Composition for alleviating obesity, improving cognitive function and memory, and preventing alzheimer's disease, comprising fermented hemp seed product as active ingredient

Abstract

The present invention relates to a composition for alleviating obesity, improving cognitive function and memory, and preventing Alzheimer's disease, comprising a fermented hemp seed product as an active ingredient. The fermented hemp seed product prepared by inoculating a Pediococcus acidilactici OHSI1 strain (deposit number: KCTC 15831BP) strain, of the present invention, has the effects of: increasing the abundance and diversity of intestinal microorganisms; increasing beneficial intestinal bacteria; reducing harmful intestinal bacteria; alleviating intestinal microbial flora imbalance; anti-obesity; antioxidation; and controlling Alzheimer's disease-associated enzyme activity, and thus can be effectively used as a food composition or a pharmaceutical composition for preventing, alleviating, or treating obesity or cognitive dysfunction, and as a health functional food composition for improving memory and cognitive function by improving intestinal microbial flora.

Description

A composition containing fermented hemp seeds as an active ingredient for improving obesity, enhancing cognitive function and memory, and preventing Alzheimer's disease.

[0001] The present invention relates to a composition for improving obesity, enhancing cognitive function and memory, and preventing Alzheimer's disease, which contains a fermented cannabis seed product as an active ingredient.

[0002] Obesity is defined as the excessive accumulation of body fat due to energy intake exceeding energy expenditure. While the causes of obesity vary, including unbalanced diets and lack of exercise, the decreased digestion of lipids or fats due to the inhibition of pancreatic lipase activity has recently been suggested as one of the contributing factors. Obesity was recognized as a disease in its own right by the World Health Organization in 1997. Furthermore, obesity is considered part of metabolic syndrome and a precursor to various adult diseases, such as diabetes, hyperlipidemia, and hypertension. The obesity rate in Korea was recorded at around 26% in 1998, but exceeded 30% in 2005. After reaching 31.7%, it remained at a similar level until 2014, rising slightly to 33.2% in 2015. It remained at a similar level of 33-34% until 2019, reaching 38.3% in 2020, a 4.5 percentage point increase from the previous year.

[0003] Due to the increasing incidence of metabolic disorders such as obesity and oxidative stress, and related diseases, the demand for healthy and nutritious foods that can prevent or improve these conditions is increasing.

[0004] As our society ages, the number of people with neurological disorders, a common geriatric condition, is also on the rise. Degeneration of acetylcholine (ACh), the brain's primary neurotransmitter, by acetylcholine esterase (AChE) is associated with most neurological disorders, and drugs that inhibit AChE are often prescribed as treatments for neurodegeneration. However, due to the side effects of synthetic drugs, there has been a growing demand for natural products with AChE inhibitory properties.

[0005] Industrial hemp (Cannabis Sativa L.) has been cultivated for thousands of years. In ancient times, it was cultivated as a multipurpose crop, providing fiber, food, and medicine. However, the cultivation of all cannabis crops, including hemp, was banned in 1937 following the discovery of delta-9-tetrahydrocannabinol (THC), the psychoactive component associated with most cannabis plants (S.O. Aloo, Mwiti, Ngugi, & Oh, 2022; Shen, Gao, Fang, Rao, & Chen, 2021). Nevertheless, in 1970, non-psychoactive cannabis varieties were reintroduced as industrial crops, distinguishing them from other psychoactive varieties. Since 1970, there has been a growing global demand for legal breeding of industrial hemp varieties with low THC contents (typically less than 0.3%) (Shen et al., 2021). Industrial hemp seeds are attracting attention in the food industry due to their rich bioactive compounds (including polyphenols and phytocannabinoids), high-quality protein, edible oil, and other beneficial nutrients. Recently, researchers have demonstrated that fermented whole hemp seeds and their sprouts contain a wide range of bioactive metabolites responsible for biological activity (SO Aloo, Park, & Oh, 2023). However, while the aforementioned benefits of hemp are known, the disease prevention and improvement effects of hemp fermentation products remain unknown.

[0006] Accordingly, the present inventors have completed the present invention by confirming that a fermented cannabis seed product using the strain Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP) has remarkable anti-obesity and cognitive-improving properties by improving intestinal microflora, and that this can be used in a composition for improving obesity or cognitive function.

[0007] The purpose of the present invention is to provide a food composition for preventing or improving obesity or cognitive dysfunction, which contains a fermented cannabis seed product as an active ingredient.

[0008] In addition, another object of the present invention is to provide a health functional food composition for improving memory and cognitive ability, which contains a fermented cannabis seed product as an active ingredient.

[0009] In addition, another object of the present invention is to provide a pharmaceutical composition for preventing or treating obesity or cognitive dysfunction, which contains a fermented cannabis seed product as an active ingredient.

[0010] In addition, another object of the present invention is to provide a method for producing a fermented cannabis seed product.

[0011] In addition, another object of the present invention is to provide a method for increasing the content of metabolites in fermented cannabis seeds.

[0012] To achieve the above purpose, the present invention provides a food composition for preventing or improving obesity or cognitive dysfunction, which comprises a fermented cannabis seed product as an effective ingredient.

[0013] In addition, the present invention provides a health functional food composition for improving memory and cognitive ability, which contains a fermented cannabis seed product as an active ingredient.

[0014] Furthermore, the present invention provides a pharmaceutical composition for preventing or treating obesity or cognitive dysfunction, which comprises a fermented cannabis seed product as an active ingredient.

[0015] In addition, the present invention provides a method for producing a fermented hemp seed product, comprising the steps of: producing a hemp seed extract; and inoculating the hemp seed extract with a strain or a culture thereof.

[0016] Finally, the present invention provides a method for increasing the content of metabolites in a fermented cannabis seed product, comprising the steps of preparing a cannabis seed extract; and inoculating the cannabis seed extract with a strain or a culture thereof.

[0017] The fermented cannabis seed product prepared by inoculating the Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP) strain of the present invention has the effects of increasing the abundance and diversity of intestinal microorganisms, increasing intestinal beneficial bacteria, reducing intestinal harmful bacteria, improving intestinal microbial flora imbalance, anti-obesity effect, antioxidant effect, and regulating enzyme activity related to Alzheimer's disease, and therefore can be usefully used as a food composition or pharmaceutical composition for preventing, improving, or treating obesity or cognitive dysfunction by improving intestinal microbial flora, and as a health functional food composition for improving memory and cognitive function.

[0018] Figure 1 is a diagram confirming the cytotoxicity of a hemp seed extract in one embodiment of the present invention.

[0019] FIG. 2 is a diagram confirming the obesity and cognitive improvement ability of a fermented cannabis seed product in one embodiment of the present invention (A: confirmation of pancreatic lipase inhibition ability, B: confirmation of acetylcholine esterase (AChE) inhibition activity).

[0020] Figure 3 is a diagram showing the antioxidant activity of a fermented hemp seed product according to one embodiment of the present invention. It was confirmed that the fermented hemp seed product exhibited remarkable free radical (DPPH and ABTS) inhibition activity.

[0021] 1) Positive control: Ascorbic acid (AA); WHS: whole hemp seeds; FWHS: fermented whole hemp seeds; DHS: hulled hemp seeds; FDHS: hulled fermented hemp seeds

[0022] FIG. 4 is a diagram confirming the high total polyphenol content of fermented hemp seeds in one embodiment of the present invention.

[0023] FIG. 5 is a diagram illustrating polyphenol compounds of fermented hemp seeds identified through a heat map in one embodiment of the present invention.

[0024] FIG. 6 is a diagram confirming the anti-obesity, neuroprotective, and lifespan extension effects of fermented cannabis seeds in a C. elegans model in one embodiment of the present invention (A, B: fat deposition and fluorescence intensity, C: AChE inhibition, D: confirmation of lifespan extension effect).

[0025] FIG. 7 is a diagram confirming changes in ROS in C. elegans cells according to a fermented cannabis seed diet in one embodiment of the present invention.

[0026] FIG. 8 is a diagram confirming that, in one embodiment of the present invention, the expression of genes related to the lifespan (Daf-16), fat synthesis (Fat-6 and Fat-7), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2) of fermented cannabis seeds is regulated.

[0027] FIG. 9 is a diagram showing the feed intake, feed conversion ratio, and body weight change of experimental animals treated with fermented hemp seeds in one embodiment of the present invention (A: method for producing fermented hemp seeds, B: experimental animal design, C: feed intake, D: feed conversion ratio, E: body weight change).

[0028] FIG. 10 is a diagram confirming the effect of improving obesity in experimental animals treated with a fermented cannabis seed product in one embodiment of the present invention (A: serum triglyceride level, B: serum total cholesterol level, C: serum high-density lipoprotein cholesterol level, D: serum low-density lipoprotein cholesterol level, E: adiponectin concentration, F: leptin concentration, G: fasting blood sugar level, H: blood insulin concentration, I: insulin resistance, J, K: adipose tissue weight, L, M: liver tissue weight, N: histological type of adipose tissue, O: histological type of liver tissue).

[0029] FIG. 11 is a diagram confirming the effect of improving cognitive function of experimental animals treated with fermented cannabis seeds in one embodiment of the present invention (A, B: novel object recognition memory test, C: Y maze test, D: passive avoidance test, E: BACE1 activity, F: AChE activity, G: MAGL activity, H: Aβ accumulation, I: SOD activity, J: CAT activity, K: MDA level, L: TNF-α concentration, M: IL-6 concentration, N: IL-10 concentration, O: histological form of hippocampus, P: histological form of cerebral cortex).

[0030] FIG. 12 is a diagram analyzing the correlation between an obesity index and an Alzheimer's disease index in one embodiment of the present invention.

[0031] FIG. 13 is a diagram showing the effect of treatment with fermented cannabis seeds on the serum and brain metabolite profiles of experimental animals in one embodiment of the present invention (A, B: serum metabolites, C, D: brain metabolites, E: common metabolites of serum and brain).

[0032] FIG. 14 is a diagram analyzing the phylum level of the intestinal microbiota according to treatment with fermented cannabis seeds in one embodiment of the present invention. (A: composition of microorganisms at the phylum level, B: abundance of Bacillota, C: abundance of Bacteroidota, D: F / B ratio, E: abundance of Deferribacterota, F: abundance of Pseudomonadota, G: abundance of Actinomycetota).

[0033] FIG. 15 is a diagram analyzing the genus and species levels of intestinal microorganisms according to treatment with fermented cannabis seeds in one embodiment of the present invention (A to E: volcano plot, F: heat map, G: PC biplot).

[0034] FIG. 16 is a diagram analyzing the correlation between intestinal microbial species, obesity serum indicators, and Alzheimer's disease brain indicators in one embodiment of the present invention (A: correlation between intestinal microbial species and obesity, B: correlation between intestinal microbial species and Alzheimer's disease).

[0035] Hereinafter, embodiments of the present invention will be described in detail with reference to the attached drawings. In the following description, detailed descriptions of well-known technologies to those skilled in the art may be omitted. Furthermore, in describing the present invention, detailed descriptions of related known functions or configurations may be omitted if it is determined that such detailed descriptions may unnecessarily obscure the gist of the present invention. Furthermore, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intentions of the user or operator, or the customs of the field to which the present invention pertains.

[0036] Therefore, definitions of these terms should be based on the overall content of this specification. Throughout this specification, whenever a part is said to "include" a component, this does not exclude other components, but rather implies the inclusion of additional components, unless otherwise specifically stated.

[0037] Throughout this specification, '%' used to indicate the concentration of a particular substance means solid / solid (w / w) %, solid / liquid (w / v) %, and liquid / liquid (v / v) %, unless otherwise stated.

[0038] In one aspect, the present invention provides a food composition for preventing or improving obesity or cognitive dysfunction, comprising a fermented cannabis seed product as an active ingredient.

[0039] Cannabis sativa L. is largely divided into marijuana and hemp. Marijuana has a high psychoactive ingredient, THC, and a low active ingredient, CBD. However, hemp has a low THC content (less than 0.3%) and a high CBD content (more than 20%). THC (Tetrahydrocannabinol) causes hallucinations, and CBD (Cannabidiol) is known to reduce pain and inflammation, control epileptic seizures, and treat addiction. Hemp is used for industrial purposes, and is generally used in textiles, building materials, food, and cosmetics. According to the Hemp Business Journal, excluding medical marijuana, the distribution volume of hemp reached $4.6 billion in 2019 and is expected to reach $26.6 billion (about 29 trillion won) in 2025, with an annual growth rate of more than 34%. In South Korea, hemp is currently prohibited from use under regulations (the Narcotics Control Act). However, to create a high-value-added industry based on CBD materials, six areas, including Imha-myeon and Pungsan-eup in Andong-si, Gyeongsangbuk-do, have been designated as Gyeongsangbuk-do Industrial Hemp Regulation-Free Special Zones, where limited demonstration activities are permitted with full-cycle traceability management. The above industrial hemp species, including the husk, can be used industrially. In the present invention, the entire portion is used, preferably the entire portion with the husk removed, but is not limited thereto.

[0040] In one embodiment of the present invention, the cognitive dysfunction may be due to obesity, but is not limited thereto.

[0041] In one embodiment of the present invention, the prevention or improvement of obesity or cognitive dysfunction may be due to improvement of intestinal microflora, but is not limited thereto.

[0042] In one embodiment of the present invention, the fermentation may be performed by inoculating the Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP) strain, but is not limited thereto.

[0043] In one embodiment of the present invention, the cognitive dysfunction may be at least one selected from the group consisting of Alzheimer's disease, cerebrovascular dementia, Pick's disease, Creutzfeldt-Jakob disease, dementia due to head injury, and Parkinson's disease, preferably Alzheimer's disease, but is not limited thereto.

[0044] In one embodiment of the present invention, the cognitive dysfunction is due to cognitive decline, and the cognitive decline may be at least one selected from the group consisting of memory decline, lethargy, amnesia, cognitive decline, learning disability, attention deficit, depression, hearing loss, analgesia, ahidrosis, and discrimination decline, but is not limited thereto.

[0045] In one embodiment of the present invention, the hemp seed may be a shelled hemp seed, but is not limited thereto.

[0046] In one embodiment of the present invention, the concentration of the fermented cannabis seed may be, but is not limited to, 0 to 1000 μg / mL, preferably 0 to 500 μg / mL, and more preferably 50 to 400 μg / mL.

[0047] In one embodiment of the present invention, the fermented cannabis seed may improve intestinal microbial flora, but is not limited thereto.

[0048] In one embodiment of the present invention, the improvement of the intestinal microflora may be, but is not limited to, increasing the abundance and diversity of intestinal microorganisms.

[0049] In one embodiment of the present invention, the improvement of the intestinal microflora may be, but is not limited to, increasing intestinal beneficial bacteria.

[0050] In one embodiment of the present invention, the beneficial bacteria may be at least one selected from the group consisting of a Duncaniella strain, a Muribaculum strain, a Fusimonas strain, an Anaerotaenia strain, an Acetivibrio strain, a Waltera strain, a Clostridium strain, a Lacrimispora strain, and a Roseburia strain, but is not limited thereto.

[0051] In one embodiment of the present invention, the Duncaniella genus strain may be, but is not limited to, Duncaniella muris.

[0052] In one embodiment of the present invention, the strain of the genus Muribaculum may be, but is not limited to, Muribaculum gordoncarteri.

[0053] In one embodiment of the present invention, the Fusimonas genus strain may be, but is not limited to, Fusimonas intestine.

[0054] In one embodiment of the present invention, the Anaerotaenia genus strain may be, but is not limited to, Anaerotaenia torta.

[0055] In one embodiment of the present invention, the Acetivibrio strain may be Acetivibrio cellulolyticus, but is not limited thereto.

[0056] In one embodiment of the present invention, the Roseburia genus strain may be Roseburia faecis, but is not limited thereto.

[0057] In one embodiment of the present invention, the strain of the genus Lacrimispora may be, but is not limited to, Lacrimispora saccharolytica.

[0058] In one embodiment of the present invention, the improvement of the intestinal microflora may be, but is not limited to, reducing harmful intestinal bacteria.

[0059] In one embodiment of the present invention, the harmful bacteria may be at least one selected from the group consisting of a strain of the genus Streptococcus, a strain of the genus Petroclostridium, a strain of the genus Lactobacillus, a strain of the genus Limosilactobacillus, a strain of the genus Jeotgalicoccus, a strain of the genus Ligilactobacillus, a strain of the genus Murimonas, a strain of the genus Faecalicatena, and a strain of the genus Roseburia, but is not limited thereto.

[0060] In one embodiment of the present invention, the Streptococcus strain may be, but is not limited to, Streptococcus danieliae.

[0061] In one embodiment of the present invention, the strain of the genus Petroclostridium may be, but is not limited to, Petroclostridium xylanilyticum.

[0062] In one embodiment of the present invention, the strain of the genus Limosilactobacillus may be, but is not limited to, Limosilactobacillus agrestis.

[0063] In one embodiment of the present invention, the strain of the genus Jeotgalicoccus may be, but is not limited to, Jeotgalicoccus halotolerans.

[0064] In one embodiment of the present invention, the strain of the genus Ligilactobacillus may be, but is not limited to, Ligilactobacillus murinus.

[0065] In one embodiment of the present invention, the Murimonas genus strain may be Murimonas intestini, but is not limited thereto.

[0066] In one embodiment of the present invention, the Faecalicatena genus strain may be, but is not limited to, Faecalicatena faecalis.

[0067] In one embodiment of the present invention, the Roseburia strain may be Roseburia inulinivorans, but is not limited thereto.

[0068] In one embodiment of the present invention, the improvement of the intestinal microflora may be, but is not limited to, improving the imbalance of the intestinal microflora.

[0069] In one embodiment of the present invention, the intestinal microbial flora imbalance may be caused by, but is not limited to, obesity.

[0070] In one embodiment of the present invention, the fermented cannabis seed may have increased anti-obesity activity, but is not limited thereto.

[0071] In one embodiment of the present invention, the fermented cannabis seed may have increased pancreatic lipase inhibitory activity, but is not limited thereto.

[0072] In one embodiment of the present invention, the fermented cannabis seed may have a shelf life extending property, but is not limited thereto.

[0073] In one embodiment of the present invention, the fermented cannabis seed may reduce fat accumulation and neutral fat, but is not limited thereto.

[0074] In one embodiment of the present invention, the fermented cannabis seed product may reduce serum triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and leptin levels, but is not limited thereto.

[0075] In one embodiment of the present invention, the fermented cannabis seed product may increase high-density lipoprotein cholesterol (HDL-C) and adiponectin levels, but is not limited thereto.

[0076] In one embodiment of the present invention, the fermented cannabis seed product may reduce fasting blood sugar and blood insulin concentrations, but is not limited thereto.

[0077] In one embodiment of the present invention, the fermented cannabis seed may reduce insulin resistance, but is not limited thereto.

[0078] In one embodiment of the present invention, the fermented cannabis seed may reduce the weight of adipose tissue and liver tissue, but is not limited thereto.

[0079] In one embodiment of the present invention, the fermented cannabis seed may have increased antioxidant activity, but is not limited thereto.

[0080] In one embodiment of the present invention, the fermented cannabis seed may have increased DPPH and ABTS radical scavenging activity, but is not limited thereto.

[0081] In one embodiment of the present invention, the fermented cannabis seed may have an increased total phenol content, but is not limited thereto.

[0082] In one embodiment of the present invention, the fermented cannabis seed may suppress ROS accumulation, but is not limited thereto.

[0083] In one embodiment of the present invention, the fermented cannabis seed may increase SOD (Superoxide Dismutase) activity, but is not limited thereto.

[0084] In one embodiment of the present invention, the fermented cannabis seed may increase CAT (Catalase) activity, but is not limited thereto.

[0085] In one embodiment of the present invention, the fermented cannabis seed may reduce the MDA (Malondialdehyde) level, but is not limited thereto.

[0086] In one embodiment of the present invention, the fermented cannabis seed may have increased anti-inflammatory activity, but is not limited thereto.

[0087] In one embodiment of the present invention, the fermented cannabis seed product may reduce inflammatory cytokine levels, but is not limited thereto.

[0088] In one embodiment of the present invention, the inflammatory cytokine may be, but is not limited to, TNF-α and IL-6.

[0089] In one embodiment of the present invention, the fermented cannabis seed may increase anti-inflammatory cytokine levels, but is not limited thereto.

[0090] In one embodiment of the present invention, the anti-inflammatory cytokine may be, but is not limited to, IL-10.

[0091] In one embodiment of the present invention, the fermented cannabis seed may regulate the expression of biomarkers related to cognition and memory, but is not limited thereto.

[0092] In one embodiment of the present invention, the biomarker related to cognition and memory may be at least one selected from the group consisting of behavioral tests such as the Novel Object Recognition test, the Y-maze test, and the Passive Avoidance test, but is not limited thereto.

[0093] In one embodiment of the present invention, the fermented cannabis seed product may regulate the activity of beta-secretase (BACE1), monoacylglycerol lipase (MAGL), and acetylcholine esterase (AChE), which are enzymes related to Alzheimer's disease, but are not limited thereto.

[0094] In one embodiment of the present invention, the fermented cannabis seed may have increased acetylcholinesterase (AChE) inhibitory activity, but is not limited thereto.

[0095] In one embodiment of the present invention, the fermented cannabis seed may improve visual recognition, avoidance learning, long-term memory, working memory, and spatial memory that are impaired due to obesity, but are not limited thereto.

[0096] In one embodiment of the present invention, the fermented cannabis seed may increase the content of metabolites reduced by obesity, but is not limited thereto.

[0097] In one embodiment of the present invention, the metabolites are N-Acetyl-1-aspartylglutamic acid, L-Phenylalanine, Trans-cinnamic acid, Myristyl sulfate, Hypoxanthine, Palmitelaidic acid, Stearic acid, Dibromodimethyl ether, 4-Bromo-1,1-dioxo-tetrahydrothiophen-3-one, Cyclopropane-1,1,2,2-tetracarboxylic acid, It may be at least one selected from the group consisting of, but is not limited to, 2,8-Dichlordibenzofuran, Perindoprilat, Terpendole E, and Auraptene.

[0098] In one embodiment of the present invention, the metabolite is derived from a fermented cannabis seed, and is detected in the blood through intestinal absorption when the fermented cannabis seed is orally administered, and is also confirmed in the brain tissue of a mouse model treated for two months, thereby proving its functional relevance to bioavailability and effects of improving obesity or enhancing cognitive function, but is not limited thereto.

[0099] In one embodiment of the present invention, obesity results in abnormalities in serum lipid profiles, increases in total body weight and related organ weights, elevated leptin levels, and decreased adiponectin levels, all of which induce insulin resistance. Insulin resistance inhibits the clearance of beta-amyloid from the central nervous system, leading to beta-amyloid toxicity and accelerating the development of Alzheimer's disease.

[0100] In one embodiment of the present invention, the cannabis seed fermentation may regulate, but is not limited to, the expression of genes associated with lifespan (Daf-16), fat synthesis (Fat-6 and Fat-7) and fat regulation (as confirmed in a C. elegans model, Trends in Endocrinology & Metabolism, 20(2), 58-65.), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2).

[0101] The term “Daf-16” used in the present invention refers to a gene found across species, including humans, mice, and C. elegans. It is located downstream of DAF-2, which sends signals in the IIS pathway, and plays a role in activating genes related to lifespan extension, adipogenesis, and oxidative stress response. In a study by Murphy et al., Daf-16 was confirmed to be involved in longevity by upregulating lifespan-related genes, such as stress response genes, and downregulating lifespan-shortening genes.

[0102] The terms “SOD-1” and “SOD-2” used in the present invention are one of human superoxide dismutases that destroy free superoxide radicals in the body, and are associated with apoptosis, familial amyotrophic lateral sclerosis, and Parkinson’s disease.

[0103] The terms “Fat-6” and “Fat-7” used in the present invention are one of the genes that promote fat synthesis in C. elegans (Watts, 2009), and also one of the genes involved in fat synthesis and fat regulation in Drosophila, and thus, it can be known that they are involved in fat synthesis and fat regulation in vivo (Trends in Endocrinology & Metabolism, 20(2), 58-65.).

[0104] The term “ACE-2” used in the present invention refers to angiotensin-converting enzyme-2, also called “ACEH,” which is a type 1 transmembrane protein homologous to angiotensin-converting enzyme, a type of metallocarboxypeptidase, and found in eukaryotes and bacteria. It plays an important role in the renin-angiotensin-aldosterone system (RAAS), which regulates body water and blood pressure.

[0105] One of the many ways to prevent or improve obesity is through lipase inhibition. Lipase is an enzyme involved in the digestion and absorption of fat, found in the pancreas, small intestine, and adipocytes. Inhibiting lipase activity reduces the rate of fat digestion and absorption, thereby reducing the amount of fat absorbed by the body, contributing to weight loss and obesity prevention. Indeed, the lipase inhibitor orlistat is approved by the Ministry of Food and Drug Safety as an obesity treatment. Orlistat inhibits pancreatic lipase activity, reducing the rate of fat digestion and absorption by approximately 30%. Clinical studies have shown that orlistat is effective in weight loss and obesity prevention.

[0106] The term "TPC (Total Polyphenol Content)" used in the present invention refers to the total polyphenol content. Polyphenols are natural compounds contained in plants that have antioxidant, anti-inflammatory, and anti-cancer effects, and include phenolic acids, flavonoids, stilbenes, and lignans. The polyphenols have the effect of inhibiting the activity of lipase, and when lipase activity is inhibited, the digestion and absorption rate of ingested fat decreases, thereby reducing the amount of fat absorbed into the body. Therefore, the TPC-rich fermented hemp seed of the present invention can help with weight loss and obesity prevention.

[0107] The food composition of the present invention can be formulated into various forms such as tablets, pills, granules, capsules, liquid preparations, and beverages and added to foods. There is no particular limitation on the type of food. Examples of foods to which the fermented cannabis seed product of the present invention can be added include drinks, meat, sausages, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, alcoholic beverages, vitamin complexes, dairy products, and dairy products, and includes all health foods and health functional foods in the conventional sense.

[0108] The health food and health functional food compositions containing the fermented hemp seed product according to the present invention can be added directly to foods or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of the fermented hemp seed product mixed can be appropriately determined depending on its intended use (prevention or improvement). Generally, the amount of the composition in the health food and health functional food can be added at 0.1 to 90 parts by weight of the total food weight. However, in the case of long-term intake for the purpose of maintaining or regulating health, the amount can be below the above range, and since there is no problem in terms of safety, the active ingredient can also be used in an amount above the above range.

[0109] The health food and health functional food composition of the present invention contains the fermented hemp seed of the present invention as an essential ingredient in the indicated proportions, and has no particular limitations on other ingredients, and may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. Examples of the aforementioned natural carbohydrates include conventional sugars such as monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; and polysaccharides, e.g., dextrin, cyclodextrin, etc.; and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the health functional food composition of the present invention.

[0110] In addition to the above, the health food and health functional food composition containing the fermented hemp seed of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the health food and health functional food composition of the present invention may contain fruit pulp for the production of natural fruit juice and fruit juice drinks and vegetable drinks.

[0111] These ingredients can be used independently or in combination. The proportions of these additives are not particularly critical, but are typically selected within the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the fermented hemp seed product of the present invention.

[0112] In one aspect, the present invention provides a health functional food composition for improving memory and cognitive ability, which comprises a fermented cannabis seed product as an active ingredient.

[0113] The term "health functional food" used in the present invention is the same as food for special health use (FoSHU), and refers to a food with high medical and healthcare effects that has been processed to efficiently exhibit a bioregulatory function in addition to providing nutrition. Here, "function" means regulating nutrients for the structure and function of the human body or obtaining a useful effect for health purposes such as physiological action. The health functional food of the present invention can be manufactured by a method commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. In addition, the formulation of the health functional food can be manufactured without limitation as long as it is a formulation recognized as a food. The health functional food of the present invention can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur with long-term administration of drugs because it uses food as a raw material, and is highly portable, so the health functional food of the present invention can be taken as a supplement to enhance the effect of improving memory and cognitive function.

[0114] The above health functional foods refer to foods that have a more active health maintenance or promotion effect than regular foods, while health supplement foods refer to foods intended for health supplementation. In some cases, the terms health functional foods, health foods, and health supplements are used interchangeably.

[0115] Specifically, the health functional food means a food product manufactured by adding the composition of the present invention to food materials such as beverages, teas, spices, gums, and confectionery, or by manufacturing it in the form of encapsulation, powder, suspension, etc., and which brings about a specific health effect when consumed, but unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs made from food as a raw material.

[0116] The above health functional food may additionally include a physiologically acceptable carrier. The type of carrier is not particularly limited, and any carrier commonly used in the relevant technical field may be used.

[0117] In addition, the health functional food may include additional ingredients commonly used in foods to improve odor, taste, appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and amino acids such as lysine, tryptophan, cysteine, and valine.

[0118] In addition, the above health functional food may contain food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), sterilizers (bleaching powder and high-purity bleaching powder, sodium hypochlorite, etc.), antioxidants (butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), coloring agents (tar color, etc.), coloring agents (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, D-potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (glucose), film agents, gum bases, foam suppressants, solvents, and improvers. The above additives can be selected according to the type of food and used in an appropriate amount.

[0119] As an example of the health functional food of the present invention, it can be used as a health beverage composition, and in this case, it can contain various flavoring agents or natural carbohydrates as additional ingredients like a regular beverage. The above-mentioned natural carbohydrates can be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; sugar alcohols such as xylitol, sorbitol and erythritol. The sweetener can be a natural sweetener such as thaumatin and stevia extract; a synthetic sweetener such as saccharin and aspartame, etc. The proportion of the natural carbohydrate can be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the health beverage composition of the present invention.

[0120] In addition to the above, the health beverage composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in combination. The proportion of these additives is not particularly important, but is typically selected within the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.

[0121] In one aspect, the present invention provides a pharmaceutical composition for preventing or treating obesity or cognitive dysfunction, comprising a fermented cannabis seed product as an active ingredient.

[0122] The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient, fermented cannabis seed. Any adjuvant known in the art may be used without limitation. However, for example, Freund's complete or incomplete adjuvant may be further included to enhance immunity.

[0123] The pharmaceutical composition according to the present invention can be prepared in a form in which the active ingredient is mixed with a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients, and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0124] The pharmaceutical composition of the present invention can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions, each according to a conventional method.

[0125] When formulated, it can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, and capsules, and such solid preparations can be prepared by mixing the active ingredient with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups, and in addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives can be included. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, Tween 61, cocoa butter, laurin, and glycerogelatin.

[0126] The pharmaceutical composition according to the present invention can be administered to a subject via various routes. All modes of administration are contemplated, including oral, intravenous, intramuscular, subcutaneous, and intraperitoneal injection.

[0127] The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, physical condition, etc. of the subject. It is obvious that the concentration of the active ingredient included in the pharmaceutical composition can be selected in various ways depending on the subject, and it is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 μg / ml. If the concentration is less than 0.01 μg / ml, pharmaceutical activity may not be observed, and if it exceeds 5,000 μg / ml, it may be toxic to the human body.

[0128] The above pharmaceutical composition can be formulated into various oral or parenteral dosage forms.

[0129] Oral dosage forms include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsions, syrups, and granules. These dosage forms may further contain, in addition to the active ingredient, diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine), lubricants (e.g., silica, talc, stearic acid and its magnesium or calcium salts, and / or polyethylene glycol). In addition, the tablets may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidine, and, if desired, disintegrants or effervescent mixtures such as starch, agar, alginic acid or its sodium salt, and / or absorbents, coloring agents, flavoring agents, and sweetening agents. The above formulation can be prepared by conventional mixing, granulating or coating methods.

[0130] In addition, representative parenteral administration formulations include injectable preparations, and solvents for injectable preparations include water, Ringer's solution, isotonic saline solution, or suspensions. Sterile fixed oils for the injectable preparations can be used as solvents or suspension media, and any non-irritating fixed oil, including mono- and di-glycerides, can be used for this purpose.

[0131] Additionally, the above injectable formulation may use a fatty acid such as oleic acid.

[0132] In one aspect, the present invention provides a method for producing a fermented hemp seed product, comprising the steps of: preparing a hemp seed extract; and inoculating the hemp seed extract with a strain or a culture thereof.

[0133] The extract according to the present invention can be obtained by extracting and separating from nature using extraction and separation methods known in the art, and the "extract" defined in the present invention is extracted from kelp using an appropriate solvent, and includes, for example, a crude extract, a polar solvent-soluble extract, or a non-polar solvent-soluble extract. Any pharmaceutically acceptable organic solvent may be used as a suitable solvent for extracting the extract from the above kelp, and water or an organic solvent may be used, and is not limited thereto, for example, purified water, alcohols having 1 to 4 carbon atoms including methanol, ethanol, propanol, isopropanol, butanol, etc., acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, cyclohexane, etc., may be used alone or in combination, and purified water is preferably used. As an extraction method, any one of a hot water extraction method, a cold immersion extraction method, a reflux cooling extraction method, a solvent extraction method, a steam distillation method, an ultrasonic extraction method, an elution method, a pressing method, etc. may be selected and used. Additionally, the desired extract may be subjected to additional conventional fractionation processes and purified using conventional purification methods.

[0134] There is no limitation on the method for preparing the extract of the present invention, and any known method can be used. For example, the extract included in the composition of the present invention can be prepared in a powder form by additional processes such as reduced pressure distillation and freeze drying or spray drying of the primary extract extracted by the above-mentioned hot water extraction or solvent extraction method. In addition, the primary extract can be further purified to obtain a fraction using various chromatography methods such as silica gel column chromatography, thin layer chromatography, high performance liquid chromatography, etc. Therefore, in the present invention, the extract is a concept that includes all extracts, fractions, and purified products obtained at each stage of extraction, fractionation, or purification, as well as their dilutions, concentrates, or dried products.

[0135] In one embodiment of the present invention, the strain may be, but is not limited to, Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP).

[0136] In one embodiment of the present invention, the fermentation may be performed at 30 to 47°C, preferably 35 to 40°C, more preferably 37°C, for 24 to 72 hours, preferably 36 to 60 hours, more preferably 48 hours, but is not limited thereto.

[0137] In one aspect, the present invention provides a method for increasing the content of metabolites in a fermented cannabis seed product, comprising the steps of: preparing a cannabis seed extract; and inoculating the cannabis seed extract with a strain or a culture thereof.

[0138] In one embodiment of the present invention, the metabolites in the fermented cannabis seed are 2,6-dimethoxybenzoic acid, phloretic acid, tetranoprostanedioic acid, dihydroxyoctadecanoate, hydroxycostic acid, methyl jasmonate, (2R, 4R, 6Z)-1,2,4-trihydroxynonadec-6-ene, tetrakis(oxiranylmethoxy)pentanol, hydroxylauric acid, and It may be at least one selected from the group consisting of (1-Acetoxy-2,4-dihydroxyheptadeca-16-ene), but is not limited thereto.

[0139] The term “extract” used in the present invention is a broad concept that includes a substance obtained by extracting a specific component from a natural product, regardless of the extraction method, solvent, or form of the extract, and can be obtained by a conventional extraction method in the art.

[0140] In one embodiment of the present invention, the “extraction method” may be, but is not limited to, hot water extraction, high temperature and pressure extraction, low temperature and pressure extraction, alcohol extraction, reflux extraction, ultrasonic extraction, or cooling extraction.

[0141] In one embodiment of the present invention, the “extract” may be a solvent using one or more of purified water, alcohols having 1 to 4 carbon atoms including methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, and cyclohexane, but is not limited thereto.

[0142] The food composition of the present invention may include a health functional food. The term "health functional food" as used herein refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients with useful functionality for the human body. Here, "functionality" means obtaining a beneficial effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological functions. The health functional food may be manufactured using methods commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art may be added. In addition, the formulation of the health functional food may be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention may be manufactured in various forms, and unlike general drugs, it has the advantage of not causing side effects that may occur with long-term administration of drugs using food as a raw material, and is highly portable, so the health functional food of the present invention can be consumed as a supplement to enhance the effects of improving obesity or cognitive ability.

[0143] In addition, there is no limitation on the type of health food in which the composition of the present invention can be used. In addition, a composition comprising the fermented hemp seed of the present invention as an active ingredient can be manufactured by mixing other appropriate auxiliary ingredients that can be included in health functional foods and known additives according to the selection of a person skilled in the art. Examples of foods to which the composition can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and the composition can be manufactured by adding the extract according to the present invention to juice, tea, jelly, and juice manufactured using the extract as a main ingredient.

[0144] In one aspect, the present invention provides a method for preventing or treating obesity or cognitive dysfunction, comprising administering the pharmaceutical composition to a subject.

[0145] The term "prevention" above refers to any action that reduces the frequency or severity of a pathological phenomenon. Prevention may be complete or partial. In this case, it may refer to a reduction in obesity or cognitive dysfunction symptoms within an individual compared to when the composition was not used.

[0146] The term "treatment" above refers to any clinical intervention intended to alter the natural processes of the target or cells to be treated, and may be performed during or to prevent the progression of a clinical pathological condition. The desired therapeutic effect may include preventing the occurrence or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the progression of the disease, alleviating or temporarily alleviating the disease state, or improving the prognosis.

[0147] The term "administration" in the present invention means introducing a given substance to an individual in an appropriate manner.

[0148] The term "subject" in the present invention means an animal that has developed or may develop obesity or cognitive dysfunction.

[0149] The pharmaceutical composition of the present invention can be administered in a therapeutically effective amount or a pharmaceutically effective amount.

[0150] In the present invention, the term "therapeutically effective amount" means the amount of a pharmaceutically acceptable salt of a composition effective in preventing or treating a target disease, and the therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as the administration method, the target site, the condition of the patient, etc. Therefore, the dosage for use in humans should be determined as an appropriate amount by taking both safety and efficacy into consideration. It is also possible to estimate the amount to be used in humans from the effective amount determined through animal testing. Such considerations in determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed.(2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed.(1990), Mack Publishing Co.

[0151] In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, and the effective dosage level can be determined based on factors including the patient's health condition, type and severity of the disease, activity of the drug, sensitivity to the drug, administration method, administration time, administration route and excretion rate, treatment period, drugs used in combination or simultaneously, and other factors well known in the medical field.

[0152] The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Considering all of the above factors, it is important to administer an amount that achieves maximum effect with the minimum amount possible without causing side effects, a determination readily available to those skilled in the art.

[0153] The composition of the present invention may be administered at a daily dose of 0.0001 to 100 mg / kg of body weight, more specifically 0.001 to 100 mg / kg of body weight, based on solid content. The above recommended dosage may be administered once a day or divided into several doses.

[0154] In the method for preventing or treating obesity or cognitive dysfunction of the present invention, the route and method of administration for administering the composition are not particularly limited, and any route and method of administration may be followed as long as the composition containing the composition can reach the target area. Specifically, the composition may be administered through various routes, such as oral or parenteral, and non-limiting examples of the routes of administration include oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, intranasal, or inhalation.

[0155] The present invention will be described in more detail below through the following examples. However, the following examples are intended only to concretize the content of the present invention and are not intended to limit the present invention.

[0156] <Example 1> Isolation, identification, and cultivation of strains

[0157] To isolate the strain from salted fish, serial dilution was performed in MRS liquid medium, then plated onto MRS solid medium, and cultured at 37℃ for 24 hours to isolate pure colonies. The obtained colonies were then selected, streaked onto MRS solid medium, and cultured at 37℃ for 24–48 hours, and the strain was identified as Pediococcus acidilacticis strain (see https: / www.ncbi.nlm.nih.gov / nuccore / PP346244).

[0158] Based on this, the above-mentioned isolated strain was deposited at the Korea Research Institute of Bioscience and Biotechnology (KCTC) Biological Resource Center under the accession number KCTC 15831BP.

[0159] Pediococcus acidilacticiOHSI1 (accession number: KCTC 15831BP) strain was inoculated into standard De Man, Rogosa, and Sharpe (MRS) medium and cultured at 37°C for 48 h. The culture medium was centrifuged to remove the MRS medium, and the remaining cell pellet was collected. The pellet was then washed once with phosphate-buffered saline (PBS) and then twice with double-distilled water for purification. The purified viable cell pellet was lyophilized for 3 days to produce the final viable cell powder. The produced viable cell powder was resuspended in PBS and used for animal administration when used in the experiment. All samples were stored at -20°C throughout the experiment.

[0160] <Example 2> Production of fermented hemp seeds

[0161] Dehulled cannabis (Cannabis Sativa L.) seeds of the Cheungsam variety were obtained from the Chuncheon open air market in Chuncheon, South Korea, and ground into powder. 300 g of cannabis seed powder was mixed with distilled water in a 1:3 (w / v) ratio and then autoclaved at 121°C for 20 min. 2 × 10 8Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP) strain was inoculated at a concentration of 1 CFU / mL and cultured for 48 hours at 37°C and 200 rpm. After fermentation, the hemp seeds were freeze-dried and stored at -20°C for use in subsequent experiments (Fig. 9(A)).

[0162] Whole hemp seed (WHS), fermented whole hemp seed (FWHS), dehulled hemp seed (DHS), and fermented dehulled hemp seed (FDHS) were weighed in 70% ethanol at a ratio of 1:20 (w / v). Each sample mixture was extracted using an orbital shaker at 40°C for 1 h and then centrifuged at 4000 xg for 10 min. The supernatant was collected in a transparent bottle covered with aluminum foil to protect from light, and the obtained residue was re-extracted twice under the same set of conditions. The final supernatants of each sample were combined and concentrated under vacuum at 40°C. The concentrated supernatant was lyophilized for 4 days. The freeze-dried sample containing the freeze-dried solid was stored at -20°C, and the extract obtained therefrom was reconstituted in 70% ethanol and used in the experiments of the present invention.

[0163] However, for the analysis related to C. elegans in Example 5, the extract was dissolved in 1% dimethyl sulfoxide (DMSO) and used in the experiment.

[0164] <Experimental Example 1> Confirmation of cytotoxicity

[0165] To confirm the cytotoxicity of the above Example 2, the viability of HepG2 cells was measured calorimetrically using the MTT assay (Mosmann, 1983).

[0166] Specifically, cells were seeded at 4×10 in 96-well plates. 4 After culturing cells / well for 24 h, they were washed with PBS and treated with various concentrations of cannabis extract (50–400 μg / ml). The cells were then washed and incubated with 500 μg / ml MTT for 1 h, and the formazan crystals were dissolved in 200 μl / well DMSO. Absorbance was measured using a calorimeter at 570 nm.

[0167] As a result, as shown in Fig. 1, it was confirmed that whole hemp (WHS), dehulled hemp (DHS, hereinafter “dehulled hemp seed fermentation”), and fermented whole hemp (FWHS, hereinafter “hemp seed fermentation”) did not have cytotoxicity.

[0168] <Experimental Example 2> Confirmation of the effects of fermented cannabis seeds on improving obesity and cognitive function (in vitro)

[0169] 2-1. Pancreatic lipase inhibition assay

[0170] To confirm the anti-obesity effect of the fermented cannabis seed of Example 2, the pancreatic lipase inhibitory activity was analyzed using the cultured sample fermented cannabis seed (50-400 μg / mL) and 50 μL (50 U / mL) of lipase enzyme in methyl cellosolve.

[0171] Specifically, 100 μL of 1 mM 4-methylumbelliferone (4-MU) dissolved in methyl cellosolve was added and incubated at room temperature for 30 minutes, after which the reaction was stopped by adding 100 μL of 0.1 M, pH 4.2 sodium citrate solution. A test blank was performed for all samples using Orlistat as a positive control.

[0172] The lipase inhibitory activity of the sample was expressed as a percentage according to the following formula:

[0173] Lipase Inhibition(%)=[1-((Ftest-Ftest blank) / (Fcontrol-Fcontrol blank))]×100

[0174] (Ftest: fluorescence value of plant extract or orlistat (standard) using substrate 4-MU oleate; Ftest blank: fluorescence value of extract or orlistat standard without substrate 4-MU oleate; Fcontrol: fluorescence value of control using substrate 4-MU oleate; Fcontrol blannk: fluorescence value of control without substrate 4-MU oleate).

[0175] As a result, as shown in Fig. 2(A), it was confirmed that the lipase inhibitory activity increased as the concentration of the fermented hemp seeds increased (50-400 μg / mL), and at a concentration of 400 μg / mL, the fermented hemp seeds (FWHS) had the highest lipase inhibitory activity (83.34%), and the fermented hemp seeds with hulls (FDHS) had the next highest lipase inhibitory activity (69.6%). In the case of the unfermented hemp seeds (DHS), the lipase inhibitory activity was confirmed to be low.

[0176] Through this, it was confirmed that the fermented cannabis seed product has an anti-obesity effect through inhibition of pancreatic lipase.

[0177] 2-2. Confirmation of acetylcholinesterase (AChE) inhibitory activity

[0178] To confirm the cognitive function improvement effect of the fermented cannabis seed of Example 2, acetylcholinesterase (AChE) inhibitory activity was analyzed.

[0179] Specifically, 100 μL of plant extract was mixed with 150 μL of AChE solution (0.04 units), and the mixture was supplemented with 0.1 M pH 8.0 sodium phosphate buffer to make a final reaction volume of 800 μL, and the mixture was incubated at room temperature for 15 minutes. After incubation, 600 μL of 0.5 mM 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB) was added, and 200 μL of acetyl thiocholine iodide (0.71 mM) was added to initiate the reaction. After an incubation period of 30 minutes, the absorbance of the reaction was measured at 412 nm using a spectrum plate reader, and the inhibitory activity of AChE was expressed as a percentage. At this time, galantamine was used as a drug control.

[0180] As a result, as shown in Fig. 2(B), it was confirmed that AChE was inhibited in a dose-dependent manner by the fermented cannabis seed. Specifically, at a dose of 400 μg / mL, the FWHS extract (78.94%) showed the most significant AChE inhibition ability, followed by FDHS (65.34%). Regardless of concentration, DHS showed the weakest inhibition ability, followed by WHS at the same concentration.

[0181] Through this, it was confirmed that the fermented cannabis seed product has an effect of improving cognitive function through inhibition of acetylcholinesterase (AChE).

[0182] 2-3. Check radical scavenging ability

[0183] To confirm the antioxidant effect of the fermented hemp seed of Example 2, the radical scavenging ability was measured using DPPH and ABTS analysis.

[0184] Specifically, 100 μL of sample or Trolox (standard) was mixed with 1 mL of DPPH solution and reacted for 30 minutes in a darkroom at room temperature, and then the absorbance was measured at 517 nm to measure the DPPH radical scavenging activity. Meanwhile, to generate ABTS radicals, 5 mL of 2.45 mM potassium persulfate and 5 mL of 7 mM ABTS solution were mixed and reacted for 16 hours in a darkroom. Then, to prepare the ABTS working solution, 2 mL of ABTS radical was mixed with 200 mL of 70% ethanol and the absorbance at 734 nm was adjusted to 0.70. 1 mL of ABTS working solution was mixed with 100 μL of samples or standards of different concentrations and reacted for 30 minutes at room temperature, and then the absorbance was measured at 734 nm. Ascorbic acid was used as a drug control, and the percentage of DPPH and ABTS inhibition abilities was calculated according to the formula below.

[0185] Inhibition (%) =((OD control-OD test sample) / (OD control))× 100

[0186] In the above formula, OD control is the absorbance for the control blank (negative control), OD test sample is the absorbance for the tested extract, and the result is expressed as IC 50.

[0187] As a result, as shown in Fig. 3, the fermented hemp seed extract had higher free radical (DPPH and ABTS) inhibition ability than the unfermented hemp seed extract.

[0188] Through this, it was confirmed that fermented hemp seeds have an antioxidant effect.

[0189] 2-4. Measurement of total phenol content

[0190] To confirm the antioxidant effect of the fermented hemp seed of Example 2, the total phenol content was measured.

[0191] Specifically, the total phenol content (TPC) of the extract (1 mg / mL) of Example 2 was analyzed based on the Folin-Ciocalteu standard. 200 μL of 10% Folin-Ciocalteu reagent was added to 100 μL of the test sample, the mixture was vortexed, and incubated at room temperature for 2 hours. Then, 800 μL of 700 mM sodium carbonate was added to the reaction mixture, and the absorbance was measured at 765 nm using a SpectraMax i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea). The total phenol content (TPC) was calculated from a standard garlic standard curve.

[0192] As a result, as shown in Fig. 4, it was confirmed that the polyphenol content increased in all samples treated with the fermented hemp seed extract. TPC was highest in FWHS (45.71 ± 0.67 mg / g GAE), and lowest in DHS (16.58 ± 0.59 mg / g GAE).

[0193] All of the above phenolic compounds are known to be powerful antioxidants and anti-obesity agents, and it has been confirmed that chronic diseases including cardiovascular disease, type 2 diabetes, obesity, oxidative stress, and stress-related disorders can be prevented through consumption of the fermented hemp seed product of the present invention.

[0194] 2-5. Identification of metabolites in fermented hemp seeds

[0195] Freeze-dried hemp seed samples were diluted in 70% ethanol and subjected to UHPLC-Q-TOF-MS / MS2 analysis. Briefly, 10 g of powdered sample was mixed with 200 mL of 70% ethanol and extracted at 40°C for 1 h. The mixture was centrifuged at 4,000 × g for 10 min, and the supernatant was collected. This extraction was repeated twice using the residue, and the supernatant was collected and concentrated in vacuum at 40°C. The concentrate was lyophilized for 4 days, stored at -20°C, and diluted in 70% ethanol before use in the experiment. The analytical column used was an Acquity UPLC BEH C18 column (150 × 2.1 mm, 1.7 μm) (Waters Co., USA). 2 μL of sample extract was injected into the system using an autosampler and eluted from the column using a binary mobile phase consisting of 0.1% formic acid in water (A) and 0.1% formic acid in acetonitrile according to the following gradient: 10–90% B (0–14 min).

[0196] The system was operated at a flow rate of 0.4 mL / min, and MS / MS data were acquired from a collision energy ramp of 15 to 45 eV in MSE mode in the negative ion mode in continuum format with a mass range of m / z 100 to 1600.

[0197] ESI parameters were set as shown in Table 1 below, and data were measured using MassLynx V4.1 (Waters Corp.). Polyphenol compounds were identified using an in-house phytochemical library (UNIFI 1.8, Waters Corp.).

[0198] Parameter ValueCapillary voltage2.5 kVCone voltage45 VSource temperature120 ℃Desolvation temperature350 ℃Cone gas flow50 L / hDesolvation gas flow800 L / h

[0199] As a result, as shown in Fig. 5, the heat map of phenolic compounds identified by UHPLC-ESI-QTOF-MS in the fermented hemp seed of Example 2 confirmed that the content of phenolic compounds such as 2,6-dimethoxybenzoic acid and phloretic acid generally increased.

[0200] <Experimental Example 3> Confirmation of the effects of fermented cannabis seeds on obesity and cognitive function improvement using the Caenorhabditis elegans model (in vivo).

[0201] 3-1. C. elegans model design

[0202] Caenorhabditis elegans were cultured on Nematode Growth Media (NGM) plates at 20°C, containing their prey, Escherichia coli OP50. The cultured C. elegans were cultured in NGM with OP50 containing 5-fluorodeoxyuridine (FudR, 140 mM) and various treatments. To establish a hyperglycemic state, the C. elegans were treated with OP50 mixed with 2% w / v D(+)-glucose to accumulate fat in the intestine. Each experiment was repeated three times.

[0203] 3-2. Lifespan analysis by fermented hemp seed diet

[0204] The lifespan of C. elegans fed with the fermented cannabis seed of Example 2 at 400 μg / mL was measured.

[0205] Specifically, each plate containing approximately 50 C. elegans was treated with a mixture of 2% glucose, E. coli OP50, and either hemp seed ferment or a drug control. The positive control (PC) consisted of C. elegans treated with 1% DMSO mixed with 2% glucose and E. coli OP50, while the other C. elegans were fed only E. coli OP50. C. elegans were then monitored and counted daily, and classified as alive or dead until all obese model C. elegans died, and dead worms were scored when they did not respond to the touch of a platinum wire.

[0206] As a result, as shown in Figure 6D, the lifespan of the fermented hemp seed (FWHS) treatment group was the longest, while the lifespan of the hemp extract (DHS) treatment group was the shortest.

[0207] Through this, it was confirmed that fermented hemp seeds have a life-extending effect.

[0208] 3-3. Measurement of fat accumulation and neutral fat reduction by fermented hemp seed diet

[0209] To confirm the obesity-improving effect of the fermented cannabis seed of Example 2, fat accumulation and neutral fat reduction were analyzed.

[0210] Specifically, to confirm fat accumulation, the fat-reducing effect of the extract of the present invention was measured through Oil red and Nile red staining. In Example 5.1, the fat-accumulating C. elegans were treated with OP50 mixed with 2% glucose and 100 μg / mL, 1 mg / mL of the extract of the present invention, or 100 μg / mL orlistat as a positive control, and then 30 adult worms were collected, mixed with oil or Nile red staining, transferred to a 2% sodium azide (NaN3) droplet on a 2% agarose pad, and observed under a microscope (IX-83 ZDC, Olympus). Fat deposition by Oil red was observed under a light microscope, and C. elegans stained with Nile red were observed under a fluorescence microscope, and the Oil and Nile Red intensities were quantified using ImageJ software ( / imagej.net / ).

[0211] Additionally, for triglyceride quantitative analysis, triglyceride (TG) was measured using a quantitative kit (BIOMAX, Seoul, Korea). TG analysis was performed according to the kit manufacturer's instructions. Briefly, C. elegans cells were homogenized with 1 mL of 0.5% Tween 20 solution, heated at 80–100°C for 1 h, and then cooled to room temperature. The supernatant obtained after 2 min of centrifugation was diluted 2-fold. Thirty μL was dispensed into a 96-well plate and made up to 50 μL with the kit buffer. Two μL of lipase was added to each well, mixed, and incubated at room temperature for 20 min. After mixing, 50 μL of the reaction mix was added and incubated for an additional 30 min in the dark at room temperature. The absorbance was then measured at 570 nm.

[0212] As shown in Figure 6A, the results of the fat accumulation analysis confirmed that all groups treated with fermented hemp seeds exhibited a higher fat accumulation inhibition effect compared to the positive control group. The fermented hemp seed extract (FWHS) showed the greatest reduction in fluorescence intensity, demonstrating the greatest anti-adipogenic effect, followed by FDHS.

[0213] Furthermore, as shown in Figure 6B, the triglyceride quantitative analysis results confirmed that all groups treated with fermented hemp seeds exhibited a fat-reducing effect. Specifically, the fermented hemp seed treatment group showed the greatest reduction in triglyceride levels, followed by FDHS.

[0214] Through this, it was confirmed that the fermented hemp seed product has the effect of inhibiting fat accumulation and reducing neutral fat.

[0215] 3-4. Confirmation of acetylcholinesterase (AChE) inhibitory activity

[0216] To confirm the cognitive function improvement effect of the fermented cannabis seed of Example 2, acetylcholinesterase (AChE) inhibitory activity was analyzed.

[0217] Specifically, AChE inhibitory activity was measured in L4 stage C. elegans using a colorimetric method. After exposure to the extract of the present invention for 7 days, approximately 5,000 C. elegans were washed three times with M9 buffer and then transferred to a microcentrifuge tube. The samples were frozen and thawed three times in liquid nitrogen, sonicated, and the C. elegans were centrifuged at 15,000 rpm for 10 minutes, and the supernatant was collected. An aliquot (150 μL) of the supernatant was mixed with a solution containing 5,5'-dithiobis-2-nitrobenzoic acid (also known as DTNB (0.25 mM)) and acetylthiocholine iodide (ASChI, 156 mM), and incubated at 30°C for 5 minutes. Absorbance was measured at 405 nm using a Spectra Max i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea), and AChE activity was expressed as a percentage of the positive control.

[0218] As a result, as shown in Figure 6C, fermented cannabis seed (FWHS) had the strongest inhibitory effect on AChE activity compared to the other experimental groups. Compared to the PC group, the FWHS treatment group showed a 37% decrease in AChE activity, while the FDHS and WHS treatment groups showed inhibitory effects of 28% and 18%, respectively.

[0219] Through this, it was confirmed that the fermented cannabis seed product has an effect of improving cognitive function through inhibition of acetylcholinesterase (AChE).

[0220] 3-5. Confirmation of ROS in C. elegans cells

[0221] To confirm the changes in ROS in vivo according to the fermented cannabis seed diet, visualization and quantification of ROS were performed.

[0222] Specifically, for visualization of intracellular ROS in C. elegans, C. elegans from Example 2 were placed in separate NGM / FUDR until they reached L4. They were grouped and supplemented with E. coli OP50 and 2% glucose to induce obesity and oxidative stress. After 3 days, all plates, except the positive control group, which used 1% DMSO instead of the extract of the present invention, were treated with three types of hemp seed extracts / Trolox (400 μg / mL) of fermented cannabis seed (FWHS), FDHS, and DHS for 7 days. Afterwards, C. elegans were washed with M9 buffer and centrifuged. For qualitative ROS analysis, approximately 30 C. C. elegans were incubated with 50 μM 2',7'-dichlorofluorescein diacetate (DCFDA) for 1 h at 20°C in the dark. The worms were then paralyzed with 10 mM sodium azide, mounted on microscope glass slides, and photographed randomly (30 / group) using a BIOREVO BZ-9000 fluorescence microscope (Keyence Deutschland GmbH, Neu-Isenburg, Germany). Relative fluorescence of the whole body of C. elegans was measured using ImageJ software (National Institutes of Health, Bethesda, MD), and the average fluorescence intensity was expressed.

[0223] As a result, as shown in Figure 7C, the lowest ROS accumulation was observed in the fermented cannabis seed treatment group. The highest accumulation was observed in the PC group, followed by the DHS group.

[0224] Additionally, for the quantification of intracellular ROS in C. elegans, ROS levels were expressed as a percentage of the positive control for quantitative intracellular antioxidant assays. After 7 days of treatment as described above, C. elegans were harvested in 100 μl of phosphate-buffered saline (PBS) containing 1% Tween-20 (PBST). Then, C. elegans were sonicated (Branson Sonifier 250, VWR Scientific, Suwanee, GA) and pipetted into wells of a 96-well plate containing DCF-DA (final concentration 50 μM in PBS). Sample fluorescence was read using a pectraMax i3 plate reader (Molecular Devices Korea, LLC, Seoul, Korea) at 37°C, with excitation at 485 nm and emission at 530 nm.

[0225] As a result, as shown in Figure 7D, ROS levels were confirmed to be reduced in all C. elegans cells treated with cannabis extract compared to the PC group. Among them, the fermented cannabis seed (FWHS) group showed the greatest reduction in ROS (68%), followed by the FDHS group (78%). In contrast, the same concentration of DHS had the lowest effect on ROS levels.

[0226] Through this, it was confirmed that fermented cannabis seed product (FWHS) was most effective in inhibiting ROS accumulation in C. elegans.

[0227] 3-6. Confirming gene expression regulation

[0228] To confirm the regulation of gene expression by the hemp seed fermentation, RNA from C. elegans was extracted using TRIzol® (Thermo Fisher Scientific, Inc., Middletown, VA), and the yield of cDNA templates was measured using a High-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Inc., Middletown, VA) and a thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA). RNA purity was then measured using the 260 / 280 absorbance ratio, and specific primers for specific genes were analyzed as shown in Table 2 (Caenorhabditis elegans primers for detection of gene expression).

[0229] Specifically, gene expression was measured using the StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA) and TaqMan® gene probes (Thermo Fisher Scientific, Inc., Middletown, VA). 10 μL of MeltDoctor™ HRM MasterMix, 2 μL of genomic DNA (10 ng / μL), 0.5 μL of each primer (10 pg / μL), and 7 μL of double-distilled water were mixed, and the relative expression of the genes was measured.

[0230] Gene nameForward primerReverse primerDaf-16CCAGACGGAAGGCTTAAACTATTCGCATGAAACGAGAATGsod-1ACGCTCGTCACGCTTTACTCTTCTGCCTTGTCTCCGsod-2GGCATCAACTGTCGCTGTACAAGTCCAGTTGTTGCCFa t-6CAACTTCCATCACACATTCCCTCCTCGTTGAATATCACATCCFat-7TTTCCACCACACATTCCCACTCTTCACTTCCGTGATTGGCAce-2CAATAATCAACTCATGGGCATCATTTTCGCGAGACGAAACGA

[0231] As a result, as shown in Fig. 8, it was confirmed that the fermented cannabis seeds regulate the expression of genes related to lifespan (Daf-16), fat synthesis (Fat-6 and Fat-7), oxidative stress inhibition (Sod-1 and Sod-2), and acetylcholinesterase expression (ACE-2).

[0232] Specifically, the expression of SOD-1 and SOD-2 genes related to suppression of oxidative stress was up-regulated, and among them, a remarkable effect was confirmed in the fermented cannabis seed (FWHS) treatment group, confirming that the extract of the present invention can suppress ROS accumulation by regulating the expression of pro-ROS related genes. In addition, the extract FWHS and FDHS up-regulated the mRNA expression daf-16, confirming that the lifespan of C. elegans treated with HWHS was improved through this. In addition, with regard to fat metabolism, it was confirmed that the expression of Fat-6 and Fat-7 genes involved in fat synthesis was reduced according to the administration of the extract of the present invention, confirming that the fermented cannabis seed of the present invention can suppress fat accumulation in vivo by regulating fat synthesis genes. Finally, both hemp seed fermentation and hulled hemp seed fermentation (FWHS and FDHS) significantly downregulated the ACE-2 gene, which is involved in enhancing AChE levels, upon administration, confirming that these fermentations significantly affect anti-AChE activity.

[0233] Through this, it was confirmed that the fermented cannabis seed product has an effect of improving obesity and cognitive function by regulating the expression of genes related to obesity and cognitive function.

[0234] <Experimental Example 4> Confirmation of the effects of fermented cannabis seeds on improving obesity and cognitive function through an animal model (in vivo).

[0235] 4-1. Animal model design

[0236] The animal experiments of the present invention were approved by the Institutional Animal Care and Use Committee (IACUC) of Kangwon National University (Approval No.: KW-230718 1), and the experiments were conducted in compliance with the UK (EU / US) animal research guidelines (ARRIVE guidelines).

[0237] Fifty-nine 9-week-old male C57BL / 6 mice were purchased from Nara Biotechnology (Seoul, Republic of Korea) and housed in a controlled laboratory environment (temperature 22±2°C, humidity 55±5%) with free access to food and water under a 12-h day / night alternating light / dark cycle. After a 1-week acclimatization period, the 59 mice were randomly divided into a normal control group (NC, 8 mice) and a high-fat diet group (HFD, 51 mice). The normal control group received a standard diet providing 10% of calories from fat, and the HFD group received a high-fat diet (D12492) providing 60% of calories from fat. From the 3rd week, the HFD group was further divided into seven subgroups (see Table 3). The high-fat diet (HFD) group continued to consume a high-fat diet and received oral saline solution (PBS) once daily for 12 weeks. The remaining subgroups received the following supplements orally daily along with the high-fat diet:

[0238] Experimental group Diet type NC Normal control group (general diet) HFD High-fat diet HFD + OR High-fat diet + 100 mg / kg BW Oral administration of Orlistat HFD + RHS High-fat diet + 400 mg / kg BW Raw hemp seed Oral administration HFD + FHS-L High-fat diet + low-concentration (100 mg / kg BW) fermented hemp seed Oral administration HFD + FHS-M High-fat diet + medium-concentration (200 mg / kg BW) fermented hemp seed Oral administration HFD + FHS-H High-fat diet + high-concentration (400 mg / kg BW) fermented hemp seed Oral administration HFD + PA High-fat diet + 100 mg / kg BW Pediococcus acidilactici Oral administration

[0239] Body weight and food intake were measured weekly during the experimental period, and memory impairment assessment tests were conducted at weeks 14 and 15. Stool samples were collected at the end of week 15 and on the final day of the experiment and stored at -80°C for intestinal microbiota analysis.

[0240] After the experiment, mice were fasted for 6 hours and sacrificed using diethyl ether. Blood was collected and centrifuged at 3,000 rpm for 10 minutes to separate serum. The separated serum, brain, liver, and adipose tissue were stored at -80°C for further analysis (Fig. 9(B)).

[0241] 4-2. Confirmation of feed intake, feed conversion rate, and body weight changes in experimental animals

[0242] Changes in feed intake, feed conversion ratio, and body weight according to treatment with fermented hemp seeds were confirmed.

[0243] As shown in Fig. 9(C), the results of measuring feed intake showed that an intake suppression effect was observed in all supplementation groups, and in particular, at the end of the experiment, the Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP) treatment group (HFD+PA) and the medium- and high-dose fermented cannabis seed treatment groups (HFD+FHS-M, HFD+FHS-H) showed the strongest intake suppression effect.

[0244] In addition, as shown in Fig. 9(D), the feed conversion ratio (FCR) was measured, and the normal control group (NC) showed the lowest FCR of 0.069, followed by the HFD+FHS-H group (0.20). On the other hand, the HFD group showed the highest FCR of 1.26.

[0245] Lastly, as shown in Figure 9(E), the results of measuring body weight changes showed that the HFD+PA group showed the greatest decrease in body weight with a 14.90% decrease compared to the HFD group, followed by HFD+FHS-H (7.95%), HFD+OR (7.59%), HFD+FHS-M (6.28%), HFD+FHS-L (5.98%), and HFD+RHS (5.89%).

[0246] Through this, it was confirmed that all fermented hemp seed treatment groups suppressed body weight gain more effectively than the raw hemp seed (RHS) treatment group.

[0247] 4-3. Confirmation of the effect of improving obesity in experimental animals

[0248] To confirm the obesity-improving effect of treatment with fermented hemp seeds, serum triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), adiponectin, leptin, fasting blood sugar levels, blood insulin concentration, and insulin resistance were measured, and fat tissue weight and liver weight were measured.

[0249] Specifically, serum triglyceride (TG) (kit lot, BMJA1722), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) (kit lot BMJL2018) levels were analyzed using commercial kits purchased from Biomax (Seoul, South Korea). Serum adiponectin (kit lot, 2101040076) and leptin (kit lot, 2101039538) concentrations were measured using commercial kits purchased from Abcam (USA). Additionally, fasting blood glucose (FBG) levels were measured using a BeneCheck blood glucose meter using blood collected from the tail vein of mice after a 6-hour fast, and blood insulin concentrations were measured using a kit purchased from Abcam (AB277390, lot number 1062872-1). HOMA-IR (Homeostatic Model Assessment for Insulin Resistance), a measure of insulin resistance, was calculated using the following equation:

[0250] HOMA-IR = [fasting blood glucose (mmol / L) × fasting serum insulin (mlU / L)] / 22.5 (Ren et al., 2021)

[0251] At the end of the 15th week, the liver and epididymal fat of the mice were removed, washed with 1% saline, and weighed after removing moisture with filter paper. The weight was then measured, and the liver index and body fat percentage were used to evaluate the liver index and body fat percentage. For histopathological observation of the liver and adipose tissue, the liver and adipose tissue were sectioned at 5 μm thickness, fixed in 10% formalin, and stained with hematoxylin-eosin (H&E). The stained samples were photographed at 400x magnification using an Olympus CX43RF microscope (Olympus Corporation, Japan).

[0252] As a result, as shown in Figs. 10(A) to (D), serum triglyceride (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) increased, and high-density lipoprotein cholesterol (HDL-C) decreased according to high-fat diet intake. In the groups treated with fermented cannabis seeds or lactic acid bacteria (Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP)), TG, TC, and LDL-C levels significantly decreased, and HDL-C levels increased. Specifically, the triglyceride (TG) level decreased depending on the concentration of fermented cannabis seeds, and the HFD+FHS-H group showed the greatest decrease at 1.63 μg / mL compared to the HFD group (2.76 μg / mL). In particular, the HFD+PA group showed the strongest reduction effect with a TG level of 1.30 μg / mL (Fig. 10(A)). The total cholesterol (TC) level did not differ significantly between HFD+FHS-M (3.32 μg / mL) and HFD+FHS-H (3.42 μg / mL), but both were significantly lower than the HFD group (5.64 μg / mL) (Fig. 10(B)). The low-density lipoprotein cholesterol (LDL-C) level did not differ significantly between the HFD+RHS group (0.55 μg / mL) and the HFD group (0.53 μg / mL), but a significant reduction was observed in the HFD+OR (0.31 μg / mL), HFD+FHS-H (0.24 μg / mL), and HFD+PA (0.20 μg / mL) groups (Fig. 10(C)). High-density lipoprotein cholesterol (HDL-C) levels were NC (0.33 μg / mL), HFD (0.162 μg / mL), HFD+OR (0.28 μg / mL), HFD+RHS (0.54 μg / mL), HFD+FHS-L (0.36 μg / mL), HFD+FHS-M (1.17 μg / mL), and HFD+PA (0.44 μg / mL) (Fig. 10(D)).

[0253] In addition, as shown in Fig. 10(E) and (F), the results of measuring the concentrations of adiponectin and leptin in the serum showed that leptin levels increased and adiponectin levels decreased in accordance with the increase in body fat accumulation due to a high-fat diet. This imbalance of leptin and adiponectin can cause chronic systemic inflammation. Specifically, the adiponectin level in the HFD group (245.56 pg / mL) was significantly reduced compared to the NC group (508.88 pg / mL). On the other hand, the OR, FHS-L, FHS-M, FHS-H, and PA treatment groups recovered the adiponectin levels, and in particular, the HFD+FHS-H group (360.7 pg / mL) showed the strongest improvement effect (Fig. 10(E)). On the other hand, leptin levels significantly increased from the NC group (34.33 pg / mL) to the HFD group (1011.25 pg / mL), but FHS-M and FHS-H treatments significantly reduced leptin levels to 45.33 pg / mL and 36.41 pg / mL, respectively (Fig. 10(F)).

[0254] As shown in Figs. 10(G)-(I), fasting blood glucose (FBG) significantly increased in the HFD group (23.48 mmol / L) compared to the NC group (13.98 mmol / L) in mice fed a high-fat diet. Accordingly, the blood insulin concentration also increased in the HFD group (31.84 μIU / mL) compared to the NC group (25.58 μIU / mL), which was related to increased insulin resistance. In addition, the HOMA-IR value in the HFD group significantly increased to 32.71. On the other hand, fasting blood glucose levels decreased in all treatment groups, and the decrease was most pronounced in the HFD+FHS-H (13.31 mmol / L) and HFD+PA (13.6 mmol / L) groups (Fig. 10(G)). This decrease in FBG was also associated with a decrease in HOMA-IR, and the HFD+FHS-H group showed the lowest HOMA-IR at 15.35. However, there was no significant difference in HOMA-IR values ​​between the NC (17.09), HFD+OR (18.46), HFD+FHS-M (17.20), HFD+PA (17.41) groups and the HFD+FHS-H group (Fig. 10(I)).

[0255] Finally, as shown in Figs. 10(J)~(O), the weights of epididymal fat and liver tissues were measured and used as indicators of body fat content. As a result, the weights of epididymal fat and liver were significantly reduced in all other treatment groups compared to the HFD and HFD+RHS groups (Figs. 10(K), (M)). In addition, H&E staining of adipose tissue and liver tissues was performed to evaluate lipid accumulation. The size of epididymal fat cells in the treatment groups was significantly smaller than in the HFD group, and the HFD+FHS-H group showed the strongest effect (Fig. 10(N)). In addition, FHS-H treatment significantly reduced HFD-induced liver fat accumulation (Fig. 10(O)).

[0256] Through this, the effect of improving obesity through treatment with fermented hemp seeds was confirmed.

[0257] 4-3. Confirmation of cognitive function improvement effect - Novel Object Recognition Test

[0258] To confirm the cognitive function improvement effect of fermented hemp seeds, the Novel Object Recognition Test was performed.

[0259] Specifically, the Novel Object Recognition Test consists of three phases: habituation, training, and testing. In the habituation phase, mice were exposed to the experimental apparatus without objects for 5 minutes per day for 2 days to acclimate. Twenty-four hours later, in the training phase, two identical objects were placed in the apparatus, and the mice were allowed to freely explore the apparatus for 5 minutes. Another 24 hours later, in the testing phase, one of the identical objects was replaced with a novel object, and the mice were allowed to explore for 5 minutes. Exploratory behavior was defined as the mouse approaching the object with its nose within 2 cm or directly touching it, excluding the time spent leaning against or resting on the object. Exploration times for the familiar object (Tfamiliar) and the novel object (Tnovel) were recorded, and the discrimination index was calculated according to the following formula:

[0260] Discrimination ratio (%) = ((Tnovel - Tfamiliar) / total search time) × 100

[0261] As a result, as shown in Figures 11(A) and (B), mice fed a high-fat diet (HFD group) showed no preference between familiar and novel objects (Figure 11(A)), and the discrimination ratio was close to 0 (Figure 11(B)). This suggests that cognitive function was impaired. On the other hand, the group treated with FHS-H or PA (Pediococcus acidilacticiOHSI1 (Accession Number: KCTC 15831BP)) along with a high-fat diet tended to explore the novel object more than the familiar object.

[0262] Through this, it was confirmed that treatment with fermented hemp seeds had an effect of improving cognitive function by improving visual recognition memory that was reduced due to a high-fat diet.

[0263] 4-4. Confirmation of improved cognitive function - Y-Maze Test

[0264] To confirm the cognitive function improvement effect of fermented hemp seeds, the Y-Maze Test was performed.

[0265] Specifically, the Y-Maze Test was performed according to the method of Bae et al., 2020, to evaluate the working memory of mice. This test was conducted using a Y-shaped maze (each arm 40 cm long, 3 cm wide, 12 cm high, and 120° angle) made of dark opaque polyvinyl material. Mice were placed in the center of the maze, and the order and number of entries into each arm were manually recorded during the 8-min movement. When three different arms were visited consecutively (e.g., ABC, CAB, BCA, etc., excluding repeated visits to the same arm, such as BAB), it was considered "spontaneous alternation" and short-term memory ability was assessed. The spontaneous alternation rate (%) was calculated using the following formula:

[0266] Spontaneous Alternation (%) = (Actual Alternations / (Total Arm Entry - 2)) × 100

[0267] Additionally, the total number of arm entries was measured to assess the locomotor activity of the mice.

[0268] As a result, as shown in Figure 11(C), the HFD group showed a lower spontaneous alternation rate than the NC group, suggesting working memory impairment. In contrast, all cannabis seed-treated groups showed a significant improvement in spontaneous alternation rate, indicating that the working memory impairment caused by the high-fat diet was recovered.

[0269] Through this, it was confirmed that treatment with fermented hemp seeds had an effect of improving cognitive function by improving working memory and spatial memory that were reduced due to a high-fat diet.

[0270] 4-5. Confirmation of improved cognitive function - Passive Avoidance Test

[0271] To confirm the cognitive function improvement effect of fermented hemp seeds, the Passive Avoidance Test was performed.

[0272] Specifically, the acquisition and retention ability of the Passive Avoidance Test was assessed by testing two identically sized (20 × 20 × 20 cm) 3 ) was evaluated using two compartments. One was a brightly lit compartment and the other was a dark compartment, and the two compartments were 5 × 5 cm. 2The mice were separated by a guillotine door of similar size. The experiment consisted of two stages: acquisition and retention. In the acquisition test, the mouse was placed in the bright compartment, and the guillotine door was opened 10 seconds later. If the mouse entered the dark compartment, the door was closed, and a mild electric shock of 0.5 mA was delivered through the floor for 3 seconds. The time it took for the mouse to voluntarily enter the dark compartment (latency) was recorded for up to 60 seconds. If the mouse did not move within 60 seconds, it was gently guided to the dark compartment. In the retention test 24 hours later, the mouse was placed back in the bright compartment, and the latency to move to the dark compartment was measured. The observation time was allowed up to 300 seconds.

[0273] As a result, as shown in Figure 11(D), while mice with normal memory delayed entry into the dark compartment by remembering the negative experience, HFD mice showed a short latency time. The FHS-M and FHS-H treatment groups showed an effect of alleviating memory decline by extending the latency time.

[0274] Through this, it was confirmed that treatment with fermented hemp seeds had an effect of improving cognitive function by improving avoidance learning and long-term memory that were impaired due to a high-fat diet.

[0275] 4-6. Confirmation of cognitive function improvement effect - Measurement of enzyme activity related to Alzheimer's disease

[0276] To confirm the cognitive function-improving effect of fermented hemp seeds, the activity of enzymes related to Alzheimer's disease was measured.

[0277] Specifically, the whole brain of the experimental mouse was extracted and homogenized in a 50 mM Tris-HCl (pH 7.4) buffer solution at a ratio of (1 / 5 or 1 / 10, w / v). The supernatant was collected and used for analysis after centrifugation at 2400 g for 20 min. Beta-secretase (BACE1), monoacylglycerol lipase (MAGL), and acetylcholinesterase (AChE) activities were measured using commercial kits, respectively. AChE activity was measured using a kit (kit lot, BMDE1816) purchased from Biomax (Korea), and BACE1 and MAGL activities were measured using kits purchased from Abcam (USA). AChE and MAGL activities were expressed in nanomoles per milliliter (nanomoles / mL), and BACE1 activity was calculated based on the amount of fluorescence emitted during the reaction. Amyloid plaque detection was performed according to the protocol of a commercial ELISA kit purchased from Invitrogen (kit lot, 390529-004).

[0278] As shown in Figs. 11(E)-(H), a high-fat diet increased beta-secretase (BACE1) activity, and the fluorescence level was significantly increased in the HFD group compared to the NC group (700031 vs. 1683867). In contrast, in the FHS-H treatment group, BACE1 activity was suppressed (682596), resulting in a decrease in amyloid production (Fig. 11(E)). To support this, when the amount of beta-amyloid (Aβ) accumulation in the brain was measured, the Aβ level in the HFD group was significantly higher (50.54 pg / mL) than in the NC group (0.75 pg / mL). However, the OR, RHS, FHS-L, FHS-M, FHS-H, and PA treatment groups all significantly reduced the Aβ level, and in particular, the FHS-H supplementation group showed 6.48 pg / mL, close to the level of the NC group (Fig. 11(H)). In addition, the HFD group showed a significant increase in acetylcholine esterase (AChE) activity to 4.79 nmol compared to the NC group (1.64 nmol) following high-fat diet intake. There was no significant difference in the RHS (4.46 nmol) and FHS-L (4.47 nmol) treatment groups, but the OR (3.16 nmol), FHS-M (3.31 nmol), FHS-H (3.27 nmol), and PA (3.41 nmol) treatment groups showed a significant decrease in AChE activity, which was effective in preventing synaptic loss (Fig. 11(F)). A high-fat diet also increased brain monoacylglycerol lipase (MAGL) activity, and the RHS, FHS-M, and FHS-H treatment groups suppressed MAGL activity to 0.000326, 0.000426, and 0.000379 nmol / min / mL, respectively. For reference, the MAGL activities of the HFD group and NC group were 0.000849 and 0.000316 nmol / min / mL, respectively (Figure 11(C)).

[0279] Through this, it was confirmed that the fermented cannabis seed product has an effect of improving cognitive function by regulating the activity of beta-secretase (BACE1), monoacylglycerol lipase (MAGL), and acetylcholinesterase (AChE), which are enzymes related to Alzheimer's disease.

[0280] 4-7. Confirmation of antioxidant effect

[0281] To confirm the antioxidant effect of fermented hemp seeds, SOD activity, CAT activity, and MDA levels, which are oxidative stress markers, were measured.

[0282] Specifically, superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) levels were assessed as brain oxidative stress markers using kits purchased from Abcam (USA) according to the manufacturer's protocol.

[0283] As shown in Figs. 11(I)-(K), a high-fat diet decreased superoxide dismutase (SOD) and catalase (CAT) activities, but the fermented hemp seed treatment group recovered this decrease. In particular, the FHS-H supplementation group most effectively improved SOD (57.89%) and CAT (3.61 nmol / mL) activities. The ranking of SOD activity was as follows: NC (71.64%) > HFD+FHS-H (57.89%) > HFD+PA (46.43%) > HFD+FHS-M (38.84%) > HFD+FHS-L (35.84%) > HFD+RHS (33.79%) > HFD+OR (28.07%) > HFD (18.18%) (Fig. 11(I)). The CAT activity ranking was as follows: NC (5.08 nmol / mL) > HFD+FHS-H (3.61 nmol / mL) > HFD+PA (2.67 nmol / mL) > HFD+FHS-M (2.49 nmol / mL) > HFD+OR (2.42 nmol / mL) > HFD+RHS (2.17 nmol / mL) > HFD+FHS-L (2.02 nmol / mL) > HFD (1.83 nmol / mL) (Fig. 11(J)). On the other hand, MDA levels were significantly increased in the brain due to a high-fat diet, and the fermented cannabis seed treatment group effectively suppressed this. MDA levels were as follows: NC (361.34 nmol / mg), HFD (1146.84 nmol / mg), HFD+OR (835.51 nmol / mg), HFD+RHS (671.53 nmol / mg), HFD+FHS-L (947.33 nmol / mg), HFD+FHS-M (855.31 nmol / mg), HFD+FHS-H (558.94 nmol / mg), HFD+PA (1120.32 nmol / mg) (Fig. 11(K)).

[0284] Through this, it was confirmed that the treatment of fermented hemp seeds prevented damage caused by oxidative stress in the brain and suppressed lipid peroxidation, thereby demonstrating that the fermented hemp seeds had an antioxidant effect.

[0285] 4-8. Confirmation of anti-inflammatory effect

[0286] To confirm the anti-inflammatory effect of fermented cannabis seeds, the levels of inflammatory and anti-inflammatory cytokines in the brain tissue of experimental animals were measured.

[0287] As shown in Figs. 11(I)-(N), a high-fat diet increased the levels of inflammatory cytokines TNF-α and IL-6, but these levels were significantly reduced by administration of fermented cannabis seeds or lactic acid bacteria. However, there was no significant difference in TNF-α and IL-6 levels between the HFD+RHS and HFD groups. The HFD+FHS-H group had the lowest TNF-α level at 1.52 pg / mL (NC: 32.90 pg / mL, HFD: 61.10 pg / mL) (Fig. 11(M)). A decrease in IL-6 levels was also observed in all fermented cannabis seed treatment groups (FHS-L, FHS-M, FHS-H). The respective IL-6 levels were HFD+FHS-L (36.96 pg / mL), HFD+FHS-M (38.28 pg / mL), and HFD+FHS-H (39.40 pg / mL), and were significantly lower than HFD (61.97 pg / mL) compared to NC (36.20 pg / mL) (Fig. 11(I)). A high-fat diet decreased the levels of IL-10, an anti-inflammatory cytokine, but promoted IL-10 expression in the brains treated with FHS-M, FHS-H, and PA. IL-10 levels were 136.74, 133.43, 146.86, and 151.36 pg / mL in the OR, RHS, FHS-M, and FHS-H treatment groups, respectively, which were higher than those in the NC group (153.46 pg / mL) and HFD group (97.13 pg / mL) (Fig. 11(N)).

[0288] Finally, tissue damage caused by a high-fat diet was evaluated through H&E staining of the hippocampus and cerebral cortex, and it was found that the hemp seed fermentation recovered the tissue damage caused by a high-fat diet (Fig. 11(O) and (P)).

[0289] Through this, it was confirmed that the treatment of the fermented cannabis seed product regulates the expression of inflammatory or anti-inflammatory cytokines, and that the fermented cannabis seed product has an antioxidant effect.

[0290] 4-9. Confirming the correlation between obesity and Alzheimer's disease

[0291] To analyze the relationship between obesity indicators and Alzheimer's disease indicators, Pearson's correlation was represented as a heatmap.

[0292] Obesity results in abnormalities in serum lipid profiles, increases in total body weight and related organ weights, elevated leptin levels, and decreased adiponectin levels. These changes induce insulin resistance. Insulin resistance inhibits the clearance of beta-amyloid from the central nervous system, leading to beta-amyloid toxicity and accelerating the development of Alzheimer's disease.

[0293] As shown in Fig. 12, adverse obesity-related markers (markers that promote disease progression) such as triglyceride (TG), total cholesterol (TC), leptin, low-density lipoprotein cholesterol (LDL-C), insulin resistance (HOMA-IR), and fasting blood glucose (FBG) showed a positive correlation with adverse Alzheimer's disease markers such as amyloid beta (Aβ) levels, AChE activity, MAGL activity, BACE1 activity, IL-6 levels, and TNF-α levels. This suggests that metabolic dysfunction and high lipid levels may worsen the pathology of Alzheimer's disease.

[0294] Therefore, it appears that hemp seed fermentation may inhibit the progression of obesity-induced Alzheimer's disease by improving the insulin pathway, oxidative stress pathway, inflammatory pathway, and adiponectin sensitivity.

[0295] <Experimental Example 5> Changes in serum and brain metabolites following treatment with fermented cannabis seeds.

[0296] To determine the effects of high-fat diet and fermented hemp seed treatment on the metabolome of mice, UHPLC-ESI-QTOF-MS2 analysis was performed on serum and brain supernatant.

[0297] Specifically, serum and brain samples (200 μL) were mixed with an equal volume of water (200 μL), respectively, and stirred at room temperature for 2 h. The mixture was centrifuged at 10,000 rpm at 4 °C for 10 min, and the supernatant was filtered through a 0.45 μm membrane filter and used for metabolite analysis. The analysis was performed using UHPLC-Q-TOF-MS / MS (AB SCIEX X500R QTOF). Q-TOF-MS2 was calibrated at a resolution of 5000 targeting the mass spectrum in the range of 100-1000 in negative mode. According to a previously established protocol, samples were injected through an autosampler and separated using an Accucore C18 analytical column. At this time, a binary solvent system consisting of water (A) and methanol (B) supplemented with 0.1% formic acid was used as the mobile phase. Metabolites were identified by comparing UHPLC-Q-TOF-MS2 data with the METLIN and HMDB online spectral databases.

[0298]

[0299] As shown in Fig. 13, it was confirmed that the metabolites of serum (Fig. 13(A), (B)) and brain (Fig. 13(C), (D)) significantly changed according to treatment with a high-fat diet and fermented hemp seeds.

[0300] <Experimental Example 6> Confirmation of the effect of fermented hemp seeds on improving intestinal microflora.

[0301] 6-1. Phylum-level analysis of the intestinal microbiota

[0302] To confirm the effect of fermented hemp seeds on improving intestinal microbiota, fecal microbiota analysis was performed.

[0303] Specifically, 16S metagenomic sequencing was performed at Macrogen Inc. (Seoul, Republic of Korea) using Herculase II Fusion DNA Polymerase and Nextera XT Index Kit V2 according to Illumina's instructions. The specific experimental methods followed those described in a previous study (Daliri et al., 2020).

[0304] As shown in Fig. 14, the dominant gut microbiota community (phylum level) was confirmed to have a clear difference (Fig. 14(A)). In the HFD group, Bacillota (formerly Firmicutes) increased to 79.96%, and Bacteroidota decreased to 16.03%. On the other hand, the NC group showed 68.19% and 26.86%, respectively. This suggests that intestinal microbial imbalance (dysbiosis) occurred due to obesity. On the other hand, the FHS-H treatment group decreased Bacillota to 65.20% and increased Bacteroidota to 29.54%, recovering it close to the NC group (Fig. 14(B), (C)). In addition, the Firmicutes / Bacteroidota (F / B) ratio also showed a significant difference between the groups. The HFD group had a significantly higher F / B ratio than the NC group, indicating intestinal microbial imbalance. The HFD+OR and HFD+RHS groups showed no significant difference from the HFD group, and the HFD+PA group actually increased the F / B ratio further. On the other hand, the FHS-H treatment group restored the F / B ratio to the level of the NC group, indicating that the fermented cannabis seed product can effectively regulate intestinal microbial imbalance induced by a high-fat diet (Fig. 14(C)).

[0305] 6-2. Genus and species-level analysis of gut microbiota

[0306] To confirm the effect of fermented hemp seeds on improving intestinal microbiota, fecal microbiota analysis was performed.

[0307] As shown in Figure 15, the logistic regression-based volcano plot applied a cutoff of 2 (p < 0.01) based on log fold change and FDR (False Discovery Rate) to identify the major microbial groups that significantly changed between groups at the genus and species levels (Figures 15(A)-(E)). In addition, a heatmap was created based on the top 20 significantly changed genera and top 24 significantly changed species (Figure 15(F)). A PC bi-plot was also created to visualize the similarity between groups at the genus and species levels (Figure 15(G)). The top 20 significantly changed genera were selected in each group compared to the HFD group (p < 0.01). Compared with the NC group, HFD intake induced changes in the gut bacterial composition, increasing the relative abundance of Streptococcus, Petroclostridium, Lactobacillus, Limosilactobacillus, Jeotgalicoccus, and Ligilactobacillus. In particular, FHS-H treatment contributed to restoring most of the altered microbial genera to normal levels. FHS-H administration increased the abundance of Streptococcus, Petroclostridium, Lactobacillus, Limosilactobacillus, Jeotgalicoccus, and Ligilactobacillus. On the other hand, a high-fat diet decreased the abundance of microorganisms such as Duncaniella, Muribaculum, Fusimonas, Anaerotaenia, Acetivibrio, Waltera, Clostridium, and Lacrimispora, and FHS-H treatment significantly restored these microbiota groups.A high-fat diet also increased bacterial species such as Murimonas intestini, Faecalicatena faecalis, Jeotgalicoccus halotolerans, Ligilactobacillus murinus, Petroclostridium xylanilyticum, Limosilactobacillus agrestis, Roseburia inulinivorans, and Streptococcus danieliae, whereas Roseburia faecis, Fusimonas intestine, Lacrimispora saccharolytica, Anaerotaenia torta, Muribaculum gordoncarteri, Duncaniella muris, and Acetivibrio cellulolyticus were significantly decreased by a high-fat diet. FHS-H treatment restored these changes to normal levels and effectively restored the balance of the gut microbiota.

[0308] 6-3. Correlation between gut microbiota species, obesity serum markers, and Alzheimer's disease brain markers.

[0309] To determine the correlation between gut microbiota species, serum obesity markers, and Alzheimer's disease brain markers, Pearson's correlation analysis was performed.

[0310] As a result, as shown in Fig. 16, 14 types of gut microbiota showed positive correlations with triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL), leptin, HOMA-IR, beta-amyloid, MDA, MAGL, BACE1, AChE, and inflammatory markers, while negative correlations were shown with high-density lipoprotein cholesterol (HDL-C), adiponectin, SOD, CAT, and IL-10. On the other hand, some compounds showed positive correlations with unfavorable indicators of obesity and AD (markers that promote disease progression) and negative correlations with favorable indicators (markers that inhibit disease progression), suggesting that they may have a detrimental effect.

[0311] In summary, treatment with fermented cannabis seeds suppressed weight gain, improved serum lipid profiles, restored adiponectin / leptin balance, and alleviated insulin resistance. Furthermore, treatment with fermented cannabis seeds significantly improved cognitive function and significantly reduced Alzheimer's disease-related markers, such as beta-amyloid (Aβ) accumulation, BACE1, MAGL, and AChE activity. In brain tissue, antioxidant enzyme (SOD, CAT) activity and anti-inflammatory capacity (decreased TNF-α and IL-6, increased IL-10) were improved. Metabolomic analysis showed that treatment with fermented cannabis seeds normalized serum and brain metabolite abnormalities associated with neurodegenerative pathways. Furthermore, gut microbiota analysis showed that fermented cannabis seeds restored gut microbiota imbalance induced by a high-fat diet, restored the Firmicutes / Bacteroidota ratio, and modulated the composition of major bacterial species. Correlation analysis results showed that changes in gut microbiota and systemic metabolites were strongly associated with improvements in obesity and Alzheimer's disease biomarkers, suggesting that fermented cannabis seed products can modulate the gut-brain axis, suggesting a novel dietary strategy for obesity-related neurodegenerative diseases.

[0312] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than restrictive. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0313]

[0314] [Correction pursuant to Rule 91, June 4, 2025]

Claims

1. A food composition for preventing or improving obesity or cognitive dysfunction, comprising a fermented cannabis seed product as an active ingredient.

2. In paragraph 1, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the above fermentation is performed by inoculating the strain Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP).

3. In paragraph 1, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the cognitive dysfunction is at least one selected from the group consisting of Alzheimer's disease, cerebrovascular dementia, Pick's disease, Creutzfeldt-Jakob disease, dementia due to head injury, and Parkinson's disease.

4. In paragraph 1, The above cognitive dysfunction is due to cognitive decline. A food composition for preventing or improving obesity or cognitive dysfunction, wherein the cognitive decline is at least one selected from the group consisting of memory loss, lethargy, amnesia, cognitive decline, learning disability, attention deficit disorder, depression, hearing loss, analgesia, ahidrosis, and discrimination decline.

5. In paragraph 1, The above fermented cannabis seed product is a food composition for preventing or improving obesity or cognitive dysfunction, which improves intestinal microflora.

6. In paragraph 5, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the improvement of the intestinal microflora increases the abundance and diversity of intestinal microflora.

7. In paragraph 5, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the improvement of the intestinal microflora increases intestinal beneficial bacteria.

8. In paragraph 7, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the beneficial bacteria is at least one selected from the group consisting of Duncaniella strains, Muribaculum strains, Fusimonas strains, Anaerotaenia strains, Acetivibrio strains, Waltera strains, Clostridium strains, Lacrimispora strains, and Roseburia strains.

9. In paragraph 5, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the improvement of the intestinal microflora reduces harmful intestinal bacteria.

10. In paragraph 9, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the harmful bacteria is at least one selected from the group consisting of a Streptococcus strain, a Petroclostridium strain, a Lactobacillus strain, a Limosilactobacillus strain, a Jeotgalicoccus strain, a Ligilactobacillus strain, a Murimonas strain, a Faecalicatena strain, and a Roseburia strain.

11. In paragraph 5, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the improvement of the intestinal microflora improves the imbalance of the intestinal microflora.

12. In paragraph 11, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the above intestinal microflora imbalance is caused by obesity.

13. In paragraph 1, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the above fermented cannabis seed product has increased anti-obesity activity.

14. In paragraph 1, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the above fermented cannabis seed product has increased antioxidant activity.

15. In paragraph 1, The above fermented cannabis seed product is a food composition for preventing or improving obesity or cognitive dysfunction, having increased anti-inflammatory activity.

16. In paragraph 1, The above fermented cannabis seed product is a food composition for preventing or improving obesity or cognitive dysfunction, wherein the expression of biomarkers related to cognition and memory is regulated.

17. In paragraph 1, The above fermented cannabis seed product is a food composition for preventing or improving obesity or cognitive dysfunction, which regulates the activity of beta-secretase (BACE1), monoacylglycerol lipase (MAGL), and acetylcholinesterase (AChE), which are enzymes related to Alzheimer's disease.

18. In paragraph 1, A food composition for preventing or improving obesity or cognitive dysfunction, wherein the above fermented cannabis seed product increases the content of metabolites reduced by obesity.

19. In paragraph 18, The metabolites are N-Acetyl-1-aspartylglutamic acid, L-Phenylalanine, Trans-cinnamic acid, Myristyl sulfate, Hypoxanthine, Palmitelaidic acid, Stearic acid, Dibromodimethyl ether, 4-Bromo-1,1-dioxo-tetrahydrothiophen-3-one, Cyclopropane-1,1,2,2-tetracarboxylic acid, 2,8-Dichlordibenzofuran, A food composition for preventing or improving obesity or cognitive dysfunction, comprising at least one selected from the group consisting of Perindoprilat, Terpendole E, and Auraptene.

20. A health functional food composition for improving memory and cognitive ability, comprising fermented cannabis seeds as an active ingredient.

21. A pharmaceutical composition for preventing or treating obesity or cognitive dysfunction, comprising a fermented cannabis seed product as an active ingredient.

22. Step of preparing a hemp seed extract; and A method for producing a fermented cannabis seed product, comprising the step of inoculating the cannabis seed extract with a strain or a culture solution thereof.

23. In paragraph 22, A method for producing a fermented cannabis seed product, wherein the cannabis seed extract is extracted with at least one solvent selected from the group consisting of purified water, alcohol having 1 to 4 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, and cyclohexane.

24. In paragraph 22, A method for producing a fermented cannabis seed product, wherein the strain is Pediococcus acidilacticiOHSI1 (Accession No.: KCTC 15831BP).

25. In paragraph 22, A method for producing a fermented hemp seed product, wherein the fermentation is performed at 30 to 47°C for 24 to 72 hours.

26. Step of preparing a hemp seed extract; and A method for increasing the content of metabolites in a fermented cannabis seed product, comprising the step of inoculating a strain or a culture solution thereof into the cannabis seed extract.

27. In paragraph 25, The metabolites in the above cannabis seed fermentation product are 2,6-dimethoxybenzoic acid, phloretic acid, tetranoprostanedioic acid, dihydroxyoctadecanoate, hydroxycostic acid, methyl jasmonate, (2R, 4R, 6Z)-1,2,4-trihydroxynonadec-6-ene, tetrakis(oxiranylmethoxy)pentanol, hydroxylauric acid, and A method for increasing the content of a metabolite in a fermented cannabis seed, wherein the metabolite is at least one selected from the group consisting of (1-Acetoxy-2,4-dihydroxyheptadeca-16-ene).

28. A method for preventing or treating obesity or cognitive dysfunction, comprising administering to a subject the pharmaceutical composition of Article 21.

Images