Differential expression of circulatory microrna MIR-142-3p in plasma-derived exosomes following chronic esophageal acid exposure

Abstract

Disclosed are methods, kits, systems, and platforms for testing, diagnosing, and treating subjects suffering from symptoms of or diagnosed with an esophageal gastric acid-related disease or condition.

Description

[0001] DIFFERENTIAL EXPRESSION OF CIRCULATORY MICRORNA MIR-142-3P IN PLASMA-DERIVED EXOSOMES FOLLOWING CHRONIC ESOPHAGEAL ACID EXPOSURE

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 642,136, filed May 3, 2024, the entire content of which is incorporated by reference in its entirety.

[0004] SEQUENCE LISTING STATEMENT

[0005] An electronic sequence listing (65005301177.xml; Size: 4,495 bytes; and Date of Creation: April 29, 2025) accompanies this application. The sequence listing is incorporated by reference in its entirety.

[0006] BACKGROUND

[0007] Noncoding RNAs (ncRNA, for example microRNAs or miRNAs, 18-22 bp) have emerged as major transcriptional regulators of gene expression and likely to regulate signaling mechanisms and pathophysiology of various diseases. Recent studies have also documented high expression of miRNAs in circulatory exosomes, which are small membrane vesicles with a diameter of 30-200 nm and released as a result of the fusion of multivesicular bodies with the plasma membrane for cell-cell communication. Exosomal miRNA expression levels reflect the physiology, pathology, and function of cells. Exosomal miRNAs are better protected from degradation because of their resistance towards endogenous ribonucleases, severe stressing conditions, such as high temperatures, high / low pH, and extended storage time. These unique properties make circulatory exosomes attractive diagnostic and prognostic biomarkers for various pathological disorders.

[0008] SUMMARY

[0009] In an aspect of the disclosure, a method of detecting a differential expression level of one or more of micro RNA (miRNA) in a subject having esophageal gastric acid exposure is provided. The method comprises obtaining a sample from the subject and a sample from a control; detecting an expression level of the miRNA in the subject sample and in the control sample, wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16-5p, and let-7a- 5p; and comparing the level of miRNA expression between the subject sample and the control sample.

[0010] In another aspect of the disclosure, a method of diagnosing gastroesophageal reflux disease in a subject is provided. The method comprises obtaining a sample from a subject and a control sample; detecting a differential expression level of miR-142-3p in the sample from a subject and in the control sample; and diagnosing the subject with gastroesophageal reflux disease when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample.

[0011] A further aspect of the disclosure is a kit, system, or platform comprising reagents for detecting one or more miRNAs in a sample from a subject. The reagents in the kit, system, or platform comprise primers for quantitative polymerase chain reaction (qRT-PCR) and / or reagents for isolating exosomes from the sample.

[0012] Another aspect of the disclosure is a method of treating in a subject having chronic esophageal gastric acid exposure. The method comprises obtaining a sample from a subject and a control; detecting a differential expression level of miRNA in the subject sample and in the control sample, wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p; diagnosing the subject with chronic esophageal gastric acid exposure when the expression level of the miRNA is increased in the sample from the subject as compared to the expression level of miRNA in the control sample; and administering an acid-reducing medication to the subject or performing a procedure on the subject to treat the chronic esophageal gastric acid exposure in the subject.

[0013] BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 is a chart showing the average cycle threshold (CT) values of three miRNAs, miR-142, MiR-122, and miR-16, in subjects with chronic esophageal acid exposure (n=5) against a saline controls (n=5).

[0015] DETAILED DESCRIPTION

[0016] Disclosed are methods, kits, systems, and platforms for use in detecting an expression level of miRNAs in a sample from a subject with esophageal gastric acid exposure, methods of diagnosis, and methods of treatment. The miRNAs may be, for example, one or more of miR-142, miR-122, and miR-16. The inventors discovered that expression of miRNAs (e.g., miR-142) is increased in exosomes isolated from blood and / or plasma samples from a rat model with esophageal gastric acid exposures, such as chronic esophageal gastric acid exposure, as compared to control animals.

[0017] Methods

[0018] Accordingly, in an aspect of the current disclosure, methods are provided for detecting an expression level of differentially expressed miRNA in a sample from a subject with esophageal gastric acid exposure. The miRNA may be, for example, one or more of miR-142, miR-122, and miR-16, and a let-7a. The expression of miRNA let-7a is used as an endogenous control for normalizing expression prolife of individual miRNAs in subjects with esophageal gastric acid exposures. In embodiments, the differential expression level of miRNA may be increased or decreased in a subject with esophageal gastric acid exposure, damage, or disease.

[0019] The terms “disease” or “disorder” or “condition” may be used interchangeably throughout this disclosure, and refer to a state of health of a mammal, for example a human, including any deviation from the normal state health of a mammal. As used herein, a “symptom” of a disease includes clinical or laboratory manifestation associated with the disease, and is not limited to what a subject can feel or observe.

[0020] The terms “damage” and “injury” may be used interchangeably throughout this disclosure and refer to an alteration in cellular or molecular integrity, activity, level, robustness, state, or other alteration that is traceable to an event. For example, an injury includes a physical, mechanical, chemical, biological, functional, infectious, or other modulator of cellular or molecular characteristics.

[0021] In some aspects, the methods comprise obtaining a sample from a subject and a control sample and detecting an expression level of one or more of miR-142, miR-122, miR-16, and let-7a in the sample from the subject and the control sample. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects and controls. In some aspects, the miR-142 is miR-142-3p. The miR-142-3p has the sequence: UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO: 1). In some aspects, the miR-122 is miR-122-5p. The sequence for miR-122-5p is UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 2). In aspects, the miR-16 is miR16-5p. The sequence for miR-16-5p is UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 3). In some aspects, the let-7a is let-7a-5p. The sequence for let-7a-5p is UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 4). In the aspects, the sample from the subject and the sample from the control contain exosomes. In aspects, the method further comprises isolating or obtaining exosomes from the subject sample and the control sample, and detecting an expression level of one or more of exosomal miR-142, miR-122, miR-16, and let- 7a in the subject sample and the control sample. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects and controls. In aspects, the method further comprises comparing the expression level of the detected exosomal miRNA in the subject sample and the control sample.

[0022] In some aspects, a method for diagnosing a subject with one or more conditions associated with esophageal gastric acid exposure, including chronic esophageal acid exposure, is provided. In some embodiments, the method comprises detecting an expression level of differentially expressed miRNA in a sample from the subject and a sample from a control. In some embodiments, the miRNA is one or more of miR-142-3p, miR-122-5p, and miR-16-5p. In all embodiments, the miRNA let-7a-5p expression is used as an endogenous or reference miRNA for normalizing expression of individual miRNAs in subjects with esophageal acid exposures and normal controls. In some embodiments, the miRNA is miR-142-3p. In some embodiments, a comparison of the expression level of the detected miRNA in the sample and control is used to diagnose the subject with one or more conditions associated with chronic esophageal acid exposure. In some embodiments, the condition is one or more of esophageal gastric acid damage, esophageal pain, acid reflux, acid reflux symptoms, and GERD. In some aspects, the method further comprises obtaining a sample from the subject and a sample from the control. In the aspects, the method further comprises isolating or obtaining exosomes from the subject sample and the control sample, and detecting an expression level of one or more of exosomal miR-142, miR-122, miR-16, and let-7a in the subject sample and the control sample. The expression of miRNA let-7a is used as an endogenous control for normalizing expression prolife of individual miRNAs in subjects with esophageal gastric acid exposures. In some embodiments, the miRNA is miR-142-3p. In the aspects, the method may further comprise comparing the expression level of the detected exosomal miRNA in the subject sample and the control sample.

[0023] Another aspect is a method of treating a subject with one or more conditions associated with esophageal gastric acid exposure, for example chronic esophageal acid exposure, the method comprising obtaining a sample from a subject and a control sample, detecting an expression level of differentially expressed miRNA in the sample from a subject and in the control sample, and administering an acid-reducing medication to the subject or performing a surgical operation on the subject to treat the one or more symptoms and / or conditions associated with esophageal gastric acid exposure in the subject. In embodiments, detecting comprises detecting an increased expression level of miRNA in the sample from a subject compared to the expression level of the miRNA in the control sample. In embodiments, an increased expression level of miRNA in the sample indicates esophageal gastric acid exposure in the subject, esophageal gastric acid damage, esophageal gastric acid disease or condition, including chronic esophageal gastric acid exposure and gastroesophageal reflux disease in the subject. In the aspects, the miRNA may be one or more of miR-142, miR-122, miR-16, and let-7a. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects with esophageal gastric acid exposures. In some embodiments, the miRNA is miR-142-3p. In the aspects, the method further comprises diagnosing the subject with chronic esophageal gastric acid exposure when the expression level of the miRNA is increased in the sample from the subject as compared to the expression level of miRNA in the control sample.

[0024] In some aspects, the method of treating further comprises isolating or obtaining exosomes from the subject sample and the control sample. In some aspects, the method comprises detecting an expression level of one or more differentially expressed exosomal miRNA in the subject sample and the control sample. In the aspects, the method further comprises comparing the expression level of the detected exosomal miRNA in the subject sample and the control sample. In the aspects, the miRNA may be one or more of miR-142, miR-122, miR-16, and let-7a. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects with esophageal gastric acid exposures.

[0025] In embodiments, the method of treating a subject may further comprise, prior to the administering step, diagnosing the subject with a disease or condition associated with chronic esophageal gastric acid exposure, such as gastroesophageal reflux disease, when the expression level of miRNA is increased in the sample from the subject as compared to the expression level of miRNA in the control sample. In the embodiments, the miRNA may be one or more of miR- 142-3p, miR-122-5p, and miR-16-5p. The miRNA let-7a-5p is used as the reference miRNA or endogenous control miRNA for normalizing the expression of individual miRNAs in subjects and controls.

[0026] The term “patient” or “subject” or “individual” may be used interchangeably and refers to all animals, including mammals, e.g., a human or non-human, who are prone, to have symptoms of, or suffer from an indicated disease or disorder, or who are treated in accordance with the disclosed methods.

[0027] As used herein, “sample” refers to any type of biological material from an organism that can be studied and analyzed. In some embodiments, the sample is from the circulatory system of an organism. In some embodiments, the sample is blood or plasma (blood and plasma are parts of circulatory system). As used herein, “blood” may include the components or constituents of blood. In some embodiments, the sample is blood and / or plasma.

[0028] As used herein, “control sample” refers to a known sample for which an experimental sample is to be compared. For example, a control sample may comprise a sample from a human donor not affected by a condition, such as esophageal acid exposure (e.g., GERD), or may be an artificial sample comprising an appropriate buffer and a miRNA according to the present disclosure in a known quantity, which can be determined by standard assay optimization techniques known in the art. As used herein, “exosomes” refer to a form of extracellular vesicles (EVs) that originate from intraluminal vesicles within the multivesicular bodies (MVB) that are released from cells upon fusion of a multivesicular body with the plasma membrane in a cell. Micro vesicles (MVs) originate from outward blebbing of the plasma membrane. Both exosomes and MVs carry cargo, including proteins, mRNA, miRNA and lipids.

[0029] In the disclosed embodiments, exosomes can be isolated with an exosome isolation kit or other suitable methods known in the art. In some embodiments, exosomes can be examined for size and morphology by Nanoparticle tracking analysis (NTA) and Transmission Electron Microscopy (TEM) or other suitable methods. In some embodiments, total exosomal RNA can be extracted using a Total Exosome RNA isolation kit or other suitable methods.

[0030] As used herein, “detecting an expression level of miRNA” may refer to the detection of relative quantity of miRNA, such as miR-142, miR-122, or miR-16, in a sample by means known in the art, e.g., quantitative reverse transcription polymerase chain reaction (qRT-PCR). The relative quantity may be determined based on another known “standard” or “reference”, or a "control" value. In some aspects, the standard, reference, or control value is the relative quantity of let-7a-5p miRNA. Let-7a-5p miRNA has the sequence: UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 4). The miRNA may be extracted specifically from exosomes from the raw sample to yield only exosomal miRNAs.

[0031] The relative values of expression of miRNAs is used as a basis to determine if a subject has esophageal gastric acid exposure, such as chronic esophageal acid exposure. Symptoms and conditions associated with esophageal acid exposure can include esophageal gastric acid damage, esophageal pain, acid reflux, acid reflux symptoms, and gastroesophageal reflux disease (GERD). Accordingly, as used herein, “increased” in terms of the relative expression of a miRNA detected by methods known in the art, e.g., quantitative polymerase chain reaction (qRT-PCR), means that the expression of the miRNA in a sample from a subject is higher than in the control sample, the statistical significance of which may be determined by known statistical methods.

[0032] In some embodiments, the relative value of expression of a miRNA according to the present disclosure is denoted by a cycle threshold (CT) value. If a miRNA level in a sample is elevated when compared to a control, the CT value will be lower for the sample compared to a control. In some embodiments, the CT value of miR- 142-3p in a sample according to the present disclosure is 24.39, while the control CT value is 29.7. In some embodiments, the normalized CT value for miR-I42-3p against let-7a-5p was 9.61 for a sample according to the present disclosure and 0.28 for a saline control. In some embodiments, the miRNA CT value of a sample according to the present disclosure is about 1% to about 25% lower than the miRNA CT value of a control. In some embodiments, the miRNA CT value of a sample according to the present disclosure is about 10% to about 20% lower than the miRNA CT value of a control. In some embodiments, the miRNA CT value of a sample according to the present disclosure is about 16% to about 20%, or about 16%, about 16.5%, about 17%, about 17.5%, about 18%, about 18.5%, about 19%, about 19.5%, or about 20% lower than the miRNA CT value of a control. In some embodiments, the miRNA CT value of a sample according to the present disclosure is about 17 to 18% lower than the miRNA CT value of a control

[0033] In some embodiments, if the level of miRNA is elevated compared to a control, it indicates likely injury to the esophagus of a subject, e.g., due to gastric acid, and a procedure is indicated, such as an endoscopy or other procedure , e.g., to evaluate the extent of damage or to treat or prevent the symptoms or conditions associated with esophageal gastric acid exposure. In some embodiments, the other procedure is a Nissen fundoplication (tightening of the esophagus and stomach) or surgical operation to treat or prevent the symptoms or conditions associated with esophageal acid exposure. In some embodiments, the condition is GERD. In some embodiments, a medication is administered to treat or prevent the symptoms or conditions associated with esophageal gastric acid exposure.

[0034] In some embodiments, if the level of miRNA is elevated in a subject when compared to a control, an acid-reducing medication may be administered to the subject. In some embodiments, the acid-reducing medication can include one or more of a proton pump inhibitor (PPI), a histamine 2 (H2) blocker, and a prokinetic agent. In embodiments, the acid-reducing medication may be used to treat or prevent the symptoms or conditions associated with esophageal gastric acid exposure. In embodiments, administering the acid-reducing medication to the subject may be before or after, a procedure such as endoscopy, or both before and after the procedure (e.g., endoscopy, Nissen fundoplication, surgery).

[0035] In some embodiments, if the level of miRNA is not elevated in a subject when compared to a control, an acid-reducing medication may or may not be administered to the subject. In embodiments, the acid-reducing medication can include one or more of a proton pump inhibitor (PPI), a histamine 2 (H2) blocker, and a prokinetic agent.

[0036] In some embodiments, if the miRNA level is not elevated then the need for endoscopy will be eliminated or significantly reduced because the non-elevated level will indicate lack of injury. This group of patients comprise the majority of patients seeking treatment or therapy for esophageal symptoms, including discomfort or distress. Kits, systems, and platforms

[0037] In another aspect of the current disclosure, kits, systems, and platforms are provided for the detection and analysis of the expression level of differentially expressed miRNA in a sample from a subject with esophageal gastric acid exposure.

[0038] As used herein, “reagents for detecting one or more miRNAs in a sample” refers to any reagents that may be used to detect miRNAs, wherein the reagents are known in the art and may comprise, e.g., primers specific for the target miRNAs, e.g., miR-142-3p, miR-122-5p, miR-16-5p, or let-7a-5p miRNA, relevant enzymes, e.g., reverse transcriptase, DNA polymerase, reagents for labeling the polynucleotides, e.g., SYBR® green dye, and appropriate buffers.

[0039] The primers may comprise “locked nucleic acids (LNAs)” also known as bridged nucleic acid (BNA), and often referred to as inaccessible RNA, are modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes. This structure provides for increased stability against enzymatic degradation. LNAs also offer improved specificity and affinity in base-pairing as a monomer or a constituent of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in a oligonucleotide.

[0040] The sequences for the miRNA for the kits, systems, and / or platforms include: miR-142-3p: UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO: 1); miR-122-5p: UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 2); miR-16-5p UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 3); and let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO:4).

[0041] In some embodiments, a kit, system, and / or platform according to the present disclosure comprises reagents for detecting one or more miRNAs in a sample from a subject. In some embodiments, the one or more miRNAs comprise a miRNA selected from the group consisting of miR-142-3p, miR-122-5p, and miR-16-5p, and let-7a-5p. In some embodiments, the one or more miRNA comprises miR-142-3p. In some embodiments, the reagents comprise primers for qRT-PCR. In some embodiments, the primers for qRT-PCR comprise locked nucleic acids (LNAs). In some embodiments, the kit, system, and / or platform further comprises reagents for isolating exosomes from the sample. In some embodiments, a method for detecting an expression level of differentially expressed miRNA in a sample using a kit, system, and / or platform according to the present disclosure is provided. In some embodiments, the miRNA is one or more of miR-142-3p, miR- 122-5p, miR-16-5p, and let-7a-5p. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects with esophageal gastric acid exposures or in controls. In some embodiments, the method comprises qRT-PCR.

[0042] In some embodiments, use of a kit, system, or platform according to the present disclosure for detection of an expression level of differentially expressed miRNA in a sample is provided. In some embodiments, the miRNA is one or more of miR-142-3p, miR-122-5p, miR-16-5p, and let- 7a-5p. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects with esophageal gastric acid exposures. In some embodiments, the kit, system, or platform comprises primers for qRT-PCR.

[0043] In some embodiments, use of a kit, system, or platform according to the present disclosure for the diagnosis and / or treating of one or more conditions associated with chronic esophageal acid exposure in a patient is provided. In some embodiments, the kit, system, or platform facilitates the detection of an expression level of differentially expressed miRNA in a sample from the subject and a sample from a control. In some embodiments, the miRNA is one or more of miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p. The expression of miRNA let-7a is used as an endogenous control for normalizing an expression profile of individual miRNAs in subjects with esophageal gastric acid exposures. In some embodiments, a comparison of the expression level of the detected miRNA in the sample and control is used to diagnose and / or treat the subject with one or more conditions associated with chronic esophageal acid exposure. In some embodiments, the condition is one or more of esophageal gastric acid damage, esophageal pain, acid reflux, acid reflux symptoms, and GERD.

[0044] The present invention is described herein using several definitions, as set forth below and throughout the application.

[0045] Definitions

[0046] The disclosed subject matter may be further described using definitions and terminology as follows. The definitions and terminology used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0047] As used in this specification and the claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise. For example, the term “a substituent” should be interpreted to mean “one or more substituents,” unless the context clearly dictates otherwise. As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean up to plus or minus 10% of the particular term and “substantially” and “significantly” will mean more than plus or minus 10% of the particular term.

[0048] As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of’ should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term “consisting essentially of’ should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.

[0049] The phrase “such as” should be interpreted as “for example, including.” Moreover, the use of any and all exemplary language, including but not limited to “such as”, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed.

[0050] Furthermore, in those instances where a convention analogous to “at least one of A, B and C, etc.” is used, in general such a construction is intended in the sense of one having ordinary skill in the art would understand the convention (e.g., “a system having at least one of A, B and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description or figures, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or ‘B or “A and B.”

[0051] All language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which can subsequently be broken down into ranges and subranges. A range includes each individual member. Thus, for example, a group having 1 -3 members refers to groups having 1, 2, or 3 members. Similarly, a group having 6 members refers to groups having 1, 2, 3, 4, or 6 members, and so forth. The modal verb “may” refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb “may” refers to an affirmative act regarding how to make or use and aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb “may” has the same meaning and connotation as the auxiliary verb “can.”

[0052] EMBODIMENTS

[0053] Embodiment 1. A method of detecting a differential expression level of one or more of micro RNA (miRNA) in a subject having esophageal gastric acid exposure, the method comprising: a) obtaining a sample from the subject and a sample from a control, b) detecting an expression level of the miRNA in the subject sample and in the control sample, wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p, and c) comparing the level of miRNA expression between the subject sample and the control sample.

[0054] Embodiment 2. The method of embodiment 1, wherein the subject exhibits symptoms of esophageal gastric acid damage, esophageal pain, acid reflux, or acid reflux symptoms.

[0055] Embodiment 3. The method of embodiment 1 embodiment 2, further comprising diagnosing damage to the esophagus when a higher level of the miRNA expression is detected than the control level.

[0056] Embodiment 4. The method of any one of the preceding embodiments, further comprising treating the subject with an acid reducing medication, or performing endoscopy or other procedure on the subject.

[0057] Embodiment 5. The method of any one of the preceding embodiments, wherein the miRNA is miR-142-3p.

[0058] Embodiment 6. The method of any one of the preceding embodiments, wherein the sample is a blood or plasma sample.

[0059] Embodiment 7. The method of any one of the preceding embodiments, wherein exosomes are isolated from the sample.

[0060] Embodiment 8. The method of any one of the preceding embodiments, wherein the method further comprises: d) administering one or more acid-reducing medication to the subject when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample; or e) performing a procedure on the subject when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample; or f) administering one or more acid-reducing medication to the subject when the expression level of miR-142-3p is not increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample.

[0061] Embodiment 9. The method of embodiment 8e), optionally comprising administering an acid-reducing medication to the subject before or after, or both before and after the procedure. Embodiment 10. The method of embodiment 8d) or 8f), wherein the acid-reducing medication comprises a medication selected from the group consisting of a proton pump inhibitor (PPI), a histamine 2 (H2) blocker, and a prokinetic agent.

[0062] Embodiment 11. The method of embodiment 8e), wherein the procedure is an endoscopy, a Nissen fundoplication, or a surgical operation.

[0063] Embodiment 12. The method of any one of the preceding embodiments, wherein detecting comprises measuring the expression of the one or more miRNA by quantitative reverse transcription polymerase chain reaction (qRT-PCR), optionally wherein the miRNA is selected from the group consisting of miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p.

[0064] Embodiment 13. A method of diagnosing gastroesophageal reflux disease in a subject, the method comprising: a) obtaining a sample from a subject and a control sample, b) detecting a differential expression level of miR-142-3p in the sample from a subject and in the control sample, and c) diagnosing the subject with gastroesophageal reflux disease when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample, optionally further comprising d) treating the subject by administering an acid-reducing medication to the subject or performing a procedure on the subject.

[0065] Embodiment 14. A kit, system, or platform comprising reagents for detecting one or more miRNAs in a sample from a subject, wherein the reagents comprise primers for quantitative polymerase chain reaction (qRT-PCR) and / or reagents for isolating exosomes from the sample. Embodiment 15. The kit, system, or platform of embodiment 14, wherein the one or more miRNAs comprise a miRNA selected from the group consisting of miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p.

[0066] Embodiment 16. The kit, system, or platform of embodiment 14 or 15, wherein the miRNA is miR-142-3p.

[0067] Embodiment 17. The kit, system, or platform of any one of embodiments 14-16, wherein the primers for qRT-PCR comprise locked nucleic acids (LNAs). Embodiment 18. A method of treating in a subject having chronic esophageal gastric acid exposure, the method comprising: a) obtaining a sample from a subject and a control, b) detecting a differential expression level of one or more miRNA in the subject sample and in the control sample, optionally wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p, c) diagnosing the subject with chronic esophageal gastric acid exposure when the expression level of the miRNA is increased in the sample from the subject as compared to the expression level of miRNA in the control sample, and d) administering an acid-reducing medication to the subject or performing a procedure on the subject to treat the chronic esophageal gastric acid exposure in the subject.

[0068] Embodiment 19. The method of embodiment 18, wherein the sample is a blood or plasma sample.

[0069] Embodiment 20. The method of embodiment 18 or 19, wherein the subject has gastroesophageal reflux disease.

[0070] Embodiment 21. The method of any one of embodiments 18-20, wherein the miRNA is miR-142-3p.

[0071] Embodiment 22. The method of any one of embodiments 18-21, wherein the procedure is an endoscopy, a Nissen fundoplication, or a surgical operation.

[0072] EXAMPLES

[0073] The following Example is illustrative and should not be interpreted to limit the scope of the claimed subject matter.

[0074] Example 1 - Gastroesophageal reflux disease results in differential expression of circulating exosomal miRNAs.

[0075] Circulatory plasma exosomal miRNAs can be explored as possible biomarkers for esophageal acid-induced pathological conditions.

[0076] Here, experiments were performed to: i) isolate exosomal miRNAs from rat plasma, and ii) further study the effect of chronic esophageal acid exposures on exosomal miRNAs expression in acid-treated and control rats.

[0077] Two groups (n=5 / group) of adult male Sprague Dawley rats were used for this study. Rats in acid and saline groups were subjected to intra-esophageal acid (0. IN HC1, pH 1.2, 2ml) and saline infusion, respectively, daily, for 7 consecutive days. Plasma-EDTA samples were collected after 2 hours following the last exposure. Exosomes were isolated using FUJIFILM exosome isolation kit and examined for size and morphology by Nanoparticle tracking analysis (NTA) and Transmission Electron Microscopy (TEM). Total exosomal RNA was extracted using Total Exosome RNA isolation kit. The expression profile of 4 abundantly expressed plasma miRNAs, miR (-16-5p, -142-3p, -122-5p and let-7a-5p) were evaluated and compared between the groups using miRCURY LNA miRNA PCR kit. Let-7a-5p was used as the endogenous control for normalizing miRNA expression.

[0078] In NTA, exosome preparations showed major population in 30-150nm range. TEM studies also confirmed the morphology and dimensions of the isolated exosomes. Out of three miRNAs, miR-142-3p expression increased significantly in acid-treated group as indicated by lower CT values compared to saline controls (24.39±0.39 vs 29.7±0.43, n=5, p<0.05). The normalized 2AC1values for miR-142-3p against let-7a-5p were acid vs saline: 9.61±1.7 vs 0.28±0.05, n=5, p<0.05 (Fig. 1).

[0079] Results show that chronic esophageal acid exposures in rats result in significant upregulation of plasma exosomal miR- 142 suggesting involvement of miRNAs in esophageal acid-induced pathological conditions. Circulatory plasma exosomal miRNAs can be explored further as possible biomarkers for patients with gastroesophageal reflux diseases.

[0080] In the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that although the present invention has been illustrated by specific embodiments and optional features, modification and / or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0081] Citations to a number of patent and non-patent references may be made herein. The cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.

Claims

CLAIMSWe claim:

1. A method of detecting a differential expression level of one or more of micro RNA (miRNAs) in a subject having esophageal gastric acid exposure, the method comprising: a) obtaining a sample from the subject and a sample from a control; b) detecting an expression level of the miRNA in the subject sample and in the control sample, wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16-5p, and let-7a-5p; and c) comparing the level of miRNA expression between the subject sample and the control sample.

2. The method of claim 1, wherein the subject exhibits symptoms of esophageal gastric acid damage, esophageal pain, acid reflux, or acid reflux symptoms.

3. The method of claim 1, further comprising diagnosing damage to the esophagus when a higher level of the miRNA expression is detected than the control level.

4. The method of claim 3, further comprising treating the subject with an acid reducing medication, or performing endoscopy or other procedure on the subject.

5. The method of claim 1, wherein the miRNA is miR-142-3p.

6. The method of claim 1, wherein the sample is a blood or plasma sample.

7. The method of any one of the preceding claims, wherein exosomes are isolated from the sample.

8. The method of claim 1, wherein the method further comprises d) administering one or more acid-reducing medication to the subject when the expression level ofmiR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample; or e) performing a procedure on the subject when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR- 142-3p in the control sample; orf) administering one or more acid-reducing medication to the subject when the expression level of miR-142-3p is not increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample.

9. The method of claim 8e), comprising optionally administering an acid-reducing medication to the subject before or after, or both before and after the endoscopy.

10. The method of claim 8d) or 8f), wherein the acid-reducing medication comprises a medication selected from the group consisting of a proton pump inhibitor (PPI), a histamine 2 (H2) blocker, and a prokinetic agent.

11. The method of claim 8e), wherein the procedure is an endoscopy, a Nissen fundoplication, or a surgical operation.

12. The method of claim 1, wherein detecting comprises measuring the expression of the one or more miRNA by quantitative reverse transcription polymerase chain reaction (qRT- PCR).

13. A method of diagnosing gastroesophageal reflux disease in a subject, the method comprising: a) obtaining a sample from a subject and a control sample; b) detecting a differential expression level of miR-142-3p in the sample from a subject and in the control sample; and c) diagnosing the subject with gastroesophageal reflux disease when the expression level of miR-142-3p is increased in the sample from the subject as compared to the expression level of miR-142-3p in the control sample.

14. A kit, system, or platform comprising reagents for detecting one or more miRNAs in a sample from a subject, wherein the reagents comprise primers for quantitative polymerase chain reaction (qRT-PCR) and / or reagents for isolating exosomes from the sample.

15. The kit, system, or platform of claim 14, wherein the one or more miRNAs comprise a miRNA selected from the group consisting of miR-142-3p, miR-122-5p, miR-16-5p, and let- 7a-5p.

16. The kit, system, or platform of claim 15, wherein the miRNA is miR-142-3p.

17. The kit, system, or platform of claim 16, wherein the primers for qRT-PCR comprise locked nucleic acids (LNAs).

18. A method of treating in a subject having chronic esophageal gastric acid exposure, the method comprising: a) obtaining a sample from a subject and a control; b) detecting a differential expression level of miRNA in the subject sample and in the control sample, wherein the one or more miRNA is miR-142-3p, miR-122-5p, miR-16- 5p, and let-7a-5p; c) diagnosing the subject with chronic esophageal gastric acid exposure when the expression level of the miRNA is increased in the sample from the subject as compared to the expression level of miRNA in the control sample; and d) administering an acid-reducing medication to the subject or performing a procedure on the subject to treat the chronic esophageal gastric acid exposure in the subject.

19. The method of claim 18, w herein the sample is a blood or plasma sample.

20. The method of claim 18, wherein the subject has gastroesophageal reflux disease.

21. The method of claim 18, wherein the miRNA is miR- 142-3p.

22. The method of claim 18, wherein the procedure is an endoscopy, a Nissen fundoplication, or a surgical operation.

Images