Composition for improving obesity or cognitive function comprising hemp seed fermentate

Abstract

The present invention relates to a food composition for improving obesity or cognitive function, comprising a hemp seed fermentate prepared using the Pediococcus acidilactici SRCM201591 strain. The fermentate was confirmed for radical scavenging ability, ROS scavenging ability, and AChE inhibitory ability, and found to have an antioxidant effect as a high content of polyphenol was measured. An anti-obesity effect was also confirmed through assays for triglyceride inhibition and C. elegans size reduction, and antioxidant and anti-obesity related gene regulation effects were identified following administration of the fermented extract. Accordingly, the fermentate can be advantageously used in the manufacture of food for improving obesity or cognitive function.

Description

Composition for improving obesity or cognitive function comprising fermented hemp seeds

[0001] The present invention relates to a composition for improving obesity or cognitive function, comprising a fermented cannabis seed product using the Pediococcus acidilacticiSRCM 201591 strain.

[0002] Obesity is defined as the excessive accumulation of body fat due to energy intake exceeding energy expenditure. While the causes of obesity vary, including unbalanced diets and lack of exercise, the decreased digestion of lipids or fats due to the inhibition of pancreatic lipase activity has recently been suggested as one of the contributing factors. Obesity was recognized as a disease in its own right by the World Health Organization in 1997. Furthermore, obesity is considered part of metabolic syndrome and a precursor to various adult diseases, such as diabetes, hyperlipidemia, and hypertension. The obesity rate in Korea was recorded at around 26% in 1998, but exceeded 30% in 2005. After reaching 31.7%, it remained at a similar level until 2014, rising slightly to 33.2% in 2015. It remained at a similar level of 33-34% until 2019, reaching 38.3% in 2020, a 4.5 percentage point increase from the previous year.

[0003] Due to the increasing incidence of metabolic disorders such as obesity and oxidative stress, and related diseases, the demand for healthy and nutritious foods that can prevent or improve these conditions is increasing.

[0004] As our society ages, the number of people with neurological disorders, a common geriatric condition, is also on the rise. Degeneration of acetylcholine (ACh), the brain's primary neurotransmitter, by acetylcholine esterase (AChE) is associated with most neurological disorders, and drugs that inhibit AChE are often prescribed as treatments for neurodegeneration. However, due to the side effects of synthetic drugs, there has been a growing demand for natural products with AChE inhibitory properties.

[0005] Industrial hemp (Cannabis Sativa L.) has been cultivated for thousands of years. In ancient times, it was cultivated as a multipurpose crop, providing fiber, food, and medicine. However, the discovery of delta-9-tetrahydrocannabinol (THC), the psychoactive component associated with most cannabis plants, led to a ban on the cultivation of all cannabis crops, including hemp, in 1937 (S.O. Aloo, Mwiti, Ngugi, & Oh, 2022; Shen, Gao, Fang, Rao, & Chen, 2021). Nevertheless, in 1970, non-psychoactive cannabis varieties were reintroduced as industrial crops, distinguishing them from other psychoactive varieties. Since 1970, there has been a growing global demand for legal breeding of industrial hemp varieties with low THC contents (typically less than 0.3%) (Shen et al., 2021). Industrial hemp seeds are attracting attention in the food industry due to their rich bioactive compounds (including polyphenols and phytocannabinoids), high-quality protein, edible oil, and other beneficial nutrients. Recently, researchers have demonstrated that fermented whole hemp seeds and their sprouts contain a wide range of bioactive metabolites responsible for biological activity (SO Aloo, Park, & Oh, 2023). However, while the aforementioned benefits of hemp are known, the disease prevention and improvement effects of hemp fermentation products remain unknown.

[0006] Accordingly, the inventors of the present invention have completed the present invention by confirming that a fermented cannabis seed product using Pediococcus acidilactici strain has remarkable anti-obesity and cognitive improvement properties and can be used in a composition for improving obesity or cognitive function.

[0007] Accordingly, the inventor of the present invention confirmed the antioxidant, anti-obesity, and neuroprotective effects of a fermented cannabis seed product using Pediococcus acidilactici strain, thereby completing the present invention.

[0008] Accordingly, the present invention aims to provide a food composition comprising a fermented cannabis seed product using Pediococcus acidilactici strain.

[0009] To achieve the above purpose, the present invention provides a food composition comprising a fermented cannabis seed product using a Pediococcus acidilactici strain.

[0010] In addition, the present invention provides a method for producing the food composition.

[0011] Fermented whole hemp seed (FWHS) using the Pediococcus acidilactici strain of the present invention has a high content of phenolic compounds and flavonoids, and can also inhibit lipase and acetylcholine esterase (AChE).

[0012] Accordingly, the fermented hemp seed of the present invention can be widely used in food compositions for improving obesity or cognitive function.

[0013] Figure 1 is a diagram confirming the cytotoxicity of hemp seed extract.

[0014] Figure 2 is a diagram confirming the obesity and cognitive improvement ability of fermented cannabis seeds. (A) is a diagram confirming pancreatic lipase inhibition activity, and (B) is a diagram confirming acetylcholinesterase (AChE) inhibition activity.

[0015] Figure 3 shows the antioxidant activity of fermented hemp seeds. It was confirmed that the fermented hemp seeds exhibited remarkable free radical (DPPH and ABTS) inhibition activity.

[0016] 1) Positive control: Ascorbic acid (AA); WHS: whole hemp seeds; FWHS: fermented whole hemp seeds; DHS: hulled hemp seeds; FDHS: hulled fermented hemp seeds

[0017] Figure 4 is a diagram confirming the high total polyphenol content of fermented hemp seeds.

[0018] Figure 5 is a diagram identifying polyphenols in fermented hemp seeds through a heat map.

[0019] Figure 6 is a diagram confirming the anti-obesity, neuroprotective, and lifespan-extending effects of fermented cannabis seeds in the C. elegans model. (A) and (B) show fat deposition and fluorescence intensity, (C) shows AChE inhibition, and (D) shows the lifespan-extending effect.

[0020] Figure 7 is a diagram confirming changes in ROS in C. elegans cells according to fermented cannabis seed diet.

[0021] Figure 8 is a diagram confirming that hemp seed fermentation regulates the expression of genes related to longevity (Daf-16), fat synthesis (Fat-6 and Fat-7), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2).

[0022] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings. In the following description, detailed descriptions of well-known technologies to those skilled in the art may be omitted. Furthermore, in describing the present invention, detailed descriptions of related known functions or configurations may be omitted if it is determined that such detailed descriptions may unnecessarily obscure the gist of the present invention. Furthermore, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intentions of the user or operator, or the customs of the field to which the present invention pertains.

[0023] Therefore, definitions of these terms should be based on the overall content of this specification. Throughout this specification, whenever a part is said to "include" a component, this does not exclude other components, but rather implies the inclusion of additional components, unless otherwise specifically stated.

[0024] The present invention relates to a composition for improving obesity or cognitive function, comprising a fermented cannabis seed product using the Pediococcus acidilacticiSRCM 201591 strain.

[0025] In addition, the present invention relates to a method for producing the composition.

[0026] Cannabis Sativa L. is largely divided into marijuana and hemp. Marijuana has a high level of THC, a psychoactive ingredient, and a low level of CBD, an active ingredient. However, hemp has a low THC content (less than 0.3%) and a high CBD content (more than 20%). THC (Tetrahydrocannabinol) causes hallucinations, and CBD (Cannabidiol) is known to reduce pain and inflammation, control epileptic seizures, and treat addiction. Hemp is used for industrial purposes, and is generally used in textiles, building materials, food, and cosmetics. According to the Hemp Business Journal, the distribution volume of hemp, excluding medical marijuana, reached 4.6 billion dollars in 2019 and is expected to reach 26.6 billion dollars (about 29 trillion won) in 2025, with an annual growth rate of more than 34%. In South Korea, hemp is currently prohibited from use under regulations (the Narcotics Control Act). However, to create a high-value-added industry based on CBD materials, six areas, including Imha-myeon and Pungsan-eup in Andong-si, Gyeongsangbuk-do, have been designated as Gyeongsangbuk-do Industrial Hemp Regulation-Free Special Zones, where limited demonstration activities are permitted with full-cycle traceability management. The above industrial hemp species, including the husk, can be used industrially. In the present invention, the entire portion is used, preferably the entire portion with the husk removed, but is not limited thereto.

[0027] In one embodiment of the present invention, the fermented hemp seed (FWHS) may be an extract of the whole hemp seed, wherein the “whole hemp seed” refers to all parts of the hemp seed, including the roots, leaves, and stems, without or with the hull removed.

[0028] In one embodiment of the present invention, the cannabis seed fermentation may regulate the expression of genes associated with lifespan (Daf-16), fat synthesis (Fat-6 and Fat-7) and fat regulation (as confirmed in a C. elegans model, Trends in Endocrinology & Metabolism, 20(2), 58-65.), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2).

[0029] The term "Daf-16" in the present invention refers to a gene found across species, including humans, mice, and C. elegans, located downstream of DAF-2, which sends signals in the IIS pathway, and plays a role in activating genes related to lifespan extension, adipogenesis, and oxidative stress response. In a study by Murphy et al., Daf-16 was confirmed to be involved in longevity by upregulating lifespan extension-related genes, such as stress response genes, and downregulating lifespan-shortening genes.

[0030] In the present invention, the terms "SOD-1" and "SOD-2" refer to one of human superoxide dismutases that destroy free superoxide radicals in the body, and are associated with apoptosis, familial amyotrophic lateral sclerosis, and Parkinson's disease.

[0031] In the present invention, the terms "Fat-6" and "Fat-7" are one of the genes that promote fat synthesis in C. elegans (Watts, 2009), and also one of the genes involved in fat synthesis and fat regulation in Drosophila, and thus, it can be known that they are involved in fat synthesis and fat regulation in vivo (Trends in Endocrinology & Metabolism, 20(2), 58-65.).

[0032] The term "ACE-2" in the present invention refers to angiotensin-converting enzyme-2, also called "ACEH", which is a type 1 transmembrane protein homologous to angiotensin-converting enzyme, a type of metallocarboxypeptidase, and is found in eukaryotes and bacteria. It plays an important role in the renin-angiotensin-aldosterone system (RAAS), which regulates body water and blood pressure.

[0033] One of the many ways to prevent or improve obesity is through lipase inhibition. Lipase is an enzyme involved in the digestion and absorption of fat, found in the pancreas, small intestine, and adipocytes. Inhibiting lipase activity reduces the rate of fat digestion and absorption, thereby reducing the amount of fat absorbed by the body, contributing to weight loss and obesity prevention. Indeed, the lipase inhibitor orlistat is approved by the Ministry of Food and Drug Safety as an obesity treatment. Orlistat inhibits pancreatic lipase activity, reducing the rate of fat digestion and absorption by approximately 30%. Clinical studies have shown that orlistat is effective in weight loss and obesity prevention.

[0034] The term "TPC (Total Polyphenol Content)" used in the present invention refers to the total polyphenol content. Polyphenols are natural compounds contained in plants that have antioxidant, anti-inflammatory, and anti-cancer effects, and include phenolic acids, flavonoids, stilbenes, and lignans. The polyphenols have the effect of inhibiting the activity of lipase, and when lipase activity is inhibited, the digestion and absorption rate of ingested fat decreases, thereby reducing the amount of fat absorbed into the body. Therefore, the TPC-rich fermented hemp seed of the present invention can help with weight loss and obesity prevention.

[0035] The term "extract" used in the present invention is a broad concept that includes a substance obtained by extracting a specific component from a natural product, regardless of the extraction method, solvent, or form of the extract, and can be obtained by a conventional extraction method in the art.

[0036] In one embodiment of the present invention, the "extraction method" may be, but is not limited to, hot water extraction, high temperature and pressure extraction, low temperature and pressure extraction, alcohol extraction, reflux extraction, ultrasonic extraction, or cooling extraction.

[0037] In one embodiment of the present invention, the "extract" may be a solvent using one or more of purified water, alcohols having 1 to 4 carbon atoms including methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, and cyclohexane, but is not limited thereto.

[0038] The food composition of the present invention may include a health functional food. The term "health functional food" as used herein refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients with useful functionality for the human body. Here, "functionality" means obtaining a beneficial effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological functions. The health functional food may be manufactured using methods commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art may be added. In addition, the formulation of the health functional food may be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention may be manufactured in various forms, and unlike general drugs, it has the advantage of not causing side effects that may occur with long-term administration of drugs using food as a raw material, and is highly portable, so the health functional food of the present invention can be consumed as a supplement to enhance the effects of improving obesity or cognitive ability.

[0039] In addition, there is no limitation on the type of health food in which the composition of the present invention can be used. In addition, a composition comprising the fermented hemp seed of the present invention as an active ingredient can be manufactured by mixing other appropriate auxiliary ingredients that can be included in health functional foods and known additives according to the selection of a person skilled in the art. Examples of foods to which the composition can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and the composition can be manufactured by adding the extract according to the present invention to juice, tea, jelly, and juice manufactured using the extract as a main ingredient.

[0040] The present invention will be described in more detail below through the following examples. However, the following examples are intended only to concretize the content of the present invention and are not intended to limit the present invention.

[0041]

[0042] <Example 1> Isolation and identification of strains

[0043] The strain Pediococcus acidilactici SRCM 201591 used in the present invention is a strain isolated from salted fish in Korea, and was provided by the Korea Fermentation Industry Microbiology Research Institute (https: / www.mifi.re.kr / ko / intro.do).

[0044]

[0045] <Example 2> Production of fermented hemp seeds

[0046] Finely ground hemp seed powder (Cheongsam seed, purchased from Cha Hemp Industry Ltd., Chuncheon, Korea) was weighed in distilled water (10% w / v), thoroughly mixed, autoclaved, and cooled to ambient temperature. The resulting slurry was inoculated with the SRCM 201591 strain (2 × 108 CFU / mL) and placed in a shaking incubator (LSI-3016R, DAIHAN LABTECH CO. LTD, Namyangju, Korea) maintained at 37°C and a shaking speed of 140 rpm. Fermentation was performed by incubating at 37°C for 48 h.

[0047] Whole hemp seed (WHS), fermented whole hemp seed (FWHS), dehulled hemp seed (DHS), and fermented dehulled hemp seed (FDHS) were weighed in 70% ethanol at a ratio of 1:20 (w / v). Each sample mixture was extracted for 1 h at 40°C using an orbital shaker and then centrifuged at 4000 × g for 10 min. The supernatant was collected in a transparent bottle covered with aluminum foil to protect from light, and the obtained residue was re-extracted twice under the same set of conditions. The final supernatants of each sample were combined and concentrated under vacuum at 40°C. The concentrated supernatant was lyophilized for 4 days. The freeze-dried sample containing the freeze-dried solid was stored at -20°C, and the extract obtained therefrom was reconstituted in 70% ethanol and used in the experiments of the present invention.

[0048] However, for the analysis related to C. elegans in Example 5, the extract was dissolved in 1% dimethyl sulfoxide (DMSO) and used in the experiment.

[0049]

[0050] <Example 3> Confirmation of cytotoxicity

[0051] To determine the cytotoxicity of Example 2, the viability of HepG2 cells was measured calorimetrically using the MTT assay (Mosmann, 1983). Cells were cultured in 96-well plates at a density of 4 × 104 cells / well for 24 hours, washed with PBS, and treated with various concentrations of cannabis extract (50–400 μg / ml). The cells were then washed and incubated with 500 μg / ml MTT for 1 hour, and the formazan crystals were dissolved in 200 μl / well DMSO. The absorbance was measured calorimetrically at 570 nm.

[0052] Through this, as shown in Fig. 1, it was confirmed that whole hemp (WHS), dehulled hemp (DHS, hereinafter “dehulled hemp seed fermentation”), and fermented whole hemp (FWHS, hereinafter “hemp seed fermentation”) did not have cytotoxicity.

[0053]

[0054] <Example 4> In vitro confirmation of obesity and cognitive improvement ability

[0055] <4.1> Pancreatic lipase inhibition assay

[0056] To confirm the anti-obesity effect of the hemp seed fermentation of Example 2, the pancreatic lipase inhibition activity was assayed using cultured samples of hemp seed fermentation (50-400 μg / mL) and 50 μL (50 U / mL) of lipase enzyme in methyl cellosolve. 100 μL of 1 mM 4-methylumbelliferone (4-MU) dissolved in methyl cellosolve was added and incubated at room temperature for 30 minutes. The reaction was stopped by adding 100 μL of 0.1 M, pH 4.2 sodium citrate solution. A test blank was performed for all samples using Orlistat as a positive control.

[0057] The lipase inhibitory activity of the sample was expressed as a percentage according to the following formula:

[0058] Lipase Inhibition (%) =[1- ((Ftest-Ftest blank) / (Fcontrol-Fcontrol blank))]×100%

[0059] (Ftest: fluorescence value of plant extract or orlistat (standard) using substrate 4-MU oleate; Ftest blank: fluorescence value of extract or orlistat standard without substrate 4-MU oleate; Fcontrol: fluorescence value of control using substrate 4-MU oleate; Fcontrol blannk: fluorescence value of control without substrate 4-MU oleate).

[0060] Through this, as shown in Fig. 2(A), it was confirmed that the lipase inhibitory activity increased as the concentration of the fermented hemp seeds increased (50-400 μg / mL), and it was confirmed that the fermented hemp seeds (FWHS) had the highest lipase inhibitory activity at a concentration of 400 μg / mL (83.34%), and the fermented hemp seeds with hulls (FDHS) had the next highest lipase inhibitory activity (69.6%). In the case of unfermented hemp seeds (DHS), the lipase inhibitory activity was confirmed to be low.

[0061]

[0062] <4.2> Confirmation of acetylcholinesterase (AChE) inhibitory activity

[0063] To confirm the AChE inhibitory activity of the fermented cannabis seed of Example 2, the following experiment was conducted.

[0064] 100 μL of plant extract was mixed with 150 μL of AChE solution (0.04 units), and the mixture was supplemented with 0.1 M pH 8.0 sodium phosphate buffer to make a final reaction volume of 800 μL, and the mixture was incubated at room temperature for 15 minutes. After incubation, 600 μL of 0.5 mM 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB) was added, and 200 μL of acetyl thiocholine iodide (0.71 mM) was added to initiate the reaction. After a 30-minute incubation period, the absorbance of the reaction was measured at 412 nm using a spectrum plate reader, and the inhibitory activity of AChE was expressed as a percentage. Galantamine was used as a drug control.

[0065] Through this, as shown in Fig. 2(B), it was confirmed that AChE was inhibited in a dose-dependent manner by the fermented cannabis seed. Specifically, at a dose of 400 μg / mL, the FWHS extract (78.94%) showed the most significant AChE inhibition ability, followed by FDHS (65.34%), and regardless of concentration, DHS showed the weakest inhibition ability, followed by WHS at the same concentration.

[0066]

[0067] <4.3> Confirmation of radical scavenging ability

[0068] To confirm the antioxidant effect of the fermented hemp seed of Example 2, the radical scavenging ability was measured using DPPH and ABTS analysis.

[0069] 100 μL of sample or Trolox (standard) was mixed with 1 mL of DPPH solution and reacted for 30 minutes in a darkroom at room temperature, and then the absorbance was measured at 517 nm to measure the DPPH radical scavenging activity. Meanwhile, to generate ABTS radicals, 5 mL of 2.45 mM potassium persulfate and 5 mL of 7 mM ABTS solution were mixed and reacted for 16 hours in a darkroom. Then, to prepare the ABTS working solution, 2 mL of ABTS radical was mixed with 200 mL of 70% ethanol and the absorbance at 734 nm was adjusted to 0.70. 1 mL of ABTS working solution was mixed with 100 μL of samples or standards of different concentrations and reacted for 30 minutes at room temperature, and then the absorbance was measured at 734 nm. Ascorbic acid was used as a drug control, and the percentage of DPPH and ABTS inhibition abilities was calculated according to the formula below.

[0070] Inhibition (%) =((OD control-OD test sample) / (OD control))× 100

[0071] In the above formula, OD control is the absorbance for the control blank (negative control), OD test sample is the absorbance for the tested extract, and the result is expressed as IC 50.

[0072] Through this, as shown in Fig. 3, it was confirmed that the fermented hemp seed product has a high free radical (DPPH and ABTS) inhibition ability compared to the unfermented hemp seed extract, and thus has a significant antioxidant effect.

[0073]

[0074] <4.4> Measurement of total phenol content

[0075] The total phenol content (TPC) of the extract (1 mg / mL) of Example 2 was analyzed using the Folin-Ciocalteu method. 200 μL of 10% Folin-Ciocalteu reagent was added to 100 μL of the test sample, the mixture was vortexed, and incubated at room temperature for 2 hours. Then, 800 μL of 700 mM sodium carbonate was added to the reaction mixture, and the absorbance was measured at 765 nm using a SpectraMax i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea). The total phenol content (TPC) was calculated from a standard garlic standard curve.

[0076] Through this, it was confirmed that the polyphenol content increased in all samples treated with fermented hemp seed extract, as shown in Fig. 4. TPC was highest in FWHS (45.71 ± 0.67 mg / g GAE), and lowest in DHS (16.58 ± 0.59 mg / g GAE).

[0077] All of the above phenolic compounds are known to be powerful antioxidants and anti-obesity agents, and it was confirmed that chronic diseases including cardiovascular disease, type 2 diabetes, obesity, oxidative stress, and stress-related disorders can be prevented through consumption of the fermented hemp seed extract of the present invention.

[0078]

[0079] <4.5> Polyphenol identification

[0080] Freeze-dried hemp seed samples were diluted in 70% ethanol and subjected to UHPLC-Q-TOF-MS / MS2 analysis. Briefly, 10 g of powdered sample was mixed with 200 mL of 70% ethanol and extracted at 40°C for 1 h. The mixture was centrifuged at 4,000 × g for 10 min, and the supernatant was collected. This extraction was repeated twice using the residue, and the supernatant was collected and concentrated in vacuum at 40°C. The concentrate was lyophilized for 4 days, stored at -20°C, and diluted in 70% ethanol before use in the experiment. The analytical column used was an Acquity UPLC BEH C18 column (150 × 2.1 mm, 1.7 μm) (Waters Co., USA). 2 μL of sample extract was injected into the system using an autosampler and eluted from the column using a binary mobile phase consisting of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile according to the following gradient: 10–90% B (0–14 min).

[0081] The system was operated at a flow rate of 0.4 mL / min, and MS / MS data were acquired from a collision energy ramp of 15 to 45 eV in MSE mode in the negative ion mode in continuum format with a mass range of m / z 100 to 1600.

[0082] ESI parameters were set as shown in Table 1 below, and data were measured using MassLynx V4.1 (Waters Corp.). Polyphenol compounds were identified using an in-house phytochemical library (UNIFI 1.8, Waters Corp.).

[0083] Parameter ValueCapillary voltage2.5 kVCone voltage45 VSource temperature120 ℃Desolvation temperature350 ℃Cone gas flow50 L / hDesolvation gas flow800 L / h

[0084] Through this, as shown in Fig. 5, it was confirmed that phenylamine was the most abundant phenolic compound identified by UHPLC-ESI-QTOF-MS in the fermented hemp seed of Example 2.

[0085]

[0086] <Example 5> Confirmation of in vivo obesity and cognitive improvement ability

[0087] <5.1> Preparing the C. elegans model

[0088] Caenorhabditis elegans were cultured on Nematode Growth Media (NGM) plates at 20°C, containing their prey, Escherichia coli OP50. The cultured C. elegans were cultured in NGM with OP50 containing 5-fluorodeoxyuridine (FudR, 140 mM) and various treatments, and to establish a hyperglycemic state, the C. elegans were treated with OP50 mixed with 2% w / v D(+)-glucose to accumulate fat in the intestine. Each experiment was repeated three times.

[0089]

[0090] <5.2> Analysis of lifespan by fermented hemp seed diet

[0091] The lifespan of C. elegans fed a 400 μg / mL hemp seed fermentation diet of Example 2 was measured. Each plate, containing approximately 50 C. elegans, was treated with a mixture of 2% glucose, E. coli OP50, and hemp seed fermentation or a drug control.

[0092] The positive control (PC) group consisted of C. elegans treated with 1% DMSO mixed with 2% glucose and E. coli OP50, while the other C. elegans were fed only E. coli OP50.

[0093] Thereafter, C. elegans were monitored and counted daily, classified as alive or dead until all obesity model C. elegans died, and dead nematodes were scored when they did not respond to the touch of a platinum wire.

[0094] Through this, as shown in Figure 6D, it was confirmed that the lifespan of the fermented hemp seed (FWHS) treatment group was the longest, while the lifespan of the hemp extract (DHS) treatment group was the shortest.

[0095]

[0096] <5.3> Measurement of fat deposition and neutral fat reduction by fermented cannabis seed diet

[0097] fat accumulation

[0098] The fat-reducing effect of the extract of the present invention was measured through Oil Red and Nile Red staining. The fat-accumulating C. elegans of Example 5.1 were treated with OP50 mixed with 2% glucose and 100 μg / mL, 1 mg / mL of the extract of the present invention, or 100 μg / mL orlistat as a positive control. Then, 30 adult worms were collected, mixed with Oil or Nile Red stain, transferred to a 2% sodium azide (NaN3) droplet on a 2% agarose pad, and observed under a microscope (IX-83 ZDC, Olympus). Fat deposition by Oil Red was observed under a light microscope, and C. elegans stained with Nile Red were observed under a fluorescence microscope, and the Oil and Nile Red intensities were quantified using ImageJ software ( / imagej.net / ).

[0099] As shown in Figure 6A, all groups treated with fermented hemp seeds demonstrated a higher fat accumulation inhibition effect compared to the positive control group. The fermented hemp seed extract (FWHS) demonstrated the highest anti-adipogenic effect, as evidenced by the greatest decrease in fluorescence intensity, followed by FDHS.

[0100]

[0101] Triglyceride quantitative analysis

[0102] Triglyceride (TG) was measured using a quantitative kit (BIOMAX, Seoul, Korea). TG analysis was performed according to the kit manufacturer's instructions. Briefly, C. elegans cells were homogenized with 1 mL of 0.5% Tween 20 solution, heated at 80–100°C for 1 h, and then cooled to room temperature. The supernatant obtained after 2 min of centrifugation was diluted 2-fold. Thirty μL was dispensed into a 96-well plate and made up to 50 μL with the kit buffer. Two μL of lipase was added to each well, mixed, and incubated at room temperature for 20 min. After mixing, 50 μL of reaction mix was added and incubated for an additional 30 min in the dark at room temperature. The absorbance was then measured at 570 nm.

[0103] As shown in Figure 6B, it was confirmed that all hemp seed fermentation treatment groups exhibited a fat-reducing effect. Specifically, the hemp seed fermentation treatment group showed the greatest reduction in triglyceride levels, followed by FDHS.

[0104]

[0105] <5.4> Confirmation of acetylcholinesterase (AChE) inhibitory activity

[0106] AChE inhibitory activity was measured in L4 stage C. elegans using a colorimetric method. After exposure to the extract of the present invention for 7 days, approximately 5,000 C. elegans were washed three times with M9 buffer and transferred to microcentrifuge tubes. The samples were frozen and thawed three times in liquid nitrogen, sonicated, and centrifuged at 15,000 rpm for 10 minutes to collect the supernatant. An aliquot (150 μL) of the supernatant was mixed with a solution containing 5,5'-dithiobis-2-nitrobenzoic acid (also known as DTNB (0.25 mM)) and acetylthiocholine iodide (ASChI, 156 mM), and incubated at 30°C for 5 minutes.

[0107] Absorbance was measured at 405 nm using a Spectra Max i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea), and AChE activity was expressed as a percentage of the positive control.

[0108] As shown in Figure 6C, fermented cannabis seed (FWHS) was found to have the strongest inhibitory effect on AChE activity compared to other experimental groups. Compared to the PC group, the FWHS treatment group showed a 37% decrease in AChE activity, while the FDHS and WHS treatment groups showed inhibitory effects of 28% and 18%, respectively.

[0109]

[0110] <5.5> Confirmation of ROS in C. elegans cells

[0111] To confirm the changes in ROS in vivo according to the fermented cannabis seed diet, visualization and quantification of ROS were performed.

[0112]

[0113] Visualization of intracellular ROS in C. elegans

[0114] C. elegans from Example 2 were placed in separate NGM / FUDR until they reached the L4 stage. They were grouped and supplemented with E. coli OP50 and 2% glucose to induce obesity and oxidative stress. After 3 days, all plates, except the positive control group, which used 1% DMSO instead of the extract of the present invention, were treated with three types of hemp seed extracts / Trolox (400 μg / mL) for 7 days: fermented hemp seed (FWHS), FDHS, and DHS. C. elegans were then washed with M9 buffer and centrifuged. For qualitative ROS analysis, approximately 30 C. elegans were incubated with 50 μM 2',7'-dichlorofluorescein diacetate (DCFDA) in the dark at 20°C for 1 h. The worms were then paralyzed with 10 mM sodium azide, mounted on microscope glass slides, and photographed randomly (30 / group) using a BIOREVO BZ-9000 fluorescence microscope (Keyence Deutschland GmbH, Neu-Isenburg, Germany). The relative fluorescence of the whole body of C. elegans was measured using ImageJ software (National Institutes of Health, Bethesda, MD), and the average fluorescence intensity was expressed.

[0115] As shown in Figure 7C, the lowest ROS accumulation was confirmed in the hemp seed fermentation treatment group. The highest accumulation was confirmed in the PC group, followed by the DHS group.

[0116]

[0117] Quantification of intracellular ROS measurements in C. elegans

[0118] ROS levels were expressed as a percentage of the positive control for quantitative intracellular antioxidant assays. After 7 days of treatment as described above, C. elegans were harvested in 100 μl of phosphate-buffered saline (PBS) containing 1% Tween-20 (PBST). C. elegans were then sonicated (Branson Sonifier 250; VWR Scientific, Suwanee, GA) and pipetted into wells of a 96-well plate containing DCF-DA (final concentration 50 μM in PBS). Sample fluorescence was read using a pectraMax i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea) at 37°C, with excitation at 485 nm and emission at 530 nm.

[0119] As shown in Figure 7D, ROS was confirmed to be reduced in all C. elegans treated with cannabis extract compared to the PC group. Among them, the fermented cannabis seed (FWHS) group showed the greatest reduction in ROS (68%), followed by the FDHS group (78%). In contrast, the same concentration of DHS had the lowest effect on ROS levels. This indicates that the fermented cannabis seed (FWHS) is the most effective in suppressing ROS accumulation in C. elegans.

[0120]

[0121] <5.6> Confirming gene expression regulation

[0122] To confirm the regulation of gene expression by the hemp seed fermentation, RNA of C. elegans was extracted using TRIzol (Thermo Fisher Scientific, Inc., Middletown, VA), and the yield of cDNA templates was measured using a High-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Inc., Middletown, VA) and a thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA). RNA purity was then measured using the 260 / 280 absorbance ratio, and specific primers for specific genes were analyzed as shown in Table 2 (Caenorhabditis elegans primers for detection of gene expression).

[0123] Gene expression was measured using the StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA) and TaqMan gene probes (Thermo Fisher Scientific, Inc., Middletown, VA). 10 μL of MeltDoctor™ HRM MasterMix, 2 μL of genomic DNA (10 ng μL-1), 0.5 μL of each primer (10 pg μL-1), and 7 μL of double-distilled water were mixed, and the relative gene expression was measured.

[0124] Gene nameForward primerReverse primerDaf-16CCAGACGGAAGGCTTAAACTATTCGCATGAAACGAGAATGsod-1ACGCTCGTCACGCTTTACTCTTCTGCCTTGTCTCCGsod-2GGCATCAACTGTCGCTGTACAAGTCCAGTTGTTGCCFa t-6CAACTTCCATCACACATTCCCTCCTCGTTGAATATCACATCCFat-7TTTCCACCACACATTCCCACTCTTCACTTCCGTGATTGGCAce-2CAATAATCAACTCATGGGCATCATTTTCGCGAGACGAAACGA

[0125]

[0126] Through this, as shown in Fig. 8, it was confirmed that the fermented cannabis seed product regulates the expression of genes related to lifespan (Daf-16), fat synthesis (Fat-6 and Fat-7), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2).

[0127] Specifically, the expression of SOD-1 and SOD-2 genes related to suppression of oxidative stress was up-regulated, and among them, a remarkable effect was confirmed in the fermented cannabis seed (FWHS) treatment group, confirming that the extract of the present invention can suppress ROS accumulation by regulating the expression of genes related to ro-ROS. In addition, the extract of FWHS and FDHS up-regulated the mRNA expression daf-16, confirming that the lifespan of C. elegans treated with HWHS was improved through this. In addition, with regard to fat metabolism, it was confirmed that the expression of Fat-6 and fat-7 genes involved in fat synthesis was reduced according to the administration of the extract of the present invention, confirming that the fermented cannabis seed of the present invention can suppress fat accumulation in the body by regulating fat synthesis genes.

[0128] Finally, both hemp seed fermentation and hulled hemp seed fermentation (FWHS and FDHS) significantly downregulated the ACE-2 gene, which is involved in enhancing AChE levels, upon administration, confirming that these fermentations significantly affect anti-AChE activity.

[0129]

[0130] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than restrictive. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A food composition for improving obesity or cognitive function, comprising fermented cannabis seeds.

2. In paragraph 1, A composition wherein the above fermentation is carried out at 37 to 40°C for 40 to 50 hours.

3. In paragraph 1, The above fermentation is a composition inoculated with the Pediococcus acidilactici SRCM201591 strain.

4. In paragraph 1, A composition wherein the above hemp seed fermentation product has an increased total polyphenol content.

5. In paragraph 1, A composition wherein the above hemp seed fermentation product is obtained by extracting the entire portion of the hemp seed.

6. In paragraph 1, A composition wherein the above hemp seed fermentation product has lipase inhibitory ability.

7. In paragraph 1, A composition wherein the above hemp seed fermentation product has ROS inhibitory ability.

8. In paragraph 1, A composition wherein the above hemp seed fermentation product has acetylcholine esterase (AChE) inhibitory activity.

9. In paragraph 1, A composition wherein the above hemp seed fermentation product has free radical DPPH and ABTS inhibitory activity.

10. In paragraph 1, A composition wherein the above hemp seed fermentation product has free radical DPPH and ABTS inhibitory activity.

11. In paragraph 1, A composition wherein the above hemp seed fermentation product regulates at least one of a pro-ROS-related gene, a lifespan-related mRNA expression gene, a fat synthesis gene, and an AChE promoting gene.

12. In paragraph 11, A composition wherein the above hemp seed fermentation product upregulates the expression of SOD-1 and SOD-2 genes, which are pro-ROS related genes.

13. In paragraph 11, A composition wherein the above hemp seed fermentation product upregulates the expression of the daf-16 gene, which is a lifespan-related mRNA expression gene.

14. In paragraph 11, A composition wherein the above hemp seed fermentation product downregulates the expression of the Fat-6 and Fat-7 genes, which are fat synthesis genes.

15. In paragraph 11, A composition wherein the above hemp seed fermentation product downregulates the expression of the ACE-2 gene, which is an AChE promoting gene.

16. A method for producing a fermented cannabis seed product, comprising the step of inoculating a cannabis seed extract with the Pediococcus acidilactici SRCM201591 strain.

17. In paragraph 16, The above fermentation was carried out with 2 x 10 Pediococcus acidilactici SRCM201591 strain 8 A composition in which the composition is inoculated at a concentration of cfu / mL and incubated at 37 to 40°C for 40 to 50 hours.

18. A method for increasing the content of total phenol compounds in hemp seeds, comprising the step of inoculating and fermenting the Pediococcus acidilactici SRCM201591 strain.

19. A method for producing hemp seeds with increased content of total phenol compounds, comprising the step of inoculating and fermenting the Pediococcus acidilactici SRCM201591 strain.

20. A method for improving obesity or cognitive function, comprising the step of administering the composition of paragraph 1 to a subject.

Images