Rice mutant gene and use thereof

By using gene editing and genetic complementation vector technology for the rice plant height-related mutant gene xjha, the problem of single dwarf genes in rice breeding has been solved, and the diversity regulation of rice plant height and yield improvement have been achieved.

WO2025232134A1PCT designated stage Publication Date: 2025-11-13XIAMEN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/132158
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-25
Filing Date
2024-11-15
Publication Date
2025-11-13

AI Technical Summary

Technical Problem

The application of dwarf genes in current rice breeding methods suffers from a lack of genetic resources, resulting in a lack of diversity in rice plant height regulation and affecting breeding outcomes.

Method used

A mutant gene xjha related to rice plant height and its encoded protein are provided. A mutation from Asp to Asn is introduced through gene editing or natural mutation. A genetic complementation vector is constructed by combining a plant expression vector and the recombinant bacterium Agrobacterium EHA105 to regulate rice plant height.

Benefits of technology

Effective regulation of rice plant height can improve the lodging resistance and yield potential of rice varieties, enhance breeding diversity, and provide new plant height regulating genes for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024132158_13112025_PF_FP_ABST
    Figure CN2024132158_13112025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a rice mutant gene and the use thereof in regulating the plant height of rice. The rice mutant gene at least has an allele mutation, and the allele mutation is the mutation into Asn from Asp at the 377th site in an amino acid sequence shown as SEQ ID No. 26. The mutant gene can effectively regulate and control the rice plant height, and has good application potential in plant architecture breeding of rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

A rice mutant gene and its uses Technical Field

[0001] This invention relates to a rice mutant gene and its uses. Background Technology

[0002] Rice is one of the world's most important food crops, and plant height is a key agronomic trait affecting rice yield, lodging resistance, and fertilizer tolerance (Liu et al. 2018). The genetic regulation mechanism of rice plant height and its application in breeding have always been one of the hot and important issues in rice genetics and breeding research.

[0003] The application of rice plant height in breeding mainly lies in the discovery and utilization of dwarfing genes. Dwarfing genes can reduce rice plant height, improve lodging resistance, increase stem strength, and reduce nutrient consumption by the stem, thereby increasing yield. Currently, there are many rice mutants and genes associated with dwarfing traits, distributed across all rice chromosomes. However, most of these identified semi-dwarf and dwarfing genes have negative effects on rice agronomic traits, thus limiting their application in breeding. Therefore, there are currently few dwarfing genes used in breeding, with the Green Revolution gene sd1 being the most widely used.

[0004] sd1 can reduce rice plant height, improve lodging resistance, increase stem strength, and reduce nutrient consumption by the stem, thereby increasing yield. There are multiple alleles of sd1 in rice, among which the loss-of-function alleles sd1-d, sd1-AJNT, and sd1-9311 are widely used in indica rice, such as in varieties like IR8, IR36, IR64, and 9311. In japonica rice, sd1-r and sd1-j are mainly retained, such as in the "Dongnong" and "Xiushui" series. Furthermore, by introducing sd1-d into the rice brand Daohuaxiang 2 (DHX2), dwarf and semi-dwarf lines carrying sd1-d were obtained (1279 and 1280) (Sha et al. 2022). However, excessive use of sd1 can lead to a single dwarf gene in breeding varieties and a reduction in genetic diversity. Therefore, there is an urgent need for new semi-dwarf rice genes that can be used for breeding.

[0005] In summary, while SD1 is widely used, it suffers from the vulnerability of having a single genetic resource. Therefore, the discovery and identification of new genes controlling plant height and the elucidation of their biological functions are of great application value for the targeted improvement of rice plant height and for ensuring the diversity of semi-dwarf genetic resources in rice. Summary of the Invention

[0006] The main technical problem to be solved by the present invention is to provide a rice mutant gene and its use in regulating rice plant height.

[0007] Another technical problem to be solved by the present invention is to provide a rice plant height-related mutant gene xjha and its use in regulating rice plant height.

[0008] Another technical problem to be solved by the present invention is to provide a plant expression vector.

[0009] Another technical problem to be solved by the present invention is to provide a recombinant bacterium.

[0010] [Correction 21.02.2025 according to Article 91] In order to solve the above-mentioned technical problems, the present invention provides a rice mutant gene, which has at least one allelic mutation, wherein the allelic mutation is that the Asp at position 377 in the amino acid sequence shown in SEQ ID NO.26 is mutated to Asn.

[0011] In a preferred embodiment: the nucleotide sequence of its genome is shown in SEQ ID NO.01.

[0012] In a preferred embodiment, the nucleotide sequence of its cDNA is shown in SEQ ID NO. 02.

[0013] In a preferred embodiment, the allelic mutation is formed by at least one of natural mutation, artificial mutagenesis, and gene editing.

[0014] The present invention also provides the use of the above-mentioned rice mutant gene in regulating rice plant height.

[0015] The present invention also provides a rice plant height-related mutant gene xjha, the amino acid sequence of the protein encoded by which is shown in SEQ ID NO.03.

[0016] In a preferred embodiment: the nucleotide sequence of its genome is shown in SEQ ID NO.01.

[0017] In a preferred embodiment, the nucleotide sequence of its cDNA is shown in SEQ ID NO. 02.

[0018] In a preferred embodiment, it is formed by at least one of natural mutation, artificial mutagenesis, and gene editing.

[0019] The present invention also provides the use of the above-mentioned rice plant height-related mutant gene xjha in regulating rice plant height.

[0020] The present invention also provides a plant expression vector containing the nucleotide sequence of the above-mentioned rice mutant gene or the nucleotide sequence of the above-mentioned rice plant height-related mutant gene xjha.

[0021] In a preferred embodiment, the nucleotide sequence of the rice mutant gene or the rice plant height-related mutant gene xjha is loaded onto pRHE.

[0022] The present invention also provides a recombinant bacterium containing the above-mentioned plant expression vector.

[0023] In a preferred embodiment, the bacteria is Agrobacterium EHA105.

[0024] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0025] This invention can effectively regulate rice plant height and has good application potential in rice variety plant type breeding. Attached Figure Description

[0026] Figure 1 shows the mature plants of wild type (WT) and mutant xjha in Example 1 of the present invention (A), with a scale bar of 10 cm; (BG) comparison of agronomic traits between WT and xjha, in cm, plant height (B), panicle length (C), panicle stem length (D), internode length (E), leaf length (F), leaf width (G), * indicates significant difference, ** indicates extremely significant difference, ns indicates no significant difference (*P<0.05, **P<0.01, nsP>0.05).

[0027] Figure 2 is a statistical chart of the yield correlation traits of WT and xjha in Example 1 (AE) of the present invention, wherein grain type (A), grain length (B), grain width (C), number of effective panicles (D), thousand-grain weight (E), number of filled grains per panicle (F), seed setting rate (G), and yield per plant (H).

[0028] Figure 3 shows the chromosome localization map of xjha in Example 2 of this invention, where: (A) xjha is located between RM495 and RM13226 on the long arm of chromosome 2; (B) using large-scale linkage analysis of 1143 F2 single plants, xjha is located in the genomic region between markers RM12965 and RM12979, with a physical distance of 131 kb, and 5 functionally annotated genes. Sequencing of the OsCPS1 gene of WT and xjha revealed that, compared with WT, the OsCPS1 of xjha has a mutation at position 48 of exon 7 from G to A, resulting in the 377th amino acid changing from aspartic acid Asp(D) to asparagine Asn(N), leading to the (OsCPS1) mutation. D377N Blue squares represent exons, gray lines represent introns, red squares represent exon 7, and orange squares represent the 5'UTR and 3'UTR.

[0029] Figure 4 shows the haploid types with a sample number greater than 10 in Example 2 of the present invention, indicating that xjha in Example 2 is a new allele mutation.

[0030] Figure 5 shows the construction of the complementation vector pRHE-OsCPS1p::OsCPS1 in Example 4 of this invention (A), and the comparison of correlation traits between WT, xjha, and plant height of complementation plants (BE). Plant type, Bar = 7cm (B), OsCPS1 mRNA level (C), plant height (D), and internode length (E).

[0031] Specific connection method

[0032] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0033] Example 1: Comparison of mutant and wild-type strains

[0034] In this embodiment, xjha is a dwarf mutant, a single-base naturally occurring mutation of the OsCPS1 gene found in the field population of the rice variety Jiahe Xinzhan. Compared with the wild-type Jiahe Xinzhan, this mutant plant exhibits reduced plant height and increased tillering, while the seed setting rate and yield are not significantly different from the wild type (Figure 1). xjha may have good application potential in breeding to improve the lodging resistance of rice varieties. The rice plant height-related mutant gene xjha was obtained from this mutant. Its full-length genome is 10202 bp, and its cDNA coding region is 2604 bp long, as shown in SEQ ID NO.01 and SEQ ID NO.02, respectively. It encodes 867 amino acids, as shown in SEQ ID NO.03, and this mutation is an allelic dwarfing mutation. The amino acid sequence of the protein encoded by the rice plant height-related gene XJHA in the wild-type rice variety relative to this mutant is shown in SEQ ID NO.26.

[0035] Example 2: Map-based cloning of the xjha gene

[0036] To locate the gene regulating plant height in the dwarf mutant of Example 1, a genetic mapping population was constructed. In this example, the dwarf mutant xjha was crossed with the japonica rice variety Samba, and a genetic mapping population was constructed for gene mapping. After selecting 20 individual plants with highly significant mutant phenotypes from the F2 population of the xjha-Samba cross for pool screening and individual plant verification, the gene was located within the interval of 9562527-10806334 on chromosome 2. New molecular markers were developed within this interval, and the interval was continuously narrowed down between two markers, ultimately locating the dwarf gene within a 140kb interval of the marker physical location chr2:10186708-1032662 (Figure 3).

[0037] Further sequencing analysis revealed that the base at position 48 of exon 7 of the xjha gene LOC_Os02g17780 was mutated from G to A, causing the 377th amino acid Asp to become Asn, thus affecting the function of the XJHA protein. Therefore, LOC_Os02g17780 (OsCPS1) can be identified as the target gene for plant height regulation, and this gene is named XJHA (wild type, whose nucleotide sequence is shown in SEQ ID NO.25). It encodes a single expressed protein with pleiotropic effects and is associated with multiple traits of rice plant type (Figure 3).

[0038] Furthermore, to characterize the genetic diversity of OsCPS1, this embodiment analyzed the haplotypes of this gene using the public database from the 3K Rice Genome Project (https: / / www.rmbreeding.cn). Fourteen single nucleotide polymorphisms (SNPs) were identified in the OsCPS1 coding region, and rice varieties were divided into 241 haplotypes. Figure 4 shows the haplotypes with more than 10 samples. No SNP sites were found on Exon7 of OsCPS1, indicating that xjha is a novel allele of OsCPS1.

[0039] The sequencing primers used in this embodiment are as follows:

[0040] CPS1-CDS1 / 2-F:gcatcgcatctccatcatctcc(SEQ ID NO.04)

[0041] CPS1-CDS1 / 2-R:cctactgttcttcgatcgggttc(SEQ ID NO.05)

[0042] CPS1-CDS3 / 4-F: aactataccaaaaacatgcggcac (SEQ ID NO.06)

[0043] CPS1-CDS3 / 4-R:tgtaacaaacctatctcaaactgtctatc(SEQ ID NO.07)

[0044] CPS1-CDS5 / 6-F:gctaagttgctataatttaagacggagg(SEQ ID NO.08)

[0045] CPS1-CDS5 / 6-R:caacatcacatgatctgagatcagc(SEQ ID NO.09)

[0046] cx-CPS1-F:catatctcgagttggcgaaacag(SEQ ID NO.10)

[0047] CPS1-CDS7 / 8 / 9-F:gattcgtggcatttcactgacc(SEQ ID NO.11)

[0048] CPS1-CDS7 / 8 / 9-R:cagtgcaatgttatatcagtactcagg(SEQ ID NO.12)

[0049] CPS1-CDS10 / 11 / 12-F:cctaccaggagaggtataatctagttac(SEQ ID NO.13)

[0050] CPS1-CDS10 / 11 / 12-R:CPS1-CDS10 / 11 / 12-R:CPS1-CDS10(SEQ ID NO.14)

[0051] CPS1-CDS13 / 14-F:gagaagaatgcttgccttggagtac(SEQ ID NO.15)

[0052] CPS1-CDS13 / 14-R:CPS1-CDS13 / 14(SEQ ID NO.16)

[0053] CPS1-CDS15-F:gataattctaactctcaaggcatctcc(SEQ ID NO.17)

[0054] CPS1-CDS15-R:cacatgtagaccatacagagatacatc(SEQ ID NO.18)

[0055] Example 3: Construction of xjha genetically complementary transgenic plants and identification of transgenic materials

[0056] In this embodiment, a 7821bp gene fragment (including 2166bp before the start codon, the full length of XJHA, and 215bp after the stop codon) from the wild-type XJHA gene xjha shown in SEQ ID NO.01 was amplified by PCR and ligated into the plant expression vector pRHE to construct the genetic complementation vector pRHE-gXJHA (Figure 4). The genetic complementation vector pRHE-gXJHA was then transformed into the semi-dwarf mutant xjha by Agrobacterium EHA105. Specifically, Agrobacterium EHA105 containing the genetic complementation vector pRHE-gXJHA was used to infect xjha mutant callus. The xjha mutant callus was co-cultured at 28℃, sterilized, screened with antibiotics, and differentiated (for about 4 months) to obtain pRHE-gXJHA transgenic plants with the full length of the rice XJHA gene.

[0057] T0 generation transgenic plants were identified by amplification using the following primers, resulting in T0 generation plants successfully transferred into the genetic complementation vector carrying the target gene.

[0058] gXJHA-F: gggagcaaacaccgcaaagg (SEQ ID NO. 19)

[0059] gXJHA-R: agaacaaatccaaaataaataatttataaaaaatg (SEQ ID NO. 20)

[0060] NosR-seq: agaccggcaacaggattcaatc (SEQ ID NO.21)

[0061] CPS1-CDS15-F:gataattctaactctcaaggcatctcc(SEQ ID NO.22)

[0062] The average plant height of the genetically complementary transgenic plants (82.4 cm) increased by 32.9% compared to the mutant xjha (62.0 cm), and there was no significant difference compared to the wild-type WT (91.0 cm) (Figure 5). qPCR detection of OsCPS1 mRNA expression levels in the complemented materials revealed that the sixth complemented material (cp6) not only had its plant height compensated for but also showed no significant change in mRNA levels (Figure 5). Measurement of internode length in cp6 showed that the lengths of all internodes, especially the penultimate and penultimate internodes, were significantly longer than those in xjha, and were basically consistent with the internode lengths in WT (Figure 5). The fact that OsCPS1WT can compensate for the plant height defect in xjha indicates that OsCPS1 is the controlling gene for the plant height phenotype of the mutant xjha. As shown in Figure 5, XJHA can regulate plant height, indicating that the rice plant height-related gene XJHA in this invention has good application potential in rice variety plant type breeding.

[0063] The primers used for the above qPCR are as follows:

[0064] QCPS1-F:gaacgtttacccggtcgatc(SEQ ID NO.23)

[0065] Qcps1-R:cttcagtccagtgcctgttg(SEQ ID NO.24)

[0066] As will be known to those skilled in the art, grasses also possess homologous genes to the rice OsCPS1 gene in Example 1. When these homologous genes undergo mutations identical or similar to the xjha mutation in the OsCPS1 gene, they can also achieve the same or similar technical effects as in the above examples, namely, partial dwarfing of the plant. These homologous genes include, but are not limited to, the wheat TaCPS3 gene (gene ID: TraesCS7D02G539200) and maize An1 (gene ID: Zm00001d032961 / Zm00001d032961).

[0067] The above description is merely a preferred embodiment of the present invention, but the design concept of the present invention is not limited thereto. Any non-substantial modifications made to the present invention by those skilled in the art within the scope of the technology disclosed in the present invention using this concept shall be deemed as an infringement of the protection scope of the present invention. Industrial applicability

[0068] [Correction 21.02.2025 based on Rule 91] This invention discloses a rice mutant gene and its use in regulating rice plant height. The gene has at least one allelic mutation, where the Asp at position 377 of the amino acid sequence shown in SEQ ID NO. 26 is mutated to Asn. This invention can effectively regulate rice plant height and has good application potential in rice variety breeding.

Claims

1. [Corrected according to Rule 91, 21.02.2025] A rice mutant gene, characterized in that: It has at least one allelic mutation, which is a mutation of Asp to Asn at position 377 of the amino acid sequence shown in SEQ ID NO.

26.

2. The plant height-related mutant gene as described in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

01.

3. A rice mutant gene as described in claim 2, characterized in that: Its cDNA nucleotide sequence is shown in SEQ ID NO.

02.

4. A rice mutant gene as described in any one of claims 1 to 3, characterized in that: The allele mutations can be formed by at least one of natural mutation, artificial mutagenesis, and gene editing.

5. Use of the rice mutant gene according to any one of claims 1 to 4 in regulating rice plant height.

6. A rice plant height-related mutant gene xjha, characterized in that: The amino acid sequence of the protein it encodes is shown in SEQ ID NO.

03.

7. The rice plant height-related mutant gene xjha as described in claim 6, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

01.

8. The rice plant height-related mutant gene xjha as described in claim 7, characterized in that: Its cDNA nucleotide sequence is shown in SEQ ID NO.

02.

9. The rice plant height-related mutant gene xjha as described in any one of claims 6 to 8, characterized in that: It can be formed through at least one of the following methods: natural mutation, artificial mutagenesis, and gene editing.

10. The use of the rice plant height-related mutant gene xjha according to any one of claims 6 to 9 in regulating rice plant height.

11. A plant expression vector, characterized in that: The nucleotide sequence containing the rice mutant gene of any one of claims 1 to 4 or the nucleotide sequence of the rice plant height-related mutant gene xjha of any one of claims 6 to 9.

12. A plant expression vector as described in claim 11, characterized in that: It uses pRHE to load the nucleotide sequence of the rice mutant gene or the rice plant height-related mutant gene xjha.

13. A recombinant bacterium, characterized in that: Contains the plant expression vector as described in claim 11 or 12.

14. The recombinant bacteria as described in claim 13, characterized in that: It is Agrobacterium EHA105.

Citation Information

Patent Citations

  • Gene mutation site detection primer and detection method for controlling plant gibberellin synthesis and plant type and application

    CN114182044A

  • Rice plant height related mutant gene xjha and application thereof

    CN118240840A

  • Application of dwarf mutation of rice plant height related gene XJHA in adjusting rice plant height

    CN118910152A