradation, and receptor recycling is a fundamental process underlying hypercholesterolemia. Cholesterol is a hydrophobic molecule which travels through the bloodstream on proteins called lipoproteins such as high-density lipoprotein (HDL) and low density lipoprotein (LDL). The cellular uptake of LDL-C requires LDLR and most LDL-C is cleared from circulation by LDLR expressed in the liver. Physiologically, LDL-C is recognized and bound by the LDLR and internalized via clathrin-mediated endocytosis, before it is transported into hepatocytes to initiate cholesterol clearance. Inside the endosome, LDL dissociates from LDLR. Whilst a majority of LDLR is recycled back to the plasma membrane, LDL remains in the maturing endosomal system, resulting in its degradation. At the same time, LDLR can join the path to degradation if it does not dissociate from LDL or if it is specifically targeted for degradation.

[0065] The LDLR pathway is a negative feedback system that plays important roles in the regulation of cholesterol homeostasis. The dysregulation of LDLR expression results in abnormal lipid accumulation. Sterol regulatory element binding proteins (SREBPs) are basic helix-loop-helix leucine zipper transcription factors that regulate transcription and synthesis of LDLR and cellular uptake of cholesterol. For cholesterol biosynthesis, SREBPs activate expression of genes encoding HMG-CoA reductase, while for cholesterol uptake, SREBPs activate expression of the LDLR (Blumenthal, 2000). Posttranscriptional regulation of LDLR expression is also crucial. Hence, LDLR may also be regulated by either proprotein convertase subtilisin / kexin type 9 (PCSK9) for degradation or inducible degrader of LDLR (IDOL) (Islam et al., 2022).

[0066] Specifically, PCSK9 is a negative regulator of LDLR and is primarily expressed in the liver, where it functions by preventing LDLR recycling to the cell surface. As a result, reduced LDL receptor expression reduces LDL clearance, leading to increased plasma LDL-C. Pharmaceutical approaches that specifically target PCSK9 include monoclonal antibodies, such as, e.g., alirocumab and evolocumab. Early clinical studies with PCSK9 targeting siRNA therapies show a robust reduction in LDL cholesterol level in genotypes of familial hypercholesterolemia and approximately 40% of patients attain LDL-C levels of <70 mg / dl (Raal et al., 2020). At the same time, a small-interfering RNA targeting PCSK9, inclisiran, has been shown to enhance LDL clearance (Srivastava, 2023). Although these PCSK9 interventions significantly lower LDL-C plasma levels and the risk of developing adverse cardiovascular events, they require frequent administration. Gennemark et al.(2021) described a chemically modified PCSK9 ASO with potential for oral delivery. A single subcutaneous dose of the ASO reduced PCSK9 by >90%. Similarly, it was shown that chemically modified ASOs, comprising locked nucleic acids, were able to silence PCSK9 and enhance LDLR expression in vivo (Gupta et al., 2010).

[0067] Another pathway of LDLR regulation was discovered by Zelcer et al. (2009), who demonstrated the degradation of LDLR by IDOL (inducible degrader of LDLR). An E3 ubiquitin ligase, IDOL was induced following activation of liver X receptors (LXRs) and subsequently interacted with the cytoplasmic tail of LDLR in mediating receptor ubiquitination and degradation. IDOL directly controls the LDLR protein and thus contributes to variation in circulating LDL-C levels (Sorrentino et al., 2013). IDOL is an LXR-regulated E3 ubiquitin ligase that functions as a post-transcriptional regulator of LDLR. IDOL controls LDLR stability independent of SREBP and PCSK9 by promoting ubiquitylation and degradation of the LDLR thereby limiting cellular LDL uptake. Expression of IDOL results in decreased LDLR abundance and reduced LDL uptake into cells (Sorrentino et al., 2012). Specifically, it has previously been shown that specific residues are involved in mediating protein-protein interaction between LDLR:IDOL. In fact, loss of function (LOF) mutations in IDOL have been associated with increased LDLR and lower circulating LDL levels (Sorrentino et al., 2013). Specifically, it was shown that the c.796C>T mutation leads to an IDOL variant that is unable to enhance ubiquitylation of the LDLR, which is required for targeting the receptor towards lysosomal degradation.

[0068] Pharmacologic management and treatment regimens of elevated or high levels of LDL-C generally follow guidelines and medical consensus, and depending on the target, may consist of a variety of different therapies. Cholesterol-lowering is the mainstream therapy for cardiovascular disease management (CVDM) and several cholesterol-lowering targets have translated to clinical arena. In addition to LDL lowering drugs, LDL apheresis has been used to reduce the levels of LDL-C. To date, marketed agents used to lower LDL include, for example, high-intensity statins to reduce high levels of LDL particles by inhibiting the enzyme HMG-CoA reductase involved in cholesterol synthesis. Other pharmaceuticals include cholesterol absorption inhibitors (e.g., ezetimibe), bile acid sequestrants, B vitamin (e.g., niacin), or lomitapide, a microsomal triglyceride transfer protein (MTP) inhibitor, reduces lipoprotein secretion and circulating concentrations of lipoprotein-borne lipids such as cholesterol and triglycerides (Srivastava, 2023). Alternatively, combination therapies comprising statins, ezetimibe, PCSK9 and MTP inhibitors and anti ANGPTL3 antibodies have been shown to normalize LDL-C in homozygous FH (Alnouri and Santos, 2022) and lower the risk of cardiovascular disease.

[0069] However, these therapies have undesirable side-effects. For instance, statins, which inhibit the HMG-CoA reductase (HMGCR) pathway, are associated withrhabdomyolysis, myopathy, and type II diabetes. Further, niacin, is associated with flushing and itching. Thus, novel compositions for the treatment of diseases and disorders associated with elevated and high LDL-C are needed that do not have these undesirable side effects. Newer treatment opportunities are emerging in the field of LDL therapy through gene-silencing approaches that specifically target genes involved in the LDL regulatory pathway. Both antisense oligonucleotide inhibition and small interfering RNA (siRNA) technology aim to degrade gene mRNA transcripts to reduce protein production and plasma lipoprotein levels. Mipomersen is a first-in-class antisense oligonucleotide (ASO) inhibitor targeted to human apolipoprotein B-100 (Apo B), the principal apolipoprotein of LDL.

[0070] Gene delivery has been demonstrated in preclinical models to stably correct several metabolic disorders, where the subject carries loss-of-function mutations in proteins that have an important role in LDL removal. The effectiveness of AAV- mediated gene therapy in correcting serum cholesterol levels in humanized mouse models of FH has been demonstrated (Kassim et al., 2010). EP3134431B1 teaches the expression of engineered human low density lipoprotein receptor (hLDLR) variants in subjects suffering from FH.

[0071] Alternatively, the emergence of genome-editing technologies has provided ways to rapidly and economically introduce sequence-specific modifications. Such DNA-editing technologies include, for example, the CRISPR–Cas nucleases that mediate gene editing or gene disruption (Jinek et al., 2012) and CRISPR base editors that mediate specific gene modification by point mutations (single base editing) (Gaudelli et al., 2017). Similarly, an improved base editing system was developed that recruits a DNA base-modifying enzyme through an RNA aptamer within the gRNA molecule to generate precise C-to-T mutations in the human genome (Collantes et al., 2021). Specifically, Musunuru et al. (2021) demonstrated that CRISPR gene editing can decrease blood levels of LDL cholesterol in vivo for months by 60% via knockout or loss-of-function (LOF) mutation of PCSK9 in the liver. Likewise, inactivating PCSK9 by adenine base editing in mouse liver and large animal model was shown to reduce blood LDL (Rothgangl et al., 2021). Clinical studies involving inactivating the PCSK9 gene using CRISPR technology have been shown to lower LDL-C levels in patients with atherosclerotic cardiovascular disease (ASCVD), and uncontrolled hypercholesterolemia (Verve Therapeutics; Phase 1 clinical trial, NCT05398029).

[0072] Generally, genomic variants that affect an organism are categorized into two basic types referred to as loss-of-function (LOF) mutations and gain-of-function (GOF) mutations. Sophisticated approaches have been developed over time for the downregulation of nucleic acid targets or LOF mutations. Such LOF mutations can be null or leaky mutations and are generally associated with a loss or reduction in protein function. Loss-of-function mutationsin the LDLR gene cause elevated levels of LDL cholesterol and premature cardiovascular disease. However, not many approaches have been developed or approved for upregulating specific targets or Gain-of-function (GOF) mutations in volved in regulating LDL. GOF mutations are generally associated with an increase in protein expression or enhancement in protein function or new functions.

[0073] Generally, LDLR mRNA is unstable. However, it can be stabilized upon extracellular signal regulated kinase (ERK) activation, possibly through the binding of certain proteins to the LDLR mRNA 3’-untranslated region (UTR) (Adachi et al., 2014). Interestingly, it was shown that ZFP36L1 and ZFP36L2 destabilize LDLR mRNA. Similarly, it has previously been reported that a deletion within the 3’-UTR of LDLR leads to a gain-of- function (GOF) in the LDLR and a reduction in LDL-C (Bjornsson et al., 2021). It was specifically shown that a large 2.5-kb deletion within the 3’-UTR resulted in an alternative, truncated mRNA isoform, which lead to a loss of target sites for microRNAs known to repress translation of LDLR transcripts. Hence, cells expressing the LDLR Del2.5 variant showed higher surface expression of LDLR and reduced LDL-C levels.

[0074] Using CRISPR editing technology, it was shown that excising a regulatory element in the LDLR gene directly influences the expression levels of LDLR surface expression. Data show that this approach elevates LDL cellular intake levels by threefold when compared to the combined knock-out of PCSK9 and administration of statins (Emendo Biotherapeutics).

[0075] While there are ways to lower LDL-C, there remains a high unmet need for novel and improved LDL lowering approaches.

[0076] Over the years, oligonucleotide therapeutics for RNA targeting have been developed to specifically silence, restore, or modify RNA derived from disease-associated genes and include therapeutics such as, for example, antisense oligonucleotides (ASOs), small interfering RNA (siRNA) and microRNA that interfere with coding and noncoding RNA. The relative ease and accuracy with which ASO sequences can be customized allows virtually any mutated gene to be targeted. As a result, ASOs are the most clinically developed, with several drugs already approved by the U.S. Food and Drug Administration (FDA) and in clinical trials (Cideciyan et al., 2019; Gagliardi and Ashizawa, 2021).

[0077] One type of RNA-editing is Site-Directed RNA Editing (SDRE), which describes the alteration of an RNA sequence by introducing or removing nucleotides from an RNA or by changing the character of a nucleobase. The first RNA editing process discovered in mammals was the natural deamination of cytidine (C) by APOBEC proteins to form uridine (U) (“C-to-U”) (Zinshteyn and Nishikura, 2009). To date, the two most useful and most studied types of RNA editing are cytidine (C) to uridine (U) (“C-to-U”) and adenosine (A) to inosine (I) (“A-to-I”) conversions, i.e., the enzymatic hydrolysis of adenosine to inosine inRNA. As inosines are decoded as guanosines during translation, both “C-to-U” and A-to-I” changes can directly alter codons and recode RNAs. While “C-to-U” editing is naturally mediated by APOBEC enzymes, “A-to-I” editing is catalysed by the adenosine deaminases acting on RNA (ADAR) protein family, which bind double-stranded or structured regions in RNAs via their double-stranded RNA-binding domains. Of the three known ADAR genes (ADAR1-ADAR3), human ADAR1 (hADAR1) and hADAR2 are expressed in most tissues and encode active deaminases. While all ADARs are multidomain proteins, comprising a targeting or dsRNA-binding domain (dsRBD) and a catalytic domain, ADAR1 proteins additionally comprise one or more Z binding domains, while splice variant ADAR2R and ADAR3 comprises an R domain (Zinshteyn and Nishikura, 2009; Wulff and Nishikura, 2010). Notably, for therapeutic purposes and the most prevalent type of RNA editing in higher eukaryotes is the “A-to-I” conversion.

[0078] The potential of “A-to-I” editing of a target RNA has already been tested in model systems for targeted RNA repair, i.e., reversal of a detrimental mutation (“compensatory editing”), of several genetic disorders. WO 2019 / 158475 discloses antisense oligonucleotides for use in the treatment or prevention of a genetic disorder, preferably selected from the group consisting of, e.g., Cystic fibrosis, Hurler Syndrome, alpha-1- antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease. Similarly, in WO 2020 / 001793, artificial nucleic acids were used for “A-to-I” editing.

[0079] RNA editing systems employing endogenous adenosine deaminase enzymes have been extensively studied, i.e., the use of exogenous oligonucleotides to specifically recruit endogenous adenosine deaminases to a specific target site of a target RNA thereby providing an improved system for targeted RNA editing. Oligonucleotide constructs for site- directed RNA editing are described in patent applications WO 2016 / 097212 and WO 2017 / 010556, which utilise endogenous cellular pathways, i.e., endogenous ADAR, to edit endogenous RNA. That precise, site-specific RNA editing can be achieved by recruiting endogenous ADARs with antisense oligonucleotides has previously been shown by Merkle et al. (2019). Merkle et al. (2019) were able to demonstrate that chemically optimized ASOs can be used to recruit endogenous human ADARs to edit endogenous transcripts in a simple and programmable way with almost no off-target editing. Terminology

[0080] To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.

[0081] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by thoseof ordinary skill in the art. For example, any nomenclature used in connection with, and techniques of, cell and tissue culture, biochemistry, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. Further, unless otherwise required by context, singular terms shall include pluralities, and plural terms shall include the singular.

[0082] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0083] The terms "about" and "approximately" may be understood to permit standard variation as would be understood by those of ordinary skill in the art.

[0084] The terms “comprise(s)”, “include(s)”, “having”, “has”, “can”, “contain(s)”, and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. For instance, the term “including” is used herein to mean, and is used interchangeably with, the phrase “including, but not limited to”. Likewise, the term “comprising” is used herein to mean, and is used interchangeably with, the phrase “comprising, but not limited to".

[0085] As used herein, the term "nucleic acid" is intended to include any DNA molecules (e.g., cDNA or genomic DNA) and any RNA molecules (e.g., mRNA) and analogues of the DNA or RNA generated using nucleotide analogues. For example, nucleic acid or oligonucleotide may comprise, an UNA (unlocked nucleic acid), a PMO (phosphorodiamidate linked morpholino) or a PNA (peptide nucleic acid). The nucleic acids or oligonucleotides can be single-stranded (ss) or double-stranded (ds). A single-stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double-stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions, for example, at regions where the two oligonucleotide chains are not complementary to each other. Each component of the DNA or RNA structure can be modified and be categorized by modification of (1) the internucleoside linkage, (2) the deoxyribose / ribose, and / or (3) the nucleobase.

[0086] The term “oligonucleotide“ or “oligonucleotides” as used herein are defined as it is generally understood by the skilled person as a molecule including two or more covalently linked nucleosides (e.g., short nucleic acid polymer(s)). They can comprise DNA and / or RNA. The oligonucleotides provided herein have a backbone comprising deoxyribonucleotides and / or ribonucleotides. The terms “oligonucleotide(s)” and “nucleic acid(s)” may be used interchangeably.

[0087] The term “nucleobase” refers to nitrogen-containing biological building blocks that form nucleosides, which, in turn, are components of nucleotides. The naturally occurringbases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogues are also included and that the term “nucleobase” also includes “modified nucleobases”. For example, cytosine (C) includes cytosine derivative 5-methyl- cytosine; uracil (U) includes, e.g., 5-methyl-uracil.

[0088] As used herein, the term "modified nucleobase" and "modified base" may be used interchangeably with the term “nucleobase”. Nucleobases may be modified or unmodified. Hence, in some embodiments, a modified nucleobase is a nucleobase that comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In one embodiment, the modified nucleobase is capable of increasing hydrogen bonding, base pair stacking interactions and / or stabilizing a nucleic acid complex. In another embodiment, the modified nucleobase (e.g., Benner’s base) is capable of mimicking the N3 protonated cytosine base. In some embodiments, a modified nucleobase is substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U. Modifications include but are not limited to nonstandard nucleobases 5-methyl-2’-deoxycytidine (m5C), pseudouridine (pU), dihydrouridine, inosine (I), and 7-methylguanosine. Other modifications may include nucleobase replacement by (N) heterocycles (e.g., nebularine) or aromatic rings that stack well in the RNA duplex, such as, e.g., a Benner’s base Z (and / or analogues) or 8-oxo- adenosine (8-oxo-A). As used herein, the term “Benner’s base Z” refers to the pyrimidine analogue 6-amino-5-nitro-3-(1′-β-D-2′-deoxyribofuranosyl)-2(1H)-pyridone (dZ). In one embodiment, a modification includes the introduction of nucleobase analogues or simple heterocycles that boost editing. As used herein, and as commonly understood by the skilled person in the art, the expression “derivative thereof” refers to a derivative of a (modified) nucleobase, nucleoside or nucleotide. For example, a derivative may be a corresponding nucleobase, nucleoside or nucleotide that has been chemically derived from said nucleobase, nucleoside or nucleotide. For instance, a derivative of deoxycytidine may include fluoro-modified deoxycytidine, 5-methyl-2’-deoxycytidine (m5C), or ribocytidine. In some embodiment, the nucleobase is iso-uridine (SbU).

[0089] The term "nucleoside(s)" refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid. The term "nucleoside(s)" encompasses all modified versions and derivatives “modified nucleobases”.

[0090] The term "nucleotide(s)" as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more linkages (e.g.,phosphate linkages in natural DNA and RNA). In some cases, the linkage may be a non- naturally occurring and / or modified linkage. In some embodiments, the linkage is an internucleoside linkage as described herein. In some embodiments, a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid. The term "nucleotide(s)" encompasses all modified versions and derivatives of “nucleosides” and “modified nucleobases”. In some embodiments, the oligonucleotide contains an iso-uridine (SbU) modification, optionally wherein the SbU is at N0.

[0091] As used herein, the term “internucleoside linkage” refers to a linkage between adjacent nucleosides. “Internucleoside linkage” and “linkage” may be used interchangeably. Linkages may be continuous or consecutive. Linkages may be discontinuous or interrupted. As used herein, the term “discontinuous” or “interrupted” means that there are not more than, e.g., 4, 5, 6, 7 or more consecutive internucleoside linkage modifications of the same modification. In some embodiments, the naturally occurring PO linkages are replaced by modified internucleoside linkages. Hence, in some embodiments, the linkage is a non- natural internucleoside linkage. In some embodiments, internucleoside linkage(s) include, but are not limited to phosphorothioate (PS), methanesulfonyl (mesyl) linkage, 3'- methylenephosphonate, 5'-methylenephosphonate, 3'-phosphoroamidate, 2'-5'- phosphodiester, and phosphoryl guanidine (PN) linkages. In one embodiment, the modified linkage is a PS linkage or a methanesulfonyl (mesyl) linkage. In one embodiment, the modified linkage is a PS linkage. In one embodiment, the modified linkage is a methanesulfonyl (mesyl) linkage. In another embodiment, the internucleoside linkage modification is a 3’-3’ or 5’-5’ phosphate ester bonds (3′-P-3′ and 5′-P-5′). The internucleoside linkage may be stereopure or stereorandom. Thus, within a particular oligonucleotide, internucleoside linkages may comprise stereopure and stereorandom linkages. In one embodiment, the natural 3’-5’ phosphodiester linkage is replaced by modified internucleoside linkages. In some embodiments, the naturally occurring one or more PO linkages are replaced by modified internucleoside linkages in order to introduce one or more PS linkages or non-phosphorus derived internucleoside linkages.

[0092] As used herein the term “antisense oligonucleotide” or “ASO” refers to a short strand of nucleotide analogue that generally hybridizes with the complementary RNA in a sequence-specific manner via Watson-Crick base pairing. The ASO does not have to be perfectly complementary to its target sequence. The ASO can comprise DNA and RNA and may be chemically modified. As used herein the terms “antisense oligonucleotide” (ASO) and “oligonucleotide” may be used interchangeably.

[0093] As used herein, the term “asymmetry” or “asymmetrical” refers to an ASO configuration in which the region 5’ to the nucleoside directly opposite to the target adenosine to be edited and the region 3’ to the nucleoside directly opposite to the targetadenosine to be edited are of different lengths. Either region may be longer or shorter than the other. In some embodiments, in an ASO with an asymmetrical configuration, the region 5’ to the nucleoside directly opposite to the target adenosine to be edited is longer than the region 3’ to the nucleoside directly opposite to the target adenosine to be edited. In some embodiments, in an ASO with an asymmetrical configuration, the region 3’ to the nucleoside directly opposite to the target adenosine to be edited is longer than the region 5’ to the nucleoside directly opposite to the target adenosine to be edited. In some embodiments, an ASO provided herein comprises a structure of (5’ – X-N0-Y – 3’), wherein N0 is the nucleoside directly opposite to the target adenosine to be edited, X is the region 5’ to N0 and Y is the region 3’ to N0. In some embodiments, X is 10-60 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleosides in length. In some embodiments, Y is 10-60 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleosides in length. In some embodiments, X is longer than Y, X is 15-40 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40) nucleosides in length, and Y is 3- 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleosides in length. As used herein, the term “complementary” or “partially complementary” or “substantially complementary” refer to nucleic acid sequences, which due to their complementary nucleotides are capable of specific intermolecular base-pairing. For example, the oligonucleotide may comprise a nucleic acid sequence complementary to a target sequence, e.g., LDLR coding DNA or RNA. As those skilled in the art appreciate, in many instances, perfect complementary is not required and one or more wobbles (wobble base pairing), bulges, mismatches, etc. may be well tolerated. The one or more wobbles, bulges, mismatches may be within or outside the CBT. For example, the ASOs may include a mismatch opposite the target nucleoside to be edited, e.g., opposite the target adenosine to be edited. Hence, in some embodiments, the complementarity of the ASOs described herein may be 100%, except at the nucleoside opposite to a target nucleoside to be edited. In some embodiments, the complementarity of the ASOs described herein may be less than 100% (e.g., at least 85%, at least 90%, at least 95%, at least 98%, or higher), aside from the mismatch at the nucleoside opposite to a target nucleoside to be edited.

[0094] As used herein, the term “target RNA” typically refers to an RNA, which is subject to the editing reaction, and is “targeted” by the respective ASO. The “target sequence” is a sequence fragment to which the antisense oligonucleotide is homologous or complementary.

[0095] The term "mutation" as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion orinsertion of one or more residues within a sequence. Mutations are described herein by identifying the original residue that is to be changed followed by the position of the residue within the sequence and by the identity of the new residue. Notably, the present disclosure is not limited to correcting one or more mutations, as it may instead be useful to change a wild-type (or endogenous) sequence into a mutated sequence by applying the ASOs described herein.

[0096] As used herein, the term “beneficial editing” refers to the editing of an RNA derived from a wild-type allele (not a mutated allele) in order to, e.g., modulate the function of the wild-type protein in a useful way to prevent or treat a disease or condition. For example, beneficial editing may include sites, such as LDLR that are not causes for genetic diseases but rather represent wild-type protein sites. These sites are mutated (no underlying G-to-A mutation) to alter the function of the wild-type protein. This beneficial change may be an A- to-I change in the target RNA. Notably, beneficial editing can also be of an RNA that is endogenous to the subject.

[0097] The term “gain-of-function (GOF) mutation” generally refers to the situation in which a gene to be overexpressed relative to a control. GOF mutations produce proteins with new or enhanced functions.

[0098] The term “loss-of-function (LOF) mutation” refers to the situation in which a gene product is prevented from being expressed or produced at the normal level such that there is a decrease in the production or activity of the encoded protein. The protein may be partially or wholly inactivated or may be terminated during translation. A complete LOF mutation is also called a null or amorphic mutation.

[0099] The term “compensatory editing” refers to the modification of RNA nucleotides to change and correct one or more detrimental or unfavourable changes in the RNA sequence when compared to wild-type, e.g., a compensatory change could help to functionally compensate for an otherwise non-editable mutation to ameliorate a disease phenotype. This compensatory change may be an A-to-I change in the target RNA.

[0100] As used herein, the term “off-target” refers to nonspecific and unintended genetic modification(s) of the target. Specifically, off-target editing may include unintended point mutations, deletions, insertions, inversions, and translocations.

[0101] The term "adenosine deaminase(s)" or “adenosine deaminases acting on RNA” (ADARs), as used herein, refers to any (poly)peptide, protein or protein domain or fragment thereof capable of catalysing the hydrolytic deamination of adenosine to inosine. The term thus not only refers to full-length and wild type ADARs but also to a functional fragment or a functional variant of an ADAR. The ADAR may be an (endogenous) adenosine deaminase catalysing the deamination of adenosine (A) to inosine (I) or deoxy-adenosine (dA) to deoxyinosine (dI). The ADAR may be a mammalian endogenous ADAR enzyme. The ADARmay be human ADAR. The ADAR may be an endogenous ADAR. Accordingly, in some embodiments, the ADAR is an endogenous human ADAR1, ADAR2 or ADAR3 (hADAR1, hADAR2 or hADAR3), or any fragment or isoform(s) thereof (e.g., hADAR1 p110 and p150).

[0102] The term "modified sugar" refers to a moiety that can replace a naturally occurring sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. The naturally occurring sugar is the pentose (five carbon sugar) deoxyribose (to form DNA) or ribose (to form RNA), though it should be understood that naturally and non-naturally occurring sugar analogues are also included. For example, other sugars may comprise, e.g., C4 sugars, C5 sugars and / or C6 sugars. In some embodiments, a modified sugar is substituted ribose or deoxyribose. In some embodiments, a modified sugar comprises a 2'-modification. Examples of useful 2’-sugar modifications, e.g., 2’-ribose, 2’-deoxyribose, 2’-arabinose etc., are widely used in the art and described herein. Those skilled in the art, after reading the present disclosure, will appreciate that various types of 2’-sugar modifications are known and can be utilized in accordance with the present disclosure. A modified sugar may be a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.).

[0103] The term “locked nucleic acid(s)” (LNA(s)) is also known as bridged nucleic acid (BNA) and refers to modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. In some embodiments, a sugar modification is 2’-O-methyl (2’-OMe), 2'-O-methoxy-ethyl (2’-MOE), 2’-F, 5’-vinyl, or S- constrained ethyl (S-cEt). In one embodiment, a 2’-modification is a C2-stereoisomer of 2’-F- ribose. In one embodiment, a 2'-modification is 2’-F. In one embodiment, a 2'-modification is 2'-FANA. In one embodiment, a modified sugar is a sugar of morpholino. In one embodiment, the oligonucleotide comprises, e.g., an UNA (unlocked nucleic acid), a PMO (phosphorodiamidate linked morpholino) or a PNA (peptide nucleic acid). Hence, in one embodiment, the nucleic acid analogue is a PNA (peptide nucleic acid). In one embodiment, the nucleic acid analogue is PMO (phosphorodiamidate linked morpholino). In one embodiment, a 2’-modification is a 2’-O-alkyl modification. In one embodiment, the 2’-O- alkyl modification is a 2’-O-methyl-, 2’-O-ethyl-, 2’-O-propyl-, or 2'-MOE modification. In a preferred embodiment, a 2’-modification is 2'-OMe. In some embodiments, a 2'-modification is 2'-MOE. In some embodiments, a 2'-modification is 2'-OR, wherein R is substituted C1-10 aliphatic. In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA (e.g., arabinose). In some instances, the 2’-O-alkyl modification is not a 2'-MOE.

[0104] The term “FANA” or “FANA-modified” refers to 2'-fluoroarabinoside modified nucleobases and / or oligonucleotides comprising such nucleobases. For example, the expression “FANA-cytidine” refers to a cytidine that comprises a 2'-fluoro-beta-D-arabinonucleic acid sugar modification. Within the context of this disclosure, the expression “a derivate thereof” refers to a corresponding nucleotide(s) or oligonucleotide(s) that has been chemically derived from said nucleotide or oligonucleotide(s).

[0105] The term “canonical transcript” as used herein is a term used in gene analysis and refers to the Ensembl Canonical transcript. Generally, it is a single transcript chosen for a gene which is the most conserved, most highly expressed and has the longest coding sequence and is represented in other key resources such as Ensemble, NCBI and UniProt (mart.ensembl.org / info / genome / genebuild / canonical.html).

[0106] As used herein, the terms “disease” or “disorder” are used interchangeably to refer to a condition in a subject. In certain embodiments, the condition is a disease in a subject, the severity of which is decreased by inducing an immune response in the subject through the administration of a pharmaceutical composition.

[0107] As used herein, the term “effective amount” in the context of administering a therapy to a subject refers to the amount of a therapy which has a prophylactic and / or therapeutic effect(s).

[0108] As used herein, the term “in combination” in the context of the administration of two or more therapies to a subject, refers to the use of more than one therapy (e.g., more than one prophylactic agent and / or therapeutic agent). The use of the term "in combination" does not restrict the order in which therapies are administered to a subject.

[0109] As used herein, the terms “prevent”, “preventing” and “prevention” in the context of the present disclosure and the administration of a therapy(ies) to a subject refers to the inhibition of the development or onset of a disease or a symptom thereof. In one embodiment, it relates to the administration of the compound to a patient who is known to have an increased risk of developing a certain condition, disorder, or disease.

[0110] As used herein, the terms “treat”, “treatment”, and “treating” refer in the context of the present disclosure to the administration of the compound to a patient, which has already developed signs and / or symptoms of a certain condition, disorder, or disease. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

[0111] The terms “subject” or “patient” are used interchangeable and relate to an animal (e.g., mammals) that may need administration of the compound of the present disclosure in the field of human or veterinary medicine. In specific embodiments, the subject is a human. The subject may be administered the oligonucleotide of the present disclosure for beneficial editing. The subject may be administered the oligonucleotide described herein for compensatory editing.

[0112] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatine, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The formulation should suit the mode of administration.

[0113] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Methods and materials are described herein for use in the present disclosure; other, suitable methods and materials known in the art can also be used. Prophylactic and Therapeutic Uses

[0114] The present disclosure, in some aspects, relates to antisense oligonucleotide (ASO) for use in the prevention or treatment of a disease or a condition associated with circulating LDL in a subject. The present disclosure further provides methods and their use in the medical setting for site-directed editing of a target RNA (e.g., binding to the target RNA via the targeting sequence and by recruiting to the target site a deaminase). Site-directed editing may take place in vitro, in situ, in vivo or ex vivo.

[0115] According to the present disclosure, the antisense oligonucleotide (ASOs) are for use in the prevention or treatment of a disease or a condition associated with circulating LDL in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous LDLR gene such that a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL- mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’- untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0116] Generally, the use of the ASOs results in a reduced level of circulating LDL (LDL-C) in the subject. Accordingly, in one embodiment, the use results in a reduced level ofcirculating LDL (LDL-C) in the subject. In one embodiment, treatment results in a reduced level of circulating LDL (LDL-C) in the subject. In one embodiment, the use results in an improvement in cellular LDL uptake. In one embodiment, the subject is human. In one embodiment, the A-to-I editing results in a gain-of-function (GOF) mutation in LDLR. In one embodiment, the LDLR is human LDLR (hLDLR).

[0117] The antisense oligonucleotide (ASOs) may be for prophylactic use. This means that the ASO is used for preventing a disease or condition associated with LDL-C. Hence, in some embodiments, the ASO is used in the prevention of a disease or disorder selected from the group consisting of cardiovascular diseases, liver disorders, autoimmune diseases, and cancer diseases. In a preferred embodiment, the disease or condition is selected from a group consisting of metabolic syndrome, atherosclerosis, coronary heart disease, bile acid- related liver disease, cholestasis; hyperlipidaemia, hypercholesterolemia, non-alcoholic fatty liver disease (NAFLD), non-alcohol steatohepatitis (NASH), steatosis or cirrhosis; and hepatocellular carcinoma (HCC), and familial hypercholesterolaemia (FH).

[0118] The antisense oligonucleotide (ASOs) may be for therapeutic use. This means that the ASO is used for treating a disease or condition associated with LDL-C. Hence, in some embodiments, the ASO is used in the treatment of a disease or disorder selected from the group consisting of cardiovascular diseases, liver disorders, autoimmune diseases, and cancer diseases. In a preferred embodiment, the disease or condition is selected from a group consisting of metabolic syndrome, atherosclerosis, coronary heart disease, bile acid- related liver disease, cholestasis; hyperlipidaemia, hypercholesterolemia, non-alcoholic fatty liver disease (NAFLD), non-alcohol steatohepatitis (NASH), steatosis or cirrhosis; and hepatocellular carcinoma (HCC), and familial hypercholesterolaemia (FH).

[0119] In one embodiment, at least one target adenosine (A) present in the target RNA sequence is to be edited. In a preferred embodiment, a single adenosine is to be edited. In one embodiment, a single adenosine is to be edited in the target RNA derived from a LDLR coding sequence. In one embodiment, at least one target adenosine present in the target RNA sequence is to be edited. In one embodiment, 1, 2, 3, 4, 5, 6, or 7 adenosine(s) is / are to be edited in the target RNA. In one embodiment, the target LDLR RNA sequence contains 1, 2, 3, 4, 5, 6, or 7 target adenosines to be edited, i.e., undergo A-to-I editing. In one embodiment, the target RNA sequence contains between 1-7 adenosines that are to be subjected to A-to-I editing. In some instances, the target RNA contains only a single (one) adenosine that is subjected to A-to-I editing. In one embodiment, the target LDLR RNA sequence contains 2 target adenosine to be edited. In one embodiment, the target LDLR RNA sequence contains 3 target adenosine to be edited. In one embodiment, the target LDLR RNA sequence contains 4 target adenosine to be edited. In one embodiment, the target LDLR RNA sequence contains 5 target adenosine to be edited. In one embodiment,the target LDLR RNA sequence contains 6 target adenosine to be edited. In one embodiment, the target LDLR RNA sequence contains 7 target adenosine to be edited.

[0120] Generally, A-to-I editing is mediated by ADAR. In one embodiment, the method comprises editing by an endogenous ADAR enzyme. In one embodiment, the method comprises editing by an exogenous ADAR enzyme. In some instances, the ADAR enzyme maybe be engineered for precise base editing. In one embodiment, the ADAR enzyme is an engineered ADAR enzyme. In one embodiment, the ADAR enzyme is an endogenous ADAR enzyme, an exogenous ADAR enzyme, or an engineered ADAR enzyme. In one embodiment, the ADAR enzyme is mammalian. In one embodiment, the ADAR enzyme is a human ADAR. In one embodiment, the ADAR enzyme is ADAR1. In one embodiment, the ADAR enzyme is ADAR2.

[0121] Genetic variants can arise from one or more mutations in the coding sequence of a gene, i.e., their expression in the respective coding regions (exon). In one embodiment, the target adenosine to be edited is located within the translated region (TR) of the LDLR target RNA sequence. In one embodiment, the target adenosine to be edited is located within the coding sequence (CDS) of the LDLR target RNA sequence.

[0122] IDOL directly controls the LDLR protein and thus contributes to variation in circulating LDL-C levels (Sorrentino et al., 2013). Hence, in one embodiment, the target adenosine is located within LDLR within the region encoding an IDOL-binding region. In one embodiment, the target adenosine to be edited is located within LDLR within the region encoding an IDOL-binding region. In one embodiment, the edited LDLR comprises a conserved single A-to-G substitution. In one embodiment, the substitution is located within the IDOL-binding region.

[0123] In one embodiment, the modified LDLR protein comprises a conserved amino acid substitution. In one embodiment, the amino acid substitution is located within the IDOL- binding region of the LDLR protein. In one embodiment, the amino acid substitution is reflective of the A-to-G mutation at the DNA level or the A-to-I mutation at the RNA level. Hence, in one embodiment, the amino acid substitution prevents or reduces interaction of LDLR with IDOL when compared to wild-type LDLR protein. In one embodiment, the amino acid substitution prevents or reduces IDOL-mediated ubiquitination and LDLR degradation. In one embodiment, the amino acid substitution prevents or reduces (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein, and / or (b) IDOL-mediated LDLR ubiquitination and LDLR degradation. In one embodiment, LDLR is resistant to degradation. In one embodiment, LDLR is resistant to IDOL-mediated degradation. In one embodiment, the LDLR variant is IDOL-resistant.

[0124] The ASO for use as described herein induce one or more amino acid substitutions with the LDLR protein. In one embodiment, the LDLR protein has an amino acid sequencethat is at least 99% identical to SEQ ID NO: 2. In one embodiment, the LDLR protein has an amino acid sequence that is at least 70%, at least 80%, at least 90% identical to SEQ ID NO: 2. In one embodiment, the LDLR protein deviates from SEQ ID NO: 2 by at least one amino acid. In one embodiment, the LDLR protein deviates from SEQ ID NO: 2 by at least 2, 3, 4, or 5 amino acids. In one embodiment, the LDLR protein deviates from SEQ ID NO: 2 by 1, 2, 3, 4, or 5 amino acid(s).

[0125] The modified LDLR protein may be an isoform that comprises one or more amino acid substitutions homologous to N819D, S820G, K830E or K830R of the canonical transcript (LDLR-208). For instance, in one embodiment, the modified LDLR protein comprises one or more amino acid substitutions at a position homologous to position 1, position 2, position 3 and position 4. In certain embodiments, an IDOL-resistant LDLR variant or isoform comprises one or more of the amino acid substitutions listed in TABLE A. In one embodiment, an IDOL-resistant LDLR variant is derived from one of the transcript ID numbers listed in TABLE A. For example, in one embodiment, the LDLR protein variant carries the N819D substitution, i.e., a change from asparagine to aspartic acid at position 819. TABLE A: Exemplary human LDLR protein isoforms and variants. The corresponding amino acid substitutions and positions are shown for each variant. Ensemble canonical transcript = transcript chosen for a gene which is the most conserved.

[0126] In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions selected from the group consisting of N819D, S820G, K830E and K830R according to the canonical transcript (LDLR-208) (see, Table A). In one embodiment, the LDLR variant contains the amino acid substitution N819D. In one embodiment, the LDLR variant contains the amino acid substitution S820G. In one embodiment, the LDLR variant contains the amino acid substitution K830E. In one embodiment, the LDLR variant contains the amino acid substitution K830R.

[0127] In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 3-6. In one embodiment, the LDLR protein comprises SEQ ID NO: 3. In one embodiment, the LDLR protein comprises SEQ ID NO: 4. In one embodiment, the LDLR protein comprises SEQ ID NO: 5. In one embodiment, the LDLR protein comprises SEQ ID NO: 6. In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions selected from the group consisting of N819D, S820G, K830E and K830R according to the canonical transcript, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 3-6.

[0128] In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 3. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 3 and substitution N819D. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 4. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 4 and substitution S820G. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 5. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 5 and substitution K830E. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 6. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 6 and substitution K830R.

[0129] In one embodiment, the LDLR is derived from LDLR-208 or is LDLR-208. In one embodiment, the LDLR variant is derived from SEQ ID NO: 2. In one embodiment, variant LDLR-208 causes an increase in LDLR uptake. In one embodiment, variant N819D leads to an increase in LDL uptake. In one embodiment, variant D820G leads to an increase in LDL uptake. In one embodiment, variant K830E leads to an increase in LDL uptake. In oneembodiment, variant K830R leads to an increase in LDL uptake. In one embodiment, the increase in LDL uptake is in the presence of IDOL.

[0130] According to the present disclosure, particular A-to-G mutations in LDLR CDS increase LDLR stability and LDLR expression in the presence of IDOL. For instance, in one embodiment, the LDLR variant N819D shows an increase in surface expression in the presence of IDOL. In one embodiment, the LDLR variant S820G shows an increase in surface expression in the presence of IDOL. In one embodiment, the LDLR variant K830E shows an increase in surface expression in the presence of IDOL. In one embodiment, the LDLR variant K830R shows an increase in surface expression in the presence of IDOL.

[0131] LDLR is normally bound to the cell membrane, where it binds LDL / cholesterol and is taken up into the cell. LDLR is naturally expressed in different tissues and organs. Hence, the oligonucleotides of the present disclosure may be used to target an RNA derived from a sequence of an LDLR gene, wherein the RNA has been derived from or is expressed in a specific tissue or organ. This means that in some embodiments, the LDLR variant is a variant that contains an amino acid substitution that corresponds to an A-to-G mutation at the DNA level (or a corresponding A-to-I mutation at the RNA level) wherein the LDLR sequence is from an organ or tissue selected from the group consisting of brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connective and soft tissue. Hence, in some embodiments, the IDOL-resistant LDLR is derived from a particular tissue (tissue-specific) or organ (organ-specific).

[0132] In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions homologous to N819D, S820G, K830E or K830R of the canonical transcript. For instance, the LDLR variant may be based on an LDLR protein naturally expressed in the liver. Hence, in some embodiments, an LDLR variant is based on an LDLR protein that is naturally expressed or found in the liver. In one embodiment, an LDLR variant contains a substitution that corresponds to a homologous position of an LDLR expressed in the liver (SEQ ID NO: 46; ENST00000252444.10; LDLR-201). In one embodiment, an LDLR variant is derived from the LDLR-201 human transcript (ENST00000252444.10; UniProt ID: J3KMZ9). In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from the group consisting of N905D, S906G, K916E, K916R according to the liver specific transcript. In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 47-50. In some embodiments, the LDLR variant has a sequence identity of at least 70% with SEQ ID NO: 46. In some embodiments, the LDLR variant has a sequence identity of at least 80%, at least 90% with SEQ ID NO: 46. In one embodiment, the LDLR variant substitution is N905D (SEQ ID NO: 47). In some embodiments, the LDLR variant has a sequence identity of at least 70% with SEQ ID NO: 47. In some embodiments, the LDLR variant has a sequenceidentity of at least 80%, at least 90% with SEQ ID NO: 47. In one embodiment, the LDLR variant substitution is S906G (SEQ ID NO: 48). In some embodiments, the LDLR variant has a sequence identity of at least 70% with SEQ ID NO: 48. In some embodiments, the LDLR variant has a sequence identity of at least 80%, at least 90% with SEQ ID NO: 48. In one embodiment, the LDLR variant substitution is K916E (SEQ ID NO: 49). In some embodiments, the LDLR variant has a sequence identity of at least 70% with SEQ ID NO: 49. In some embodiments, the LDLR variant has a sequence identity of at least 80%, at least 90% with SEQ ID NO: 49. In one embodiment, the LDLR variant substitution is K916R (SEQ ID NO: 50). In some embodiments, the LDLR variant has a sequence identity of at least 70% with SEQ ID NO: 50. In some embodiments, the LDLR variant has a sequence identity of at least 80%, at least 90% with SEQ ID NO: 50. In one embodiment, the LDLR variant N905D shows an increase in expression in the presence of IDOL. In one embodiment, the LDLR variant S906G shows an increase in expression in the presence of IDOL. In one embodiment, the LDLR variant K916E shows an increase in expression in the presence of IDOL. In one embodiment, the LDLR variant K916R shows an increase in expression in the presence of IDOL.

[0133] In one embodiment, the LDLR is derived from LDLR-201 or is LDLR-201. In one embodiment, the LDLR is derived from SEQ ID NO: 46. In one embodiment, variant LDLR- 201 causes an increase in LDLR uptake. In one embodiment, variant N905D leads to an increase in LDL uptake. In one embodiment, variant S906G leads to an increase in LDL uptake. In one embodiment, variant K916E leads to an increase in LDL uptake. In one embodiment, variant K916R leads to an increase in LDL uptake.

[0134] An LDLR isoform may be derived from the LDLR-202 human transcript (Ensembl ID: ENST00000455727.6; UniProt ID: P01130-3). In one embodiment, the LDLR is derived from LDLR-202 or is LDLR-202. In one embodiment, the LDLR is derived from SEQ ID NO: 83. In some embodiments, the LDLR variant has a sequence identity of at least 70%, at least 80%, or at least 90% with SEQ ID NO: 83. In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 84-87. In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from N651D, S652G, K662E, and K662R of LDLR-202. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 84-87. In one embodiment, the LDLR variant substitution is N651D. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 84. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 84 and comprises substitution N651D. In one embodiment, the LDLR variant substitution is S652G. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 85. In one embodiment, the LDLR protein variantcomprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 85 and comprises substitution S652G. In one embodiment, the LDLR variant substitution is K662E. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 86. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 86 and comprises substitution K662E. In one embodiment, the LDLR variant substitution is K662R. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 87. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 87 and comprises substitution K662R. In one embodiment, variant LDLR-202 causes an increase in LDLR uptake. In one embodiment, variant N651D leads to an increase in LDL uptake. In one embodiment, variant S652G leads to an increase in LDL uptake. In one embodiment, variant K662E leads to an increase in LDL uptake. In one embodiment, variant K662R leads to an increase in LDL uptake.

[0135] An LDLR isoform may be derived from the LDLR-203 human transcript (Ensembl ID: ENST00000535915.5; UniProt ID: P01130-4). In one embodiment, the LDLR is derived from LDLR-203 or is LDLR-203. In one embodiment, the LDLR is derived from SEQ ID NO: 88. In some embodiments, the LDLR variant has a sequence identity of at least 70%, at least 80%, or at least 90% with SEQ ID NO: 88. In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 89-92. In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from N778D, S779G, K789E, and K789R of LDLR-203. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 89-92. In one embodiment, the LDLR variant substitution is N778D. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 89. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 89 and comprises substitution N778D. In one embodiment, the LDLR variant substitution is S779G. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 90. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 90 and comprises substitution S779G. In one embodiment, the LDLR variant substitution is K789E. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 91. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 91 and comprises substitution K789E. In one embodiment, the LDLR variant substitution is K789R. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 92. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 92 and comprises substitution K789R. In one embodiment, variant LDLR-203 causes anincrease in LDLR uptake. In one embodiment, variant N778D leads to an increase in LDL uptake. In one embodiment, variant S779G leads to an increase in LDL uptake. In one embodiment, variant K789E leads to an increase in LDL uptake. In one embodiment, variant K789R leads to an increase in LDL uptake.

[0136] An LDLR isoform may be derived from the LDLR-204 human transcript (Ensembl ID: ENST00000545707.5; UniProt ID: P01130-2). In one embodiment, the LDLR is derived from LDLR-204 or is LDLR-204. In one embodiment, the LDLR is derived from SEQ ID NO: 93. In some embodiments, the LDLR variant has a sequence identity of at least 70%, at least 80%, or at least 90% with SEQ ID NO: 93. In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 94-97. In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from N641D, S642G, K652E, and K652R of LDLR-204. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 94-97. In one embodiment, the LDLR variant substitution is N641D. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 94. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 94 and comprises substitution N641D. In one embodiment, the LDLR variant substitution is S642G. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 95. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 95 and comprises substitution S642G. In one embodiment, the LDLR variant substitution is K652E. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 96. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 96 and comprises substitution K652E. In one embodiment, the LDLR variant substitution is K652R. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 97. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 97 and comprises substitution K652R. In one embodiment, variant LDLR-204 causes an increase in LDLR uptake. In one embodiment, variant N641D leads to an increase in LDL uptake. In one embodiment, variant S642G leads to an increase in LDL uptake. In one embodiment, variant K652E leads to an increase in LDL uptake. In one embodiment, variant K652R leads to an increase in LDL uptake.

[0137] An LDLR isoform may be derived from the LDLR-207 human transcript (Ensembl ID: ENST00000558013.5; UniProt ID: P01130-5). In one embodiment, the LDLR is derived from LDLR-207 or is LDLR-207. In one embodiment, the LDLR is derived from SEQ ID NO: 98. In some embodiments, the LDLR variant has a sequence identity of at least 70%, at least 80%, or at least 90% with SEQ ID NO: 98. In one embodiment, the modified LDLRprotein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 99-102. In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from N819D, S820G, K830E, and K830R of LDLR-207. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 99-102. In one embodiment, the LDLR variant substitution is N819D. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 99. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 99 and comprises substitution N819D. In one embodiment, the LDLR variant substitution is S820G. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 100. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 100 and comprises substitution S820G. In one embodiment, the LDLR variant substitution is K830E. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 101. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 101 and comprises substitution K830E. In one embodiment, the LDLR variant substitution is K830R. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 102. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 102 and comprises substitution K830R. In one embodiment, variant LDLR-207 causes an increase in LDLR uptake. In one embodiment, variant N819D leads to an increase in LDL uptake. In one embodiment, variant S820G leads to an increase in LDL uptake. In one embodiment, variant K830E leads to an increase in LDL uptake. In one embodiment, variant K830R leads to an increase in LDL uptake.

[0138] An LDLR isoform may be derived from the LDLR-212 human transcript (Ensembl ID: ENST00000560467.2; UniProt ID: H0YM92). In one embodiment, the LDLR is derived from LDLR-212 or is LDLR-212. In one embodiment, the LDLR is derived from SEQ ID NO: 103. In some embodiments, the LDLR variant has a sequence identity of at least 70%, at least 80%, or at least 90% with SEQ ID NO: 103. In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 104-107. In one embodiment, the modified LDLR protein comprises an amino acid substitution selected from N779D, S780G, K790E, and K790R of LDLR-212. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 104-107. In one embodiment, the LDLR variant substitution is N779D. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 104. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 104 and comprises substitution N779D. In one embodiment, the LDLR variant substitution is S780G. In oneembodiment, the LDLR protein variant comprises SEQ ID NO: 105. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 105 and comprises substitution S780G. In one embodiment, the LDLR variant substitution is K790E. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 106. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 106 and comprises substitution K790E. In one embodiment, the LDLR variant substitution is K790R. In one embodiment, the LDLR protein variant comprises SEQ ID NO: 107. In one embodiment, the LDLR protein variant comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 107 and comprises substitution K790R. In one embodiment, variant LDLR-212 causes an increase in LDLR uptake. In one embodiment, variant N779D leads to an increase in LDL uptake. In one embodiment, variant S780G leads to an increase in LDL uptake. In one embodiment, variant K790E leads to an increase in LDL uptake. In one embodiment, variant K790R leads to an increase in LDL uptake.

[0139] In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions selected from the group consisting of: a) N905D, S906G, K916E, or K916R according to the liver specific transcript (LDLR-201), optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 47-50; b) N651D, S652G, K662E, or K662R of LDLR-202, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 84-87; c) N778D, S779G, K789E, or K789R of LDLR-203, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 89-92; d) N641D, S642G, K652E, or K652R of LDLR-204, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 94-97; e) N819D, S820G, K830E, or K830R of LDLR-207, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 99-102; and f) N779D, S780G, K790E, or K790R of LDLR-212, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 104-107.

[0140] An LDLR polypeptide of the present disclosure may comprise an amino acid sequence that is at least 80% identical to an amino acid sequence derived from any one of the LDLR isoforms of TABLE A and that comprises one of more of the corresponding amino acid substitutions listed in TABLE A. In one embodiment, the polypeptide is derived from one of the following isoforms and comprises one or more of the following corresponding amino acid substitutions: a) LDLR-208, comprising substitution N819D, S820G, K830E or K830R; b) LDLR-201, comprising substitution N905D, S906G, K916E, or K916R; c) LDLR-202, comprising substitution N651D, S652G, K662E, or K662R; d) LDLR-203, comprising substitution N778D, S779G, K789E, or K789R; e) LDLR-204, comprising substitution N641D, S642G, K652E, or K652R; f) LDLR-207, comprising substitution N819D, S820G, K830E, or K830R; or g) LDLR-212, comprising substitution N779D, S780G, K790E, or K790R; optionally wherein the polypeptide is able to mediate a reduction in LDL-C. In one embodiment, a polypeptide is any one of the polypeptides selected from the list consisting of: SEQ ID NOs: 3-6, SEQ ID NOs: 47-50, SEQ ID NOs: 84-87, SEQ ID NOs: 89-92, SEQ ID NOs: 94-97, SEQ ID NOs: 99-102, and SEQ ID NOs: 104-107.

[0141] In some embodiments, the ASO for use as described herein induce one or more amino acid substitutions in the LDLR protein. In some embodiments, the LDLR protein is a murine LDLR protein (mLDLR). In one embodiment, the LDLR protein has an amino acid sequence that is at least 99% identical to SEQ ID NO: 175. In one embodiment, the LDLR protein has an amino acid sequence that is at least 70%, at least 80%, at least 90% identical to SEQ ID NO: 175. In one embodiment, the LDLR protein deviates from SEQ ID NO: 175 by at least one amino acid. In one embodiment, the LDLR protein deviates from SEQ ID NO: 175 by at least 2, 3, 4, or 5 amino acids. In one embodiment, the LDLR protein deviates from SEQ ID NO: 175 by 1, 2, 3, 4, or 5 amino acid(s).

[0142] The modified LDLR protein may be an isoform that comprises one or more amino acid substitutions homologous to N821D, S822G, K832E or K832R of mLDLR For instance, in one embodiment, the modified LDLR protein comprises one or more amino acid substitutions at a position homologous to position 1, position 2, position 3 and position 4 as described in TABLE B. In certain embodiments, an IDOL-resistant LDLR variant or isoform comprises one or more of the amino acid substitutions listed in TABLE B. In one embodiment, an IDOL-resistant LDLR variant is derived from one of the transcript ID numbers listed in TABLE A. For example, in one embodiment, the LDLR protein variant carries the N821D substitution, i.e., a change from asparagine to aspartic acid at position 821. TABLE B: Murine LDLR (mLDLR) protein.

[0143] In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions selected from the group consisting of N821D, S822G, K832E and K832R according to mLDLR (see, Table B). In one embodiment, the LDLR variant contains the amino acid substitution N821D. In one embodiment, the LDLR variant contains the amino acid substitution S822G. In one embodiment, the LDLR variant contains the amino acidsubstitution K832E. In one embodiment, the LDLR variant contains the amino acid substitution K832R.

[0144] In one embodiment, the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 176-179. In one embodiment, the LDLR protein comprises SEQ ID NO: 176. In one embodiment, the LDLR protein comprises SEQ ID NO: 177. In one embodiment, the LDLR protein comprises SEQ ID NO: 178. In one embodiment, the LDLR protein comprises SEQ ID NO: 179. In one embodiment, the modified LDLR protein comprises one or more amino acid substitutions selected from the group consisting of N821D, S822G, K832E and K832R according to the canonical transcript, optionally wherein the modified LDLR protein comprises one of the sequences selected from the group consisting of SEQ ID NOs: 176-179.

[0145] In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 176. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 176 and substitution N821D. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 177. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 177 and substitution S822G. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 178. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 178 and substitution K832E. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 179. In one embodiment, the LDLR protein contains an amino acid sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 179 and substitution K832R.

[0146] In one embodiment, the LDLR is derived from mLDLR. In one embodiment, the LDLR variant is derived from SEQ ID NO: 175. In one embodiment, variant mLDLR causes an increase in LDLR uptake. In one embodiment, variant N821D leads to an increase in LDL uptake. In one embodiment, variant S822G leads to an increase in LDL uptake. In one embodiment, variant K832E leads to an increase in LDL uptake. In one embodiment, variant K832R leads to an increase in LDL uptake. In one embodiment, the increase in LDL uptake is in the presence of IDOL.

[0147] Depending on the LDLR isoform or variant, the uptake in cellular LDL may vary. In one embodiment, the cellular LDL uptake is about 2-fold, about 3-fold, about 4-fold, about 5- fold, or about 6-fold higher than the cellular LDL uptake mediated by wild-type LDLR. In one embodiment, the cellular LDL uptake is between about 2-fold to 6-fold higher than the LDLuptake mediate by wild-type LDLR. In one embodiment, the cellular LDL uptake is between about 2-fold to 10-fold higher than the LDL uptake mediate by wild-type LDLR.

[0148] While not changing the predicted protein sequence, genetic variations at untranslated regions (UTRs) may modify regulatory elements affecting the interaction of the UTRs with proteins and microRNAs. The functional consequences include modulation of mRNA transcription, secondary structure, stability, localization, translation, and access to regulators like microRNAs (miRNAs) and RNA-binding proteins (RBPs). Hence, modulation of UTR represents one approach to enhance mRNA stability and / or translation efficiency.

[0149] In one embodiment, editing decreases degradation of the LDLR encoding RNA. In one embodiment, editing increases stability of the LDLR encoding RNA. In one embodiment, editing increases LDLR cell surface expression relative to a control. In one embodiment, editing increases stability of the LDLR encoding RNA and LDLR protein variant cell surface expression in the presence of IDOL relative to a control.

[0150] Messenger RNA (mRNA) turnover plays a major role in the regulation of protein levels. The 3' untranslated region (3'-UTR) comprises the bulk of noncoding sequences and is important for regulation of mRNA processing, stability, translation and localization. Regulation of mRNA is, in part, achieved through cis-regulatory elements located within the 3’-UTR of, e.g., LDLR RNA. Such elements include adenosine and uridine (AU)-rich elements (AREs). Hence, in one embodiment, the target adenosine (A) to be edited is located within the 3’-UTR of the LDLR target RNA sequence. In one embodiment, the target adenosine to be edited is located within the proximal region of the 3’-UTR, i.e., corresponding to a region immediately 3’ to the coding sequence. In one embodiment, the target adenosine to be edited is located within the distal region of the 3’-UTR, i.e., end of the 3’-UTR. In one embodiment, editing within the 3’-UTR prevents or reduces negative regulation of the LDLR encoding RNA and / or increases stability of LDLR encoding RNA. Preferably, the edited site in the 3’-UTR of the target RNA sequence is within the proximal region of the 3’-UTR. In one embodiment, the edited site in the 3’-UTR of the target RNA sequence is at the proximal region of the 3’-UTR. In one embodiment, the editing increases LDLR protein expression.

[0151] In one embodiment, one or more adenylate uridylate rich elements (AREs) are located 3’ and / or 5’ of the target adenosine to be edited. In one embodiment, the ARE comprises a core sequence of AUUUA.

[0152] The different ASOs used for the in the prevention or treatment of a disease or a condition associated with low-density lipoprotein (LDL) in a subject may target one or more different adenosine nucleotides within the target LDLR sequence. In one embodiment, the one or more target adenosines are located within regions of adenylate uridylate richelements (AREs). In one embodiment, the target adenosine (A) to be edited is located within mARE1.

[0153] In one embodiment, only 1 target adenosine is to be edited in the 3’-UTR of the target RNA. In one embodiment, target RNA is edited to comprise one of the following A-to-I mutations: A98I, A100I, A111I, A113I, A115I, or A119I. In one embodiment, target RNA is edited to comprise the A98I mutation. In one embodiment, target RNA is edited to comprise the A100I mutation. In one embodiment, target RNA is edited to comprise the A111I mutation. In one embodiment, target RNA is edited to comprise the A113I mutation. In one embodiment, target RNA is edited to comprise the A115I mutation. In one embodiment, target RNA is edited to comprise the A119I mutation. In some cases, the target RNA may be edited to comprise the A123I mutation.

[0154] This single conversion to inosine (I) in the target RNA corresponds to a A-to-G change in the coding DNA. In one embodiment, LDLR 3’-UTR variant is the LDLR A111I or A111G variant. In one embodiment, LDLR 3’-UTR variant is the LDLR A113I or A113G variant. In one embodiment, LDLR 3’-UTR variant is the LDLR A115I or A115G variant. In one embodiment, LDLR 3’-UTR variant is the LDLR A119I or A119G variant. In one embodiment, LDLR 3’-UTR variant is the LDLR A98I or A98G variant. In one embodiment, LDLR 3’-UTR variant is the LDLR A100G variant. In some cases, the LDLR 3’-UTR variant may be the LDLR A123I or A123G variant.

[0155] In some cases, the LDLR 3’-UTR variant may comprise a sequence derived from an organ or tissue selected from the group consisting of brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connective and soft tissue. Hence, in some embodiments, the LDLR 3’-UTR variant is tissue-specific. In some embodiments, the LDLR 3’-UTR variant contains a sequence homologous to an LDLR 3’-UTR sequence expressed in the brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connective and soft tissue. As there are various isoforms of LDLR, in some embodiments, the LDLR 3’-UTR variant contains an isoform expressed in the brain, eye, endocrine tissue, respiratory tissue, liver, pancreas, kidney, connective and soft tissue. In one embodiment, the LDLR 3’-UTR variant is or corresponds to an isoform selected from TABLE 20. In one embodiment, the LDLR 3’- UTR variant comprises an isoform sequence selected from TABLE 20. In one embodiment, the LDLR 3’-UTR variant comprises a sequence selected from SEQ ID NO: 69-76. In one embodiment, the LDLR 3’-UTR variant is homologous to an isoform selected from TABLE 20.

[0156] Also provided herein are method of treating a disease or a condition in a subject associated with low-density lipoprotein (LDL), wherein the method comprises site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that:a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0157] Also provided herein are method of preventing a disease or a condition in a subject associated with low-density lipoprotein (LDL), wherein the method comprises site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0158] An ASO for use as described herein may be delivered to a subject by a variety of routes as will be appreciated by the skilled person. These include, but are not limited to, mucosal, intranasal, intratracheal, oral, intradermal, intramuscular, intraperitoneal, transdermal, intravenous, and subcutaneous routes. In certain embodiments, a composition is formulated for intramuscular administration. In some embodiments, a composition is formulated for subcutaneous administration. In certain embodiments, a composition is not formulated for administration by injection.

[0159] The amount of an oligonucleotide which will be effective in the treatment and / or prevention of a LDL associated disease or condition will depend on the nature of the disease and can be determined by standard clinical techniques. The precise dose to be employed in the formulation will also depend on the route of administration. In certain embodiments, an in vitro assay is employed to help identify optimal dosage ranges. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.

[0160] Various approaches may be used to deliver the oligonucleotides described herein. An oligonucleotide may be delivered as is (i.e., naked and / or in isolated form) to an individual, an organ (the liver), or specifically to a cell. When administering an oligonucleotide, it is preferred that the oligonucleotide is dissolved in a solution that is compatible with the delivery method. Such delivery may be in vivo, in vitro or ex vivo. Nanoparticles and micro-particles that may be used for in vivo ASO delivery are well known in the art. Alternatively, a plasmid can be provided by transfection using known transfection reagents.

[0161] In a preferred embodiment, the oligonucleotides of the present disclosure are administered and delivered ‘as is’, also referred to as ‘naked’. Nevertheless, the art contains multiple ways of delivering oligonucleotides to cells, either in vitro, ex vivo or in vivo. That is, depending on the disease, disorder or infection that needs to be treated, or on the cell,tissue or part of the body that needs to be reached by the oligonucleotides of the present disclosure (e.g., in case of beneficial editing), an administration route or delivery method may be selected. Examples for delivery when an oligonucleotide is not delivered naked, are delivery agents or vehicles such as nanoparticles, like polymeric nanoparticles, liposomes, antibody-conjugated liposomes, cationic lipids, polymers, or cell-penetrating peptides.

[0162] Use of an excipient or transfection reagents may aid in delivery of the oligonucleotides (or compositions) to a cell and / or into a cell (preferably a cell wherein “beneficial editing” is to be achieved as outlined herein). Preferred are excipients or transfection reagents capable of forming complexes, nanoparticles, micelles, vesicles and / or liposomes that deliver each oligonucleotide or composition as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection reagents comprise polyethylenimine (PEI; ExGen500 (MBI Fermentas)), LipofectAMINE™ 2000 (lnvitrogen), lipofectinTM, or derivatives thereof, and / or viral capsid proteins that are capable of self-assembly into particles that can deliver each constituent as defined herein to a target cell.

[0163] An ASO can be linked to a moiety that enhances uptake of the ASO in cells. For instance, targeted delivery of oligonucleotides to liver hepatocytes using bi- or triantennary N-acetylgalactosamine (GalNAc) conjugates has previously described for, e.g., treating liver diseases, including Hepatitis B virus (HBV), non-alcoholic Fatty Liver Disease and genetic diseases (Debacker et al., 2020). Other moieties include, but are not limited to, cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell-penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly-arginine, oligolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment, or a single chain antigen binding domain such as a cameloid single domain antigen-binding domain. Accordingly in some embodiments, the ASO is delivered using drug conjugates with antibodies, nanobodies, cell penetrating peptides and aptamers. In one embodiment, the oligonucleotide is conjugated to an antibody, preferably a Fab fragment.

[0164] The oligonucleotides for use according to the present disclosure may be used in combination with another therapy. For instance, the oligonucleotides may be used with another hypercholesterolemia therapy or any therapy intended to lower LDL-C. In some embodiments, the hypercholesterolemia therapy is selected from the group consisting of: a statin, a PCSK9 inhibitor, a small interfering RNA, a selective microsomal triglyceride transfer protein inhibitor, an apolipoprotein B antisense oligonucleotide, a monoclonal antibody against angiopoietin-like protein 3 (ANGPTL3), Vitamin E, metformin, aspirin, a peroxisome proliferator-activated receptor (PPAR) agonist, a thyroid hormone receptor beta (THR-P) agonist, insulin, a sulfonylurea, a farnesoid X receptor (FXR) agonist, a glucagon-like peptide 1 (GLP-1) antagonist, a fibric acid derivative, a bile acid sequestrant, nicotinic acid, a selective cholesterol absorption inhibitor, red rice yeast, an omega 3 fatty acid, a fatty acid ester, and an adenosine triphosphate-citrate lyase (ACL) inhibitor.

[0165] Also provided herein is a method of treating or preventing a disease or condition associated with LDL in a subject, comprising administering to said subject a therapeutic that targets and disrupts the LDLR gene or transcript within the IDOL-binding region or 3’-UTR.

[0166] Also provided is an expression construct for use in the treatment or prevention of a disorder or condition associated with LDL in a subject, wherein the expression construct targets and disrupts the LDLR gene or transcript within the IDOL-binding region or the 3’- UTR.

[0167] Further provided is an ASO or a composition of the present disclosure for use in the treatment or prevention of a disorder or condition associated with LDL in a subject. In one embodiment, the disorder or condition associated with LDL in a subject is hypercholesterolemia (including familial hypercholesterolaemia), hypertriglyceridemia, hyperlipidaemia, non-alcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis or hepatocellular carcinoma. (Antisense) Oligonucleotides and compositions

[0168] Provided herein are, inter alia, (antisense)oligonucleotides (ASOs) for use in the methods of the present disclosure. Advantageously, the oligonucleotides are useful for use in site-directed A-to-I editing of a target LDLR RNA inside a cell with endogenous adenosine deaminase acting on RNA (ADAR). This means, the ASOs are useful in changing a wild-type (or endogenous) sequence into a mutated sequence to modulate protein expression, stability and / or function (“beneficial editing”).

[0169] As described herein, in the context of providing oligonucleotides for use in the prevention or treatment of a disease or a condition associated with low-density lipoprotein (LDL) in a subject, wherein the ASO effects site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine, and to achieve a beneficial editing, it is necessary to target a sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0170] The oligonucleotides may be of varying lengths. For instance, in some embodiments, the oligonucleotide has a length of between 20 and 200 nucleotides. In some embodiments, oligonucleotides range from about 23-80 nucleotides in length, e.g., about 23-50 nucleotides (nt) in length or about 40-80 nucleotides in length. In certain embodiments, the oligonucleotide has a length of 23-80 nucleotides. In one embodiment, the oligonucleotide is 30-50 nt long. In some embodiments, the oligonucleotide has a length of 23-80, 23-70, 23-60, 23-50, 23-40, 23-33, or 23-38 nucleotides. In some embodiments, the oligonucleotide has a length of 25-80, 25-70, 25-60, 25-50, 25-40 nucleotides. In some embodiments, the oligonucleotide has a length of 30-80, 30-70, 30-60, 30-50, 30-40 nucleotides. In some embodiments, the oligonucleotide has a length of 40-80, 50-80, 60-80, or 70-80 nucleotides. In one embodiment, the oligonucleotide has a length of 28-60, 28-55, 28-50, 28-45, 28-40, 28-35, or 28-30 nucleotides. In one embodiment, the oligonucleotide has a length of 25-60, 25-55, 25-50, 25-45, 25-40, 25-35, or 25-30 nucleotides. In one embodiment, the oligonucleotide has a length of 28-70 nucleotides. In one embodiment, the oligonucleotide has a length of: (i) 28-60, 28-55, or 28-45 nucleotides; (ii) 59 nucleotides; or (iii) no more than 45 nucleotides.

[0171] In some embodiments, the oligonucleotide has a length of at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. In one embodiment, the oligonucleotide has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. In one embodiment, the oligonucleotide has a length of 25 nucleotides. In one embodiment, the oligonucleotide has a length of 30 nucleotides. In one embodiment, the oligonucleotide has a length of 32 nucleotides. In one embodiment, the oligonucleotide has a length of 33 nucleotides. In one embodiment, the oligonucleotide has a length of 34 nucleotides. In one embodiment, the oligonucleotide has a length of 35 nucleotides. In one embodiment, the oligonucleotide has a length of 36 nucleotides. In one embodiment, the oligonucleotide has a length of 45 nucleotides. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the present disclosure. In one embodiment, the oligonucleotide has a length of 40 nucleotides.

[0172] The oligonucleotides of the present disclosure may be symmetrical or asymmetrical. In one embodiment, the oligonucleotide is asymmetrical, preferably wherein the ASO has an asymmetry of: a) 25-1-8; b) 23-1-12; or c) 29-1-15. In one embodiment, the oligonucleotide has an asymmetry of 25-1-8. In one embodiment, the oligonucleotide has an asymmetry of 23-1-12. In one embodiment, the oligonucleotide has an asymmetry of 29-1-15.

[0173] In one embodiment, the oligonucleotide has a length of 45 or less nucleotides and wherein outside of the CBT (5’- N+1N0N-1-3’) no more than 4 nucleotides aredeoxynucleotides. In one embodiment, the oligonucleotide has a length of 40 nucleotides. In one embodiment, the oligonucleotide has a length of 45 nucleotides.

[0174] Specifically, in one embodiment, the ASO has a length of 20-200 nucleotides (nt) comprising: (i) a nucleic acid sequence substantially complementary to the target RNA sequence derived from the an endogenous LDLR gene; and (ii) a central base triplet (CBT) of 3 nucleotides (5’- N+1 N0 N-1 -3’) with a central nucleotide (N0) that is directly opposite to the target adenosine to be edited when the ASO is hybridised to the target RNA sequence.

[0175] While not intending to be bound by any particular theory of operation, it is believed that nucleobase and backbone linkage modifications of ASOs are useful in stabilising and improving the editing efficacy and lysosomal stability of the oligonucleotides of the present disclosure. These modifications also have the potential to reduce the off-target editing of the different ASOs. Since the one or more modifications can be synthetically transferred to various oligonucleotide sequences, such modifications have the potential to improve the editing efficacy of oligonucleotides with different specificities. Hence, the oligonucleotide used to target the target RNA can be unmodified but is preferably modified.

[0176] For instance, the ASOs described herein may comprise one or more chemical modifications. In one embodiment, the oligonucleotide comprises chemically modified nucleobases and / or internucleoside linkage modifications. In a preferred embodiment, the ASO comprises a modification at the 2’-position of the sugar residue. In one embodiment, the oligonucleotide comprises 2’-sugar modifications, wherein the 2’-sugar modifications comprise, e.g., 2’-Fluoro (F), 2’-O-methyl (2’-OMe), 2'-O-methoxy-ethyl (2’-MOE), 2’-FANA, etc.. In one embodiment, the oligonucleotide contains an iso-uridine (SbU) modification. In one embodiment, the SbU is at N0.

[0177] In one embodiment, the oligonucleotide comprises DNA and / or RNA. In one embodiment, the oligonucleotide is single stranded.

[0178] In some embodiments, the oligonucleotide has an editing efficacy of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80 %, or 90%. In some embodiments, the oligonucleotide has an editing efficacy of at least 5%. In some embodiments, the oligonucleotide has an editing efficacy of at least 10%. In some embodiments, the oligonucleotide has an editing efficacy of at least 20%.

[0179] In some embodiments, the oligonucleotide has an editing efficacy of between 5% and 100%. In some embodiments, the oligonucleotide has an editing efficacy of between 5% and 90%, between 5% and 80%, or between 5% to 70%. In some embodiments, the oligonucleotide has an editing efficacy of between 10% and 90%, between 10% and 80%, or between 10% to 70%. In some embodiments, the oligonucleotide has an editing efficacy of between 10% and 60%, between 20% and 60%, between 20% and 70%, or between 30% and 70%. In some embodiments, the oligonucleotide has an editing efficacy of between 5%and 10%, between 5% and 15%, or between 5% and 20%. In some embodiments, the oligonucleotide has an editing efficacy of between 5% and 30%. In some embodiments, the oligonucleotide has an editing efficacy of between 10% and 20%.

[0180] In some embodiments, the oligonucleotide has an editing efficacy of about 5%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the oligonucleotide has an editing efficacy of about 5%. In some embodiments, the oligonucleotide has an editing efficacy of about 6%. In some embodiments, the oligonucleotide has an editing efficacy of about 7%. In some embodiments, the oligonucleotide has an editing efficacy of about 8%. In some embodiments, the oligonucleotide has an editing efficacy of about 9%. In some embodiments, the oligonucleotide has an editing efficacy of about 10%. In some embodiments, the oligonucleotide has an editing efficacy of about 15%. In some embodiments, the oligonucleotide has an editing efficacy of about 20%. In some embodiments, the oligonucleotide has an editing efficacy of about 50%. In some embodiments, the oligonucleotide has an editing efficacy of about 60%. In some embodiments, the oligonucleotide has an editing efficacy of about 70%. In some embodiments, the oligonucleotide has an editing efficacy of about 80%. In some embodiments, the oligonucleotide has an editing efficacy of about 90%.

[0181] Uniform blocks or stretches of large 2’-sugar modifications within the ASO tend to interfere with the binding of ADAR´s dsRNA binding proteins (dsRBDs). Hence, the oligonucleotides of the present disclosure may be modified in a way to avoid such interference. For example, the oligonucleotides are modified such that they do not comprise continuous stretches or uniform blocks of nucleotides carrying the same chemical modification (i.e., avoidance of a block-like modification structure). Hence, in one embodiment, the oligonucleotide is not uniformly modified. In one embodiment, the oligonucleotide contains no uniform blocks and / or no block-like modification structure. In one embodiment, the oligonucleotide does not comprise continuous stretches or uniform blocks of nucleotides carrying the same chemical modification at the 2’ position of the sugar moiety. In a preferred embodiment, the oligonucleotides are modified as to avoid uniform blocks of 2’-F- and / or 2’-OMe-modifications. In some embodiments, the oligonucleotides do not contain any blocks of 2’-H (DNA). In a preferred embodiment, the oligonucleotides are modified as to avoid uniform blocks of 2’-F-modifications, 2’-OMe-modifications, and / or 2’-H groups. Notably, the maximum block size of 2’-F- and 2’-OMe-modifications can differ. Accordingly, in one embodiment, the oligonucleotide comprises larger blocks of 2’F-modified nucleotides. In one embodiment, the oligonucleotide comprises larger blocks of 2’OMe- modified nucleotides. In one embodiment, 2’-OMe-modifications are accepted in smallerblocks than 2’-F-modifications. In one embodiment, 2’-F-modifications are accepted in larger blocks than 2’-OMe-modifications.

[0182] The oligonucleotide of the present disclosure may contain some “continuous stretch(es)” or “uniform block(s)” of a certain length. However, in one embodiment, no more than 6 consecutive nucleotides have the same 2’-modification. In one embodiment, the size or length of the “continuous stretch(es)” or “uniform block(s)” is 2, 3, 4, 5, or 6 nucleotides long. In one embodiment, the size or length of the “continuous stretch(es)” or “uniform block(s)” is no more than 4, 5, or 6 nucleotides long. In one embodiment, the oligonucleotide comprises no more than 4, 5, or 6 consecutive nucleotides comprising a 2’-F modification. In one embodiment, the oligonucleotide comprises no more than 4, 5, or 6 consecutive nucleotides comprising a 2’-OMe modification. In one embodiment, one or more uniform blocks are interrupted. Interruption can take place by any other chemical modification (e.g., DNA, RNA, 2’-F, 2’-OMe, 2’-MOE, LNA, etc.). In one embodiment, one or more uniform blocks of 2’-F-modified nucleotides are interrupted, preferably by 2´-OMe-modified nucleotides. In one embodiment, one or more uniform blocks of 2´-OMe-modified nucleotides are interrupted, preferably by 2’-F-modified nucleotides. In some embodiments the blocks are disrupted by DNA.

[0183] The oligonucleotides may contain internucleoside linkage modifications. Internucleoside linkage modifications, such as PS linkages, tend to have a positive effect, inter alia, on the pharmacokinetics as well as stability, protein binding, and intracellular localization of ASOs. Accordingly, the oligonucleotides may comprise one or more internucleoside linkage modifications. In one embodiment, the ASO comprises at least one internucleoside linkage modification selected from the group consisting of phosphorothioate (PS), 3'-methylenephosphonate, 5'-methylenephosphonate, 3'-phosphoroamidate, 2'- 5'phosphodiester, methanesulfonyl (mesyl) and phosphoryl guanidine (PN). In one embodiment, the oligonucleotide contains at least one methanesulfonyl (mesyl) linkage modification and / or at least one PS linkage modification. In one embodiment, the internucleoside linkage modification is methanesulfonyl (mesyl). In one embodiment, the internucleoside linkage modification is PS. In one embodiment, the internucleoside linkage modification is a 3’-methylenephosphonate linkage. In one embodiment, the internucleoside linkage modification is a 5’-methylenephosphonate linkage. In one embodiment, the internucleoside linkage modification is a 3’-phosphoroamidate linkage. In one embodiment, the internucleoside linkage modification is a 2’-5’-phosphodiester linkage. In one embodiment, the internucleoside linkage modification is a phosphoryl guanidine (PN) linkage. In one embodiment, the nucleic acid analogue is a PNA (peptide nucleic acid). In one embodiment, the nucleic acid analogue is PMO (phosphorodiamidate linked morpholino). In one embodiment the oligonucleotide comprises PS, phosphate (PO), and / orphosphorodiamidate linkages. In one embodiment, the oligonucleotide contains a continuous stretch of PS linkages. In one embodiment, the continuous stretch of PS linkages is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more linkages long.

[0184] Oligonucleotides seem to benefit from having a base level of internucleoside linkage modifications. In one embodiment, at least 15% modification is beneficial to achieve good RNA editing. In one embodiment, the internucleoside linkage modification content is at least 15%. In one embodiment, the internucleoside linkage modification content is at least 30%. In one embodiment, the internucleoside linkage modification content is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, or 90%. In one embodiment, no more than 95%, 90%, 85%, 80%, 70%, 60%, 50%, 40%, or 30% of the linkages are internucleoside linkage modifications. However, at the same time, it is desirable to reduce overall PS content to reduce, e.g., toxicity and non-specific protein binding. In one embodiment, no more than 95%, 90%, 85%, 80%, 70%, 60%, 50%, 40%, 30% or 20% of the linkages are internucleoside linkage modifications.

[0185] The CBT may carry different modifications and permutations of the various modifications. In certain embodiments, the CBT is chemically modified. That is, positions N- 1, N0 and / or N+1 may carry modifications at the 2’ position. In one embodiment, only one position within the CBT is chemically modified. In one embodiment, two positions within the CBT are chemically modified. In one embodiment, all positions within the CBT are chemically modified. In one embodiment, the regions 3’ and 5’ to the CBT do not contain more than a total of 6 deoxyribonucleosides or have a total deoxyribonucleoside content of 5-50%.

[0186] In one embodiment, each of the three nucleosides of the CBT is either singularly or a combination of: (i) a deoxyribonucleotide; and / or (ii) 2’-FANA-modification; and / or (iii) 2’-O- methyl-modification; and / or (iv) 2’-F-modification. In one embodiment, (i) N+1is 2’-F, 2’- FANA, DNA, or 2’-O-methyl; and / or (ii) N0 is 2’-FANA or DNA, optionally N0 is deoxycytidine, or FANA-cytidine; and / or (iii) N-1 is 2’-FANA, DNA, or 2’-O-methyl.

[0187] The nucleotides 5’ and / or 3’ to the CBT may be chemically modified to carry 2’- modifications. In one embodiment, the nucleotides 5’ and / or 3’ to the CBT are 2’-O-alkyl- modified or 2’-F-modified.

[0188] In some embodiments, one or more of the nucleosides in the CBT is a 2’-O-Me modified nucleoside. In some embodiments, none of the nucleosides in the CBT is a 2’-O- Me modified nucleoside.

[0189] Oligonucleotides of different lengths may require a different mixture of particular 2’- modifications and internucleoside linkage modifications in order to provide optimal RNA editing. The shorter the oligonucleotide, the better might be the endosomal escape. Moreover, toxicity of the particular oligonucleotide may also depend on its length. Also,shorter oligonucleotides may experience higher specificity. On the other hand, while longer oligonucleotides may bind stronger or faster to their respective RNA target, editing-boosting bulges, mismatches and wobbles may also work better in long oligonucleotides.

[0190] Loop-hairpin or “stem-loop” structured oligonucleotides have previously been described (WO 2020 / 001793) and used successfully to harness ADARs with oligonucleotides. However, they are comparably large and – without being bound by any theory–- the inventors believe that a more intelligent design of the ASO can form a substrate duplex that is also very well and quickly recognized by endogenous ADAR so that the large recruitment motifs can be omitted. For the delivery and manufacture this is a clear advantage as much shorter ASOs can be designed. Hence, the oligonucleotides may or may not include a recruitment motif for a deaminase. The oligonucleotides for use as described herein form an RNA duplex to which the ADAR enzyme adheres, whereby the editing efficiency is increased. In one embodiment, the oligonucleotide does not comprise a loop-hairpin structured ADAR recruitment motif.

[0191] Stability and editing efficacy of the various oligonucleotides may be influenced by the amount and consecutive arrangement of the particular 2’-modifications. That is, repeated modifications of the same type of 2’-modification have been found to be detrimental to the RNA editing efficacy of the oligonucleotide. Hence, oligonucleotides generally do not contain uniform blocks of more than about 6 nucleotides with the same 2’-modification. For example, in one embodiment, the oligonucleotide comprises no more than 6 consecutive nucleotides that are 2’-F-modified and / or 2’-O-alkyl-modified. In one embodiment, no more than 4, 5, or 6 consecutive nucleotides are 2’-F-modified; and / or no more than 4, 5, or 6 consecutive nucleotides are 2’-O-alkyl-modified.

[0192] In one embodiment, the 2’-O-alkyl-modification is a 2’-OMe-modification.

[0193] In one embodiment, 2’-OMe modifications are preferred over DNA close to the CBT. In one embodiment, 2’-F modifications are preferred over DNA close to the CBT.

[0194] Also provided herein are antisense oligonucleotides (ASOs) comprising a sequence having at least 80% complementarity to a target RNA sequence derived from a sequence of the endogenous LDLR gene, optionally wherein the gene encodes LDLR comprising SEQ ID NO: 1, wherein the ASO mediates A-to-I editing of a target adenosine in the target RNA such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; (iv) increased in LDLR protein expression; and / or (v) increased activity or function to take up LDL; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0195] In some aspects, the present disclosure provides antisense oligonucleotides (ASOs) for site-directed adenosine-inosine (A-to-I) editing of a target adenosine in a targetRNA sequence encoded by a sequence of a low-density lipoprotein receptor (LDLR) gene. The ASOs provide herein comprise a nucleobase sequence substantially complementary to the target RNA sequence. The ASOs provided herein comprise a central base triplet (CBT) of 3 nucleosides (5’ - N+1N0N-1- 3’) with a central nucleoside (N0) that is directly opposite to the target adenosine to be edited when the ASO is hybridized to the target RNA sequence.

[0196] In some embodiments, the ASOs described herein are capable of recruiting an endogenous ADAR enzyme, e.g., by forming an RNA duplex between the ASO and the target RNA sequence to which the ADAR enzyme associates. ASOs described herein are capable of recruiting an endogenous ADAR enzyme and without a loop-hairpin structured ADAR recruitment motif formed by additional sequences separate from the sequence complementary to the target sequence.

[0197] In some embodiments, ASOs provided herein can be 20-200 nucleosides (nt) in length. In some embodiments, an ASO is 20-200 nucleosides in length (e.g., 20-40, 30-50, 40-60, 60-80, 80-100, 100-120, 120-140, 140-160, 160-180, 180-200, 20-60, 40-100, 60- 120, 80-160, 100-180, or 120-200 nucleosides in length). In some embodiments, an ASO is 20-50 (e.g., 20-50, 20-40, 20-30, 30-50, 30-40, or 40-50) nucleosides in length. In some embodiments, an ASO is 30-50 (e.g., 30-50, 30-40, or 40-50) nucleosides in length. In some embodiments, an ASO is 34 nucleosides in length. In some embodiments, an ASO is 36 nucleosides in length. In some embodiments, an ASO is 37 nucleosides in length. In some embodiments, an ASO is 45 nucleosides in length.

[0198] In some embodiments, ASOs of the present disclosure can be asymmetrical. An asymmetrical ASO has the following structure: (5’ – X-N0-Y – 3’), wherein X (encompassing the region 5’ to N0) and Y (encompassing the region 3’ to N0) are of different lengths, wherein N0 is the nucleotide that is directly opposite to the target adenosine to be edited when the ASO is hybridized to a target RNA sequence (N0=1 nucleoside). In some embodiments, X is greater than Y. In some embodiments, X is 15-40 nucleotides (e.g., 15-20, 15-30, 20-25, 25- 30, 30-35, 35-40, 20-30, 25-35, 20-40, or 30-40 nucleotides) in length. In some embodiments, Y is 3-20 nucleotides (e.g., 3-5, 3-10, 3-15, 5-10, 10-15, 15-20, 5-15, or 10-20 nucleotides) in length. In some embodiments, an ASO described herein has an asymmetrical structure of 25-1-8. In some embodiments, an ASO described herein has an asymmetrical structure of 23-1-12. In some embodiments, an ASO described herein has an asymmetrical structure of 29-1-15. In some embodiments, an ASO described herein has an asymmetrical structure of 29-1-6. In some embodiments, an ASO described herein has an asymmetrical structure of 29-1-7. In some embodiments, an ASO described herein has an asymmetrical structure of 29-1-8. In each of the represented asymmetrical structures, “1” represents the N0nucleoside of the CBT, and the numbers from left to right represent the number of nucleosides from 5’ to 3’ of the ASO.

[0199] In some embodiments, an ASO described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified nucleosides. In some embodiments, an ASO described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, an ASO described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified nucleosides and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages.

[0200] In some embodiments, the one or more modified nucleosides comprise 2’-modified nucleosides, e.g., one or more 2’-modified nucleosides selected from: a 2’- deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O-methoxyethyl (2’-MOE) modified nucleoside, a 2’-fluoro-arabinonucleic Acid (2’-FANA) modified nucleoside, bridged nucleic acid (BNA), locked nucleic acid (LNA), constrained ethyl nucleosides (cET), and combinations thereof. In some embodiments, each nucleoside of an ASO described herein is a 2’-modified nucleoside selected from: a 2’- deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O-methoxyethyl (2’-MOE) modified nucleoside, a 2’-fluoro-arabinonucleic Acid (2’-FANA) modified nucleoside, bridged nucleic acid (BNA), locked nucleic acid (LNA), and constrained ethyl nucleosides (cET). In some embodiments, each nucleoside of an ASO described herein is a 2’-modified nucleoside selected from: a 2’-deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, and a 2’- O-methoxyethyl (2’-MOE) modified nucleoside. In some embodiments, each nucleoside of an ASO described herein is a 2’-modified nucleoside selected from: a 2’-deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O- methoxyethyl (2’-MOE) modified nucleoside, locked nucleic acid (LNA). In some embodiments, an ASO described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, or more) LNAs. In some embodiments, an ASO described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, or more) LNAs at the 5’ and / or 3’ terminus of the ASO.

[0201] In some embodiments, an ASO described herein comprises an iso-uridine (SbU) modification. In some embodiments, an ASO described herein comprises an iso-uridine (SbU) modification at position N0. In some embodiments, an ASO described herein comprises an iso-uridine (SbU) modification at position N0, and each of the nucleosides other than N0is selected from a 2’-deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O-methoxyethyl (2’-MOE) modified nucleoside, and a locked nucleic acid (LNA).

[0202] In some embodiments, in any one of the ASOs described herein, each nucleoside in the CBT (5’ - N+1N0N-1- 3’) is a 2’-modified nucleoside. In some embodiments, in any one of the ASOs described herein, each nucleoside in the CBT (5’ - N+1N0N-1- 3’) is a 2’- modified nucleoside selected from: a deoxyribonucleotide (DNA), a 2’-MOE modifiednucleoside, and a 2’-F modified nucleoside. In some embodiments, in any one of the ASOs described herein, in the CBT (5’ - N+1N0N-1- 3’), N+1is 2’-F modified nucleoside, DNA or a 2’-MOE modified nucleoside, and / or N0is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and / or N-1is DNA (e.g., deoxyinosine or deoxycytidine). In some embodiments, in any one of the ASOs described herein, in the CBT (5’ - N+1 N0 N-1 - 3’), N+1 is a 2’-F modified nucleoside, N0 is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and N-1 is DNA (e.g., deoxyinosine, deoxycytidine, deoxythymine, or deoxyadenosine). In some embodiments, in any one of the ASOs described herein, in the CBT (5’ - N+1 N0 N-1 - 3’), N+1 is DNA, N0 is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and N-1 is DNA (e.g., deoxyinosine, deoxycytidine, deoxythymine, or deoxyadenosine). In some embodiments, in any one of the ASOs described herein, in the CBT (5’ - N+1 N0 N-1 - 3’), N+1 is a 2’-MOE modified nucleoside, N0 is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and N-1 is DNA (e.g., deoxyinosine, deoxycytidine, deoxythymine, or deoxyadenosine). In some embodiments, in any one of the ASOs described herein, each of the internucleoside linkage between the CBT nucleosides is a phosphorothioate internucleoside linkage.

[0203] In some embodiments, in any one of the ASOs described herein, no more than 6 (e.g., no more than 6, no more than 5, no more than 4, no more than 3, or no more than 2) consecutive nucleosides of the ASO have the same 2’-modification (e.g., a 2’-F modification or a 2’-O-Me modification). In some embodiments, in any one of the ASOs described herein, the regions 3’ to the CBT do not contain more than a total of 6 (e.g., 6, 5, 4, 3, 2, 1, or 0) deoxyribonucleosides. In some embodiments, in any one of the ASOs described herein, the regions 5’ to the CBT do not contain more than a total of 6 (e.g., 6, 5, 4, 3, 2, 1, or 0) deoxyribonucleosides. In some embodiments, in any one of the ASOs described herein, the regions 3’ to the CBT do not contain more than a total of 6 (e.g., 6, 5, 4, 3, 2, 1, or 0) deoxyribonucleosides, and the regions 5’ to the CBT do not contain more than a total of 6 (e.g., 6, 5, 4, 3, 2, 1, or 0) deoxyribonucleosides. In some embodiments, in any one of the ASOs described herein, the ASO, except for the CBT region, does not contain more than a total of 6 (e.g., 6, 5, 4, 3, 2, 1, or 0) deoxyribonucleosides.

[0204] In some embodiments, any one of the ASOs described herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, the one or more modified internucleoside linkage is selected from phosphorothioate (PS), 3'-methylenephosphonate, 5'-methylenephosphonate, 3'- phosphoroamidate, 2'-5'phosphodiester, methanesulfonyl (mesyl) and phosphoryl guanidine (PN), and combinations thereof. In some embodiments, an ASO described herein comprises at least one (e.g., 1, 2, 3, 4, 5, 6 or more) methanesulfonyl (mesyl) internucleoside linkage. In some embodiments, an ASO described herein comprises at least one PS (e.g., 1, 2, 3, 4, 5, 6 or more) internucleoside linkage. In some embodiments, an ASO described hereincomprises at least one (e.g., 1, 2, 3, 4, 5, 6 or more) methanesulfonyl (mesyl) internucleoside linkage and comprises at least one PS (e.g., 1, 2, 3, 4, 5, 6 or more) internucleoside linkage. In some embodiments, in an ASOs described herein, at least 15% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or higher) of the internucleoside linkages are modified internucleoside linkages. In some embodiments, in an ASOs described herein, at least 30% (e.g., at least 30%, at least 40%, at least 50%, at least 60%, or higher) of the internucleoside linkages are modified internucleoside linkages. In some embodiments, any one of the ASOs described herein comprises 1-5 (e.g., 1, 2, 3, 4, or 5) phosphodiester internucleoside linkages.

[0205] In some embodiments, an ASOs described herein is for site-directed A-to-I editing of a target adenosine in a target RNA sequence in a 3’-untranslated region (3’-UTR) of LDLR RNA. In some embodiments, the target adenosine and / or target RNA sequence is within the proximal region of the 3’-UTR (i.e., corresponding to a region immediately 3’ to the coding sequence) of LDLR RNA. In some embodiments, one or more (e.g., 1, 2, 3, or more) adenylate uridylate rich elements (AREs) are located 3’ and / or 5’ of the target adenosine to be edited. In some embodiments, each of the one or more AREs comprises a core sequence of AUUUA. In some embodiments, the target adenosine is located within ARE1.

[0206] In some embodiments, an ASOs described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 98, 100, 111, 113, 115, or 119 in the 3’UTR as set forth in SEQ ID NO: 38 , or to the adenosine at positions 189, 191, or 197 in the 3’UTR as set forth in SEQ ID NO: 228. In some embodiments, the A to I editing results in a nucleobase substitution that corresponds to A98I, A100I, A111I, A113I, A115I, or A119I in the 3’UTR as set forth in SEQ ID NO: 38, or to A189I, A191I or A197I in the 3’UTR as set forth in SEQ ID NO: 228.

[0207] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 98 in the 3’UTR as set forth in SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A98I in the 3’UTR as set forth in SEQ ID NO: 38.

[0208] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 100 in the 3’UTR as set forth in SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A100I in the 3’UTR as set forth in SEQ ID NO: 38.

[0209] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 111 in the 3’UTR as set forthin SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A111I in the 3’UTR as set forth in SEQ ID NO: 38.

[0210] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 113 in the 3’UTR as set forth in SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A113I in the 3’UTR as set forth in SEQ ID NO: 38.

[0211] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 115 in the 3’UTR as set forth in SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A115I in the 3’UTR as set forth in SEQ ID NO: 38.

[0212] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 119 in the 3’UTR as set forth in SEQ ID NO: 38, the A to I editing results in a nucleobase substitution that corresponds to A119I in the 3’UTR as set forth in SEQ ID NO: 38.

[0213] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 189 in the 3’UTR as set forth in SEQ ID NO: 228, the A to I editing results in a nucleobase substitution that corresponds to A189I in the 3’UTR as set forth in SEQ ID NO: 228.

[0214] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 191 in the 3’UTR as set forth in SEQ ID NO: 228, the A to I editing results in a nucleobase substitution that corresponds to A191I in the 3’UTR as set forth in SEQ ID NO: 228.

[0215] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine corresponding to the adenosine at position 197 in the 3’UTR as set forth in SEQ ID NO: 228, the A to I editing results in a nucleobase substitution that corresponds to A197I in the 3’UTR as set forth in SEQ ID NO: 228.

[0216] In some embodiments, an ASO described herein comprises at least 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, or more) consecutive nucleobases of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, an ASO described herein comprises or consists of the nucleobase sequence of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

[0217] In some embodiments, an ASO described herein comprises or consists of the nucleobase sequence of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210- 227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T, wherein each nucleoside of the ASO is a modified nucleoside (e.g., any one of the modified nucleosides described herein), wherein the ASO comprises one or more modified internucleoside linkages (e.g., any one of the modified internucleoside linkages described herein), wherein in the CBT (5’ - N+1 N0 N-1 - 3’), N+1 is 2’-F modified nucleoside, DNA or a 2’-MOE modified nucleoside, and / or N0 is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and / or N-1 is DNA (e.g., deoxyinosine or deoxycytidine).

[0218] In some embodiments, any one of the ASOs described herein is conjugated to a GalNAc moiety (e.g., at the 5’ end or the 3’ end).

[0219] In some embodiments, the ASO is selected from: AI-1916, AI-1917, AI-1918, AI- 2288, AI-2289, AI-2290, AI-3483, AI-3118, AI-3484, AI-3476, AI-3477, AI-3481, AI-3487, AI- 4167, AI-4168, AI-4169, AI-4170, AI-4171, AI-4172, AI-4173, AI-4174, AI-1940, AI-1941, AI- 1942, AI-2260, AI-2268, AI-3127, AI-3478, AI-3480, AI-3828, AI-3829, AI-3837, AI-3838, and AI-5040.

[0220] In some embodiments, A to I editing in the 3’-UTR of LDLR RNA prevents or reduces (e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more) negative regulation of the LDLR RNA and / or increases (e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, by at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 2-fold, at least 5-fold, at least 10%) stability of LDLR RNA, relative to the LDLR RNA prior to the A to I editing. In some embodiments, A to I editing in the 3’-UTR of LDLR RNA increases (e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, by at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 2-fold, at least 5-fold, at least 10%) LDLR protein expression, relative to the LDLR RNA prior to the A to I editing.

[0221] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine in a target RNA sequence in a translated region (TR) of LDLR RNA. In some embodiments, the target adenosine and / or target RNA sequence is in a region of LDLR RNA that encodes an inducible degrader of LDLR protein (IDOL)-binding region of LDLR protein. In some embodiments, the target adenosine is a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as set forth in SEQ ID NO: 2, or to N821, S822, or K832 in the LDLR protein as set forth in SEQ IDNO: 175. In some embodiments, wherein the A-to-I editing of the target adenosine results in an amino acid substitution in the LDLR protein, wherein the amino acid substitution corresponds to N819D, S820G, K830E and K830R in the LDLR protein as set forth in SEQ ID NO: 2, or to N821D, S822G, K832E and K832R in the LDLR protein as set forth in SEQ ID NO: 175.

[0222] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to N819 in the LDLR protein as set forth in SEQ ID NO: 2, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to N819D in the LDLR protein as set forth in SEQ ID NO: 2.

[0223] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to S820 in the LDLR protein as set forth in SEQ ID NO: 2, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to S820G in the LDLR protein as set forth in SEQ ID NO: 2.

[0224] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to K830 in the LDLR protein as set forth in SEQ ID NO: 2, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to K830E or K830R in the LDLR protein as set forth in SEQ ID NO: 2.

[0225] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to N821 in the LDLR protein as set forth in SEQ ID NO: 175, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to N821D in the LDLR protein as set forth in SEQ ID NO: 175.

[0226] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to S822 in the LDLR protein as set forth in SEQ ID NO: 175, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to S822G in the LDLR protein as set forth in SEQ ID NO: 175.

[0227] In some embodiments, an ASO described herein is for site-directed A-to-I editing of a target adenosine that is a nucleoside of a codon encoding an amino acid corresponding to K832 in the LDLR protein as set forth in SEQ ID NO: 175, and the A-to-I editing of the target adenosine results in an amino acid substitution corresponding to K832E or K832R in the LDLR protein as set forth in SEQ ID NO: 175.

[0228] In some embodiments, an ASO described herein comprises at least 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22,at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, or more) consecutive nucleobases of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T. In some embodiments, an ASO described herein comprises or consists of the nucleobase sequence of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

[0229] In some embodiments, an ASO described herein comprises or consists of the nucleobase sequence of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T, wherein each nucleoside of the ASO is a modified nucleoside (e.g., any one of the modified nucleosides described herein), wherein the ASO comprises one or more modified internucleoside linkages (e.g., any one of the modified internucleoside linkages described herein), wherein in the CBT (5’ - N+1 N0 N-1 - 3’), N+1 is 2’-F modified nucleoside, DNA or a 2’-MOE modified nucleoside, and / or N0 is DNA (e.g., deoxycytidine or deoxy-isouridine (SbU)), and / or N-1 is DNA (e.g., deoxyinosine or deoxycytidine).

[0230] In some embodiments, any one of the ASOs described herein is conjugated to a GalNAc moiety (e.g., at the 5’ end or the 3’ end).

[0231] In some embodiments, the ASO is selected from: AI-1904, AI-1905, AI-1906, AI- 1907, AI-1908, AI-1909, AI-1910, AI-1911, AI-1912, AI-1913, AI-1914, and AI-1915, AI-1928, AI-1929, AI-1930, AI-1931, AI-1932, AI-1933, AI-1934, AI-1935, AI-1936, AI-1937, AI-1938, AI-1939, AI-2261, AI-2269 , AI-3145, AI-3445, AI-3444, AI-2267, AI-3447, AI-3448, AI-3449, AI-3450, AI-3451, AI-3455, AI-3456, AI-3469, AI-3474, AI-3841, AI-3840, AI-3839, AI-3833, AI-3836, AI-3835, AI-3834, AI-3139, AI-3463, and AI-3464.

[0232] In some embodiments, wherein the A to I editing results in an amino acid substitution in LDLR that prevents or reduces (e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or more): (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation, relative to an LDLR protein without the amino acid substitution.

[0233] The oligonucleotides provided herein target RNA sequences derived from a sequence encoding a low-density lipoprotein receptor (LDLR) protein, e.g., a gene or allele encoding LDLR. The LDLR sequence may be endogenous or exogenous. The specific oligonucleotides may comprise deoxyribonucleotides (DNA) and / or ribonucleotides (RNA) as well as a mixture of chemical modifications, including internucleoside linkage modifications and modifications at the 2’-position of the sugar residue. In some embodiments, theoligonucleotide targets an RNA sequence derived from human LDLR. In one embodiment, the oligonucleotide comprises one of the sequences selected from: SEQ ID NOs: 7-36, 77- 82, 117-124, 140-143, 195-198, and 220-227. In one embodiment, the oligonucleotide comprises a sequence as listed in TABLE 5, TABLE 18, Table 23, or TABLE 28. In some embodiments, the oligonucleotide targets an RNA sequence derived from murine LDLR. In some embodiments, the oligonucleotide comprises one of the sequences selected from: SEQ ID NOs: 110-116, 125-139, 144-173, 180-194, and 199-219. In some embodiments, the oligonucleotide comprises a sequence as listed in TABLE 22, TABLE 24, TABLE 26, TABLE 30, TABLE 31, or TABLE 32.

[0234] The oligonucleotides of the present disclosure may be used to mediate A-to-I editing of protein coding or protein non-coding RNAs. In one embodiment, the oligonucleotides of the present disclosure are used to mediate A-to-I editing of protein coding RNA. In one embodiment, the oligonucleotide mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in the amino acid substitution N819D.

[0235] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – ACGGGGUUGUCAAAGUUGAUGCUGUCIAUGUUCU – 3’ (SEQ ID NO: 22), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA&mC*mG*fG*fG*mG*fU*mU*fG*fU*fC*fA&fA*mA*fG*mU*fU*fG*fA*fU*fG&mCfU*fG*fU*d C*dI*mAfU*mG*mU*mU*mC*mU – 3’ (SEQ ID NO: 7; AI-1904), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0236] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGGGUUGUCAAAGUUGAUGCUGUCIAUGUUCUUAAG – 3’ (SEQ ID NO: 23), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG&mG*fG*mG*fU*mUfG*fU*fC*fA&fA*mA*fGmU*fU*fG*fA*fU*fG&mCfU*fG*fU*dC*dI*mAf U*mG*mU*fU*mC*fU*mU*mA*mA*mG – 3’ (SEQ ID NO: 8; AI-1905), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0237] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – AUAGACGGGGUUGUCAAAGUUGAUGCUGTCIAUGUUCUUAAGCCG – 3’ (SEQ ID NO: 24), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA*mU*mA*fG*fA*fC*mG*fG*mG*fG*fU*fU*fG*fU*mC*fA&mA*fA*fG*fU*mU*fG*mA*fU*mG& mCmUfG*dT*dC*dImAfUfG*fU*mU*fC*fU*fU*mA*fA*fG*mC*mC*mG – 3’ (SEQ ID NO: 9; AI- 1906), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the resulting LDLR protein variantcomprises SEQ ID NO: 3. In one embodiment, the oligonucleotide mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in the amino acid substitution S820G.

[0238] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGACGGGGUUGUCAAAGUUGAUGCCIUUGAUGU – 3’ (SEQ ID NO: 25), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fA*fC*mG*fG*mG*fG*fU*fU*fG&fU*mC*fA*mA*fA*fG*fU*fU*fG&mAfU*fG*fC*d C*dI*mUfU*mG*mA*mU*mG*mU – 3’ (SEQ ID NO: 10; AI-1907), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dI and dC is deoxyinosine and deoxycytidine, respectively.

[0239] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – GACGGGGUUGUCAAAGUUGAUGCCIUUGAUGUUCUU – 3’ (SEQ ID NO: 26), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG&mA*fC*mG*fG*mGfG*fU*fU*fG&fU*mC*fAmA*fA*fG*fU*fU*fG&mAfU*fG*fC*dC*dI*mUf U*mG*mA*fU*mG*fU*mU*mC*mU*mU – 3’ (SEQ ID NO: 11; AI-1908), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dI and dC is deoxyinosine and deoxycytidine, respectively.

[0240] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - CUGAUAGACGGGGUUGUCAAAGUUGAUGCCIUUGAUGUUCUUAAG – 3’ (SEQ ID NO: 27), wherein. In one embodiment, the ASO comprises a structure of: 5’ - mC*mU*mG*fA*fU*fA*mG*fA*mC*fG*fG*fG*fG*fU*mU*fG&mU*fC*fA*fA*mA*fG*mU*fU*mG& mAmUfG*dC*dC*dImUfUfG*fA*mU*fG*fU*fU*mC*fU*fU*mA*mA*mG – 3’ (SEQ ID NO: 12; AI-1909), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, I = inosine, and wherein dI and dC is deoxyinosine and deoxycytidine, respectively.

[0241] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GCCCCAICAGCTUCAGUCCCUUTCTCIUCGAUGG – 3’ (SEQ ID NO: 195), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG&mC*mCfC&fC*mA*fI*mCmoeAfG*fC*moeT&fU*mCfA*mG*fUmoe(MeC)*fC*moe(M eC)fU&mUmoeTfC*moeT*dC*dI&mUfC*moeG*mA*mU*mG&mG – 3’ (SEQ ID NO: 140; AI-2261), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein and wherein dI and dC is deoxyinosine and deoxycytidine.

[0242] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ -CTGAUAGACGGGGUUGUCAAAGUUGAUGCCIUUGAUGUUCUUAAG – 3’ (SEQ ID NO: 196), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - ln(MeC)*lnT*mG*fA*fU*fA*mG*fA*mC*fG*fG*fG*fG*fU*mU*fG&mU*fC*fA*fA*mA*fG*mU *fU*mG&mAmUfG*dC*dC*dImUfUfG*fA*mU*fG*fU*fU*mC*fU*fU*mA*lnA*lnG – 3’ (SEQ ID NO: 141; AI-2269), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-N; & = mesyl linkage; * = PS linkage; I = inosine; and wherein and wherein dI and dC is deoxyinosine and deoxycytidine. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 4.

[0243] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in the amino acid substitution K830E. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – AUGUGGACCUCAUCCUCUGUGGUCUUCUGAUAGA – 3’ (SEQ ID NO: 28). In one embodiment, the ASO comprises a structure of: 5’ - mA&mU*mG*fU*fG*mG*fA*mC*fC*fU*fC*fA&fU*mC*fC*mU*fC*fU*fG*fU*fG&mGfU*fC*fU*d( SbU)*dC*mUfG*mA*mU*mA*mG*mA – 3’ (SEQ ID NO: 13; AI-1910), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, SbU = iso-Uridine, and wherein d(SbU) and dC is deoxyiso-uridine and deoxycytidine, respectively.

[0244] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – GUGGACCUCAUCCUCUGUGGUCUUCUGAUAGACGGG – 3’ (SEQ ID NO: 29). In one embodiment, the ASO comprises a structure of: 5’ - mG&mU*fG*mG*fA*mCfC*fU*fC*fA&fU*mC*fCmU*fC*fU*fG*fU*fG&mGfU*fC*fU*d mUfG*mA*mU*fA*mG*fA*mC*mG*mG*mG – 3’ (SEQ ID NO: 14; AI-1911), whereinO-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, SbU = iso-Uridine, and wherein d(SbU) and dC is deoxyiso-uridine and deoxycytidine, respectively.

[0245] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – GCAAAUGUGGACCUCAUCCUCUGUGGUCTUCUGAUAGACGGGGUU – 3’ (SEQ ID NO: 30). In one embodiment, the ASO comprises a structure of: 5’ - mG*mC*mA*fA*fA*fU*mG*fU*mG*fG*fA*fC*fC*fU*mC*fA&mU*fC*fC*fU*mC*fU*mG*fU*mG& mGmUfC*dT*d(SbU)*dCmUfGfA*fU*mA*fG*fA*fC*mG*fG*fG*mG*mU*mU – 3’ (SEQ ID NO: 15; AI-1912), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, dT = thymidine, SbU = iso-Uridine, and wherein d(SbU) and dC is deoxyiso-uridine and deoxycytidine, respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 5.

[0246] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in the amino acid substitution K830R. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AAUGUGGACCUCAUCCUCUGUGGUCCTCUGAUAG – 3’ (SEQ ID NO: 31). In one embodiment, the ASO comprises a structure of: 5’ - mA&mA*mU*fG*fU*mG*fG*mA*fC*fC*fU*fC&fA*mU*fC*mC*fU*fC*fU*fG*fU&mGfG*fU*fC*dC *dT*mCfU*mG*mA*mU*mA*mG – 3’ (SEQ ID NO: 16; AI-1913), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dT and dC is deoxythymidine and deoxycytidine, respectively.

[0247] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UGUGGACCUCAUCCUCUGUGGUCCTCUGAUAGACGG – 3’ (SEQ ID NO: 32). In one embodiment, the ASO comprises a structure of: 5’ - mU&mG*fU*mG*fG*mAfC*fC*fU*fC&fA*mU*fCmC*fU*fC*fU*fG*fU&mGfG*fU*fC*dC*dT*mCf U*mG*mA*fU*mA*fG*mA*mC*mG*mG – 3’ (SEQ ID NO: 17; AI-1914), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dT and dC is deoxythymidine and deoxycytidine, respectively.

[0248] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- GGCAAAUGUGGACCUCAUCCUCUGUGGUCCTCUGAUAGACGGGGU –3’ (SEQ ID NO: 33). In one embodiment, the ASO comprises a structure of: 5’ - mG*mG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fC*fC*mU*fC&mA*fU*fC*fC*mU*fC*mU*fG*mU& mGmGfU*dC*dC*dTmCfUfG*fA*mU*fA*fG*fA*mC*fG*fG*mG*mG*mU – 3’ (SEQ ID NO: 18; AI-1915), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dT and dC is deoxythymidine and deoxycytidine, respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 6.

[0249] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR gene resulting in the amino acid substitution N821D. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - ACUGGGUUGUCAAAGUUUAUGCUGUCIAUGUUCU – 3’ (SEQ ID NO: 180), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA&mC*mU*fG*fG*mG*fU*mU*fG*fU*fC*fA&fA*mA*fG*mU*fU*fU*fA*fU*fG&mCfU*fG*f U*dC*dI*mAfU*mG*mU*mU*mC*mU – 3’ (SEQ ID NO: 125; AI-1928), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0250] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UGGGUUGUCAAAGUUUAUGCUGUCIAUGUUCUUCAG – 3’ (SEQ ID NO: 181), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mG*fG*mG*fU*mUfG*fU*fC*fA&fA*mA*fGmU*fU*fU*fA*fU*fG&mCfU*fG*fU*dC*dI* mAfU*mG*mU*fU*mC*fU*mU*mC*mA*mG – 3’ (SEQ ID NO: 126; AI-1929), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0251] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GUAGACUGGGUUGUCAAAGUUUAUGCUGTCIAUGUUCUUCAGCCG – 3’ (SEQ ID NO: 182), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG*mU*mA*fG*fA*fC*mU*fG*mG*fG*fU*fU*fG*fU*mC*fA&mA*fA*fG*fU*mU*fU*mA*fU* mG&mCmUfG*dT*dC*dImAfUfG*fU*mU*fC*fU*fU*mC*fA*fG*mC*mC*mG – 3’ (SEQ ID NO: 127; AI-1930), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 176.

[0252] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR gene resulting in the amino acid substitution S822G. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGACUGGGUUGUCAAAGUUUAUGCCIUUGAUGU – 3’ (SEQ ID NO: 183), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fA*fC*mU*fG*mG*fG*fU*fU*fG&fU*mC*fA*mA*fA*fG*fU*fU*fU&mAfU*fG*f C*dC*dI*mUfU*mG*mA*mU*mG*mU – 3’ (SEQ ID NO: 128; AI-1931), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0253] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GACUGGGUUGUCAAAGUUUAUGCCIUUGAUGUUCUU – 3’ (SEQ ID NO: 184), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG&mA*fC*mU*fG*mGfG*fU*fU*fG&fU*mC*fAmA*fA*fG*fU*fU*fU&mAfU*fG*fC*dC*dI* mUfU*mG*mA*fU*mG*fU*mU*mC*mU*mU – 3’ (SEQ ID NO: 129; AI-1932), wherein m= 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0254] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ – CUGGUAGACUGGGUUGUCAAAGUUUAUGCCIUUGAUGUUCUUCAG – 3’ (SEQ ID NO: 185), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mC*mU*mG*fG*fU*fA*mG*fA*mC*fU*fG*fG*fG*fU*mU*fG&mU*fC*fA*fA*mA*fG*mU*fU* mU&mAmUfG*dC*dC*dImUfUfG*fA*mU*fG*fU*fU*mC*fU*fU*mC*mA*mG – 3’ (SEQ ID NO: 130; AI-1933), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0255] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGACUGGGUUGUCAAAGUTUATGCCIUUGAUGU – 3’ (SEQ ID NO: 199), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mAmGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fU*mCfA*mA*fAmoeG*fU*moeTfU*mA moeTfG*moe(MeC)*dC*dI&mUfU*moeG*mAmU*mG&mU – 3’ (SEQ ID NO: 144; AI- 3145), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0256] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - TAGACUGGGUUGUCAAAGUTUATGCCIUUGAUGT – 3’ (SEQ ID NO: 200), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnT&fAmGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fU*mCfA*mA*fAmoeG*fU*moeTfU*mAm oeTfG*moe(MeC)*dC*dI&mUfU*moeG*mAmU*fG&lnT – 3’ (SEQ ID NO: 145; AI-3445), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnAmGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fU*mCfA*mA*fAmoeG*fU*moeTfU*mA moeTfG*moe(MeC)*dC*dI&mUfU*moeG*mAmU*lnG&lnT – 3’ (SEQ ID NO: 146; AI- 3444), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PSlinkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnA*mGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fUmCfAmA*fAmoeG*fUmoeTfU*mAm oeTfG*moe(MeC)*dC*dI&mUfU*moeG*mA*mU*lnG&lnT – 3’ (SEQ ID NO: 147; AI- 2267), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnA*mG*fA*fC*mU*fG*mGmoeGfU*fU*moeG&mUmC*fA*mA*mAmoeG*fU*moeTfU *mAmoeTfG*moe(MeC)*dC*dI&mUfU*moeGfA*mU*lnG&lnT – 3’ (SEQ ID NO: 148; AI- 3447), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesy linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnA*mGfA&fC*mU*fG*mGmoeGfU*fU*moeG&fU*mCfA*mA*fAmoeG*fU*moeTfU&m AmoeTfG*moe(MeC)*dC*dI&mUfU*moeG*mA*mU*lnG&lnT – 3’ (SEQ ID NO: 149; AI- 3448), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnAmGfA*fC*fU*fG*fGmoeGfU*fU*moeG*fU*mCfA*mA*fAmoeG*fU*moeTfU*mAmo eTfG*moe(MeC)*dC*dI&mUfU*moeG*fAfU*lnG&lnT – 3’ (SEQ ID NO: 157; AI-3841), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnAmGfA*fC*mU*fG*mGmGfU*fU*moeG*fU*mCfA*mA*mAmoeG*mU*moeTfU*mA moeTfG*moe(MeC)*dC*dI&mUfU*moeG*mAmU*lnG&lnT – 3’ (SEQ ID NO: 158; AI- 3840), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’- MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnA*mGfA*fC*mU*fG*mGmoeGfU*fU*moeG&fU*moe(MeC)fA*mA*mAmoeGfU*moe TfU*mAmoeTfG*moe(MeC)*dC*dI&mU*fU*moeGmA*mU*lnG&lnT – 3’ (SEQ ID NO: 150; AI-3449), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage;* = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0257] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - TAGACUGGGUUGUCAAAGTTUATGCCIUUGAUGT – 3’ (SEQ ID NO: 201), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnA*mGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fU*moe(MeC)fA*mA*fA*moeG*moeTm oeTfU*mAmoeTfG*moe(MeC)*dC*dI&mUfU*moeG*mA*mU*lnG&lnT – 3’ (SEQ ID NO: 151; AI-3450), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0258] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - TAGACUGGGUUGUCAAAGTTUATGCCIUUGATGT – 3’ (SEQ ID NO: 206), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnT&lnAmoeGfA*fC*mU*fG*mGmoeGfU*fU*moeG*fU*mCfA*moeA*fAmoeG*moeT*moe TfU*mAmoeTfG*moe(MeC)*dC*dI&mUfU*moeG*mAmoeT*lnG&lnT – 3’ (SEQ ID NO: 159; AI-3839), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 177.

[0259] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR gene resulting in the amino acid substitution K832E. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AUGUGGAGCUCGUCCUCUGUGGUCUUCUGGUAGA – 3’ (SEQ ID NO: 186), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA&mU*mG*fU*fG*mG*fA*mG*fC*fU*fC*fG&fU*mC*fC*mU*fC*fU*fG*fU*fG&mGfU*fC*f U*d(SbU)*dC*mUfG*mG*mU*mA*mG*mA – 3’ (SEQ ID NO: 131; AI-1934), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); SbU = iso-Uridine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein d(SbU) and dC is deoxy-isouridine and deoxycytidine respectively.

[0260] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GUGGAGCUCGUCCUCUGUGGUCUUCUGGUAGACUGG – 3’ (SEQ ID NO: 187), wherein I represents inosine. In one embodiment, the ASO comprises astructure of: 5’ - mG&mU*fG*mG*fA*mGfC*fU*fC*fG&fU*mC*fCmU*fC*fU*fG*fU*fG&mGfU*fC*fU*d(SbU) *dC*mUfG*mG*mU*fA*mG*fA*mC*mU*mG*mG – 3’ (SEQ ID NO: 132; AI-1935), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); SbU = iso-Uridine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein d(SbU) and dC is deoxy-isouridine and deoxycytidine respectively.

[0261] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GCAAAUGUGGAGCUCGUCCUCUGUGGUCTUCUGGUAGACUGGGUU – 3’ (SEQ ID NO: 188), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG*mC*mA*fA*fA*fU*mG*fU*mG*fG*fA*fG*fC*fU*mC*fG&mU*fC*fC*fU*mC*fU*mG*fU* mG&mGmUfC*dT*d(SbU)*dCmUfGfG*fU*mA*fG*fA*fC*mU*fG*fG*mG*mU*mU – 3’ (SEQ ID NO: 133; AI-1936), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); SbU = iso- Uridine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein d(SbU) and dC is deoxy-isouridine and deoxycytidine respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 178.

[0262] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR gene resulting in the amino acid substitution K832R. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGUAG – 3’ (SEQ ID NO: 189), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA&mA*mU*fG*fU*mG*fG*mA*fG*fC*fU*fC&fG*mU*fC*mC*fU*fC*fU*fG*fU&mGfG*fU*f C*dC*dT*mCfU*mG*mG*mU*mA*mG – 3’ (SEQ ID NO: 134; AI-1937), wherein m = 2’- O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0263] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UGUGGAGCUCGUCCUCUGUGGUCCTCUGGUAGACUG – 3’ (SEQ ID NO: 190), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mG*fU*mG*fG*mAfG*fC*fU*fC&fG*mU*fCmC*fU*fC*fU*fG*fU&mGfG*fU*fC*dC*dT *mCfU*mG*mG*fU*mA*fG*mA*mC*mU*mG – 3’ (SEQ ID NO: 135; AI-1938), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = lockednucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0264] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGUAGACUGGGU – 3’ (SEQ ID NO: 191), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG*mG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU&mGmGfU*dC*dC*dTmCfUfG*fG*mU*fA*fG*fA*mC*fU*fG*mG*mG*mU – 3’ (SEQ ID NO: 136; AI-1939), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - mG*mG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUfG*fG*mU*fA*fG*fA*mC*fU*fG*mG*mG*mU – 3’ (SEQ ID NO: 152; AI-3451), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0265] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGUA – 3’ (SEQ ID NO: 202), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG*mG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUfG*mG*mU*mA – 3’ (SEQ ID NO: 153; AI-3455), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0266] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGU – 3’ (SEQ ID NO: 203), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG*mG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUmG*mG*mU – 3’ (SEQ ID NO: 154; AI-3456), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0267] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGUAG – 3’ (SEQ ID NO: 204), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mUfG*fU*mG*fG*mAmoeGfC*fU*moe(MeC)*fG*mUfC*mC*fUmo e(MeC)*fU*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*mG*mU*mA&mG – 3’ (SEQ ID NO: 155; AI-3469), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mUfG*fU*mG*fG*mAmoeGfC*fU*moe(MeC)*fG*mUfC*mC*fUmo e(MeC)*fU*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*mG*mU*lnA&lnG – 3’ (SEQ ID NO: 160; AI-3833), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mUfG*fU*fG*fG*fAmoeGfC*fU*moe(MeC)*fG*mUfC*mC*fUmoe( MeC)*fU*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*fG*fU*lnA&lnG – 3’ (SEQ ID NO: 161; AI-3836), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mUfG*fU*mG*fG*mAmGfC*fU*moe(MeC)*fG*mUfC*mC*mUmoe (MeC)*mU*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*mG*mU*lnA&lnG – 3’ (SEQ ID NO: 162; AI-3835), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUfG*fG*mU*lnA&lnG – 3’ (SEQ ID NO: 164; AI-3139), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0268] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGUAGACUGGGT – 3’ (SEQ ID NO: 205), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fAmUfG*fU*mG*fG*mAmoeGfC*fU*moe(MeC)*fG*mUfC*mC*fUmoe (MeC)*fU*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*mGmU*fA*fG*fA*mC*f U*fG*mG*lnG&lnT – 3’ (SEQ ID NO: 156; AI-3474), wherein m = 2’-O-methyl; f = 2’- fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0269] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAATGUGGAGCUCGUCCUCTGUGGUCCTCUGGTAG – 3’ (SEQ ID NO: 207), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*moeTfG*fU*mG*fG*mAmoeGfC*fU*moe(MeC)*fG*mUfC*moe(M eC)*fUmoe(MeC)*moeT*moeGfU*mGmoeGfU*moe(MeC)*dC*dT&mCfU*moeG*mG*mo eT*lnA&lnG – 3’ (SEQ ID NO: 163; AI-3834), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0270] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGTA – 3’ (SEQ ID NO: 208), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUfG*mG*lnT&lnA – 3’ (SEQ ID NO: 165; AI-3463), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively.

[0271] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GGCAAAUGUGGAGCUCGUCCUCUGUGGUCCTCUGGT – 3’ (SEQ ID NO: 209), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnG*mC*fA*fA*fA*mU*fG*mU*fG*fG*fA*fG*fC*mU*fC&mG*fU*fC*fC*mU*fC*mU*fG* mU*mGmGfU*dC*dC*dT&mCfUmG*lnG&lnT – 3’ (SEQ ID NO: 166; AI-3464), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln =locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dT and dC is deoxythymidine and deoxycytidine respectively. In one embodiment, the resulting LDLR protein variant comprises SEQ ID NO: 179.

[0272] In one embodiment, an ASO of the present disclosure mediates A-to-I editing of protein non-coding RNA. For instance, an ASO may mediate A-to-I editing within the 3’ untranslated regions (UTRs), which are non-coding. In one embodiment, an ASO mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in an A-to-I substitution at position A111. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- UCUGCCUCCCAGAUGAAUAAAUAUACAAAACAAA – 3’ (SEQ ID NO: 34). In one embodiment, the ASO comprises a structure of: 5’ - mU&mC*mU*fG*fC*mC*fU*mC*fC*fC*fA*fG&fA*mU*fG*mA*fA*fU*fA*fA*fA&mUfA*fU*fA *dC*dA*mAfA*mA*mC*mA*mA*mA – 3’ (SEQ ID NO: 19; AI-1916), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0273] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- UGCCUCCCAGAUGAAUAAAUAUACAAAACAAAGCUC – 3’ (SEQ ID NO: 35). In one embodiment, the ASO comprises a structure of: 5’ – mU&mG*fC*mC*fU*mCfC*fC*fA*fG&fA*mU*fGmA*fA*fU*fA*fA*fA&mUfA*fU*fA*dC*dA* mAfA*mA*mC*fA*mA*fA*mG*mC*mU*mC – 3’ (SEQ ID NO: 20; AI-1917), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0274] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- CUGUUCUGCCUCCCAGAUGAAUAAAUAUACAAAACAAAGCUCUGG– 3’ (SEQ ID NO: 36). In one embodiment, the ASO comprises a structure of: 5’ - mC*mU*mG*fU*fU*fC*mU*fG*mC*fC*fU*fC*fC*fC*mA*fG&mA*fU*fG*fA*mA*fU*mA*fA* mA&mUmAfU*dA*dC*dAmAfAfA*fC*mA*fA*fA*fG*mC*fU*fC*mU*mG*mG – 3’ (SEQ ID NO: 21; AI-1918), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0275] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - CTGUUCUGCCUCCCAGAUGAATAAAUAUACAAAACAAAGCUCUGG – 3’ (SEQ ID NO: 220), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - ln(MeC)&lnT*mG*fU*fU*fCmUfG*fC*mC*fU*mCmoe(MeC)fC*fA*moeG*fA*mUfG*mA*fA moeT*fA*moeAfA*mUmoeAfU*moeA*dC*dA&mAfA*moeA*mCmA*fA*fA*fG*mC*fU*fC* mU*lnG&lnG – 3’ (SEQ ID NO: 117; AI-4167), wherein m = 2’-O-methyl; f = 2’-fluoro;d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0276] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - TCTGCCUCCCAGAUGAATAAAUAUACAAAACAAA – 3’ (SEQ ID NO: 221), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnT&ln(MeC)*moeTfG&fC*mC*fU*mCmoe(MeC)fC*fA*moeG&fA*mUfG*moeA*fAmoeT* moeA*moeAfA&mUmoeAfU*moeA*dC*dA&mAfA*moeA*mC*moeA*lnA&lnA – 3’ (SEQ ID NO: 118; AI-4168), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0277] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GCCCCIGCAGCTUCAGUCCCUUTCTCIUCGAUGG – 3’ (SEQ ID NO: 197), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mG&mC*mCfC&fC*mI*fG*mCmoeAfG*fC*moeT&fU*mCfA*mG*fUmoe(MeC)*fC*moe(M eC)fU&mUmoeTfC*moeT*dC*dI&mUfC*moeG*mA*mU*mG&mG – 3’ (SEQ ID NO: 142; AI-2260), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dI and dC is deoxyinosine and deoxycytidine respectively.

[0278] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - CTGUUCUGCCUCCCAGAUGAAUAAAUAUACAAAACAAAGCUCUGG – 3’ (SEQ ID NO: 198), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - ln(MeC)*lnT*mG*fU*fU*fC*mU*fG*mC*fC*fU*fC*fC*fC*mA*fG&mA*fU*fG*fA*mA*fU*mA* fA*mA&mUmAfU*dA*dC*dAmAfAfA*fC*mA*fA*fA*fG*mC*fU*fC*mU*lnG*lnG – 3’ (SEQ ID NO: 143; AI-2268), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0279] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in an A-to-I substitution at position A113. In one embodiment, an ASO described herein comprises the nucleobase sequence of5’- GCCUGUUCUGCCUCCCAGAUGAAUAAAUACAUAAAACAAAGCUCU – 3’ (SEQ ID NO: 80). In one embodiment, the ASO comprises a structure of: 5’ - mG*mC*mC*fU*fG*fU*mU*fC*mU*fG*fC*fC*fU*fC*mC*fC&mA*fG*fA*fU*mG*fA*mA*fU*mA& mAmAfU*dA*dC*dAmUfAfA*fA*mA*fC*fA*fA*mA*fG*fC*mU*mC*mU – 3’ (SEQ ID NO: 77; AI-2288), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0280] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GCCUGUUCUGCCTCCCAGAUGAATAAAUACAUAAAACAAAGCUCT – 3’ (SEQ ID NO: 222), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&ln(MeC)*mC*fU*fG*fUmUfC*fU*mG*fC*mCmoeTfC*fC*moe(MeC)*fA*mGfA*mU*fG moeA*fA*moeTfA*mAmoeAfU*moeA*dC*dA&mUfA*moeA*mAmA*fC*fA*fA*mA*fG*fC* mU*ln(MeC)&lnT – 3’ (SEQ ID NO: 119; AI-4169), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0281] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GTTCUGCCTCCCAGATGAATAAAUACAUAAAACA – 3’ (SEQ ID NO: 223), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnG&lnT*moeTfC&fU*mG*fC*mCmoeTfC*fC*moe(MeC)&fA*mGfA*moeT*fGmoeA*moe A*moeTfA&mAmoeAfU*moeA*dC*dA&mUfA*moeA*mA*moeA*ln(MeC)&lnA – 3’ (SEQ ID NO: 120; AI-4170), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0282] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in an A-to-I substitution at position 115. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- AAGCCUGUUCUGCCUCCCAGAUGAAUAAACAUAUAAAACAAAGCU 3’ (SEQ ID NO: 81). In one embodiment, the ASO comprises a structure of: 5’ - mA*mA*mG*fC*fC*fU*mG*fU*mU*fC*fU*fG*fC*fC*mU*fC&mC*fC*fA*fG*mA*fU*mG*fA*mA& mUmAfA*dA*dC*dAmUfAfU*fA*mA*fA*fA*fC*mA*fA*fA*mG*mC*mU – 3’ (SEQ ID NO: 78; AI-2289), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0283] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AAGCCUGUUCUGCCUCCCAGATGAAUAAACAUATAAAACAAAGCT – 3’ (SEQ ID NO: 224), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnA*mG*fC*fC*fUmGfU*fU*mC*fU*mGmoe(MeC)fC*fU*moe(MeC)*fC*mCfA*mG*fA moeT*fG*moeAfA*mUmoeAfA*moeA*dC*dA&mUfA*moeT*mAmA*fA*fA*fC*mA*fA*fA*m G*ln(MeC)&lnT – 3’ (SEQ ID NO: 121; AI-4171), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0284] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - CTGUUCUGCCUCCCAGATGAAUAAACAUATAAAA – 3’ (SEQ ID NO: 225), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - ln(MeC)&lnT*moeGfU&fU*mC*fU*mGmoe(MeC)fC*fU*moe(MeC)&fC*mCfA*moeG*fAm oeT*moeG*moeAfA&mUmoeAfA*moeA*dC*dA&mUfA*moeT*mA*moeA*lnA&lnA – 3’ (SEQ ID NO: 122; AI-4172), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0285] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from an LDLR gene resulting in an A-to-I substitution at position 119. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’- UCCGAAGCCUGUUCUGCCUCCCAGAUGAACAAAUAUAUAAAACAA – 3’ (SEQ ID NO: 82). In one embodiment, the ASO comprises a structure of: 5’ - mU*mC*mC*fG*fA*fA*mG*fC*mC*fU*fG*fU*fU*fC*mU*fG&mC*fC*fU*fC*mC*fC*mA*fG*mA& mUmGfA*dA*dC*dAmAfAfU*fA*mU*fA*fU*fA*mA*fA*fA*mC*mA*mA – 3’ (SEQ ID NO: 79; AI-2290), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); & = mesyl linkage, * = PS linkage, and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0286] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - TCCGAAGCCUGUTCUGCCUCCCAGAUGAACAAATAUAUAAAACAA – 3’ (SEQ ID NO: 226), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ – lnT&ln(MeC)*mC*fG*fA*fAmGfC*fC*mU*fG*mUmoeTfC*fU*moeG*fC*mCfU*mC*fCmoe( MeC)*fA*moeGfA*mUmoeGfA*moeA*dC*dA&mAfA*moeT*mAmU*fA*fU*fA*mA*fA*fA*m C*lnA&lnA – 3’ (SEQ ID NO: 123; AI-4173), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0287] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AAGCCUGUTCUGCCUCCCAGAUGAACAAATATAT – 3’ (SEQ ID NO: 227), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnA*moeGfC&fC*mU*fG*mUmoeTfC*fU*moeG&fC*mCfU*moe(MeC)*fCmoe(MeC)* moeA*moeGfA&mUmoeGfA*moeA*dC*dA&mAfA*moeT*mA*moeT*lnA&lnT – 3’ (SEQ ID NO: 124; AI-4174), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0288] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR (mLDLR) gene resulting in an A-to-G substitution at position 189. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UUUCUGUCCCCAGACAAUAAAUAUACAAAACAGA – 3’ (SEQ ID NO: 192), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mU*mU*fC*fU*mG*fU*mC*fC*fC*fC*fA&fG*mA*fC*mA*fA*fU*fA*fA*fA&mUfA*fU*fA *dC*dA*mAfA*mA*mC*mA*mG*mA – 3’ (SEQ ID NO: 137; AI-1940), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0289] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UCUGUCCCCAGACAAUAAAUAUACAAAACAGAACCU – 3’ (SEQ ID NO: 193), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mC*fU*mG*fU*mCfC*fC*fC*fA&fG*mA*fCmA*fA*fU*fA*fA*fA&mUfA*fU*fA*dC*dA* mAfA*mA*mC*fA*mG*fA*mA*mC*mC*mU – 3’ (SEQ ID NO: 138; AI-1941), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0290] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - GCCUUUUCUGUCCCCAGACAAUAAAUAUACAAAACAGAACCUGGG – 3’ (SEQ ID NO: 194), wherein I represents inosine. In one embodiment, the ASO comprises astructure of: 5’ - mG*mC*mC*fU*fU*fU*mU*fC*mU*fG*fU*fC*fC*fC*mC*fA&mG*fA*fC*fA*mA*fU*mA*fA* mA&mUmAfU*dA*dC*dAmAfAfA*fC*mA*fG*fA*fA*mC*fC*fU*mG*mG*mG – 3’ (SEQ ID NO: 139; AI-1942), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0291] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR (mLDLR) gene resulting in an A-to-I substitution at position 191. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - CUUUUCUGUCCCCAGACAAUAAAUACAUAAAACA – 3’ (SEQ ID NO: 217), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mC&mU*mUfU*fU*mC*fU*mG*fUfC*fC*fC&fC*fAfG*mA*mC*fA*fA*fUfA*mAmAfU*dA*d C*dA&mUfAfA*fA*mA*mC&mA – 3’ (SEQ ID NO: 110; AI-3483), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0292] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGCCUUUUCUGTCCCCAGACAATAAAUACAUAAAACAGAACCUG – 3’ (SEQ ID NO: 218), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fC*fC*fU*mUfU*fU*mC*fU*mGmoeTfC*fC*moe(MeC)*fC*mAfG*mA*fCmo eA*fA*moeTfA*mAmoeAfU*dA*dC*dA&mUfA*moeA*mA*mA*fC*fA*fG*mA*fA*fC*mC*m U&mG – 3’ (SEQ ID NO: 111; AI-3118), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fC*fC*fU*mUfU*fU*mC*fU*mGmoeTfC*fC*moe(MeC)*fC*mAfG*mA*fCmo eA*fA*moeTfA*mAmoeAfU*moeA*dC*dA&mUfA*moeA*mA*mA*fC*fA*fG*mA*fA*fC*mC *mU&mG – 3’ (SEQ ID NO: 112; AI-3484), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fC*fC*fUmUfU*fU*mC*fU*mGmoeTfC*fC*moe(MeC)*fC*mAfG*mA*fCmoe A*fA*moeTfA*mAmoeAfU*moeA*dC*dA&mUfA*moeA*mAmA*fC*fA*fG*mA*fA*fC*mC*mU&mG – 3’ (SEQ ID NO: 116; AI-3487), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0293] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGCCUTUUCUGTCCCCAGACAATAAAUACAUAAAACAGAACCUG – 3’ (SEQ ID NO: 213), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fC*fC*fUmoeTfU*fU*mC*fU*mGmoeTfC*fC*moe(MeC)*fC*mAfG*moeA*fC moeA*moeA*moeTfA*mAmoeAfU*moeA*dC*dA&mUfA*moeA*mAmoeA*fC*fA*fG*mA*f A*fC*mC*mU&mG – 3’ (SEQ ID NO: 170; AI-3828), wherein m = 2’-O-methyl; f = 2’- fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0294] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - UAGCCUUUUCUGUCCCCAGACAATAAAUACAUAAAACAGAACCUG – 3’ (SEQ ID NO: 214), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mU&mA*mG*fC*fC*fUmUfU*fU*mC*fU*mGmUfC*fC*moe(MeC)*fC*mAfG*mA*mCmoeA *mA*moeTfA*mAmoeAfU*moeA*dC*dA&mUfA*moeA*mAmA*fC*fA*fG*mA*fA*fC*mC*m U&mG – 3’ (SEQ ID NO: 171; AI-3829), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’- deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0295] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AGUAGCCUUUUCUGUCCCCAGACAACAAAUAUAU – 3’ (SEQ ID NO: 219), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - mA&mG*mUfA*fG*mC*fC*mU*fUfU*fU*fC&fU*fGfU*mC*mC*fC*fC*fAfG*mAmCfA*dA*d C*dA&mAfAfU*fA*mU*mA&mU – 3’ (SEQ ID NO: 113; AI-3476), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0296] In one embodiment, an ASO described herein mediates A-to-I editing of a target RNA sequence derived from a murine LDLR (mLDLR) gene resulting in an A-to-I substitution at position 197. In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ -AGCCAGUAGCCUUUUCUGUCCCCAGACAACAAAUAUAUAAAACAG – 3’ (SEQ ID NO: 210), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fG*mU*fA*mG*fC*fC*fU*fU*fU*mU*fC&mU*fG*fU*fC*mC*fC*mC*fA* mG*mAmCfA*dA*dC*dA&mAfAfU*fA*mU*fA*fU*fA*mA*fA*fA*mC*lnA&lnG – 3’ (SEQ ID NO: 167; AI-3127), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0297] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AGCCAGTAGCCUTUUCUGUCCCCAGACAACAAATAUAUAAAACAG – 3’ (SEQ ID NO: 211), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fG*moeTfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)&fU*moeGfU*mC* mCmoe(MeC)*fCmoeAfG*mAmoe(MeC)fA*dA*dC*dA&mAfA*moeT*fA*mU*fA*fU*fA*mA *fA*fA*mC*lnA&lnG – 3’ (SEQ ID NO: 168; AI-3478), wherein m = 2’-O-methyl; f = 2’- fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fG*moeTfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)&fU*moeGfU*mC* mCmoe(MeC)*fCmoeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*fA*mU*fA*fU*fA* mA*fA*fA*mC*lnA&lnG – 3’ (SEQ ID NO: 114; AI-3477), wherein m = 2’-O-methyl; f = 2’- fluoro; moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fG*moeTfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)&fU*moeGfU*mC* mCmoe(MeC)*fCmoeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*fA*mU*fA*fU*fA* mA*fA*fA*mC*lnA&lnG(C7)(GalNAc) – 3’ (SEQ ID NO: 114; AI-5040), wherein m = 2’-O- methyl; f = 2’-fluoro; moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl- cytosine; & = mesyl; * = PS linkage; I = inosine; wherein dA and dC represent deoxyadenosine and deoxycytidine respectively; and C7 represents a linker.

[0298] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AGCCAGUAGCCUTUUCUGUCCCCAGACAACAAATAUAUAAAACAG – 3’ (SEQ ID NO: 212), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fG*mUfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)*fU*mGfU*mC*fCmo e(MeC)*fC*moeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*mA*mU*fA*fU*fA*mA*fA*fA*mC*lnA&lnG – 3’ (SEQ ID NO: 169; AI-3480), wherein m = 2’-O-methyl; f = 2’- fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fGmUfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)*fU*mGfU*mC*fCmoe( MeC)*fC*moeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*mAmU*fA*fU*fA*mA*fA* fA*mC*lnA&lnG – 3’ (SEQ ID NO: 115; AI-3481), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0299] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AGCCAGTAGCCUTUUCUGUCCCCAGACAACAAATATAUAAAACAG – 3’ (SEQ ID NO: 215), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fGmoeTfA*fG*mC*fC*mUmoeTfU*fU*moe(MeC)*fU*mGfU*moe(Me C)*fCmoe(MeC)*moe(MeC)*moeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*mAm oeT*fA*fU*fA*mA*fA*fA*mC*lnA&lnG – 3’ (SEQ ID NO: 172; AI-3837), wherein m = 2’-O- methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5-methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC is deoxyadenine and deoxycytidine respectively.

[0300] In one embodiment, an ASO described herein comprises the nucleobase sequence of 5’ - AGCCAGUAGCCUUUUCUGUCCCCAGACAACAAATAUAUAAAACAG – 3’ (SEQ ID NO: 216), wherein I represents inosine. In one embodiment, the ASO comprises a structure of: 5’ - lnA&lnG*mC*fC*fA*fGmUfA*fG*mC*fC*mUmUfU*fU*moe(MeC)*fU*mGfU*mC*mCmoe( MeC)*mC*moeAfG*mAmoe(MeC)fA*moeA*dC*dA&mAfA*moeT*mAmU*fA*fU*fA*mA*fA *fA*mC*lnA&lnG – 3’ (SEQ ID NO: 173; AI-3838), wherein m = 2’-O-methyl; f = 2’-fluoro; d=2’-deoxyribonucleoside (DNA); moe=2’-MOE; ln = locked nucleic acid (LNA); MeC=5- methyl-cytosine; & = mesyl linkage; * = PS linkage; I = inosine; and wherein dA and dC represent deoxyadenosine and deoxycytidine respectively.

[0301] In some embodiments, the oligonucleotide comprises a sequence that is at least 70% identical to any one of the sequences selected from: SEQ ID NO: 7-36, 77-82, 117-124, 140-143, 195-198, and 220-227. In some embodiments, the oligonucleotide comprises a sequence that is at least 80% identical to any one of the sequences selected from: 7-36, 77- 82, 117-124, 140-143, 195-198, and 220-227. In some embodiments, the oligonucleotide comprises a sequence that is at least 90% identical to any one of the sequences selectedfrom: SEQ ID NO: 7-36, 77-82, 117-124, 140-143, 195-198, and 220-227. In one embodiment, the oligonucleotide comprises any one of the sequences selected from: SEQ ID NO: 7-36, 77-82, 117-124, 140-143, 195-198, and 220-227. In one embodiment, the ASO is selected from a list consisting of AI-1904, AI-1905, AI-1906, AI-1907, AI-1908, AI-1909, AI- 1910, AI-1911, AI-1912, AI-1913, AI-1914, AI-1915, AI-2261, and AI-2269. In one embodiment, the ASO is selected from the list consisting of AI-1916, AI-1917, AI-1918, AI- 2288, AI-2289, AI-2290, AI-4167, AI-4168, AI-4169, AI-4170, AI-4171, AI-4172, AI-4173, AI- 4174, AI-2260, and AI-2268.

[0302] In some embodiments, the oligonucleotide comprises a sequence that is at least 70% identical to any one of the sequences selected from: SEQ ID NOs: 110-116, 125-139, 144-173, 180-194, and 199-219. In some embodiments, the oligonucleotide comprises a sequence that is at least 80% identical to any one of the sequences selected from: SEQ ID NOs: 110-116, 125-139, 144-173, 180-194, and 199-219. In some embodiments, the oligonucleotide comprises a sequence that is at least 90% identical to any one of the sequences selected from: SEQ ID NOs: 110-116, 125-139, 144-173, 180-194, and 199-219. In one embodiment, the oligonucleotide comprises any one of the sequences selected from: SEQ ID NOs: 110-116, 125-139, 144-173, 180-194, and 199-219. In some embodiments, the ASO is selected from a list consisting of AI-1928, AI-1929, AI-1930, AI-1931, AI-1932, AI- 1933, AI-1934, AI-1935, AI-1936, AI-1937, AI-1938, AI-1939, AI-3145, AI-3445, AI-3444, AI- 2267, AI-3447, AI-3448, AI-3449, AI-3450, AI-3451, AI-3455, AI-3456, AI-3469, AI-3474, AI- 3841, AI-3840, AI-3839, AI-3833, AI-3836, AI-3835, AI-3834, AI-3139, AI-3463, and AI-3464. In one embodiment, the ASO is selected from a list consisting of AI-3483, AI-3118, AI-3484, AI-3476, AI-3477, AI-3481, AI-3487, AI-1940, AI-1941, AI-1942, AI-3127, AI-3478, AI-3480, AI-3828, AI-3829, AI-3837, and AI-3838.

[0303] Guide RNA (gRNA) or single guide RNA (sgRNA) is a short sequence of RNA that may function as a guide for various protein, including Cas-proteins or ADAR proteins (Mali et al., 2013). It has been shown that genetically encodable guide RNAs may be used to re- address ADAR enzymes toward specific sites in user-defined mRNA targets (Wettengel et al., 2017). Hence, in one embodiment, an ASO comprises a genetically encodable guide RNA. Moreover, it has previously been shown that CLUSTER guide RNAs enable precise and efficient RNA editing with endogenous ADAR enzymes in vivo (Reautschnig et al., 2022). In some instances, the ASOs can be designed to comprise CLUSTER guide RNAs. The CLUSTER guide RNAs bind their target RNAs in a multivalent fashion, achieve editing with high precision and efficiency. In one embodiment, the ASOs is designed to comprise a CLUSTER guide RNA. In one embodiment the ASO comprises a cluster of recruitment sequences.

[0304] Other aspects of the present disclosure provide additional compositions and methods of A to I editing of a target adenosine in the LDLR RNA, including, without limitation, CRISPR / Cas gene editing agents and associated single guide RNA (sgRNA). In some embodiments, the sgRNA is for site-directed editing by a Cas9-based adenosine base editor of a target adenosine in a low-density lipoprotein receptor (LDLR) gene, wherein the LDLR gene comprises a sense strand and a reverse complementary strand, wherein the sgRNA is capable of hybridizing to a target sequence on the reverse complementary strand, wherein the target sequence hybridizes to a sequence on the strand where the target adenosine is located.

[0305] In some embodiments, the target adenosine is in a coding region or a sequence in the LDLR gene that encodes a 3’-untranslated region (3’-UTR) of LDLR RNA. In some embodiments, the target adenosine corresponds to the adenosine at position 98, 100, 111, 113, 115, or 119 of the 3’UTR as set forth in SEQ ID NO: 37, or to the adenosine at positions 191 or 197 of the 3’UTR as set forth in SEQ ID NO: 108. In some embodiments, editing of the target adenosine prevents or reduces negative regulation of the LDLR RNA and / or increases stability of LDLR RNA. In some embodiments, the editing of the target adenosine increases LDLR protein expression.

[0306] In some embodiments, the target adenosine is in a region of LDLR gene that encodes an inducible degrader of the LDLR protein (IDOL)-binding region of LDLR protein. In some embodiments, the target adenosine is in a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as set forth in SEQ ID NO: 2. In some embodiments, editing of the target adenosine results in an amino acid substitution that prevents or reduces (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation.

[0307] Oligonucleotides may be modified at their 5’ and / or 3’ termini. The oligonucleotides may comprise one or more different linkers, tags or coupling agents at either one or both termini. The oligonucleotides may comprise a moiety, which enhances cellular uptake of the oligonucleotide, e.g., N-acetylgalactosamine (GalNAc). Hence, in some embodiments, the oligonucleotide comprises a moiety or is conjugated to a moiety that enhances cellular uptake of the oligonucleotide. Preferably, the moiety enhancing cellular uptake is a triantennary N-acetyl galactosamine (GalNAc3).

[0308] Oligonucleotides may be expressed by a vector. The oligonucleotide may be expressed by an expression construct, a viral vector, a virus-like particle vector, or a bacterial vector. In one embodiment, the oligonucleotide is delivered and / or formulated as a lipid nanoparticle (LNP).

[0309] Also provided herein are genetic or expression constructs comprising a polynucleotide sequence encoding human LDLR, wherein the nucleotide sequence is atleast 60%, at least 70%, at least 80%, at least 90, at least 95% or is 100% identical to SEQ ID NO: 1. In one embodiment, the polynucleotide sequence is between about 95% and about 99.99% identical to SEQ ID NO: 1. In one embodiment, the polynucleotide sequence contains an A-to-G nucleotide mutation at one of the following positions of SEQ ID NO: 1 selected from the group consisting of: 2455, 2458, 2488, and 2489. In one embodiment, the polynucleotide sequence is or is derived from an LDLR that contains an A-to-G substitution at a position homologous to the position 2455, 2458, 2488, or 2489 in the wild-type hLDLR coding sequence (SEQ ID NO: 1).

[0310] Also provided herein is a host cell comprising an oligonucleotide or an expression construct described herein.

[0311] Also provided herein is an isolated polypeptide comprising a sequence that is at least 80% or at least 90% identical to SEQ ID NO: 2 and having one of the following substitutions selected from the group consisting of: N819D, S820G, K830E and K830R, optionally wherein the polypeptide is able to mediate a reduction in LDL-C.

[0312] The nucleic acids or oligonucleotides (or ASOs) provided herein may be incorporated into compositions. The compositions may be used according to the present disclosure. Accordingly, provided herein is a composition containing the oligonucleotide(s) for use of the present disclosure. In some embodiments, the present disclosure provides oligonucleotide compositions for use comprising oligonucleotides described herein. In some embodiments, the compositions are pharmaceutical compositions. As used herein, pharmaceutical composition means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents (such as an oligonucleotide) and a sterile aqueous solution. In one embodiment, the composition contains one or more oligonucleotides described herein.

[0313] The pharmaceutical compositions may be in any form that allows for the composition to be administered to a subject. The compositions may be used in methods of treating and / or preventing a genetic disorder, condition, or disease as described herein. In a specific embodiment, the pharmaceutical compositions are suitable for veterinary and / or human administration.

[0314] Provided herein is a pharmaceutical composition comprising the oligonucleotide or a pharmaceutically acceptable salt thereof for use. In one embodiment, a composition comprises an oligonucleotide for use as described herein in an admixture with a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is simply a saline solution. This can be isotonic or hypotonic.

[0315] In some embodiments, a pharmaceutical composition comprises one or more other therapies in addition to an oligonucleotide of the present disclosure.

[0316] In certain embodiments, the compositions of the present disclosure further include diluents of various buffer content (e.g., Tris-HCI, acetate, phosphate), pH, and ionic strength, and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking substances (e.g., lactose, mannitol). In some embodiments, the material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. In some embodiments, hyaluronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and / or rate of in vivo clearance of the present ASOs and derivatives. In some embodiments, the compositions may be prepared in liquid form, or may be in dried powder, such as lyophilized form.

[0317] In certain embodiments, the pharmaceutical compositions additionally comprise one or more salts, e.g., sodium chloride, calcium chloride, sodium phosphate, monosodium glutamate, and aluminium salts (e.g., aluminium hydroxide, aluminium phosphate, alum (potassium aluminium sulfate), or a mixture of such aluminium salts). In other embodiments, the pharmaceutical compositions described herein do not comprise salts.

[0318] The pharmaceutical compositions described herein can be included in a container, pack, or dispenser together with instructions for administration. Patient Population

[0319] The oligonucleotides or composition of the present disclosure can be administered to various subjects. In some embodiments, a subject to be administered an oligonucleotide is an animal. In certain embodiments, the animal is a primate. In certain embodiments, the primate is a human. In certain embodiments, the subject to be administered an oligonucleotide is an infant, a child or a teenager. In certain embodiments, the subject is a human adult. In some embodiments, the subject is an elderly human.

[0320] In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does not have a genetic mutation in the wild-type or endogenous LDLR gene or has not been diagnosed with high levels of LDL-C. In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does not have a genetic mutation in the IDOL- binding region of the LDLR. In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does not have a genetic mutation in the LDLR 3’-UTR. In one embodiment, a subject is at risk of having high levels of LDL-C. In certain embodiments, an oligonucleotide is administered to a subject who has not been diagnosed with a disease associated with elevated or high levels of LDL-C.

[0321] In certain embodiments, an oligonucleotide is administered to a subject that does have a genetic mutation in the wild-type or endogenous ldlr gene. In certain embodiments,an oligonucleotide is administered to a subject, wherein the subject does have a genetic mutation in the IDOL-binding region of the LDLR. In certain embodiments, an oligonucleotide is administered to a subject, wherein the subject does have a genetic mutation in the LDLR 3’-UTR. In some embodiments, the subject to be administered an oligonucleotide is any individual at increased risk of developing high levels of LDL-C. In some embodiments, an oligonucleotide is administered to a subject who has elevated or high levels of LDL-C (compared to control). In certain embodiments, an oligonucleotide is administered to a subject who has been diagnosed with a disease associated with elevated or high levels of LDL-C.

[0322] In some embodiments, the subject to be administered an oligonucleotide is an individual affected by any condition associated with LDL or LDL-C. In some embodiments, the subject to be administered an oligonucleotide is an individual affected by any condition associated with increased or elevated levels of LDL or LDL-C. In some embodiments, the subject to be administered an oligonucleotide is an individual affected by any condition associated with increased or elevated levels of LDL or LDL-C compared to control.

[0323] In some embodiments, the subject to be administered an oligonucleotide (or composition comprising the same) suffers from or is at a risk of suffering from is hypercholesterolemia, familial hypercholesterolaemia, hypertriglyceridemia, hyperlipidaemia, non-alcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis or hepatocellular carcinoma.

[0324] Assays for testing the expression of an oligonucleotide may be conducted using any assay known in the art. Likewise, if the oligonucleotide is expressed by a vector, assays for testing the expression of the oligonucleotide may be conducted using any assay known in the art. For example, an assay for testing the expression of the oligonucleotide may include PCR. Functional analysis of the oligonucleotide may be done by assessing for target protein expression by Western Blotting.

[0325] Oligonucleotides for use as described herein are preferably assayed in vitro and / or in vivo for the desired therapeutic or prophylactic activity prior to use in humans. For example, in vitro and / or in vivo assays can be used to determine whether it is preferable to administer an oligonucleotide and / or another therapy.

[0326] Also provided herein are methods of preventing or treating a disease or condition associated with low-density lipoprotein (LDL) in a subject. In one embodiment, the ASO effects site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence derived from a sequence of an endogenous low-density lipoprotein receptor (LDLR) gene such that: a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression. In some embodiments, a method can be for the treatment of a condition, disorder or disease associated with low-density lipoprotein (LDL) in a subject, wherein the method comprises administering to a subject a therapeutically effective amount of an oligonucleotide or a pharmaceutical composition thereof. In one embodiment, the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression. In one embodiment, editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression. Methods for LDLR target editing

[0327] The present disclosure further provides methods for altering a target polynucleotide sequence in a primary cell. The methods are used to make desired changes, e.g., an A-to-I or A-to-G change, in a target sequence in a cell or a subject. The target sequence may be edited through an adenosine deamination reaction mediated by ADAR, converting adenosines into inosine. Alternatively, the target sequence may be edited using gene therapy. This site-directed editing may take place in vitro, in situ, in vivo or ex vivo.

[0328] The present disclosure relates, inter alia, to methods for editing a target adenosine in a target nucleic acid. For example, the present disclosure provides methods of editing a LDLR polynucleotide, e.g., a wild-type LDLR encoding polynucleotide to generate a LDLR variant. The polynucleotide can be RNA or DNA. For instance, the present disclosure relates to in vitro methods for editing a target adenosine in a target RNA sequence derived from a sequence of an endogenous LDLR gene. The present disclosure also relates to methods for deaminating at least one adenosine present in a target RNA sequence derived from a sequence of an endogenous LDLR gene in a cell.

[0329] In one aspect provided herein is a method for mutating an endogenous LDLR allele or an endogenous nucleic acid encoding LDLR in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition comprising the following selected from: (i) CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR- associated 9) components; (ii) adenine base editors (ABE); (iii) transcription-activator like effector nucleases (TALEN); (iv) Zinc-finger nucleases (ZFNs); (v) an expression construct of the disclosure; (vi) an oligonucleotide of the disclosure; and (vii) a composition of the disclosure; and wherein the method introduces a mutation within one or more of the following regions: (a) IDOL binding region; and / or (b) 3’-UTR. In one embodiment, the method involves gene therapy. In one embodiment, the method comprises delivery of mRNA. In one embodiment, the method comprises delivery of a DNA sequence. In one embodiment, the LDLR allele is to be mutated such that a) the LDLR protein has (i) reducedbinding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0330] In one embodiment, the method comprises introducing into the cell (i) one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to the LDLR protein coding sequence and comprise a binding site for a CRISPR associate (Cas) protein; (ii) a Cas nucleic acid sequence or a variant thereof that encodes the Cas protein that targets but does not cleave the target nucleic acid sequence; and wherein the coding sequence is to be edited such that a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

[0331] In one embodiment, the method for mutating the endogenous LDLR allele comprises delivery of mRNA. In one embodiment, the method for mutating the endogenous LDLR allele comprises gene therapy.

[0332] In one embodiment, the mutation results in a LDLR protein that is not able to interact with IDOL or interacts with IDOL at a level that is lower than that of a wild-type LDLR protein. In one embodiment, the mutation results in an increase in LDLR expression or cell surface expression. In one embodiment, the mutation results in a LDLR protein that is not able to interact with IDOL or interacts with IDOL at a level that is lower than that of a wild- type LDLR protein. In one embodiment, the LDLR allele encodes human LDLR, optionally wherein the human LDLR allele encodes SEQ ID NO: 1. In some embodiments, the A-to-G nucleotide change is at one of the following positions of SEQ ID NO: 1 selected from the group consisting of: 2455, 2458, 2488, and 2489.

[0333] In another aspect provided herein is a method for editing a target adenosine in a target nucleic acid, wherein the method comprises contacting the target nucleic acid with an oligonucleotide described herein. In one embodiment, the method is used in vitro. In one embodiment, the method is used in vivo. In one embodiment, the method is used ex vivo. In one embodiment, the method is used in situ.

[0334] In another aspect provided herein is a method for deaminating at least one specific adenosine present in a target RNA sequence derived from an endogenous LDLR gene in a cell, wherein the method comprises the steps of: (a) contacting the target nucleic acid with an oligonucleotide; (b) allowing uptake by the cell of the oligonucleotide; (c) allowing annealing of the oligonucleotide to the target RNA sequence; and(d) allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wildtype enzyme to deaminate the target adenosine in the target RNA sequence to an inosine.

[0335] In one embodiment, the method comprises after step (d), a step of identifying the presence of the inosine in the RNA sequence. The editing reaction is preferably monitored or controlled by sequence analysis of the target RNA.

[0336] Introducing single A-to-G substitution increases stability and LDLR expression. Hence, in one embodiment, there is an increase in LDLR stability. In one embodiment, there is an increase in LDLR cell surface expression.

[0337] The methods of the present disclosure can be used with cells from any organ, e.g., skin, lung, heart, kidney, liver, pancreas, gut, muscle, gland, eye, brain, blood and the like. The compositions and methods described herein is particularly suitable for modifying LDLR derived sequences in cells, tissues or organs implicated in a diseased state associated with LDL-C. In particular, the compositions and methods described herein may be used with liver cells, bronchial epithelial cells and adrenal gland and cortex tissue. For example, such cells may include, but are not limited, to hepatocytes and / or hepatocyte like cells.

[0338] The methods described herein may be used to target different sites or domains within the LDLR. LDLR is made up of a number of functionally distinct domains, e.g., the N- terminal domain of the LDLR is responsible for ligand binding. In some embodiment, the methods described herein target the IDOL binding region. In some embodiment, the methods target the 3’-UTR of an RNA derived from a sequence of an endogenous LDLR gene. EXAMPLES

[0339] The present disclosure shall be described in more detail by the following Examples and Figures. The examples shown in the following are merely illustrative and shall describe the present disclosure in a further way. These examples shall not be construed to limit the present disclosure thereto.

[0340] The sequences disclosed herein are also shown in the enclosed sequence listing. However, the sequence listing shows only the sequence of nucleotides, whereas the modification of the nucleotides and of the bonds between the nucleotides is not shown in the sequence listing. The relevant modifications associated with the sequences are disclosed in the Tables below and, to some extent, in the Figures.

[0341] For some experiments, editing efficacy is expressed as the fold change relative to the wild-type (WT) control.Example 1. Single A-to-G nucleotide substitution in hLDLR coding sequence prevents IDOL-mediated degradation of LDLR.

[0342] To determine the effect of single A-to-G mutations within the intracellular tail on LDLR protein stability, different hLDLR protein variants were generated and screened for their ability to resist IDOL-mediated ubiquitination and degradation in HEK293T cells. The results are presented in FIGs.1A-1E.

[0343] Table 1 summarizes the reagents and equipment used in Example 1. Table 1. Reagents and Equipment used.

[0344] The coding DNA sequence (CDS) (positions 1 to 2583) for full-length hLDLR (SEQ ID NO: 1) is shown in Table 2. SEQ ID NO: 1 refers to the collaborative consensus coding sequence (CCDS) version ID CCDS12254.1 (Ensembl Annotation Release 108; NCBI Annotation Release 110) of hLDLR (gene ENSG00000130164). IDOL ubiquitinates the LDLR protein through the conserved residues. The intracellular tail of hLDLR, corresponding to nucleotides 2431-2583, has been underlined (Table 2). Single, adenosine nucleotides to be edited in each exemplary variant have been bolded. Their respective position within the coding sequence has been indicated by superscript numbering. Table 2: Wild-type hLDLR coding sequence (CDS). SEQ ID NO: 1. Length of CDS is 2583bp. Position 1 is located at the 5’ end.

[0345] The corresponding amino acid sequences of wild-type hLDLR protein (LDLR-208; ENST00000558518.6) (SEQ ID NO: 2) and LDLR variants (SEQ ID NOs: 3-6) is listed in Table 3. The single, specific amino acid substitutions are shown in bold and have been underlined for each LDLR variant. TABLE 3. Amino Acid Sequence for CCDS 12254.1 (LDLR-208) and LDLR variants. Position in canonical transcript – Ensembl ID: ENST00000558518 UniProt ID: P01130.

[0346] A single A-to-G nucleotide substitution was efficiently introduced into the intracellular tail of the hLDLR CDS to generate a hLDLR protein variant. The different hLDLR variants 1 to 4, their respective nucleotide changes and amino acid substitutions are summarised in TABLE 4. TABLE 4. Exemplary hLDLR variants. A-to-G refers to an adenosine to guanosine change. The respective position of the A-to-g change is indicated. The type and position of the corresponding amino acid change is also shown.

[0347] Expression Plasmids: Expression plasmids encoding wild-type (WT) hLDLR and hLDLR variants 1-4 were generated and provided by Biocat GmbH. Briefly, the IDOL coding sequence and one of the coding sequences of hLDLR variants 1-4 were cloned into a dual-expression pcDNA5 plasmid (FIG.1A). The hLDLR CDS was placed under the control of the CMV promoter and IDOL was placed under the control of the EF1a promoter.

[0348] Cell culture and Transfections: 75,000 HEK293T (human embryonic kidney) cells / 24-well were grown in 5 mM glucose Dulbecco’s Modified Eagle’s Medium (DMEM) (4.5 g / l Glucose, Catalog No.61965-026, Thermo Fisher Scientific) supplemented with 10% FBS and Glutamax. Cells were cultured at 37°C with 5% CO2. 200 ng plasmids was subsequently transfected onto HEK293T cells. Empty pcDNA5 served as negative control.Wild-type LDLR served as positive control. Transfections were performed for 24 hrs, using LipofectamineTM2000 Transfection Reagent (Catalog No.11668019, Thermo Fisher Scientific), following manufacturer’s instructions.

[0349] Cell harvesting and processing for Western Blot: Approximately 22 h post transfection, the medium was removed and replaced by DMEM without fetal bovine serum (FBS) (Gibco, Catalog. No. A5256701) for approx.2 h before cells were harvested. The cells were detached by pipetting up and down and collected into 1.5 ml tubes. Next, the cells were centrifuged at 1000xg for 5mins, and the supernatant was discarded. Cold phosphate-buffered saline (PBS) was added to the cells, the cells were resuspended and washed 3 times in PBS. After the final wash, PBS was removed from the tubes and 50 µl of RIPA Lysis Buffer (Catalog No.89901, Thermo Fisher Scientific), supplemented with 1x Halt Protease Inhibitor (Catalog No.87785, Thermo Fisher Scientific), was added to the cell pellet. Using 25G needle and syringe, the lysates were sheared to get rid of any DNA contamination by passing the lysate through the needle 5-7 times. Next, the lysates were centrifuged at 16000xg for 10 min. at 4°C. Clear supernatant was then transferred to fresh 1.5ml tubes and BCA assay (Pierce™ BCA Protein Assay Kit (Catalog No.23227, Thermo Fisher Scientific) was performed as per the manufacturer’s protocol to determine protein concentrations.

[0350] Simple Western: The Simple Western was performed using the Jess Automated Western Blot System (Simple Western™ Jess instrument) (Bio-Techne, Catalog No.004- 650) as per the manufacturer’s protocol at pre-determined sample and antibody concentrations. Rabbit anti-LDLR antibody (NBP1-06709, Novus Biologicals) was used at 1:100 dilution and mouse anti-IDOL antibody (NBP2-46069, Novus Biologicals) was used at 1:10 dilution. Mouse anti-GAPDH antibody (NB300-221, Novus Biologicals) was used at 1:25 dilution. LDLR was detected using near-infrared (NIR) channel and IDOL and GAPDH were detected in Chemiluminescence channels using the following secondary antibodies: Anti-Rabbit Secondary NIR Antibody (043-819, Bio-Techne) and Anti-Mouse Secondary HRP Antibody (042-205, Bio-Techne). GAPDH served as positive loading control.

[0351] Western analysis demonstrated that the different hLDLR variants have increased resistance to IDOL-mediated degradation compared to wild-type hLDLR. As expected, there was high level of WT LDLR expression in the absence of IDOL (FIGs.1B and 1D, lane 2). Introducing a single A-to-G substitution into the hLDLR CDS resulted in the expression of hLDLR protein variants exhibiting increased protein stability and cell surface expression in the presence of IDOL (FIG.1A-1E). Specifically, as shown in FIG.1B, in the presence of IDOL, hLDLR variant K830E (lane 4) and variant K830R (lane 5) showed higher levels of protein expression compared to WT LDLR (lane 3), suggesting enhanced resistance to IDOL-mediated degradation. Similarly, as shown in FIG.1D, hLDLR variant N819D (lane 4)and variant S820G (lane 5) showed higher levels of protein expression compared to WT LDLR (lane 3).

[0352] Further, it was shown that this increase in hLDLR variant protein expression as about 3-fold. In the presence of IDOL, a single A-to-G nucleotide mutation (or its respective amino acid substitution) was shown to increase hLDLR protein surface expression by approximately 3-fold when compared to wild-type hLDLR (FIGs.1C-1D). As shown in FIG. 1C, in the presence of IDOL, there was an approximate 2.5 to 3-fold change in LDLR surface expression for the N819D and N820D variants. Similarly, for the K830R and K830E variants, the change in cell surface expression was about 3-fold or higher relative to wild-type (FIG. 1E).

[0353] The findings demonstrate that hLDLR CDS can be targeted for efficient A-to-G editing. Furthermore, the results demonstrate that the specific amino acid substitutions give rise to hLDLR protein variants with improved stability and resistance to IDOL-mediated degradation and increased cell surface expression when compared to wild-type.

[0354] These findings confirm that gain-of-functions mutations, e.g., A-to-G or A-to-I mutations, can be introduced to enhance hLDLR stability and cell surface expression. More importantly, the results provide a proof-of-concept for targeting hLDLR coding RNAs for ADAR-mediated A-to-I editing to introduce amino acid substitutions in the hLDLR protein that will lead to LDLR protein variants with enhanced stability and improved resistance to IDOL-mediated degradation. Example 2. A-to-I editing of hLDLR coding RNA by antisense oligonucleotides.

[0355] To investigate the potential of different antisense oligonucleotides for their ability to target hLDLR coding mRNA for and mediate A-to-I editing, several antisense oligonucleotides with different nucleotide sequences and chemical modifications were synthesized and assayed for their in vitro RNA editing efficacy. The different antisense oligonucleotides, their sequence, and chemical modifications are listed in Table 5. Table 5 also shows the corresponding amino acid substitution to be brought about by each antisense oligonucleotide. Table 5. Examples of antisense oligonucleotides targeting hLDLR RNA. m = 2’-O-methyl-N; f= 2'F-N, dN = deoxy-N, * = PS linkage, & = Mesyl, SbU = iso-Uridine, I = Inosine. Amino acid substitution and asymmetry are shown in parentheses.

[0356] Editing efficiency of different antisense oligos (ASOs) at a final concentration of 50 nM was tested in vitro in human hepatocytes. The transfection was performed using RNAiMAX as transfection reagent in a 96-well format. After 24 h of treatment, the editing was quantified via RNA sequencing. RNAiMAX served as control. The results are shown in FIGs.2A-2D.

[0357] Reagents and Machines used: Human Cryoplateable Hepatocytes (BioIVT, Cat. No. X008052-P); Opti-MEM™ (improved Minimal Essential Medium (MEM); Thermo Fisher, Cat. No.51985042); 96-well plates (Sarstedt, Cat. No.83.3924); PBS (Gibco™, Cat. No. 14190250); TORPEDO™ Antibiotic Mix (BioIVT, Cat. No. Z99029); INVITROGRO CP Medium (BioIVT, Cat. No. Z99009); INVITROGRO HI Medium (BioIVT, Cat. No. Z99000); Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher, Cat. No.13778075); Luna® Universal One-Step RT-qPCR Kit (NEB, Cat. No. E3005E); OneTaq Hot Start 2X Master Mix with GC Buffer (NEB, Cat. No. M0485L); Lysis / Binding Buffer for Dynabeads™ (Thermo Fisher, Cat. No. A33562); Dynabeads™ mRNA Purification Kit (Thermo Fisher, Cat. No.61006); C.WASH™ (Cytena); and Illumina ISeq100.

[0358] Cell culture: Human Cryoplateable Hepatocytes were thawed in a water bath for 2 min at 37 °C and mixed with 5 ml of INVITROGRO CP medium supplemented with TORPEDO antibiotics according to the manufacturers protocol. The cell suspension was diluted to 7x105cells / ml and subsequently 70 µL / well of the suspension was seeded into 96-well plates. After 4 h, the medium was replaced with 80 µL of INVITROGRO HI Medium, supplemented with TORPEDO antibiotics. The transfection was conducted 1h after medium change.

[0359] Editing assay procedure: The transfection mixture was prepared with RNAiMAX in Opti-MEM as transfection reagent according to the manufacturers protocol.20 µL of the transfection mixture was applied to each well of the 96-well plate, containing 0.3 µL / well of RNAiMAX with ASO. The cells were incubated at 37 °C and 5% CO2 for 24 h. The medium was removed, and the cells were washed by 100 µL / well of cold-PBS. Lysis was performed by applying 100 µL of Lysis buffer and pipetting 10 X up and down. The lysate was immediately frozen at -80 °C for 2 days. The lysate was thawed on ice and mRNA isolation was performed using a Cytena C.WASH and a Dynabeads™ mRNA purification kit according to the manufacturers protocol. A one step RT-PCR was performed using Luna® universal one-step RT-qPCR kit and the primers as listed in Table 6. The PCR products were diluted 1:10 in water and used as template for the indexing PCR with illumines indexing primer libraries, i7 and i5. OneTaq Hot Start 2X master mix with GC buffer was used for this PCR according to the manufacturers protocol. The sample for sequencing was prepared according to illumina protocols for sequencing runs with an iSeq100. The loading mixture was spiked with 15% PhiX.Table 6: Primers used in A-to-I Editing Assay.

[0360] As shown in FIGs.2A-2D, all antisense oligonucleotides were able to specifically target the LDLR RNA and edit the specific target adenosine (A). Further, there was an overall increase in target editing yields compared to control (RNAiMAX). Moreover, a general trend was observed in that shorter antisense oligonucleotides showed lower editing compared to longer antisense oligonucleotides. That is, all antisense oligonucleotides with a length of 45 nt or a 29-1-15 asymmetry showed the highest levels of target editing. As shown for LDLR N819D (FIG.2A), highest editing yields (%) were achieved with ASO AI-1906 (45 nt), having an editing efficacy of about 8% (FIG.2A). Similar percentage editing was observed for target sites K830E (FIG.2C), where AI-1912 showed the highest editing around 6%. Likewise, for the K830R target site, percentage editing of up to about 7% were observed (FIG.2D). Interestingly, much higher levels of target editing were detected for the LDLR S820G site, even with shorter antisense oligonucleotide lengths (FIG.2B). ASO AI-1909 showed the highest percentage editing at around 20%.

[0361] Overall, the results demonstrate that the different antisense oligonucleotides were able to specifically target LDLR RNA. Further, the results show that chemically modified antisense oligonucleotides comprising a mixture of, e.g., 2’-F- and 2’-OMe backbone modifications and PS linkages, can efficiently target LDLR coding RNA and mediate A- to-I editing of a specific target site within the target RNA. The data suggest that theremight be an interplay between the chemical modification of the antisense oligonucleotide, antisense oligonucleotide length, and the position of the specific target site in order to achieve optimal A-to-I editing. Example 3. A-to-G substitution within the hLDLR 3’-UTR leads to an increase in hLDLR protein expression.

[0362] The 3'-UTR of mRNA plays a key role in the post-transcriptional regulation of gene expression. That is, the 3’-UTRs of mRNAs contain cis-acting elements that function in the regulation of protein translation and / or mRNA degradation. For instance, adenylate- uridylate-rich elements (AU-rich elements; AREs) can be found in the 3'-UTR of many messenger RNAs (mRNAs), which represent one of the most common determinants of RNA stability and degradation in mammalian cells (Chen and Shyu, 1995). It is hypothesized that deletion or modification of the 3’-UTR confers resistance to negative regulation of LDLR by miRNAs and proteins.

[0363] To investigate the impact of the LDLR 3´UTR and the effect of single A-to-G point mutations or a plurality of A-to-G mutations within the AREs on LDLR protein stability, several mutant variants coding for the LDLR 3´-UTR were generated and examined for their expression in vitro. The DNA nucleotide sequences for wild-type LDLR 3’-UTR is listed in Table 7. The different variants of hLDLR-3´UTR are listed in Table 8 to 17 respectively. LDLR versions mARE1 (Table 8), mARE2 (Table 9), and mARE3 (Table 10) carry several A-to-G point mutations either in the proximal or distal region of the 3‘- UTR. Variant LDLR A111G (Table 11), LDLR A113G (Table 12), LDLR A115G (Table 13), LDLR A119G (Table 14), LDLR A98G (Table 15), LDLR A100G (Table 16), and LDLR A123G (Table 17) each carry a single A-to-G mutation is indicated (position 1 being the start of the 3’-UTR).

[0364] Table 7 lists the DNA (SEQ ID NO: 37) and RNA (SEQ ID NO: 38) sequence for WT LDLR 3’-UTR, which are based on and were derived from the ENST00000252444-10 / ENST00000558518.6 (Ensembl). Table 7: WT LDLR 3’-UTR coding sequence and RNA sequence.3’-UTR for LDLR- 208 / 201 Transcript (ENST00000252444-10 / ENST00000558518.6); Length: 2504 nt. Positions: 1-2504. Targeted adenosine sites are shown in bold und underlined.

[0365] Table 8 lists the coding sequence for the LDLR mARE1 variant. The LDLR variant mARE1 coding sequence (SEQ ID NO: 39) contains 7 A-to-G mutations. The coding sequence is shown in Table 8. Table 8: LDLR mARE1. The different A-to-G mutations are shown in bold and have been underlined. Mutations are located within the proximal region of the 3’-UTR.

[0366] Table 9 lists the coding sequence for the LDLR mARE2 variant. The LDLR mARE2 variant coding sequence (SEQ ID NO: 40) contains 7 A-to-G mutations. The coding sequence is shown in Table 9. Table 9: LDLR mARE2. The different mutations are shown in bold and have been underlined.

[0367] Table 10 lists the coding sequence for the LDLR mARE3 variant. The LDLR mARE3 variant coding sequence (SEQ ID NO: 41) contains 9 A-to-G mutations. The coding sequence is shown in Table 10. Table 10: LDLR mARE3 variant. The mutations are shown in bold and have been underlined. Mutations are located within a distal region of the 3’-UTR.

[0368] Further, LDLR variants were generated carrying single A-to-G mutations within the 3’-UTR, i.e., within the proximal region of the 3’-UTR. One of the variants or modification for translational upregulation of LDLR is A111G (A111G). The LDLR A111G variant coding sequence (SEQ ID NO: 42) contains a single A-to-G mutation within the proximal region of the 3’-UTR. The coding sequence is shown in Table 11. Table 11: LDLR A111G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0369] The LDLR A113G variant coding sequence (SEQ ID NO: 43) contains a single A- to-G mutation at position 113 (A113G, A113G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 12. Table 12: LDLR A113G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0370] The LDLR A115G variant coding sequence (SEQ ID NO: 44) contains 1 A-to-G mutation at position 115 (A115G, A115G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 13.Table 13: LDLR A115G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0371] The LDLR A119G variant coding sequence (SEQ ID NO: 45) contains 1 A-to-G mutation at position 119 (A119G, A119G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 14. Table 14: LDLR A119G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0372] The LDLR A98G variant coding sequence (SEQ ID NO: 51) contains 1 A-to-G mutation at position 98 (A98G, A98G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 15. Table 15: LDLR A98G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0373] The LDLR A100G variant coding sequence (SEQ ID NO: 52) contains 1 A-to-G mutation at position 100 (A100G, A100G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 16. Table 16: LDLR A100G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0374] The LDLR A123G variant coding sequence (SEQ ID NO: 53) contains 1 A-to-G mutation at position 123 (A123G, A123G) within the proximal region of the 3’-UTR. The coding sequence is shown in Table 17. Table 17: LDLR A123G variant. The single A-to-G mutation is shown in bold and has been underlined.

[0375] Constructs: The different LDLR 3´-UTRs were fused to the C-terminal end of the hRLuc (mammalian codon optimised Renilla luciferase) reporter (FIG.3A) and expressed in the psiCHECK2.0 vector under the control of the SV40 promoter. hLuc2 (control, mammalian codon optimised Firefly luciferase from Luciola lateralis) was expressed from the same backbone under the control of a second HSV TK promoter.

[0376] The of wild-type and variant versions of hLDLR-3´UTR were evaluated via transient transfections in Huh-7 cells and luciferase assays. Results are shown in FIGs. 3B-3C.

[0377] Cell culture and Transfections: Huh-7 cells were grown in 5 mM glucose DMEM (1 g / l Glucose, Thermo #11885084) supplemented with 10% FBS, 2 mM Gluta-Max (Gibco). Cells were cultured at 37°C and 5% CO2.50,000 Huh-7 cells were seeded in 24-well plates and transfected 24 hours later using 50 ng psiCHECK2.0 constructs and Lipofectamine 3000 (Thermo #L3000008), following manufacturer’s instructions.24 hrs after transfection, cell culture media was removed, and 96-well plates were directly frozen at -80°C for up to 1 week.

[0378] Luciferase Assay: Initially, the luciferase reagents were thawed and warmed up to room temperature (RT) (22-25°C) for 30 mins in the dark. A 1x Passive Lysis Buffer (PLB) was prepared by adding 1 volume of 5X PLB (Promega #E1941) to 4 volumes of nuclease- free water. Mixed well and stored at 4°C (for a maximum of 4 weeks). Frozen (dry) cell plates were thawed to RT for 5 mins on bench. Next, 80 µl of freshly (or within 4 weeks) prepared 1x PLB (22-25°C) in nuclease-free water were added to each well. Next, 80 µl of Firefly Luciferase (FLuc) reagent were added to a total volume of ~ 160 µl. The sample was then incubated at RT (22-25°C) for 5 mins in dark before 140 µl of the lysate and luciferase mixture were transferred to Greiner Bio-One microplate, 96-well, F-Bottom (chimney well), black (Greiner Bio-One #655076). FLuc readings were taken as soon as the transfer was completed. Next, the Renilla Luciferase (RLuc) substrate was prepared by adding Stop & Glo reagent (1:100) to the Renilla assay buffer (prewarmed to RT). 1 / 2 volume of RLuc substrate was added per well based on the working plate volume, mix bypipetting 5x. The sample was incubated at RT for 5 mins in the dark, before RLuc readings were taken. The ratio of RLuc to FLuc was calculated for each variant and normalised against similar ratio for the WT LDLR 3´UTR.

[0379] As shown in FIG.3B, LDLR versions mARE1 and LDLR versions carrying a single A-to-G mutation showed a significant fold increase RLuc readings over WT LDLR 3’UTR. Specifically, LDLR variant mARE1 displayed a nearly 2-fold increase compared to the WT LDLR 3’UTR, while LDLR variants mARE2 and mARE3 showed levels that were similar to the WT. The single A-to-G mutant LDLR variants A111G, A113G, A115G and A119G showed a fold increase of about 1.5 compared to control. Similarly, as shown in FIG.3C, LDLR variants A98G and A100G showed a fold increase of about 1.5 when compared to wild-type LDLR 3’-UTR.

[0380] The results show that sequence modification of the LDLR 3’-UTR impacts protein expression. This may be as a consequence of changes in mRNA stability as a result of interfering with the regulation of the accessibility of functional effectors such as RNA binding proteins or ncRNAs. Specifically, the data suggest that introducing single A-to-G mutations within the 3’-UTR can be used to increase overall protein expression.

[0381] Further, these data serve as a proof-of-concept that hLDLR-3´UTR is a feasible target for ADAR-mediated A-to-I editing in order to enhance translation of hLDLR coding mRNA and hLDLR protein expression. Example 4. A-to-I editing of hLDLR 3’-UTR by antisense oligonucleotides.

[0382] To investigate the potential of ASOs to specifically target the 3’-UTR of hLDLR and mediate precise A-to-I editing within said the 3’-UTR, antisense oligonucleotides of varying lengths were synthesized and tested in vitro. Each ASO was specific to the LDLR 3’-UTR A111 target site and carried a different combination of modifications at the 2’-position of the sugar residue and internucleoside linkage modifications. The various antisense oligonucleotides and their chemical modifications are summarised in Table 18. RNAiMAX served as negative control. The same protocols were used as in Example 2. The results are shown in FIGs.4A-4D. Table 18: Examples of ASOs targeting 3’-UTR of LDLR. mM ’= 2’-O-methyl-N; f= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine.Table 19: Primers used in A-to-I Editing Assay. The same primers were used for the 111, 113, 115 and 119 sites.

[0383] The same reagents and machines, cell culture and editing assay procedure was used as described for Example 2 above.

[0384] As shown in FIGs.4A-4D, antisense oligonucleotides targeting the LDLR 3’-UTR were able to efficiently mediate an A-to-I editing of the target RNA. While antisense oligonucleotides AI-1916 and AI-1917 showed editing of between 5% and 10%, antisense oligonucleotide AI-1918 showed an editing efficacy of nearly 15%. Similarly, the antisense oligonucleotide AI-2289 demonstrated an editing percentage of about 7 % (FIG.4C), while antisense oligonucleotide AI-2290 showed an editing percentage of about 15% (FIG.4B). Surprisingly, AI-2288 (targeting A113) showed an editing efficacy of about 50% (FIG.4B). The results shows that the LDLR 3’-UTR could not only be effectively targeted by the ASOs but that the ASOs were able to effectively mediate A-to-I editing at the specific target site. Furthermore, the data corroborate the findings presented in Example 2, in that ASOs with a29-1-15 asymmetry or a length of 45 nt tend to show higher editing efficacy than ASOs of shorter length.

[0385] Overall, the results demonstrate that chemically modified antisense oligonucleotides can effectively target the LDLR 3’-UTR and undertake A-to-I editing of said target LDLR 3’-UTR. These results further highlight the potential of using antisense oligonucleotides for A-to-I editing to temporarily optimize the UTR for improved LDLR protein expression. Example 5. LDLR protein variants show improved cellular LDL Uptake.

[0386] LDLR mediates the uptake of lipoprotein particles, mainly LDL, into cells via receptor-mediated endocytosis (Brown et al., 1986). To investigate the functionality and ability of different LDLR variants carrying substitutions in the IDOL-binding region to efficiently mediate LDL uptake, LDLR protein variants N819D, S820G, K830E and K830R (all carrying substitutions within LDLR intracellular tail) were co-expressed in the presence of IDOL and examined for their ability to take up LDL in vitro. The different reagents used and experimental set up are described below. The results are shown in FIG.5.

[0387] Reagents: RIPA Lysis Buffer (Catalog.No.89901, Thermo Fisher), Halt Protease Inhibitor (Catalog.No.87785, Thermo Fisher), and Pierce™ BCA Protein Assay Kit (Catalog.No.23227, Thermo Fisher) were used as described in TABLE 1 under Example 1. Further, Image-iT™ Low Density Lipoprotein Uptake Kit, Bodipy FL (Catalog No. I34359, Invitrogen) was used to measure LDL uptake according to the manufacturer’s protocol.

[0388] Constructs: Wild-type and mutant LDLR variants expressed in pcDNA5 plasmid backbone were generated at Biocat GmbH. LDLR and IDOL (MYLIP) were cloned into a dual-expression pcDNA5 plasmid. LDLR was placed under CMV promoter and IDOL under EF1a promoter. The plasmids were used to generate stable-expression cell lines in the Flp- In™ T-REx™ 293 Cell Line (Invitrogen, Catalog.No: R78007) as described in Wettengel et al., Nucl Acids Res.2017;45:2797–2808. The cell lines were subsequently used to assess LDL-Uptake activity using the Image-iT™ Low Density Lipoprotein Uptake Kit, Bodipy FL (Invitrogen, Catalog No. I34359).

[0389] Cell Culture: Flp-In-TRex expression cells were grown in 5 mM glucose DMEM (4.5 g / l Glucose, Catalog No.61965-026, Thermo Fisher) supplemented with 10% FBS (Gibco, Catalog.No.A5256701) and Glutamax. Cells were cultured at 37°C with 5% CO2. Expression of LDLR from the CMV promoter was induced by Doxycycline Hydrochloride (Sigma Aldrich, Catalog.No.D3072).

[0390] LDL-Uptake Assay: On day-1, 2x105Flp-In TRex cells expressing either LDLR wild- type or one of the four variants (N819D, S820G, K830E, K830R) were seeded in 24-wellplate format. On day-2, the medium was removed and replaced by DMEM + 10% FBS + Doxycycline 10ng / ml 4hrs before the cells were harvested. Next, the cells were subjected to serum starvation by replacing the medium with DMEM + Doxycycline 10ng / ml 3 hours before harvest. After 2 hours, Bodipy-LDL was added to the cells at a concentration of 5 µg / ml and incubated at 37°C for 1hour. The cells were then washed by cold-PBS three times and detached by pipetting up and down and collected into 1.5ml tubes. The cells were subsequently centrifuged at 1000xg for 5mins, and the supernatant was discarded.250µl of RIPA buffer (supplemented with 1x Halt protease inhibitor) was added to the cell pellet and the lysates were vortexed thoroughly for 30 seconds and centrifuged at 16000xg for 5 mins to get rid of cell debris. Clear supernatant was then transferred to fresh 1.5ml tubes. Protein concentration was determined via BCA assay and was performed as per the manufacturer’s protocol. Bodipy signal was measured in the lysates using Spectramax i3x microplate reader at Ex / Em 495 / 520nm in 100µl of sample in duplicates. Finally, the fluorescence signal was normalised to the total protein content in each sample.

[0391] As shown in FIG.5, in the presence of IDOL, LDLR variants N819D, S820G, K830E and K830R demonstrated enhanced uptake of LDL-particles compared to wild-type LDLR. Specifically, variant N819D and variant S820G showed LDL uptake levels that were about 4- fold higher than that of wild-type LDLR, while LDL uptake levels for K830E and K830R were just below and above 2-fold, respectively.

[0392] These data not only demonstrate that the LDLR variants were able to specifically bind and take up LDL through the LDL receptor internalization pathway but also that this binding and uptake is significantly improved compared to wild-type LDLR. These results provide evidence that A-to-I editing can be efficiently used as a tool for engineering LDLR GOF variants to enhance LDL uptake and lower the levels of circulating LDL. Moreover, these finding emphasize the use of A-to-I editing as a prospective therapeutic approach in the treatment or prevention of disease or disorders associated with elevated plasma LDL-C levels. Example 6. LDLR protein coding isoform alignment.

[0393] Human LDLR is expressed in various cells, tissues and organs. Sequence similarity searches and sequence alignments can identify homologous regions. A human LDLR mRNA 3’-UTR Clustal Omega sequence alignment was generated based on the sequences listed in Table 20. The sequence alignment is depicted in FIG.6. The ARE1 region sequence is AGAGCTTTGTTTTATATATTTATTCA (SEQ ID NO: 69) (the corresponding core ATTTA sequence has been underlined).Table 20: Human LDLR mRNA 3’-UTR sequences. LDLR protein coding isoforms. ARE1 region was aligned against the 3´UTR sequences of all 9 protein coding hLDLR transcripts.* hLDLR transcripts contain the ARE1 region at same positions in their 3´UTR (A98-A123).#LDLR-205 has an extremely short 3’-UTR and does not align with the sequence.

[0394] As shown in FIG.6, eight of the nine hLDLR transcripts contain the ARE1 region at same positions in their 3’-UTR (position A98-A123). LDLR-205 has an extremely short 3’- UTR ("AGGATAA”) and does not align with the other corresponding LDLR 3’-UTR sequences. The results from the alignment confirm that there is sequence homology between the different LDLR isoforms. Further, these data suggest that different LDLR isoforms from different tissues or organs may be targeted by (but not limited to), e.g., A-to-I editing or gene therapy, in order to create LDLR GOF variants thereby mediating enhanced LDL uptake and lowering the blood levels of circulating LDL. Example 7. A-to-I editing of LDLR coding mRNA leads to lower LDL-C.

[0395] ARE 1 containing the 3’-UTR sites is highly conserved between species. That is, position 191 (A191) in mouse LDLR 3’-UTR corresponds to position 113 (A113) in the 3’- UTR of human LDLR and position 197 (A197) in mouse LDLR 3’-UTR corresponds to position 119 (A119) in the 3’-UTR of human LDLR. Hence, the ability of different antisense oligonucleotides to mediate A-to-I editing of the mLDLR 3’-UTR at sites A191 and A197 was assessed in primary mouse hepatocytes.

[0396] 25,000 primary mouse hepatocytes were seeded in collagen-coated 96-well plates containing DMEM low Glucose + 10% FBS + 1% Penicillin / Streptomycin.4 hrs later, mediawas changed to William’s E medium + 2 mM Glutamax + 1% Penicillin / Streptomycin, and the cells were transfected with 4 nM or 20 nM ASO using 0.3 µl RNAiMAX per well.

[0397]

[0398] The two wildtype DNA reference sequences (SEQ ID NO: 108 and SEQ ID NO: 109) of the murine LDLR (mLDLR) are listed in Table 21. These sequences only differ in the terminal 4 nucleotides which are only present in SEQ ID NO: 109 (in lower case). The targeting positions 191 (A191) and 197 (A197) have been indicated respectively. The antisense oligonucleotides, their sequence and specific modification patterns are shown in Table 22. The results are shown in FIGs.7A-7B. Table 21: WT LDLR 3’-UTR coding sequence and RNA sequence in mice. Targeted adenosine sites are shown in bold und underlined.

[0399] The different antisense oligonucleotides, their sequence, and chemical modifications are listed in Table 22. Table 22 also shows the corresponding amino acid substitution to be brought about by each antisense oligonucleotide. Table 22. Examples of antisense oligonucleotides targeting murine LDLR (mLDLR) RNA. m = 2’-O-methyl-N; f’= 2'F-N, dN = deoxy-N, * = PS linkage, & = Mesyl, SbU = iso-Uridine, I = Inosine; ln = locked nucleic acid. Amino acid substitution and asymmetry are shown in parentheses.

[0400] Three distinct ASOs were generated for each of the two target sites and tested in vitro for their ability to specifically target and edit each respective site. As shown in FIG.7A, there was efficient A-to-I editing of the A191 target site of the mLDLR 3’UTR. While the editing was lower for AI-3483, antisense oligonucleotides AI-3118 and AI-3484 showed efficient editing at 4 nM and 20 nM. Notably, the editing efficacy for AI-3118 and AI-3484 doubled to about 70% at a concentration of 20 nM. Similarly, ASOs AI-3476, AI-3477 and AI- 3481 were efficiently used to target and edit the A197 site of the mLDLR 3’UTR (FIG.7B). Most prominent editing was observed for AI-3477 and AI-3481 at 4 nM and 20 nM. Maximum editing was observed for AI-3481 at 20 nM, reaching a value of about 80% (FIG. 7B).

[0401] These data demonstrate that mLDLR 3'UTR sites 191 (A191) and 197 (A197) can be effectively targeted and edited via A-to-I editing using the antisense oligonucleotides provided herein. Additionally, the results show that this editing can achieve high efficiency, reaching up to 80% in murine hepatocytes in vitro.

[0402] The ability of different antisense oligonucleotides to mediate A-to-I editing of the hLDLR 3’-UTR at sites (A111, A113, A115 and A119) was assessed in human hepatocytes.

[0403] Human hepatocytes were isolated and grown as described below.

[0404] Materials: LIVERPOOL® Cryoplateable Hepatocytes (BioIVT, Cat. No. X008052-P); Collagen-coated 96-well plate (greiner, Cat. No.655950); INVITROGRO™ CP Medium (BioIVT, Cat. No. Z99029); INVITROGRO™ HI Medium (BioIVT, Cat. No. Z99009); TORPEDO™ Antibiotic Mix (BioIVT, Cat. No. Z99000); DPBS, no calcium, no magnesium (Gibco, Cat. No.14190250); RIPA Lysis and Extraction Buffer (Thermo Scientific, Cat. No 89901); Pierce™ BCA Protein Assay Kit (Thermo Scientific, Cat. No.23227).

[0405] Cell culture: Primary human hepatocytes were seeded at a density of 49,000 cells / well in 70 µL plating medium (INVITROGRO™ CP Medium + 2.2% TORPEDO™ Antibiotic Mix) per well in a collagen-coated 96-well plate and incubated at 37 °C and 5% CO2.After 4 h, the medium was changed to 80 µL growth medium per well (INVITROGRO™ HI Medium + 0.44% TORPEDO™ Antibiotic Mix) and cells were transfected with 20 nM ASO using 0.3 µl RNAiMAX per well. Cells were lysed after 48 h incubation at 37 °C and 5% CO2for RNA isolation and sequencing analysis or for protein measurement using ELISA.

[0406] For ELISA, cells were washed with 100 µL DPBS per well and subsequently lysed with 30 µL RIPA buffer per well. Lysates were sheared and clarified by centrifugation at 16.6 g at 4 °C for 10 minutes. Protein concentrations were determined using Pierce BCA assay. 2µg of protein was analysed using Human LDLR Quantikine ELISA kit (DLDLR0, R&DSystems) based on manufacturer’s protocol. Analysis was performed using 4 parameter logistic regression method on GraphPad Prism 10.

[0407] Primers used for editing assay: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGCCTTGTTTTATTCAAAGACAG (SEQ ID NO: 230) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGAAACCAAAATCCCAACCCAAGCC (SEQ ID NO: 231) GCATTGCCTGCCAGAGCTTTGTTTTCTATATTTATTCATCTGGGAGGCAGAACAGTAG (SEQ ID NO: 232) Table 23. Examples of antisense oligonucleotides targeting human LDLR (hLDLR) RNA. mN= 2'OMe-N ; fN= 2'F-N, dN=deoxy-N, moeN=2'OMOE, MeC=5-methyl-cytosine, lnN=LNA-N, *= PS, &=Mesyl, * Same ASO Cartridge purified. Samples diluted in 100µl PBS to obtain 250µM stocks. Stocks in vials. Registered as Batch 2 in Benchling.

[0408] Two distinct ASOs were generated for each of the four target sites (A111, A113, A115 and A119) and tested in vitro for their ability to specifically target and edit each respective site as shown in Table 23. As shown in FIG.8A, there was an increase in LDLR 3’-UTR site editing up to 70%. Further, there was an increase up to 3.5-fold of LDLR protein expression following RNA in ASO-treated human hepatocyte cells (FIG.8B).

[0409] These data demonstrate that hLDLR 3'UTR sites 111 (A111), 113 (A113), 115 (A115) and 119 (A119) can be effectively targeted and edited via A-to-I editing using the antisense oligonucleotides provided herein. Additionally, the results show that this editing can achieve high efficiency, reaching up to 70% in human hepatocytes in vitro. Example 8.3’UTR targeting results in 3-fold increase in LDLR expression in vivo.

[0410] Loss-of-function mutations in the LDLR cause elevated levels of LDL cholesterol and premature cardiovascular disease. It was previously shown that high intensity statin treatment reduces LDL by only 50-60% (Blumenthal, R. S., 2000). Similarly, inclisiran has been shown to achieve approximately a 52% reduction in LDL-C (Ray et al., 2023). Hence, various antisense oligonucleotides were tested for their activity and ability to target and edit the murine LDLR 3’UTR in vivo.

[0411] In vivo studies: Studies were conducted in C57BL / 6 mice.6-9 week old male WT C57BL / 6J mice from The Jackson Laboratory were acclimated for 17 days prior to start of study. Animals were housed 4 per cage with free access to food and water during acclimation. Mice were individually identified through tail marking prior to weighing and dosing. All procedures were performed according to NeoSome IACUC policies and guidelines as well as OLAW standards. Antisense oligonucleotides AI-3487 (targeting the A191 site) and AI-3477 (targeting the A197G site) were formulated with lipid nanoparticles (LNPs: DLin-MC3-DMA, cholesterol, DSPC, and DMG-PEG 2000 at a molar ratio of 50:38.5:10:1.5) and injected intravenously at a dose of 3 mg / kg. Mice were injected the respective antisense oligonucleotide intravenously or vehicle control (20 mM Tris HCl, pH 7.4 + 8%w / v sucrose) on day 0 (d0). Liver samples were harvested on day 5 (d5) for western blot analysis (FIG.9A).

[0412] Mouse liver lysate preparation: Freshly isolated liver from all groups were immediately frozen in liquid nitrogen. Frozen liver tissue samples were sonicated in RIPAcell extraction buffer containing complete protease inhibitor cocktail. The homogenate was centrifuged at 10,000×g for 15 min at 4 ºC. Protein concentration in the supernatant was determined by the BCA using bovine serum albumin as standard protein assay method (Pierce, Rockford, IL, USA).

[0413] Western Blotting: An equal amount of protein samples (prepared in RIPA buffer) was denatured in 2X SDS sample buffer, incubated at 95°C for 5 min, resolved by 4-20 % Tris-Glycine gel (Thermofisher), and transferred onto PVDF membrane. The membrane was immunoblotted with mouse LDLR antibody (Abcam, Cat. #AB52818) or Gapdh antibody (Cell Signaling Technology, Cat. #2118), followed by horseradish peroxidase conjugated secondary antibody and developed by Enhanced Chemiluminescence system. Signals were captured by iBright Imaging CL1000 System (Thermofisher). For quantification, the band intensities were determined by densitometry and analysed using the ImageJ digital imaging processing software (ImageJ 1.54g, National Institutes of Health, Bethesda, MD, USA). The expression of mouse LDLR was normalized to the expression of Gapdh. The fold overexpression of mouse LDLR protein in the ASO treated groups is normalized to the vehicle control group.

[0414] The different antisense oligonucleotides, their sequence, and chemical modifications are listed in Table 24. Table 24 also shows the corresponding amino acid substitution to be brought about by each antisense oligonucleotide. The results are shown in FIGs.9A-9C. Table 24. Examples of antisense oligonucleotides targeting murine LDLR (mLDLR) RNA. m = 2’-O-methyl-N; f= 2'F-N, dN = deoxy-N, * = PS linkage, & = Mesyl, SbU = iso-Uridine, I = Inosine; ln = locked nucleic acid. Amino acid substitution and asymmetry are shown in parentheses.

[0415] As shown in FIGs.9A-9C, the different ASOs lead to an increase in LDLR expression when compared to control. Specifically, as shown in FIG.9B, there was an about 1.5-fold increase in LDLR expression for the AI-3487 ASO targeting the site A191 site. Surprisingly, this change fold increased even further to about 3-fold for ASO AI-3477targeting the A197 site. LDLR protein expression was confirmed and quantified using densitometry of western blot samples from mouse liver and normalized to vehicle control (FIG.9C).

[0416] These data show that the 3’UTR region can be efficiently targeted and edited in vivo in order to induce an increase in LDLR expression. At the same time, these data show that the extend of target editing (%) and change in LDLR expression may be target site dependent. Overall, these data further confirm that targeting the 3’UTR of LDLR could be a powerful approach for treating patients suffering from homozygous or heterozygous familial hypercholesterolemia or any other disorder or condition associated with LDLR and / or LDL-C. Example 9. Targeting of the LDLR 3’UTR leads to a decrease in non-HDL- cholesterol and LDL-C in vivo.

[0417] The LDLR is a cell surface receptor that plays a central role in regulating blood cholesterol levels by mediating the uptake of LDL particles from the bloodstream. Once it had been confirmed that LDLR protein levels could be increased by ASOs targeting the 3' UTR, the inventors investigated whether this increase in LDLR levels would also affect the total level of non-HDL cholesterol (i.e., "bad" cholesterol) in vivo.

[0418] In vivo studies: Studies were conducted in C57BL / 6 mice or transgenic (Tg) mice with human APOB / CETP expression.6-9 week old male WT C57BL / 6J mice or transgenic (Tg) mice with human APOB / CETP expression from The Jackson Laboratory were acclimated for 17 days prior to start of study. Animals were housed 4 per cage with free access to food and water during acclimation. Transgenic mice with human APOB / CETP expression was chosen to mirror human lipoprotein profile. Mice were individually identified through tail marking prior to weighing and dosing. All procedures were performed according to NeoSome IACUC policies and guidelines as well as OLAW standards. The same antisense oligonucleotides as listed in Table 24 were used. Antisense oligonucleotides AI-3487 (targeting the A191 site) and AI-3477 (targeting the A197 site) were formulated with LNPs (DLin-MC3-DMA, cholesterol, DSPC, and DMG-PEG 2000 at a molar ratio of 50:38.5:10:1.5). C57BL / 6 mice were administered the respective antisense oligonucleotide intravenously at a dose of 3 mg / kg or vehicle control (20 mM Tris HCl, pH 7.4 + 8%w / v sucrose). Blood samples were collected on day 0 (d0) right before injection as well as day 3 (d3) and day 5 (d5) post injection. Transgenic (Tg) mice with human APOB / CETP expression were injected with 3 mg / kg LNP-formulated AI-3477, and 5 days later, livers were harvested for measuring RNA editing or blood samples were collected on day 2 (D- 2) prior injection as well as day 3 (D3) and day 5 (D5) post injection.

[0419] Non-HDL-cholesterol and LDL-C measurement: Serum chemistry profiles were obtained using the AU680 Chemistry System (Beckman Coulter). Total cholesterol and HDLis determined enzymatically using reagents designed for the AU680 Chemistry System and following the manufacturer’s instructions. LDL-direct levels are determined by direct homogenous assay. The LDL-Cholesterol test is a two-reagent homogenous system. The assay is comprised of two distinct phases. In phase one a unique detergent solubilizes cholesterol from non-LDL-lipoprotein particles. This cholesterol is consumed by cholesterol esterase, cholesterol oxidase, peroxidase and 4- aminoantipyrine to generate a colourless end product. In phase two a second detergent in reagent 2 releases cholesterol from the LDL – lipoproteins. This cholesterol reacts with cholesterol esterase, cholesterol oxidase and a chromogen system to yield a blue colour complex which can be measured bichromatically at 540 / 660nm. The resulting increase in absorbance is directly proportional to the LDL-C concentration in the sample.

[0420] Statistical Analysis: Two-way ANOVA with uncorrected Fisher’s LSD test, significance to pre-dose: *p < 0.05,**p < 0.005 (FIG.9B) **p < 0.001,***p < 0.0001 (FIG. 10B).

[0421] As shown in FIGs.10A-10B, targeting of the 3’UTR led to a decrease in non-HDL cholesterol blood concentration. Specifically, for ASO AI-3477, targeting the A197 site of the mLDLR 3’UTR, a significant decrease in non-HDL-cholesterol could be detected by day 3 and day 5 post dose (FIG.10B). Interestingly, this decrease in non-HDL cholesterol reached a maximum value of about 40% compared to control.

[0422] As shown in FIGs.11A-11D, ASO AI-3477 targeting 3’-UTR site A197 led to significant reduction in LDL-C in human APOB / CETP mouse model (FIG.11A). Specifically, for ASO AI-3477, targeting 3’-UTR site A197 of the mLDLR 3’UTR, showed approximately 40% RNA editing (FIG.11B). This editing caused a 2.8-fold significant increase in LDLR protein (as measured by ELISA) in the liver of transgenic (Tg) mice following treatment with the ASO AI-3477 (FIG.11C). Further, LDL-C was measured in blood samples 2 days prior injection (pre-dose) as well as 3 and 5 days following ASO AI-3477 injection (post-dose). AI-3477-treated mice showed significant decreases in in LDL-C after 3 and 5 days of treatment compared to 2-day pre-dose. Interestingly, this decrease in LDL-C levels (mg / dl) reached a maximum value of about 74% compared to pre- dose levels (FIG.11D).

[0423] These data demonstrate that A-to-I editing can be effectively utilized to target the 3' UTR of LDLR, enhancing and / or stabilizing LDLR protein expression, which in turn leads to a significant reduction in non-HDL cholesterol levels. Specifically, these findings show that the antisense oligonucleotides provided herein can target specific LDLR target sites as disclosed herein to lower LDL-C levels, offering a promising approach fortreating or preventing cardiovascular and / or liver diseases, including familial hypercholesterolemia.

[0424] Those having ordinary skill in the art will appreciate that the disclosure can be modified in ways not specifically described herein. Example 10. Editing Efficiency of LDLR targeting ASOs in vitro in mouse and human cells

[0425] Antisense oligonucleotides (ASOs) were designed to for editing of murine LDLR (mLDLR). Each ASO was designed to edit mLDLR RNA to achieve one of the following amino acid substitutions in mLDLR: N821D, S822G, K832E, K832R (see TABLE 25); or an A-to-I mutation in the 3’-UTR at the A189 position (see TABLE 21). The amino acid sequence of mLDLR and variants are shown in Table 25. ARE 1 containing the 3’-UTR sites is highly conserved between species (FIG.14C). That is, position 189 (A189) in mouse LDLR 3’-UTR corresponds to position 111 (A111) in the 3’-UTR of human LDLR. The intended mutation of each ASO is indicated in Table 26.

[0426] Each ASO was tested in murine hepatocytes at two concentrations, 20 mM or 50 mM, and the editing efficacy was measured. Results for each ASO, compared to the RNAiMAX negative control, are shown in FIG.12A. Table 25. Amino Acid Sequence for mLDLR and variants. Ensembl ID: ENSMUST00000034713.9; UniProt ID: P35951.Table 26: Examples of ASOs targeting mLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU =

[0427] Antisense oligonucleotides (ASOs) were also designed to for editing of human LDLR (hLDLR). Each ASO was designed to edit hLDLR to achieve one of the following amino acid substitutions in hLDLR: N819D, S820G, K830E, K830R; or an A-to-I mutation in the 3’-UTR at the A111 position. The intended mutation of each ASO is indicated in Table 27.

[0428] Each ASO was tested in Huh7 cells at three concentrations, 10 mM, 20 mM or 50 mM, and the editing efficacy was measured. Results for each ASO, compared to the RNAiMAX negative control, are shown in FIG.12B. Table 27: Examples of ASOs targeting hLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, MeN = 5-methyl-N.Example 11. In vitro designs for hLDLR targeting ASOs with LNAs increase target affinity.

[0429] Antisense oligonucleotides (ASOs) containing locked nucleic acids (LNAs) were designed to for editing of hLDLR. Each ASO was designed to edit hLDLR to achieve an S820G amino acid substitutions in hLDLR; or an A-to-I mutation in the 3’-UTR at the A111 position. AI-1909, AI-2261, and AI-2269 share a nucleobase sequence and have similar 2’-modifications and internucleoside linkage modifications. However, AI-2261 has a LNA at each end. AI-2269 has two LNAs at each end. AI-1918, AI-2260, and AI-2268 share a nucleobase sequence and have similar 2’-modifications and internucleoside linkage modifications. However, AI-2260 has a LNA at each end. AI-2268 has two LNAs at each end. The sequence, modifications, and intended mutation of each ASO are indicated in Table 28.

[0430] Each ASO was tested in Huh7 cells at two concentrations, 10 mM or 50 mM, and the editing efficacy was measured. Results for each ASO, compared to similar ASOs without LNAs, are shown in FIG.13. The presence of LNAs in an ASO enhances its binding affinity to a complementary strand. The introduction of LNAs has significantly improved editing efficiency for almost all sites. Whether one or two LNAs results in better performance depends on the editing site. Table 28: Examples of ASOs targeting hLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, ln=locked nucleic acid (LNA), MeN = 5-methyl-N.Example 12. Testing designs for 3’-UTR hLDLR targeting ASOs in vitro.

[0431] Antisense oligonucleotides (ASOs) were also designed to for editing the 3’-UTR region of human LDLR (hLDLR). Sites in this region affect mRNA stability. Each ASO was designed to achieve an A-to-I mutation in the 3’-UTR at one of the following positions: A111, A113, A115, or A119. These sites correspond to sites 3, 4, 5, and 6, respectively, in the ARE1 region of the 3’-UTR. Conservation of the LDLR ARE1 region across species is shown in FIG.14C. The intended mutation of each ASO is indicated in Table 29.

[0432] Each ASO was tested in Huh7 cells or human hepatocytes at two concentrations, 10 mM or 50 mM, and the editing efficacy was measured. Results for each ASO are shown in FIGs.14A-14B. Table 29: Examples of ASOs targeting hLDLR 3’-UTR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, MeN = 5-methyl-N.Example 13. Activities of mLDLR targeting ASOs in vitro.

[0433] Antisense oligonucleotides (ASOs) were designed to for editing of murine LDLR (mLDLR). Each ASO was designed to edit mLDLR to achieve one of the following amino acid substitutions: S822G or K832R. The intended mutation of each ASO is indicated in Table 30.

[0434] Each ASO was tested in murine hepatocytes at two concentrations, 4 mM or 20 mM, and the editing efficacy was measured. Results for each ASO are shown in FIGs. 15A-15B, 16, and 17A-17B. Table 30: Examples of ASOs targeting mLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU =Example 14. Activities of ASOs targeting the 3’-UTR of mLDLR in vitro.

[0435] Antisense oligonucleotides (ASOs) were designed to for editing of murine LDLR (mLDLR) in the 3’-UTR region. Each ASO was designed to edit mLDLR to achieve one of the following mutations: A191I or A197I (see TABLE 21). The intended mutation of each ASO is indicated in Table 31.

[0436] ASO were tested in murine hepatocytes at two concentrations, 4 mM or 20 mM, and the editing efficacy was measured. Results for A-to-I editing at position A191 are shown in FIG.18A. Results for A-to-I editing at position A197 are shown in FIG.18B. Table 31: Examples of ASOs targeting mLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, ln = locked nucleic acid (LNA), MeN = 5-methyl-N.

[0437] Antisense oligonucleotides (ASOs) were designed to for editing of murine LDLR (mLDLR) in the 3’-UTR region. Each ASO was designed to edit mLDLR to achieve A-to-Imutation at one of the following positions: A191 or A197. The intended mutation of each ASO is indicated in Table 32.

[0438] ASO were tested in murine hepatocytes at two concentrations, 4 mM or 20 mM, and the editing efficacy was measured. Results for A-to-I editing at position A191 are shown in FIG.19A. Results for A-to-I editing at position A197 are shown in FIG.19B. Table 32: Examples of ASOs targeting mLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, ln = locked nucleic acid (LNA), MeN = 5-methyl-N.Example 15. CRISPR-Cas9 adenosine-based editing (ABE).

[0439] CRISPR-Cas9 adenosine-based editing (ABE) was tested as a method to mutate mLDLR. A guide RNA (sgRNA3) with the sequence of SEQ ID NO: 174 (mT*mA*mC*CAGAmAGACCACAGAGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*U*U*U)and the enzyme NG-ABE8e were tested in vitro in hepa1-6 cell. mN = 2’-O-methyl; * = PS linkage. A schematic of sgRNA3 is shown in FIG.20A. sgRNA3 was designed to create a AAG to GAG mutation resulting in a K832E amino acid substitution in mLDLR. Methods

[0440] On day 1, hepa1-6 cells were seeded into cell culture with complete medium and incubated. Complete medium includes: 90% DMEM (Gibco, Cat#11995-065), 10% FBS (Omega Scientific Inc, Cat#FB-02), and 1%P / S (Cat#15140-122).

[0441] On day 2, hepa1-6 cells were transfected with NG-ABE8e mRNA and sgRNA.

[0442] Image-iT™ Low Density Lipoprotein Uptake Kit, Bodipy FL (Catalog No. I34359, Invitrogen) was used to measure LDL uptake according to the manufacturer’s protocol.

[0443] Sanger sequences was used to determine the accuracy of sgRNA3 editing. Results

[0444] Hepa1-6 cells treated with sgRNA3 and ABE8e show increased LDL-FITC uptake. The median fluorescence intensity (MFI) of LDL uptake for sgRNA3 compared to the negative control is shown in FIG.20B. Example 16. Activities of GalNAc conjugated ASO in vivo.

[0445] The activities of a 3’-GalNAc conjugated ASO (AI-5040) was tested in mice expressing the human ApoB100 and CETP transgenes (obtained from Taconic Biosciences). Six-to-eight-week-old female mice were subcutaneously injected with 10mg / kg AI-5040 dissolved in PBS or PBS only as indicated. Injections were performed on experimental day 0, day 2 and day 4. Animals were sacrificed 7 days after the first dose and livers were collected and snap-frozen. Tail serum was collected 3 days before treatment and at day 7 (7 days after the first dose) before sacrifice. Mice were fasted for 4 hours before tail bleeding and sacrifice. Non-HDL cholesterol was determined by calculating the difference of measured total cholesterol and HDL-cholesterol measured from serum samples.

[0446] Tissues were lysed in Dynabead lysis buffer (Dynabeads™ mRNA Purification Kit, Thermofisher) with a bead homogenizer (Bead Mill Max, VWR) and 1.4 mm ceramic beads, at 4.5 m / s for 30 sec. The lysates were used for mRNA purification using the Dynabeads™ mRNA Purification Kit (Thermofisher). The obtained RNA was then reverse transcribed and PCR-amplified for subsequent NGS amplicon sequencing and determining the RNA editing yield.

[0447] LDLR levels were measured from liver samples with the Mouse LDLR ELISA Kit (Quantikine, R&D Systems). Tissues were lysed in RIPA buffer (ThermoScientific) with 1X Phosphatase inhibitor and 1X Protease inhibitor (ThermoScientific), with a bead homogenizer (Bead Mill Max, VWR) and 1.4 mm ceramic beads, at 4.5 m / s for 30 sec. Aftermeasuring protein concentration with BCA assay, lysates were diluted and the ELISA was performed following manufacturer´s instructions.

[0448] AI-5040 targets A197 of mouse LDLR in the 3’ UTR of mouse LDLR and induces an A-to-I editing at A197. Editing efficacy in the liver tissue of mouse treated with AI-5040 was shown in FIG.21A. LDLR protein levels in was analysed by ELISA and the data shows AI- 5040 increased LDLR protein level in mouse liver (FIG.21B). Correspondingly, AI-5040 reduced non-HDL cholesterol in mice on day 7 post first administration (FIG.21C). Table 33: Examples of GalNAc conjugated ASO targeting mLDLR. mN = 2’-O-methyl-N; moeN = 2’-MOE-N; f’= 2'F-N, dN = deoxy-N, * = PS, & = Mesyl, SbU = iso-Uridine, I = Inosine, ln = locked nucleic acid (LNA), MeN = 5-methyl-N, C7= C7 linkerREFERENCES . Adachi, S.; M. Homoto; R. Tanaka; Y. Hioki; H. Murakami; et al. (2014). ZFP36L1 and ZFP36L2 control LDLR mRNA stability via th...

Claims

CLAIMS What is claimed is:

1. An antisense oligonucleotide (ASO) for site-directed adenosine-to-inosine (A-to-I) editing of a target adenosine in a target RNA sequence encoded by a sequence of a low- density lipoprotein receptor (LDLR) gene, wherein the ASO comprises a nucleobase sequence substantially complementary to the target RNA sequence, wherein the ASO comprises a central base triplet (CBT) of 3 nucleosides (5’ - N+1 N0 N-1 - 3’) with a central nucleoside (N0) that is directly opposite to the target adenosine to be edited when the ASO is hybridized to the target RNA sequence.

2. The ASO of claim 1, wherein the ASO is capable of recruiting an endogenous ADAR enzyme, and does not comprise a loop-hairpin structured ADAR recruitment motif.

3. The ASO of claim 1 or claim 2, wherein the ASO is 20-200 nucleosides in length, optionally wherein the ASO is 20-50 nucleosides in length.

4. The ASO of any one of claims 1-3, wherein the ASO is asymmetrical, optionally wherein the region 5’ to the CBT is 15-40 nucleosides in length, and the region 3’ to the CBT is 3-20 nucleosides in length.

5. The ASO of any of claims 1-4, wherein the ASO has an asymmetry of: a) 25-1-8; b) 23-1-12; or c) 29-1-15; wherein the numbers from left to right represent nucleosides from 5’ to 3’, and wherein the 1 represents the N0nucleoside of the CBT.

6. The ASO of any one of claims 1-5, wherein the ASO comprises one or more modified nucleosides and / or one or more modified internucleoside linkages.

7. The ASO of claim 6, wherein the one or more modified nucleosides comprise 2’- modified nucleosides, optionally wherein the one or more modified nucleosides is selected from: a 2’-deoxyribonucleode, a 2’-O-methly (2’-O-Me) modified nucleoside, a 2’-fluoro (2’-F) modified nucleoside, a 2’-O-methoxyethyl (2’-MOE) modified nucleoside, a 2′-fluoro-arabinonucleic Acid (2’-FANA) modified nucleoside, bridged nucleic acid (BNA), locked nucleic acid (LNA), constrained ethyl nucleosides (cET), and combinations thereof.

8. The ASO of any one of claims 1-7, wherein the one or more modified nucleosides comprises an iso-uridine (SbU) modification, optionally wherein the SbU is at N0.

9. The ASO of any one of claims 1-8, wherein each of the three nucleosides of the CBT is selected from: (i) a deoxyribonucleotide (DNA); (ii) 2’-MOE modified nucleoside; (iii) 2’-F modified nucleoside; and (iv) 2’-O-Me modified nucleoside.

10. The ASO of any one of claims 1-9, wherein: (i) N+1 is 2’-F modified nucleoside, DNA, or 2’-MOE modified nucleoside; and / or (ii) N0 is DNA, optionally wherein N0 is deoxycytidine or deoxy-isouridine (SbU); and / or (iii) N-1 is DNA, optionally wherein N-1 is deoxyinosine or deoxycytidine.

11. The ASO of any one of claims 1-10, wherein no more than 6 consecutive nucleosides of the ASO have the same 2’-modification, optionally wherein the 2’-modification is a 2’-F modification or a 2’-O-Me modification.

12. The ASO of any one of claims 1-11, wherein the regions 3’ and 5’ to the CBT do not contain more than a total of 6 deoxyribonucleosides.

13. The ASO of any one of claims 5-12, wherein the one or more modified internucleoside linkage is selected from phosphorothioate (PS), 3'-methylenephosphonate, 5'-methylenephosphonate, 3'-phosphoroamidate, 2'-5'phosphodiester, methanesulfonyl (mesyl) and phosphoryl guanidine (PN), and combinations thereof.

14. The ASO of any one of claims 1-13, wherein the ASO comprises at least one methanesulfonyl (mesyl) linkage and / or at least one PS linkage.

15. The ASO of any one of claims 1-14, wherein at least 15%, preferably at least 30%, of the internucleoside linkages in the ASO are modified internucleoside linkages.

16. The ASO of any one of claims 1-15, wherein the ASO comprises 1-5 unmodified phosphodiester internucleoside linkages.

17. The ASO of any one of claims 1-16, wherein the target adenosine and / or target RNA sequence is in a translated region (TR) or a 3’-untranslated region (3’-UTR) of LDLR RNA.

18. The ASO of any one of claims 1-17, wherein the target adenosine and / or target RNA sequence is in the 3’-UTR of LDLR RNA, optionally wherein the target adenosine and / or target RNA sequence is within the proximal region of the 3’-UTR of LDLR RNA.

19. The ASO of claim 18, wherein one or more adenylate uridylate rich elements (AREs) are located 3’ and / or 5’ of the target adenosine to be edited, optionally wherein each of the one or more AREs comprises a core sequence of AUUUA.

20. The ASO of claim 18 or claim 19, wherein the target adenosine is located within ARE1.

21. The ASO of any one of claims 18-20, wherein the target adenosine corresponds to the adenosine at position 98, 100, 111, 113, 115, or 119 in the 3’UTR as set forth in SEQ ID NO: 38, or to the adenosine at position 189, 191, or 197 in the 3’UTR as set forth in SEQ ID NO:

228.

22. The ASO of claim 21, wherein the A to I editing results in a nucleobase substitution that corresponds to A98I, A100I, A111I, A113I, A115I, or A119I in the 3’UTR as set forth in SEQ ID NO: 38, or to A189I, A191I or A197I in the 3’UTR as set forth in SEQ ID NO:

228.

23. The ASO of any one of claims 18-22, wherein the ASO comprises at least 15 consecutive nucleobases of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

24. The ASO of any one of claims 18-22, wherein the ASO comprises the nucleobase sequence of any one of SEQ ID NOs: 34-36, 80-82, 192-194, 197-198, and 210-227, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

25. The ASO of any one of claims 18-24, wherein the ASO is selected from: AI-1916, AI-1917, AI-1918, AI-2288, AI-2289, AI-2290, AI-3483, AI-3118, AI-3484, AI-3476, AI-3477, AI-3481, AI-3487, AI-4167, AI-4168, AI-4169, AI-4170, AI-4171, AI-4172, AI-4173, AI-4174, AI-1940, AI-1941, AI-1942, AI-2260, AI-2268, AI-3127, AI-3478, AI-3480, AI-3838, AI-3829, AI-3837, AI-3838, and AI-5040.

26. The ASO of any one of claims 18-25, wherein A to I editing in the 3’-UTR of LDLR RNA prevents or reduces negative regulation of the LDLR RNA and / or increases stability of LDLR RNA.

27. The ASO of any one of claims 18-26, wherein the A to I editing increases LDLR protein expression.

28. The ASO of any one of claims 1-17, wherein the target adenosine and / or target RNA sequence is in a region of LDLR RNA that encodes an inducible degrader of LDLR protein (IDOL)-binding region of LDLR protein.

29. The ASO of claim 28, wherein the target adenosine is a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as set forth in SEQ ID NO: 2, or to N821, S822, or K832 in the LDLR protein as set forth in SEQ ID NO:

175.

30. The ASO of claim 29, wherein the A-to-I editing of the target adenosine results in an amino acid substitution in the LDLR protein, wherein the amino acid substitution corresponds to N819D, S820G, K830E and K830R in the LDLR protein as set forth in SEQ ID NO: 2, or to N821D, S822G, K832E and K832R in the LDLR protein as set forth in SEQ ID NO:

175.

31. The ASO of any one of claims 28-30, wherein the ASO comprises at least 15 consecutive nucleobases of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

32. The ASO of any one of claims 28-30, wherein the ASO comprises the nucleobase sequence of any one of SEQ ID NOs: 22-33, 180-191, 195-196, or 199-209, wherein each T can optionally and independently be a U, and each U can optionally and independently be a T.

33. The ASO of any one of claims 28-32, wherein the ASO is selected from: AI-1904, AI-1905, AI-1906, AI-1907, AI-1908, AI-1909, AI-1910, AI-1911, AI-1912, AI-1913, AI-1914, AI-1915, AI-1928, AI-1929, AI-1930, AI-1931, AI-1932, AI-1933, AI-1934, AI-1935, AI-1936, AI-1937, AI-1938, AI-1939, AI-2261, AI-2269, AI-3145, AI-3445, AI-3444, AI-2267, AI-3447, AI-3448, AI-3449, AI-3450, AI-3451, AI-3455, AI-3456, AI-3469, AI-3474, AI-3841, AI-3840, AI-3839, AI-3833, AI-3836, AI-3835, AI-3834, AI-3139, AI-3463, and AI-3464.

34. The ASO of any one of claims 30-33, wherein amino acid substitution prevents or reduces (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation.

35. A composition comprising the ASO of any one of claims 1-34.

36. The composition of claim 35, further comprising a pharmaceutically acceptable carrier.

37. A single guide RNA (sgRNA) for site-directed editing by a Cas9-based adenosine base editor of a target adenosine in a low-density lipoprotein receptor (LDLR) gene, wherein the LDLR gene comprises a sense strand and a reverse complementary strand, wherein the sgRNA is capable of hybridizing to a target sequence on the reverse complementary strand, wherein the target sequence hybridizes to a sequence on the strand where the target adenosine is located.

38. The sgRNA of claim 37, wherein the target adenosine is in a coding region or a sequence in the LDLR gene that encodes a 3’-untranslated region (3’-UTR) of LDLR RNA.

39. The sgRNA of claim 37 or claim 38, wherein the target adenosine corresponds to the adenosine at position 98, 100, 111, 113, 115, or 119 of the 3’UTR as set forth in SEQ ID NO: 37, or to the adenosine at positions 191 or 197 of the 3’UTR as set forth in SEQ ID NO:

108.

40. The sgRNA of claim 39, wherein editing of the target adenosine prevents or reduces negative regulation of the LDLR RNA and / or increases stability of LDLR RNA.

41. The sgRNA of claim 37-40, wherein the editing of the target adenosine increases LDLR protein expression.

42. The sgRNA of claim 37 or claim 38, wherein the target adenosine is in a region of LDLR gene that encodes an inducible degrader of the LDLR protein (IDOL)-binding region of LDLR protein.

43. The sgRNA of claim 42, wherein the target adenosine is in a nucleoside of a codon encoding an amino acid corresponding to N819, S820, or K830 in the LDLR protein as set forth in SEQ ID NO:

2.

44. The sgRNA of claim 43, wherein editing of the target adenosine results in an amino acid substitution that prevents or reduces (a) interaction of LDLR with IDOL when compared to wild-type LDLR protein; (b) IDOL-mediated LDLR ubiquitination; and / or (c) LDLR protein degradation.

45. A composition comprising the sgRNA of any one of claims 37-44.

46. The composition of claim 45, further comprising a Cas9-based adenosine base editor or a nucleic acid sequence encoding a Cas9-based adenosine base editor.

47. The composition of claim 45 or claim 46, further comprising a pharmaceutically acceptable carrier.

48. A method of mutating an endogenous nucleic acid encoding LDLR in a cell, the method comprising contacting the cell with the ASO of any one of claims 1-34, or the composition of any one of claims 35, 36, 46, and 47.

49. A method of increasing LDLR expression and / or activity in a cell, the method comprising contacting the cell with the ASO of any one of claims 1-34, or the composition of any one of claims 35, 36, 46, and 47.

50. The method of claim 48 or claim 49, wherein the cell is in vitro.

51. The method of claim 48 or claim 49, wherein the cell is in vivo in a subject.

52. A method of treating a disorder or condition associated with LDL in a subject, the method comprising administering to the subject the ASO of any one of claims 1-34, or the composition of any one of claims 35, 36, 46, and 47.

53. The ASO of any one of claims 1-34, or the composition of any one of claims 35, 36, 46, and 47 for use in a method of treating a disorder or condition associated with LDL in a subject, the method comprising administering the ASO or the composition to the subject.

54. The method of claim 51 or claim 52, or the ASO or composition for use of claim 53, wherein the subject is human.

55. The method of claim 52, or the ASO or composition for use of claim 53 or claim 54, wherein the administration is subcutaneous.

56. The method of claim 52, or the ASO or composition for use of any one of claims 53- 55, wherein the disorder or condition associated with LDL in a subject is hypercholesterolemia, hypertriglyceridemia, non-alcoholic fatty liver disease (NAFLD), acute pancreatitis, non-alcoholic steatohepatitis (NASH) without or with hepatic fibrosis, cirrhosis or hepatocellular carcinoma.

57. A method for mutating an endogenous nucleic acid encoding LDLR in a cell, wherein the method comprises delivering to the cell a non-naturally occurring composition comprising one of the following selected from: (i) CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat / CRISPR-associated 9) components; (ii) adenine base editors (ABE); (iii) transcription-activator like effector nucleases (TALEN); (iv) Zinc-finger nucleases (ZFNs); (v) the ASO of any one of claims 1-34; (vii) the composition of any one of claims 35, 36, 47, and 48; and wherein the method introduces a mutation within one or more of the following regions: (a) IDOL binding region; and / or (b) 3’-UTR.

58. The method of claim 57, wherein the LDLR allele is to be mutated such that a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; orb) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

59. The method of claims 57 or 58, wherein the method comprises introducing into the cell (i) one or more ribonucleic acid (RNA) sequences that comprise a portion that is complementary to the LDLR protein coding sequence and comprise a binding site for a CRISPR associate (Cas) protein; (ii) a Cas nucleic acid sequence or a variant thereof that encodes the Cas protein that targets but does not cleave the target nucleic acid sequence; and wherein the coding sequence is to be edited such that a) the LDLR protein has (i) reduced binding to the inducible degrader of the LDLR protein (IDOL); (ii) increased stability; (iii) improved resistance to IDOL-mediated degradation; or (iv) increased in LDLR protein expression; or b) editing of the 3’-untranslated region (UTR) of the target RNA leads to an increase in LDLR protein expression.

60. The method of claims 57 or 58, wherein the method for mutating the endogenous LDLR allele comprises delivery of mRNA.

61. The method of claims 57 or 58, wherein the method for mutating the endogenous LDLR allele comprises gene therapy.

Images