Compositions and methods for augmenting VEGF therapy for ischemic tissue revascularization
By targeting the PLCy2 promoter with guide RNAs and a DNA demethylase, the composition enhances VEGF therapy in diabetic wounds, improving blood flow and vascularization in ischemic tissues.
Patent Information
- Application Number
- PCT/IB2025/055002
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-14
- Filing Date
- 2025-05-13
- Publication Date
- 2025-11-20
AI Technical Summary
Existing VEGF therapy for diabetic wounds has yielded disappointing results in improving perfusion and vascularization, highlighting the need for effective methods to treat ischemic tissues.
A composition comprising guide RNAs targeting the PLCy2 promoter, dCas9 linked to an antigen-binding partner, and a catalytic domain of a DNA demethylase is delivered to ischemic tissues to demethylate the PLCy2 promoter, enhancing vascularization and blood flow.
The composition effectively improves blood flow and vascularization in ischemic tissues by demethylating the PLCy2 promoter, thereby augmenting the efficacy of VEGF therapy in diabetic wounds.
Smart Images

Figure IB2025055002_20112025_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS FOR AUGMENTING VEGF THERAPY FOR ISCHEMIC TISSUE REVASCULARIZATIONCROSS-REFERENCE TO REEATED APPLICATION
[0001] The present application claims the benefit of U.S. Provisional Patent Application No. 63 / 647,242, filed May 14, 2024, the disclosure of which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under W81XWH-22-1-0146 awarded by the U.S. Army Medical Research and Development Command and DK136814, DK128845, DK135447, and DK125835 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING
[0003] The Sequence Listing associated with this application is filed in electronic format via Patent Center and is hereby incorporated by reference into the specification in its entirety. The name of the file containing the Sequence Listing is 2500676.xml. The size of the file is 15,860 bytes, and the file was created on May 8, 2025.BACKGROUND OF THE INVENTIONField of the Invention
[0004] Provided herein are compositions and methods for modifying gene expression and, in non-limiting embodiments, for treating ischemia.Description of Related Art
[0005] Diabetic wounds are complicated by underlying peripheral vasculopathy. Reliance on vascular endothelial growth factor (VEGF) therapy to improve perfusion makes logical sense, yet clinical study outcomes on rescuing diabetic wound vascularization have yielded disappointing results. Accordingly, methods, compounds, and compositions useful for treatment of ischemic wounds and lesions are desired.SUMMARY OF THE INVENTION
[0006] A composition for treating ischemic tissue, including at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQ ID NO: 15, or a nucleic acid including a gene for expressing at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQID NO: 15; a dCas9 linked to an antigen binding partner or a nucleic acid including a gene for expressing a dCas9 linked to an antigen binding partner; and a catalytic domain of a DNA demethylase linked to an antigen-binding regent or a nucleic acid including a gene for expressing a catalytic domain of a DNA demethylase linked to an antigen-binding reagent.
[0007] Also provided herein is a composition including a nucleic acid including a plasmid including genes for expressing a guide RNA targeting a PLCy2 promoter sequence.
[0008] Also provided herein is a composition including a nucleic acid including a plasmid including genes for expressing the dCas9 linked to a peptide.
[0009] Also provided herein is a composition including a nucleic acid including a plasmid including genes for expressing the catalytic domain of a DNA demethylase linked to an antigen-binding regent.
[0010] Also provided herein is a kit including a composition as described herein.
[0011] Also provided herein is a method of treating ischemic tissue, including a step of delivering a composition described herein in an amount effective to improve blood flow and / or vascularization into the ischemic tissue.
[0012] Further non-limiting embodiments are set forth in the following numbered clauses:
[0013] 1. A composition for treating ischemic tissue, comprising: at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQ ID NO: 15, or a nucleic acid comprising a gene for expressing at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQ ID NO: 15; a dCas9 linked to an antigen binding partner or a nucleic acid comprising a gene for expressing a dCas9 linked to an antigen binding partner; and a catalytic domain of a DNA demethylase linked to an antigen-binding regent or a nucleic acid comprising a gene for expressing a catalytic domain of a DNA demethylase linked to an antigen-binding reagent.
[0014] 2. The composition of clause 1, comprising at least two independent guide RNAs targeting different sequences of the PLCy2 promoter sequence or at least two nucleic acids each comprising genes for expressing independent guide RNAs targeting different sequences of the PLCy2 promoter sequence.
[0015] 3. The composition of clause 1 or clause 2, comprising at least three independent guide RNAs targeting different sequences of the PLCy2 promoter sequence or at least three nucleic acids each comprising genes for expressing independent guide RNAs targeting different sequences of the PLCy2 promoter sequence.
[0016] 4. The composition of any of clauses 1-3, wherein the guide RNA comprises at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or a nucleic acid comprising genes for expressing the guide RNA comprises at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ IDNO: 3.
[0017] 5. The composition of any of clauses 1-4, wherein the guide RNA is provided as a nucleic acid comprising a gene for expressing the guide RNA.
[0018] 6. The composition of any of clauses 1-5, wherein expression of the guide RNA is driven by a tissue-specific promoter.
[0019] 7. The composition of any of clauses 1-6, wherein expression of the guide RNA is driven by a tissue-specific promoter for selective expression in endothelial cells.
[0020] 8. The composition of any of clauses 1-7, wherein expression of the guide RNA is driven by a CDH5 promoter.
[0021] 9. The composition of any of clauses 1-8, comprising a fusion protein of a dCas9 and a peptide or a nucleic acid comprising a gene for expressing a fusion protein of a dCas9 and a peptide.
[0022] 10. The composition of any of clauses 1-9, wherein the peptide linked to a dCas9 is a repeating peptide, optionally having a length of about 22 amino acids.
[0023] 11. The composition of any of clauses 1-10, wherein the peptide linked to a dCas9 is a peptide repeat of GCN4.
[0024] 12. The composition of any of clauses 1-11, wherein the catalytic domain of a DNA demethylase is from the TET family of enzymes.
[0025] 13. The composition of any of clauses 1-12, wherein the catalytic domain of a DNA demethylase is from a TET1 enzyme.
[0026] 14. The composition of any of clauses 1-13, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is an antibody or derived from an antibody.
[0027] 15. The composition of any of clauses 1-14, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is an antibody fragment.
[0028] 16. The composition of any of clauses 1-15, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is a scFv.
[0029] 17. The composition of any of clauses 1-16, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is a scFv is directed towards GCN4.
[0030] 18. The composition of any of clauses 1-17, further comprising a VEGF or a nucleic acid comprising a gene for expressing a VEGF.
[0031] 19. The composition of any of clauses 1-18, comprising a nucleic acid comprising a gene for expressing a VEGF.
[0032] 20. The composition of any of clauses 1-19, wherein the nucleic acid comprising a gene for expressing a VEGF comprises the open reading frame of a VEGF.
[0033] 21. The composition of any of clauses 1-20, wherein the nucleic acid comprising a gene for expressing a VEGF comprises the open reading frame of VEGFA.
[0034] 22. The composition of any of clauses 1-21, further comprising a buffered solution.
[0035] 23. The composition of any of clauses 1-22, wherein the buffered solution is a saline solution.
[0036] 24. The composition of any of clauses 1-23, wherein the buffered solution is a phosphate buffered saline solution.
[0037] 25. The composition of any of clauses 1-24, further comprising a hydrophilic bioerodible polymer.
[0038] 26. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the guide RNA targeting a PLCy2 promoter sequence of any of clauses 1- 25.
[0039] 27. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the dCas9 linked to a peptide of any of clauses 1-25.
[0040] 28. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the catalytic domain of a DNA demethylase linked to an antigen-binding regent of any of clauses 1-25.
[0041] 29. A kit comprising the composition of any of clauses 1-28.
[0042] 30. The kit of clause 29, further comprising one or more electrodes, an electroporation chip, and / or a power source, such as a battery.
[0043] 31. A method of treating ischemic tissue, comprising delivering the composition of any of clauses 1-28 in an amount effective to improve blood flow and / or vascularization into the ischemic tissue.
[0044] 32. The method of clause 31, wherein the composition is delivered up to three days following an injury.
[0045] 33. The method of clause 31 or clause 32, wherein the composition is delivered up to three days following an ischemic event.
[0046] 34. The method of any of clauses 31-33, further comprising delivering VEGF or a nucleic acid comprising a gene for expressing VEGF asynchronously with the delivery of the composition of any one of claims 1-28.
[0047] 35. The method of any of clauses 31-34, further comprising delivering VEGF or a nucleic acid comprising a gene for expressing VEGF after up to 10 days after the delivery of the composition of any of clauses 1-28.
[0048] 36. The method of any of clauses 31-35, wherein the VEGF or a nucleic acid comprising a gene for expressing VEGF is delivered up to 10 days after the delivery of the composition of any of clauses 1-28.
[0049] 37. The method of any of clauses 31-36, wherein the VEGF or a nucleic acid comprising a gene for expressing VEGF is delivered after the delivery of the composition of any of clauses 1-28 and prior to the resolution of ischemia.
[0050] 38. The method of any of clauses 31-37, wherein the composition is delivered by non-viral transfection.
[0051] 39. The method of any of clauses 31-38, wherein the composition is delivered by electroporation.
[0052] 40. The method of any of clauses 31-39, wherein the composition is delivered by nanoelectroporation.
[0053] 41. The method of any of clauses 31-40, wherein the composition is delivered by tissue nanoelectroporation technique 2.0.
[0054] 42. The method of any of clauses 31-41, wherein the composition is delivered to ischemic tissue.
[0055] 43. The method of any of clauses 31-42, wherein the composition is delivered to a diabetic wound.
[0056] 44. The method of any of clauses 31-43, wherein the composition is delivered to a patient with an ischemic disease.
[0057] 45. The method of any of clauses 31-44, wherein the ischemic disease is peripheral artery disease.
[0058] 46. The method of any of clauses 31-45, wherein the ischemic disease is coronary artery disease.
[0059] 47. The method of any of clauses 31-46, wherein the ischemic disease is cerebrovascular disease.
[0060] 48. The method of any of clauses 31-47, wherein the composition is delivered to a patient with a metabolic disease.
[0061] 49. The method of any of clauses 31-48, wherein the metabolic disease is diabetes mellitus.
[0062] 50. The method of any of clauses 31-49, wherein the metabolic disease is type 2 diabetes.
[0063] 51. The method of any of clauses 31-50, wherein the composition is delivered in more than once to the patient.
[0064] 52. The method of any of clauses 31-51, wherein the VEGF is delivered more than once to the patient.BRIEF DESCRIPTION OF THE DRAWINGS
[0065] FIGS. 1A-1D show the correlation between low PLCy2 levels and promoter methylation is observed in the diabetic wound-edge endothelial cell subsets. (1A) UMAP plot shows single-cell transcriptomes of 66709 human chronic wound-edge (WE) cells (44979 T2DM (D), n =5; 21730 non-diabetic (ND, n =5). Cellular heterogeneity with 12(0-11) distinct clusters (with %) of cells identified (based on specific markers, right). Each dot represents a cell. (IB) Endothelial cells (0, 1, 2, 3, 4) were then sub-setted in 5 different subclusters. (IB) Dot plot represents the classification of endothelial subclusters based on endothelial cell subtype- specific markers. (IB) Bar plot showing that diabetic WE has comparatively low RGCChlSPARChlcapillary endothelial cells (subcluster 0) and high SELEhlACKRlhlvenous endothelial cells (subcluster 2) as compared to non-diabetic WE. Student t-test. (1C) Violin plot showing that PLCy2 expression was significantly down in all five subclusters of endothelial cells despite differences in origin (arterial, venous, or capillary). P<0.05 (Wilcoxon Rank Sum test). (1C) Representative immunohistochemical images and (1C) its analyses of vWF+ / PLCy2+co-localization in human diabetic and non-diabetic WE. n=6. Scale bar, 50 pm. White arrows show major blood vessels. *P<0.05 (Student t-test). (ID) Selection of CDH5+tissue elements (green) and collection before and after the laser capture microdissection (LCM). (ID) Schematic of human PLCy2 promoter analyzed through bisulfite sequencing in LCM captured CDH5+tissue elements. Increased methylation of PLCy2 promoter was found in diabetic WE LCM captured CDH5+elements (45%) compared to non-diabetic WE (11%), n=12 clones from 4 subjects. *P<0.05 (Student t-test). ND: nondiabetic; T2DM: Type 2 Diabetes Mellitus.
[0066] FIGS. 2A-2D show the methylation status of the PLCy2 promoter in the skin of acute diabetic mice. (2A) UCSC Genome browser excerpt showing presence of a CpG island containing 62 CpGs in the promoter of murine PLCy2 gene indicating that its expression can be governed by DNA methylation marks. (2B) Schematic diagram showing STZ-induced diabetic mice. (2B) Blood glucose level in normal C57BL / 6 and STZ-induced diabetic C57BL / 6 at dl5 used in this study. (2C) Methylation status of a region of PLCy2 promoter (mml0_chr8: 117,498, 149-117,498,925) analyzed through bisulfite sequencing (methylated CpG, black; unmethylated CpG, white) (n=10 clones from 4 animals). (2C) Distribution of methylated and unmethylated CpGs in PLCy2 promoter (non-diabetic (top); STZ-induced diabetic (bottom)). (2D) Expression of PLCy2 mRNA was analyzed by quantitative RT-qPCR. Actb was used as internal control(n=6,5). (2D) Representative IHC analysis of PLCy2 (green) in normal murine skin (n=7,8). (H) Intensity analysis of the images. (Scale bar: 100 pm; *P < 0.05, Student’s t-test). STZ: Streptozotocin.
[0067] FIGS. 3A-3E show ischemic conditions prompt DNA hypermethylation in the promoter region, leading to the subsequent downregulation of PLCy2 in murine skin. (3A) Schematic diagram showing creation of ischemic monopedicle flap on the dorsum of C57BL / 6 mice to study the effect of ischemia on PLCy2 promoter methylation. (3A) Monopedicle dorsal skin flap experiment showing samples collected from different flap regions. The extent of ischemia was categorically characterized by dividing the flap into three parts [proximal (green box), intermediate (blue box) and distal (red box) from cephalad attachment (scale bar: 5mm)]. (3B) Methylation status of a region of PLCy2 promoter (mml0_chr8: 117498097-117498981) analyzed through bisulfite sequencing (methylated CpG, black; unmethylated CpG, white) (n=22, 20, 19 clones from 8 subjects). (3C) Distribution of methylated and unmethylated CpGs in PLCy2 promoter proximal (top); intermediate (middle); distal (bottom). (3D) Representative IHC analysis of PLCy2 (red) in the monopedicle flap containing all three abovementioned regions. (3E) Intensity analysis of the IHC images. (Scale bar: 100 pm; n=4 *P < 0.05 intermediate vs proximal; §P < 0.05 distal vs proximal (one-way ANOVA, followed by Tukey HSD post hoc test).
[0068] FIGS. 4A-4F show endothelial-targeted demethylation of PLCy2 improves VEGF therapy on diabetic wound-edge vascularization. (4A) Vector components used for targeted demethylation of PLCy2 promoter in STZ- induced diabetic mice using CRISPR / dCas9 approach. Endothelial cells targeting was achieved by CDH5 promoter-driven guide RNAs. (4A) Schematic diagram showing TNT-mediated delivery of VEGF ORFs or / and endothelial demethylation cocktail in bipedicle ischemic wound model of STZ-induced diabetic mice. (4A)Blood glucose level in STZ- induced diabetic mice used in this study. (4B) Respective PeriMed laser speckle-assisted perfusion images (scale bar: 5mm) and (4B) their analysis data presented as arbitrary perfusion units. TNT procedure was done with scramble-gRNA, VEGF only, demethylation cocktail only or VEGF plus demethylation cocktail CDH5 promoter-driven (endothelial) PLCy2 gRNA in presence of dCas9-TETlCD cocktail. Perfusion was calculated based on the ratio of the wound area vs distant normal skin, n = 6-11, *P < 0.05 gRNA PLCy2 vs scramble-gRNA; §P < 0.05 gRNA PLCY2+VEGF VS Sham; #P < 0.05 gRNA PLCY2+VEGF vs VEGF (two-way ANOVA, followed by Tukey HSD post hoc test). (4C-4D) Blood flow and pulse pressure at the wound edge were measured using the pulse wave Doppler feature of Vevo 2100. The pulse wave profiles at day 10 are shown. The increase in blood flow and pulsation as indicated by increase the peaks heights are shown for the respective groups compared to the control. The percentage of VTI and the calculated pulse pressure are shown as bar graphs n=6. *P < 0.05 (one-way ANOVA, followed by Tukey HSD post hoc test). VTI: Velocity Time Integral; scr gRNA: Scramble-gRNA; VEGF: VEGF ORFs; gRNA PLCY2: gRNAs for PLCY2 promoter; STZ: Streptozotocin. (4E) Wound closure was monitored at different days after wounding in abovementioned murine bipedicle ischemic wounds (4B) subjected to TNT by digital planimetry (4F). n = 5-11. *P < 0.05 gRNA PLCY2 VS scramble-gRNA; §P < 0.05 gRNA PLCY2+VEGF VS scramble-gRNA; #P < 0.05 gRNA PLCY2+VEGF VS VEGF (two-way ANOVA, followed by Tukey HSD post hoc test).
[0069] FIGS. 5A-5B show endothelial cell-specific demethylation of PLCY2 promoter during VEGF therapy increases angiogenesis pathway in diabetic ischemic wounds. Immunohistochemical analysis of different vascular markers in the ischemic dlO wound-edge tissue from STZ induced diabetic mice. The wound-edge were treated with demethylation cocktail at dl post-surgery in absence or presence of PLCY2 gRNAs. Following colocalization analyses were performed: (5A) VWF+ / PLCY2+and (5A) their colocalization coefficient. (5B) vWF+ / p-PLCY2+and (5B) their colocalization coefficient. (Scale bar: 100 pm; n = 4. *P < 0.05 one-way ANOVA, followed by Tukey HSD post hoc test), scr gRNA: Scramble-gRNA; PLCY2 gRNA: gRNAs for PLCY2 promoter; STZ: Streptozotocin; vWF: Von Willebrand factor.
[0070] FIGS. 6A-6B show demethylation of the PLCY2 promoter during VEGF therapy promotes ischemic tissue angiogenesis via activating MAPK44 / 42. Immunohistochemical analysis of different vascular markers in the ischemic dlO wound-edge tissue from STZ induced diabetic mice were performed. The wound-edges were treated with demethylation cocktail at dl post-surgery in absence or presence of PLCY2 gRNAs. Following colocalization analyses were performed: (6A) vWF+ / VEGFA+ and their colocalization coefficient. (6B)vWF+ / p-44 / 42MAPK+ and their colocalization coefficient. (Scale bar: 100 pm; n = 4. *P < 0.05 one-way ANOVA, followed by Tukey HSD post hoc test). Scramble-gRNA; PLCy2 gRNA: gRNAs for PLCy2 promoter; STZ: Streptozotocin; vWF: Von Willebrand factor.
[0071] FIGS. 7A-7B show PLCy2 overexpression in endothelial cells increases VEGF expression via activation of MAPK44 / 42 / HIFla signaling. (7A) ELISA analyses of the expression of PLCy2 and phospho-PLCy2 (Tyr 753) in the whole cell lysate. n=4-6, *P<0.05 (Student t-test); (7A) Expression levels of VEGFA were quantified in media obtained from empty vector and PLCy2 overexpression vector transfected HMEC. n=3, *P<0.05 (Student t- test). (7A) Western blot analyses of MAPK 44 / 42 and phospho-MAPK44 / 42 expression in the whole cell lysate obtained from empty vector and PLCy2 overexpression vector transfected HMEC. P-Actin was used as the loading control. The fold change of the expression between the groups is shown below. n=4, *P<0.05 (Student t-test). (7B) Immunohistochemical analyses were performed nucleus / HIFl-a and their colocalization coefficient. n=5. Scale bar: 100 pm; *P<0.05 (Student t-test). ORFs: open reading frame; scr gRNA: Scramble-gRNA; gRNA PLCy2: gRNAs for PLCy2 promoter; STZ: Streptozotocin.DESCRIPTION OF THE INVENTION
[0072] The use of numerical values in the various ranges specified in this application, unless expressly indicated otherwise, are stated as approximations as though the minimum and maximum values within the stated ranges are both preceded by the word “about”. In this manner, slight variations above and below the stated ranges can be used to achieve substantially the same results as values within the ranges. Also, unless indicated otherwise, the disclosure of ranges is intended as a continuous range including every value between the minimum and maximum values. As used herein, “a” and “an” refer to one or more.
[0073] As used herein, the term “comprising” is open-ended and may be synonymous with ‘including’, ‘containing’, or ‘characterized by’. The term "consisting essentially of" limits the scope of a claim to the specified materials or steps, and those that do not materially affect basic and novel characteristic(s). The term “consisting of" excludes any element, step, or ingredient not specified in the claim. As used herein, embodiments "comprising" one or more stated elements or steps also include but are not limited to embodiments "consisting essentially of" and "consisting of" these stated elements or steps.
[0074] As used herein, the term “patient” or “subject” refers to members of the animal kingdom including but not limited to human beings, and “mammal” refers to all mammals, including, but not limited to human beings.
[0075] As used herein, the “treatment” or “treating” of a condition means administration to a patient by any suitable dosage regimen, procedure and / or administration route an amount of a composition, device or structure effective to, and with the object of achieving a desirable clinical / medical end-point, including attracting progenitor cells, healing a wound, correcting a defect, etc.
[0076] Active ingredients, such as nucleic acids or analogs thereof, may be compounded or otherwise manufactured into a suitable composition for use, such as a pharmaceutical dosage form or drug product in which the compound is an active ingredient. Compositions may comprise a pharmaceutically acceptable carrier, or excipient. An excipient is an inactive substance used as a carrier for the active ingredients of a medication. Although "inactive", excipients may facilitate and aid in increasing the delivery or bioavailability of an active ingredient in a drug product. Non-limiting examples of useful excipients include: antiadherents, binders, rheology modifiers, coatings, disintegrants, emulsifiers, oils, buffers, salts, acids, bases, fillers, diluents, solvents, flavors, colorants, glidants, lubricants, preservatives, antioxidants, sorbents, vitamins, sweeteners, etc., as are available in the pharmaceutical / compounding arts. In one example, a nucleic acid is delivered in a lipid nanoparticle.
[0077] Useful dosage forms include: intravenous, intramuscular, intraocular, or intraperitoneal solutions, oral tablets or liquids, topical ointments or creams, and transdermal devices (e.g., patches). In one embodiment, the compound is a topical liquid, emulsion, or lipid nanoparticle comprising a nucleic acid or analog thereof, such as an RNAi reagent, an mRNA, a DNA comprising a gene for expressing a polypeptide, or an antisense oligonucleotide. Useful dosage forms may also include a hydrogel. As used herein, a “hydrogel” is a two-phase composition comprising a hydrophilic, polymeric composition containing synthetic or naturally derived organic moieties capable of absorbing, retaining, containing, or otherwise comprising water or biological fluids. A large variety of well-known polymer compositions are cytocompatible as well as biocompatible, and can form hydrogels, which can be modified / functionalized. Nonlimiting examples of such hydrogels include: natural or synthetic polysaccharides, hydrogels based on extracellular matrix components, natural or synthetic proteins (e.g. fibrin and collagen), poly acrylates, and polyacrylamides, among a large variety of other useful hydrophilic polymer compositions. Non-limiting examples of acrylates include poly(acrylic acid), poly(methacrylic acid).
[0078] Suitable dosage forms may include single-dose, or multiple-dose vials or other containers, such as medical syringes or droppers, containing a composition comprising an active ingredient useful for treatment of corneal opacity as described herein.
[0079] Pharmaceutical formulations adapted for administration include aqueous and nonaqueous sterile solutions which may contain, for example and without limitation, antioxidants, buffers, bacteriostats, lipids, liposomes, lipid nanoparticles, emulsifiers, suspending agents, and rheology modifiers. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous solutions and suspensions may be prepared from sterile powders, granules and tablets.
[0080] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. For example, sterile injectable solutions can be prepared by incorporating the active agent in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, typical methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
[0081] A "therapeutically effective amount" refers to an amount of a drug product or active agent effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. An "amount effective" for treatment of a condition is an amount of an active agent or dosage form, such as a single dose or multiple doses, effective to achieve a determinable endpoint. The "amount effective" is preferably safe - at least to the extent the benefits of treatment outweighs the detriments, and / or the detriments are acceptable to one of ordinary skill and / or to an appropriate regulatory agency, such as the U.S. Food and Drug Administration. A therapeutically effective amount of an active agent may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the active agent to elicita desired response in the individual. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount may be less than the therapeutically effective amount.
[0082] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single dose or bolus may be administered, several divided doses may be administered over time, or the composition may be administered continuously or in a pulsed fashion with doses or partial doses being administered at regular intervals, for example, every 10, 15, 20, 30, 45, 60, 90, or 120 minutes, every 2 through 12 hours daily, or every other day, etc., be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. In some instances, it may be especially advantageous to formulate compositions in dosage unit form for ease of administration and uniformity of dosage. The specification for the dosage unit forms is dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
[0083] By " expression" or “gene expression,” it is meant the overall flow of information from a gene or functional / structural RNA, to produce a gene product (typically a protein, optionally post-translationally modified, or a functional / structural RNA). A “gene” refers to a functional genetic unit for producing a gene product, such as RNA or a protein in a cell, or other expression system encoded on a nucleic acid and comprising: a transcriptional control sequence, such as a promoter and other cis-acting elements, such as transcriptional response elements (TREs) and / or enhancers; an expressed sequence that may encode a protein (referred to as an open-reading frame or ORF), and a polyadenylation sequence. By "expression of genes under transcriptional control of," or alternately "subject to control by," a designated sequence such as TRE or transcription control element, it is meant gene expression from a gene containing the designated sequence operably linked (functionally attached, typically in cis) to the gene. A "gene for expression of" a stated gene product is a gene capable of expressing that stated gene product when placed in a suitable environment— that is, for example, when transformed, transfected, transduced, etc. into a cell, and subjected to suitable conditions for expression.
[0084] A nucleic acid molecule (a nucleic acid) refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide,deoxynucleotide or a modified form of either type of nucleotide. The term “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” The term includes single- and double- stranded forms of DNA. A polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide linkages. A “codon-optimized” nucleic acid refers to a nucleic acid sequence that has been altered such that the codons are optimal for expression in a particular system (such as a particular species or group of species). For example, a nucleic acid sequence can be optimized for expression in mammalian cells. Codon optimization does not alter the amino acid sequence of the encoded protein.
[0085] Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems have been modified for genome engineering and other purposes are based on an adaptive immune system in bacteria. CRISPR systems are two-component systems that include a guide RNA or single guide RNA (gRNA or sgRNA, respectively) and a CRISPR-associated nuclease. Traditionally, engineered CRISPR systems are used for genomic engineering, but have also been adapted for transcriptional control. Cas enzymes are able to bind target DNA independently of their ability to cleave target DNA. For transcriptional control, Cas nuclease domains can be rendered inactive by point mutations. For example, in Cas9, both RuvC and HNH nuclease domains can be rendered inactive by point mutations (for example and without limitation, D10A and H840A in S. pyogenes Cas9, SpCas9), resulting in a nuclease dead or deactivated Cas9 (dCas9) molecule that cannot cleave target DNA. As used herein, a “dCas9 molecule” may be a modified Cas9 that retains the ability to bind to a target DNA sequence based on the gRNA targeting sequence (see, e.g., Addgene: CRISPR Guide, w w:addgene;OTg / gui.des / CTisp5; / ) but does not cleave the target DNA to any substantial degree, guide RNAs disclosed herein may be specific to a particular organism, such as a mouse or a human, though those of skill in the art will appreciate that suitable guide RNAs for other organisms based on the sequences disclosed herein and the level of skill in the art.
[0086] A dCas9 protein may be linked, for example covalently linked, to a peptide to form a fusion protein. A dCas9 protein may be complexed with another protein. For example and without limitation, dCas9 protein may be linked or complexed to a peptide that comprises an antigen-binding partner.
[0087] In the context of the present disclosure, antigen-binding reagents, for example to deliver CRISPR / Cas9 reagents, are provided. Antigen binding reagents bind specifically to their antigen binding partner. Collectively an antigen binding reagent and its binding partner may be termed a “binding pair”. One common, and non-limiting, example of a binding pair isstreptavidin / avidin and biotin. A classic binding pair is an antibody and its corresponding antigen, where a paratope of the antibody binds an epitope of the antigen. Likewise, in the context of the present disclosure, an antigen binding molecule may be a nanobody (e.g., camelid VHH), which forms a binding pair with its target, to which it binds specifically. “Specific binding” refers to binding of members of a binding pair to the substantial exclusion of cross -reactivity with other molecules in the context of a therapeutic approach, diagnostic assay, or production method in which the specific binding is to be employed. Sufficiency of the specificity of binding may be evaluated during development of a therapeutic drug product or diagnostic assay and may be evaluated according to any medically- or pharmaceuticallyrelevant standard, such as governmental regulatory standards.
[0088] An antigen binding molecule or complexes thereof may be, for example and without limitation, a monoclonal antibody, including fragments, derivatives, or analogs thereof, or complexes thereof, including without limitation: Fab, Fab', Fv fragments, single chain Fv (scFv) fragments, dsFv, Fabl fragments, F(ab')2 fragments, single domain antibodies, camelized (camelid) antibodies and antibody fragments, humanized antibodies and antibody fragments, and multivalent versions of the foregoing; multivalent binding reagents including without limitation: monospecific or bispecific antibodies, such as disulfide stabilized Fv fragments, scFv tandems ((ScFv)2 fragments), diabodies, triabodies, tetrabodies, which typically are covalently linked or otherwise stabilized (e.g., leucine zipper or helix stabilized) scFv fragments, bi-specific T-cell engager (BiTE, e.g., a DbTE), di-scFv (dimeric single-chain variable fragment), single-domain antibody (sdAb), or antibody binding domain fragments. Antibody fragments also include miniaturized antibodies or other engineered binding reagents that exploit the modular nature of antibody structure, comprising, often as a single chain, one or more antigen-binding or epitope-binding sequences (e.g., paratope) and, at a minimum, any other amino acid sequences needed to ensure appropriate specificity, delivery, and stability of the composition.
[0089] scFv molecules may be manufactured using any suitable technology. Typically, recombinant cells comprising genes for expressing scFv-containing polypeptides are engineered, e.g., according to decades-old methods using any of a variety of publicly- and commercially-available expression systems. Huston J. S., M. Mudgett-Hunter, M. S. Tai et al., “Protein engineering of single-chain Fv analogs and fusion proteins, ’’Methods in Enzymology, vol. 203, pp. 46-88, 1991; Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NB, Hamid M. scFv antibody: principles and clinical application. Clin Dev Immunol. 2012;2012:980250; Gqciarz A, Ruddock LW. Complementarity determining regions and frameworks contribute tothe disulfide bond independent folding of intrinsically stable scFv. PLoS One. 2017 Dec 18;12(12):e0189964; Sandomenico A, Sivaccumar JP, Ruvo M. Evolution of Escherichia coli Expression System in Producing Antibody Recombinant Fragments. Int J Mol Sci. 2020 Aug 31 ;21(17):6324; Petrus MLC, Kiefer LA, Puri P, Heemskerk E, Seaman MS, Barouch DH, Arias S, van Wezel GP, Havenga M. A microbial expression system for high-level production of scFv HIV-neutralizing antibody fragments in Escherichia coli. Appl Microbiol Biotechnol. 2019 Nov;103(21-22):8875-8888; and Toleikis L, Frenzel A. Cloning single-chain antibody fragments (ScFv) from hybridoma cells. Methods Mol Biol. 2012;907:59-71; see, also, scfy
[0090] As used herein “DNA demethylating enzyme” is an enzyme that catalyzes the removal of methyl groups from methylated cytosines, specifically in 5’-CpG-3’ sequences. Examples of DNA demethylating enzymes include TET enzymes. By “TET protein” or “TET enzyme”, it is meant the family of Ten-Eleven Translocation dioxygenase enzymes, a family of DNA- demethylating enzymes. TET1 is a member of the TET family of enzymes. An exemplary activity of a TET catalytic domain is to catalyze oxidation of methylated cytosines to 5- hydroxycytosines as part of the demethylation process. The TET, e.g. TET1, catalytic domain is conserved and may have higher catalytic activity than a full-length TET protein. The catalytic domain of TET enzymes may be linked or complexed, for example and without limitation, as a fusion protein, to a peptide that comprises an antigen-binding molecule such as, for example and without limitation, a scFv (Morita el al. (2016). Targeted DNA demethylation in vivo using dCas9-peptide repeat and scFv-TETl catalytic domain fusions. Nat Biotechnol 34, 1060- 1065.).
[0091] Provided herein are compositions for treating a wound. In non-limiting embodiments, the wound may be accompanied by ischemia. In non-limiting embodiments, the wound is in a patient with diabetes or a similar metabolic disorder, for example those known to be associated with poor blood flow / perfusion. In non-limiting embodiments, the patient has a wound, accompanied by ischemia, and has Type I or Type II diabetes or is pre-diabetic.
[0092] In non-limiting embodiments, the composition includes a CRISPR / dCas9-based demethylation cocktail targeting a methylated endothelial PLCy2 promoter. In non-limiting embodiments, the composition includes at least one independent guide RNA targeting a PLCy2 promoter sequence, for example a mouse sequence, having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 (CTGTTCTCTTGGCTAAGCGATCGCGGCCAGGCAGGTGGTACTGGGGCTGCCTCA GTTTCCCCCTGGTCGGGCAAGGCATGACTCTTTTAGGATGCTCTGGCGGGTCGGGACCCGCCTTGAGACAGGGCGGCGCGTTAAGGGGGGCGGCCCCGAGGAGTCACGT GGCGCGGCCGCCTCCAAAGCAGAAGTAAGGAGCGCCGCTGAGCAAGACCTGCGC TGCCGGACTGCCCGGGCCCCAGGCGGCTGCTGCACGAGGGACCCCCGAGTCCCC CCAACCCGTGGCTGGCAGGCCCAGGGATTGTGCGGGTGGCTGCGCTCCGGGGGT ACCGCCAGGTGAGTAGCCAGGATGGATGGAGCTCCCCGGGGACTTGCGCGTGTG CGGGGACCCTAGAGCTGGCACCGCGTTGGGTGGGGACTGCGCCGGAGCCCAAGA GGGCGCGGGCAGGGCTGGGGTGCGCGATCCGGGCAGGTGGCCGGGTGTGCCCTG GGGAACCCTTGCTTAGGGACAGCCGGGCCCGGCCCAGCCGCCGGCCACTTCCTCT CCTGGGGCTGGCGCCACCTCTCCAGGGTGAGCAGTGGCCAACTAGGGTTTGAAT GAGAGACGCGGCTCCGGGTGCTGGGGTGGCCGAAGCGTCTACCTCGCCACCGAG AGTCCTACGCGGGAGCCGCGTCCCTGCTTGCGGGGACTTGATTTTGAACAGTACT TCCCAGTAGTACACAGGTGGCTCCGGGGTGGGGCGGAGCAGCTCTTTCTCCACAC GCGATTCTGGGACCCGCCCCTCCCGCAATTCAGTTCAGTTTGGGGATCTCAAAGA GGTCATTTGCCTCGCGGGGAGCCAGAATTCGAAGGGAAGGTGGGTTGTATCCGG ACCTAGGAGGTTGATA) or a nucleic acid comprising a gene for expressing at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14. In non-limiting embodiments, the composition includes at least one independent guide RNA targeting a PLCy2 promoter sequence, for example a human sequence, having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 15 (CTCCAGGAATGCCATGATATTGGGGAATTCCCTTTGCACCTGGCCAAGTGGCCT CGGGCAGGTAGCCTCCCCTCGGGTTGCCTCAGTTTCTTCTTTGGCACGCAGAGGC GGGGCTCCAGGCCTGGGCCGCTCCATGGCGGGGAGGGCGCGGGGACGCTGCACT CGGGGTGCGCTCCGAGAGGCGGACCCGGCTGGGCGCGCCTGGGGCGGGGCGAG GCGGGGCGAGGCTGGGCGGTGCGGGGGGCGGCCCCCGAGGATCACGTGGCGCG GCGCCGCGGCCGAAGCAGAAGTAGCGAGCGCCGGCGGCGGAGGGCGTGAGCGG CGCTGAGTGACCCGAGTCGGGACGCGGGCTGCGCGCGCGGGACCCCGGAGCCCA AACCCGGGGCAGGCGGGCAGCTGTGCCCGGGCGGCACGGCCAGGTGAGCTGCCC GGCCGGGAGCGAGGCAGGCAGGGCGCCCAGGGACCTGCGCCCCGCGGGGACCG GCTCCCAGGGCGCTGCGTCCGAGGGGGTCTGCGTCCTGGCTCAGCCGGAGCGGG CAGGGACGGGGCGCACCCTCGGGGACCCCGGCCCGCCGTGCCCGGGGTCCGTTT GGTGACGGCAGGGATCCTGGCCCAGCCGCTGGCCACTTCCTCACCCCGGGCCGG CGCCACCTCTCCGGTCCGTGCGGTGGGGCGGCCCCAGCTTTGAATGGGGACCGG GAGGAAGGTCAGGGGTCGTGTGGGGGCTGGCGTTCAAAACTCCTCTTTTCGAGCGGCTCTGCGTGGGGTGGCGCCGTCTCTCTTGACGGCCCTTGTGCCCAGAGCTCGC GGACGCTCGGAGCCACACTTCCCTGTCTCACTTCGGTGGTTGCGGGTGGCGGGTG GGAGCGATACCGCGGGAGGCGCAGTCCTTCCCGGAGA) or a nucleic acid comprising a gene for expressing at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 15. In non-limiting embodiments, the composition includes a dCas9 linked to an antigen binding partner or a nucleic acid comprising a gene for expressing a dCas9 linked to an antigen binding partner. Suitable antigen binding partners are known to those of skill in the art and may include those described herein.
[0093] In non-limiting embodiments, the composition also includes a catalytic domain of a DNA demethylase linked to an antigen-binding regent or a nucleic acid comprising a gene for expressing a catalytic domain of a DNA demethylase linked to an antigen-binding reagent. Suitable antigen-binding reagents are known to those of skill in the art and may include antibodies, antibody derivatives, antibody fragments, and / or scFvs (including, without limitation, those directed to GCN4).
[0094] In non-limiting embodiments, the composition may include at least two, for example at least two or at least three, independent guide RNAs, each targeting the same or different sequences of the PLCy2 promoter sequence, or at least two nucleic acids each including genes for expressing independent guide RNAs targeting the same or different sequences of the PLCy2 promoter sequence. In non-limiting embodiments, the at least two independent guide RNAs each target different sequences.
[0095] In non-limiting embodiments, a useful guide RNA may include at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or a nucleic acid with a gene for expressing the guide RNA may include at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3. Suitable guide RNAs may be designed based on the target sequence of interest, and, thus, for a human PLCy2 promoter sequence (such as SEQ ID NO: 15 or a sequence having 90%, 95%, or greater sequence identity to SEQ ID NO: 15), it is within the level of one of skill in the art to designuseful guide RNAs. For example, and without limitation, in non-limiting embodiments, a useful guide RNA may include a sequence selected from any sequence or sub-sequence included within SEQ ID NO: 15 or a sequence that is complementary to SEQ ID NO: 15, including sequences of at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases.
[0096] In non-limiting embodiments, the guide RNA may be driven by a tissue-specific promoter. Tissue-specific promoters are known to those of skill in the art and may include those selective for a given cell type, such as endothelial cells, including, without limitation a CDH5 promoter, a PEC AMI promoter, and / or a VWF promoter.
[0097] In non-limiting embodiments, the composition may include a fusion protein formed of a dCas9 and a peptide. In non-limiting embodiments, the composition may include a nucleic acid including a gene for expressing a fusion protein (for example one formed of a dCas9 and a peptide). Useful peptides for the purposes disclosed herein may include, without limitation, repeating peptides. Useful repeating peptides may include those including a GCN4 repeat.
[0098] In non-limiting embodiments, the composition includes a catalytic domain of a DNA demethylase from a TET family of enzymes, such as TET1.
[0099] In non-limiting embodiments, the composition may include a therapeutic agent.
[0100] In non-limiting embodiments, the therapeutic agent is a hormone and / or pro-hormone, such as estrogen, progestin, progesterone, growth hormone, thyroid-stimulating hormone, oxytocin, follicle-stimulating hormone, luteinizing hormone, testosterone, cortisol, prolactin, corticotropin-releasing hormone, gonadotrophin-releasing hormone, somatostatin, thyrotropinreleasing hormone, antidiuretic hormone, corticotropin, melatonin, thyroxine, triiodothyronine, reverse triiodothyronine, calcitonin, aldosterone, DHEA, epinephrine, norepinephrine, insulin, glucagon, leptin, adiponectin, plasminogen activator inhibitor- 1, angiotensin, angiotensinogen, erythropoietin, renin, vitamin D, insulin-like growth factors (IGFs), such as IGF-1, ghrelin, somatostatin, glucagon-like peptides (GLPs), such as GLP-1, and / or the like.
[0101] In non-limiting embodiments, the therapeutic agent is a growth-enhancing factor, which as utilized herein means a composition that enhances, accelerates, and / or promotes healing following trauma. In non-limiting embodiments, such growth-enhancing factors include growth factors, such as, without limitation, a neurotrophic or angiogenic factor, which optionally may be prepared using recombinant techniques. Non-limiting examples of growth factors include basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF),vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), insulin-like growth factors 1 and 2 (IGF-1 and IGF-2), platelet derived growth factor (PDGF), stromal derived factor 1 alpha (SDF-1 alpha), nerve growth factor (NGF), ciliary neurotrophic factor (CNTF), neurotrophin-3, neuro trophin-4, neurotrophin-5, pleiotrophin protein (neurite growthpromoting factor 1), midkine protein (neurite growth-promoting factor 2), brain-derived neurotrophic factor (BDNF), tumor angiogenesis factor (TAF), corticotrophin releasing factor (CRF), transforming growth factors alpha and beta (TGF-a and TGF-P), interleukin-8 (IL-8), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukins, and interferons. Commercial preparations of various growth factors, including neurotrophic and angiogenic factors, are available from R & D Systems, Minneapolis, Minnesota; Biovision, Inc, Mountain View, California; ProSpec-Tany TechnoGene Ltd., Rehovot, Israel; and Cell Sciences®, Canton, Massachusetts.
[0102] In non-limiting embodiments, the therapeutic agent is a cytokine, for example a pro- inflammatory cytokine and / or an anti-inflammatory cytokine. In non-limiting embodiments, the therapeutic agent may be, without limitation, an interleukin, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL- 19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, IL-39, and / or IL-40, tumor necrosis factors (TNF), such as TNF-a, interferons (IFN), such as IFN-a, IFN-P, and / or IFN-y, colony-stimulating factors (CSF), such as G-CSF, chemokines, lymphokines, monokines, and the like known to those of skill in the art.
[0103] In non-limiting embodiments, the therapeutic agent is a drug. As used herein, the terms "drug" and "drugs" refer to any compositions having a preventative or therapeutic effect, including and without limitation, antibiotics, antivirals, antimycotics, peptides, hormones, organic molecules, steroids, NSAIDS, vitamins, supplements, factors (including growth factors), proteins, and chemoattractants.
[0104] In non-limiting embodiments, the drug is an antimicrobial agent, such as, without limitation, isoniazid, ethambutol, pyrazinamide, streptomycin, clofazimine, rifabutin, fluoroquinolones, ofloxacin, sparfloxacin, rifampin, azithromycin, clarithromycin, dapsone, tetracycline, erythromycin, ciprofloxacin, doxycycline, ampicillin, amphotericin B, ketoconazole, fluconazole, pyrimethamine, sulfadiazine, clindamycin, lincomycin, pentamidine, atovaquone, paromomycin, diclazaril, acyclovir, trifluorouridine, foscarnet, penicillin, gentamycin, ganciclovir, iatroconazole, miconazole, Zn-pyrithione, and silver saltssuch as chloride, bromide, iodide and periodate. Exemplary antimicrobial agents are known to those of skill in the art.
[0105] In non-limiting embodiments, the drug is an antimycotic agent, such as clotrimazole, fluconazole, ketoconazole, posconazole, voriconazole, isavuconazole, nystatin, amphotericin B, flucytosine, echinandins, and / or micafungin. Exemplary antimycotic agents are known to those of skill in the art.
[0106] In non-limiting embodiments, the drug is an antiviral agent (which as used herein includes antiretroviral agents), such as adamantane antivirals, antiviral boosters, antiviral combinations, antiviral interferons, chemokine receptor antagonists, integrase strand transfer inhibitors, miscellaneous antivirals, neuraminidase inhibitors, non-nucleoside reverse transcriptase inhibitors (NNRTIs), non- structural protein 5A (NS5A) inhibitors, nucleoside reverse transcriptase inhibitors (NRTIs), protease inhibitors, and / or purine nucleosides. Exemplary antiviral agents are known to those of skill in the art.
[0107] In non-limiting embodiments, the drug is an anti-inflammatory agent, such as, without limitation, an NSAID, such as salicylic acid, indomethacin, sodium indomethacin trihydrate, salicylamide, naproxen, colchicine, fenoprofen, sulindac, diflunisal, diclofenac, indoprofen, sodium salicylamide; an anti-inflammatory cytokine; an anti-inflammatory protein; a steroidal anti-inflammatory agent; or an anti-clotting agent, such as heparin. Other drugs that may promote wound healing and / or tissue regeneration may also be included.
[0108] In non-limiting embodiments, the therapeutic agent is a VEGF or a nucleic acid including a gene for expressing a VEGF (such as an open reading frame of a VEGF, for example of VEGFA).
[0109] In non-limiting embodiments, the composition includes a buffered solution, for example a buffered saline solution, such as saline, for example phosphate-buffered saline (PBS). In non-limiting embodiment, the buffered solution includes a 23.4% solution of sodium chloride..
[0110] In non-limiting embodiments, the composition may further include a polymer, including natural polymers (for example, a polysaccharide, a polypeptide, a nucleic acid-based polymer, a silk, a wool, and / or a cellulose), synthetic polymers, and combination polymers (for example, and without limitation, collagen, laminin, fibronectin, polyethylene glycol, gelatin, alginate, polydimethylsiloxane (PDMS), polyethylene terephthalate (PET), non-PET thermoplastic polymers such as polymethyl methacrylate (PMMA), polycarbonate (PC), polystyrene (PS), cyclo-olefin-copolymers (COCs) (e.g., Topas), cyclo-olefin polymers (COPs) (e.g., Zeonor, Zeonex), polymethyl methacrylate (PMMA), polyetheretherketone(PEEK), polyetherimide (PEI), polysulfone, polyphenolsulfone (PPSU), ultra-high molecular weight polyethylene (UHMW-PE), polyamideimide (PAI), polytetrafluorethylene (PTFE), polycarbonate (PC), polyester such as polyethylene terephthalate (PET) and polybutylene terephthalate (PBT), polystyrene (PS), polysulfone (PSU), and delrin (acetal homopolymer), polyester (PE), polyurethane (PU), poly(ester urethane) urea (PEUU), poly(ether ester urethane) urea (PEEUU), poly(ester carbonate urethane)urea (PECUU), and polycarbonate urethane)urea (PCUU) copolymers, and other suitable polymeric materials, such as are disclosed, for example and without limitation in U.S. Patent Nos. 8,535,719; 8,673,295; 8,889,791; 8,974,542 and 9,023,972, the contents of which are incorporated herein by reference in their entirety). In non-limiting embodiments, the polymer may be a hydrophilic polymer. In view of the intended uses of the compositions described herein, those of skill will appreciate that any polymer useful herein, for example and hydrophilic polymer, may be biocompatible. In non-limiting embodiments, the polymer is bioerodible.
[0111] In non-limiting embodiments, a composition as described herein may include a plasmid containing one or more nucleic acids for expressing a guide RNA targeting a PLCy2 promoter sequence as described herein. In non-limiting embodiments, a composition as described herein may include a plasmid containing one or more nucleic acids for expressing a dCas9 linked to a peptide as described herein. In non-limiting embodiments, a composition as described herein may include a plasmid containing one or more nucleic acids for expressing a catalytic domain of a DNA methylase linked to an antigen-binding reagent as described herein. Suitable plasmids, which include those safe for use in human patients, are known to those of skill in the art, and include pcDNA3.
[0112] Also provided herein are kits including a composition as described herein. In nonlimiting embodiments, the kit may also include a device for delivery of a composition as described herein, for example a composition for viral and / or non-viral transfection, and / or a device suitable for electroporation and / or tissue nanotransfection. In non-limiting embodiments, the kit may include one or more electrodes, for example two electrodes, a power source, for example a battery, an electroporation chip, for example a tissue nanotransfection (TNT) chip, such as a TNT 2.0 chip, a buffer, such as saline or PBS as described herein, and / or an agent for cleaning, exfoliating, and / or disinfecting a patient’s skin. As used herein, TNT refers to gene transfer technology, for example electromotive and / or electroporation-based gene transfer technology, developed to achieve tissue reprogramming in vivo.
[0113] Also provided herein is a method of treating a patient with a composition as described herein. In non-limiting embodiments, the patient has a wound, for example an ischemic wound.In non-limiting embodiments the wound is a chronic wound. In non-limiting embodiments, the patient has experienced an ischemic event. In non-limiting embodiments, the patient is diagnosed with diabetes and / or another metabolic disorder, for example those known to be associated with poor blood flow / perfusion. In non-limiting embodiments, the patient has an ischemic disease, such as peripheral artery disease, coronary artery disease, and / or cerebrovascular disease. In non-limiting embodiments, the patient has a wound, accompanied by ischemia, and has Type I or Type II diabetes or is pre-diabetic. In non-limiting embodiments, the methods may include administering to the patient an amount of a CRISPR / dCas9-based demethylation cocktail targeting a demethylate endothelial phospholipase Cy2 (PLCy2) promoter in the patient effective to demethylate the endothelial PLCy2 promoter in the patient and administering vascular endothelial growth factor (VEGF) to the patient in amounts effective to treat the wound. In non-limiting embodiments, the cocktail is administered with TNT technology.
[0114] In non-limiting embodiments, a composition as described herein, for example including a CRISPR / dCas9-based demethylation cocktail targeting a methylated endothelial PLCy2 promoter, is administered to the patient through a device, which may include a reservoir and one or more microneedles. In non-limiting embodiments, the composition is administered before, during, and / or after a growth factor, such as VEGF, is administered to the patient. In non-limiting embodiments, the composition is administered before, during, or after an ischemic event. In non-limiting embodiments, the composition is administered after an ischemic event, for example up to 1, 2, 3, 4, 5, 6, or7 days after an ischemic event. In non-limiting embodiments, the composition is administered up to 3 days following an ischemic event. In non-limiting embodiments, a growth factor, such as VEGF, is administered to the patient after an ischemic event, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days following the ischemic event and / or following administration of a composition (such as a CRISPR / dCas9-based demethylation cocktail targeting a methylated endothelial PLCy2 promoter) as described herein. In non-limiting embodiments, the growth factor, such as VEGF, is administered up to 7 days after a composition as described herein (such as a CRISPR / dCas9-based demethylation cocktail targeting a methylated endothelial PLCy2 promoter) is administered. Those of skill will appreciate that administration regimens described herein may be repeated. That is, a composition and / or a therapeutic agent as described herein may be delivered more than once to a patient.
[0115] In non-limiting embodiments, the method includes administering a composition as described herein and / or a therapeutic agent as described herein in an amount effective to improve blood flow and / or vascularization in the patient.
[0116] In non-limiting embodiments, a composition and / or a therapeutic agent as described herein are administered to ischemic tissue. In non-limiting embodiments, a composition and / or a therapeutic agent as described herein are administered to a site of a wound, such as a diabetic wound.
[0117] In non-limiting embodiments, the composition described herein is delivered with a hydrogel. Useful hydrogels, described herein and known to those of skill in the art, may be arranged in sheets for topical application of the composition, and / or may be formed into microneedles for application to a patient’s skin. Suitable hydrogels for delivery of compositions, for example, controlled delivery, are known to those of skill in the art any may include ECM-based hydrogels, polymer-based hydrogels (including natural polymers (including those described herein), synthetic polymers (including those described herein), and hydrogels including a mixture of ECM, natural polymers, and / or synthetic polymers), and may be biocompatible and / or dissolvable (for example, bioerodible). Useful hydrogels may be fully natural (or natural molecule(s)-derived), synthetic, or semi- synthetic (a mixture of natural and synthetic (bio)materials). In the “natural” domain, the hydrogels can be, for example, a fibrin network holding natural polymers or derivatives (e.g., collagen, laminin, fibronectin) in place. In other words, fibrin (a natural molecule) may be the scaffold keeping other extracellular matrix proteins of interest together. In the “synthetic” domain, the hydrogels can be, for example, biocompatible polymers or their derivatives (e.g., PEGs) to generate a scaffold holding the cells. In the “semi- synthetic” domain, the hydrogels may include a combination of natural and synthetic polymers. Suitable hydrogels may be reverse gelling hydrogels (those gelling at elevated temperatures, for example those having a lower solution critical temperature (LCST) of 25 degrees Celsius to 37 degrees Celsius, 25 degrees Celsius or higher, 37 degrees Celsius or higher, or any value or subrange therebetween. In non-limiting embodiments, the hydrogel containing the composition is applied topically in one or more sheets, or as one or more hydrogel microneedles.ExampleBackground
[0118] Type 2 diabetes mellitus (T2DM) accounts for over 90% of diabetes cases and is often associated with secondary complications. Sustained elevated glucose levels in diabetic individuals contribute to endothelial dysfunction, hinder angiogenesis, and facilitate theoccurrence and progression of nonhealing chronic ulcers. Diabetic wounds, impacted by ischemia and insufficient angiogenesis, show decreased vascularity and capillary density, resulting in poor perfusion. Ischemia is a common complication of diabetic chronic wounds which results from underlying vasculopathy and is intensified by persistent inflammation. Reliance on VEGF therapy to improve perfusion makes logical sense, yet clinical study outcomes fall far short of expectations. It is critically important to troubleshoot barriers and to establish a therapeutic regimen that delivers desirable functional outcomes. Possible factors limiting VEGF therapy outcomes include insufficient local concentration of VEGF signaling partners and regression of immature vessels9. To circumvent the low-efficiency hurdle of VEGF single-gene “monotherapy”, combined gene augmentations are being investigated. Recently, through single-cell RNA-sequencing (scRNA-seq) in uninjured skin, it has been reported that in the diabetic ischemic limb, Phospholipase C gamma 2 (PLCy2) transcript abundance remain low, accounting for diminished efficiency of VEGF therapy (Rustagi et al. (2022). Endothelial Phospholipase Cgamma2 Improves Outcomes of Diabetic Ischemic Limb Rescue Following VEGF Therapy. Diabetes 77, 1149-1165.). However, the underlying mechanisms of such a blunted response remain unknown. Additionally, it is not known that is there any PLCy2hlsubcluster of dermal endothelial cells is responsible for the augmentation of VEGF therapy in diabetic tissue. Understanding such PLCy2 responsive wound-edge endothelial cell diversity and responses to diabetic conditions is vital for developing targeted strategies to augment VEGF therapy for chronic wound perfusion and healing. In the present study scRNA-seq technique was applied to identify endothelial cell diversity between human diabetic and non-diabetic wound-edge and to characterize them by PLCy2 gene expression.
[0119] Emerging evidence demonstrate that hyperglycemia and ischemia in combination leads to DNA methylation and subsequent epigenetic silencing in the complex interplay between genes and the environment in diabetic subjects. Ischemia induced increase in DNA methyltransferases (DNMTs) levels may result in hypermethylated vasculogenic genes such as endothelial nitric oxide synthase (eNOS), vascular endothelial growth factor (VEGF), and VEGFR2, thereby causing endothelial dysfunction. Such gene promoter hypermethylation contributes to a “metabolic memory” that results in vascular dysfunction in diabetic individuals even after achieving glycemic control. The administration of 5-azacytidine (5-aza), a global demethylating agent, improved vasculogenic and healing outcomes. However, 5-aza mediated demethylation events are not gene- specific and are therefore limited in their ability to provide specific mechanistic insights. This limitation can be addressed by employing the CRISPR- dCas9 approach of gene targeted methylation editing. The present study investigates themechanism behind observed downregulation of PLCy2 expression in diabetic tissue. In addition, this study presents a novel therapeutic approach to rescue PLCy2 abundance and function to improve the efficiency and robustness of vasculogenic VEGF therapy during wound healing in diabetic subjects. This work recognizes that optimal VEGF therapy requires a favorable methylation status of its downstream signaling molecules. Recognition that the rescue of PLCy2 expression from hyperglycemia-dependent-hypermethylation can stimulate tissue vascularization in diabetics may help reconsider the therapeutic benefits of VEGF therapy.
[0120] In this work, bipedicle ischemic wounds were placed in diabetic mice. PLCy2 promoter CpG methylation were analyzed using bisulfite sequencing. To specifically demethylate PLCy2 promoter in endothelial cells during VEGF therapy, a CRISPR / dCas9 based demethylation cocktail was delivered to the wound-edge using tissue nano-transfection (TNT) technology. The functional outcome of such demethylation was assessed using perfusion imaging. PLCy2 promoter was hypermethylated murine diabetic ischemic wound-edge. Demethylation-based upregulation of PLCy2 during VEGF therapy improved wound tissue blood flow with increased abundance of vWF+ / PLCy2+vascular elements by activating p42 / p44-MAPK>HIFla pathway. Taken together, topical TNT-based endothelial demethylation of the PLCy2 gene promoter improved effects of VEGF therapy on the perfusion of cutaneous diabetic wounds resulting in improved closure.Materials and MethodsHuman Subjects:
[0121] Surgically discarded and deidentified human chronic wounds were obtained from individuals undergoing surgeries who were clinically diagnosed with diabetes or who did not have diabetes. The demographics of subjects included in this study are provided in Table 1.Table 1
[0122] A chronic wound as per standard definition is a wound that fails to progress towards healing or respond to treatment over the normal expected healing timeframe (4 weeks). A total of twelve nondiabetic and twelve diabetic wound-edge tissue samples were investigated in this study. Out of these, three T2DM and five nondiabetic skin samples were used for scRNA-seq analysis, and others were used for validation studies (Table 1). The patients with T2DM (n = 12; 10 male, 2 female; 10 Caucasian, and 2 African American) had a mean age of 63.3 ± 11.5 years (mean ± SD). The group without diabetes (n = 12; 8 male, 3 female, 1 unknown; 9 Caucasian, and 2 African American, 1 unknown) had a mean age of 50.6 ± 14.2 years (mean ± SD). The subjects with T2DM (n = 12) had an HbAlc value of 9.1 ± 2.9% (mean ± SD). Additional single cell RNA sequencing data from diabetic foot ulcer patients (n = 7 samples) were retrieved from the GEO database (accession number GSE165816, average age 44.0+8.1 years).Single cell RNA sequencing (scRNA-seq):
[0123] Single-cell suspensions were generated from the diabetic (n=5) and non-diabetic (n=5) wounds using a lOx genomics platform. Briefly, the tissue was chopped into small pieces and subjected to enzymatic dissociation using a whole-skin dissociation kit (cat. no. 130-101-540) in MACS C Tubes (cat. no. 130-093-237; Miltenyi Biotec, San Diego, CA). The samples were incubated in a water bath at 37°C for 3 h. After incubation, the samples were diluted by adding 0.5 mF of cold complete cell culture medium to stop the enzymatic reaction. The C Tubes were then tightly closed and attached upside down onto the sleeve of the gentle- MACS OctoDissociator, and a UW human skin dissociation program was performed. The cell suspension was subjected to a 70-pm filter and placed on a 15-mL tube to remove the debris. RBCs were lysed using 10X RBC lysis buffer (cat. no. 420301; BioLegend, San Diego, CA). The resulting cell suspension was used for scRNA-seq using the lOx Genomics platform using Chromium Next GEM Single Cell 30 GEM, Library & Gel Bead Kit v3.1 (lOx Genomics) and sequenced on an Illumina NovaSeq 6000 (Illumina).Determination of cell-type identity:
[0124] Obtained raw scRNA-seq data were processed using CellRanger and analyzed using Seurat v4.0 package in R. Processed data were examined for read quality in R and stored as Seurat objects. Briefly, quality filtering of the samples was performed using “subset” module in Seurat. Cells qualifying multiple thresholds including mitochondrial content <15%, cells expressing > 200 genes, and genes uniquely expressed in >3 cells were considered for downstream analysis. Quality filtered data of 66709 cells were normalized using the SCTransform and integrated using reciprocal principal component analysis (rpca) function in Seurat. Further, unsupervised analysis of the integrated samples was performed using principal component analysis (PCA). Principal components thus obtained were projected to identify the cluster of cells using “FindNeighbors” followed by “RunUMAP” (Uniform Manifold Approximation and Projection) and “FindClusters” (at 25% resolution) analyses in Seurat. Twelve cluster of cells were identified and subsequently annotated to different cell compartments based on known signature of cells and established marker genes documented in PanglaoDB.Sub-clustering and differential expression analysis:
[0125] Cluster 0, consisted of 12576 cells expressing high VWF, PECAM1 and CDH5 with low LYVE1, and was characterized as vascular endothelial cells. The expression profile and cell distribution of these genes were visualized using the ‘FeaturePlot’ module in Seurat. Further, this endothelial cell cluster was isolated using “subset’ module in Seurat, sub-clustered and visualized in UMAP plot as described previously. Signature genes of endothelial cell subsets were collected from previous studies and annotated for identification of subtypes. The proportion of these subsets were computed and compared between the groups using student’s t-test. Next, the expression level of PLCy2 was extracted and tested for significant differential changes between the groups in subsets using Wilcoxon rank-sum test.
[0126] In addition, scRNA-seq data from 7 wound samples retrieved from the GEO database (accession number GSE165816) were quality filtered, normalized and integrated as described previously. Vascular endothelial cells (VWFhl, PECAMlhl, CDH5hland LYVEllow) wereisolated and re-analyzed separately. Identities of endothelial cell subsets from the data was considered as reference ID and digitally transferred onto the vascular endothelial cell cluster of this additional cohort using ‘Integration and Label Transfer’ approach of Seurat. Next, the endothelial cells were merged with prospective samples used in this study using ‘merge’ function of Seurat with retained normalization. PLCy2 level was compared using FindMarkers between the combined diabetic and non-diabetic wounds.Animal studies:
[0127] Commercially available, adult (8-12-week-old male mice, 25 g in weight) C57BL / 6 mice, obtained from The Jackson Laboratory (Bar Harbor, ME), were used for the experiments. For diabetic induction, mice were injected with streptozotocin (STZ) in the intraperitoneal region (50 mg / kg, 5 days) prepared in citrate buffer (sodium citrate, 0.05 mol / L, 4.5 pH). Mice were fasted for 6 h at the time of STZ injection with free access to water. Two weeks after the STZ injection, blood samples were collected by tail venipuncture for the estimation of blood glucose levels. Blood glucose levels were assessed using the Bayer Contour blood glucose monitoring system. Animals with fasting (6-h) blood glucose levels for two consecutive readings of >250 mg / dL (14 mmol) were considered diabetic. Mice were housed individually after surgery with a 12-h light / dark cycle and temperature in the institutional animal facilities and allowed access to food and water ad libitum.Laser capture microdissection (LCM):
[0128] Laser capture microdissection was performed using the laser microdissection system from PALM Technologies (Bemreid, Germany). Briefly, a rich fraction of dermal keratinocytes (KRT14+; Cat# NBP2-34403AF488 Alexa Fluor® 488); fibroblasts (COL1A2+; Cat# sc-393573 PE); endothelial cells (vWF+; Cat# ab310904 PE) from murine skin and endothelial cells from human wound edges was identified using FITC Mouse anti-Human CD144 (Cat# 560411, Becton Dickinson), cut and captured under a 20X ocular lens. The samples were catapulted into 25 pl of cell direct lysis extraction buffer (Invitrogen). Approximately 10,00,000 pm2of tissue area was captured into each cap and the lysate was then stored at -80 °C for further processing.Ischemic bi-pedicle flap model:
[0129] The bipedicle ischemic wound was induced by a stent wound (3mm) in the middle of flap on dorsal side to study ischemic tissue perfusion. Briefly, STZ-induced diabetic mice were anesthetized with 1-3% isoflurane and placed on a heated pad. Preoperative analgesia was obtained using a subcutaneous injection of buprenorphine and carprofen. Two parallel 30 mm full thickness incisions on either side of the midline are 10mm apart from each other. A fullthickness flap was raised within the boundaries of the above incisions keeping the cranial and caudal pedicles intact pedicles intact. Incised edges were cauterized to retard the growth of new blood vessels. A circular 3mm stent wound was made at the center of the flap using a sterile disposable dermal punch biopsy tool. Two additional similar wounds were created on the adjacent normal skin at the same level along the cranio-caudal axis. The wounds are covered with air permeable dressing and then bandaged with clinical white cloth tape.In vivo non-viral transfection using tissue nanotransfection 2.0 technology:
[0130] In a wound setting, gene delivery approach has important consequences of its own. Unrelated to wound biology, work from the Cooke lab elegantly showed how transduced viral vector delivery itself could be a component of the “active principle” of an intervention (Sayed et al. (2015). Transdifferentiation of human fibroblasts to endothelial cells: role of innate immunity. Circulation 131, 300-309.).
[0131] In a wound setting, regulatory barriers are lower for non-viral gene delivery approaches. Among non-viral approaches, multiple alternatives including lipid-based and bulk electroporation (BEP) have been tested. Wound outcomes are clearly different for each of these approaches. For example, fragile wound tissue is highly sensitive to BEP which causes additional tissue injury thus blunting recovery. TNT employs a gentler nano-electroporation based delivery of plasmid producing the results as reported. A murine ischemic bipedicle wound model was utilized to deliver VEGF ORF and demethylation Cocktail. Electrical force was used to deliver plasmid into skin through TNT2.0. TNT was applied on skin flap adjacent to the wound site.
[0132] The administration regime was decided based on a previous publication where treatment of ischemic wounds with a global DNA topical application of 5-azacytidine (5-aza), a DNA methylation inhibitor, on day 1 post-wounding was able to rescue the ischemia and improve the wound healing rate (Singh et al. (2022). Genome-wide DNA hypermethylation opposes healing in patients with chronic wounds by impairing epithelial-mesenchymal transition. J Clin Invest 132(17):el57279.). In the present study, the vasculogenic demethylation cocktail was administered on day 1 post-ischemic wounding. This timing was also intended to influence the early stages of wound healing, including the inflammatory phase. It has been hypothesized that by potentially reversing the hypermethylation of genes involved in the inflammatory response, demethylation could help in normalizing the inflammatory process, which is often dysregulated in diabetic wounds. For the proposed rescue to be effective it is important that the tissue be viable. The intervention is ineffective on day 7 post-ischemia when tissue viability is clearly compromised. This observation is consistent with Singh et al.((2022). Genome-wide DNA hypermethylation opposes healing in patients with chronic wounds by impairing epithelial-mesenchymal transition. J Clin Invest 132(17):el57279.).
[0133] To optimize delivery, the skin at the edges of the wound was exfoliated to remove dead keratinized cell layers, exposing nucleated epidermal cells. The demethylation cocktail (2000 ng of each plasmid in 500 pL of IX PBS) was prepared at a concentration of 0.04 ng / pL, with or without the VEGFA ORF plasmid. A gold-coated electrode (cathode) was immersed in the plasmid solution, and a 25G needle counter electrode (anode) was inserted into the dermis below the flap. Pulsed electrical stimulation (10x10 ms pulses, 100V, current: <10 Amp) was applied across the electrodes to drive the demethylation cocktail into the tissue. A similar gRNA plasmid, non-targeting control gRNA having no hits of >70% homology to any sequence in any organism in the NCBI database was used as scrambled control.Plasmids for targeted DNA demethylation:
[0134] Targeted DNA demethylation was performed as described previously, using the endothelial cell-specific guide RNAs specific to murine PLCy2 promoter-associated CpG island (Position: mml0_chr8: 117498197-117498881; 62 CpGs; pcDNA3.1 / CDH5-gRNA PLCv2). To achieve endothelial specificity, CDH5 promoter associated with RNA polymerase III was used to drive guide RNA (gRNA) expression. While it is more common to use RNA polymerase III (Pol III) promoters such as U6 or Hl for gRNA expression, the study employed the CDH5 promoter. CDH5 is a tissue- specific promoter selectively expressed in endothelial cells, making it suitable for the targeted gene-editing approach in vascular tissues. Specifically, the gRNA is driven by the CDH5 promoter and terminated by a Pol III terminator, to achieve endothelial cell-specific expression of the gRNA. In a preliminary in vitro study using Mouse Pulmonary Endothelial Cells (MPEC), three independent PLCy2 specific guide RNAs were tested (gRNA 1: GTACACAGGTGGCTCCGGGG (SEQ ID NO: 1); gRNA2: GCGGGGAGCCAGAATTCGAA (SEQ ID NO: 2); gRNA3:GGTGGGTTGTATCCGGACCT (SEQ ID NO: 3)) using individual gRNAs and a combination of three gRNAs together. Combining gRNAs (1+2+3) resulted in a more pronounced demethylation effect than using a single gRNA of PLCy2 promoter. Hence three guide RNA cocktail was used for follow-up in vivo studies. Antibody (scFv)-fused TET1CD (pCAG-scFvGCN4sfGFPTETlCD)) and dCas9 fused with peptide repeat (pCAG-dCas9- 5xPlat2AflD) were gifts from Izuho Hatada (Gunma University, Maebashi, Japan) (Addgene plasmids 82561 and 82560) (Morita et al. (2016). Targeted DNA demethylation in vivo using dCas9-peptide repeat and scFv-TETl catalytic domain fusions. Nat Biotechnol 34, 1060- 1065.).Bisulfite conversion and sequencing:
[0135] DNA was isolated from cultured endothelial cells, murine skin tissue and LCM- captured skin tissue elements using QIAamp DNA mini kit according to the manufacture protocol. EZ DNA Methylation-Gold kit (Zymo Research) was used to accomplish bisulfite conversion of genomic DNA and amplification was performed using Platinum™ II Taq Hot- Start DNA Polymerase. The primers for the sequencing region of the human PLCy2 promoter were used: forward, TTTTTTTTTTGGTATGTAGA (SEQ ID NO: 4); reverse, CCTACCCCAAATTTAAACTC (SEQ ID NO: 5). For sequencing the murine PLCy2 promoter, the following primers were used: Pl forward, TGTATTTTTTTTTGTTGGGGAAT (SEQ ID NO: 6); reverse, CCCTAATAATTACTTTAAATTC (SEQ ID NO: 7); P2 forward, TAGTTAGGATGGATGGAGTT (SEQ ID NO: 8); reverse, CTATCCCTAAACAAAAATTC (SEQ ID NO: 9); P3 forward, TAGTTTTTTTTTGGTTGGGTAAG (SEQ ID NO: 10); reverse, TCCTTACTTCTACTTTAAAAAC (SEQ ID NO: 11); P4 forward, GGGATTTGATTTTGAATAGT (SEQ ID NO: 12); reverse,CAAAACAAATAACCTCTTTAAAAT (SEQ ID NO: 13). A CpG site methylated in more than 10% of the total clones studied was assigned as methylated.Laser speckle imaging
[0136] Laser speckle imaging (PeriCam PSI; Perimed Inc., Sweden) was conducted presurgery, 2 h post-surgery to confirm successful blood flow and at the different time points mentioned (days 3, 7, and 10 post-surgery). Bipedicle flap perfusion was measured using Pimsoft software.Doppler blood flow ultrasonic acquisition.
[0137] To perform this experiment, first the target wound tissue was paired at least 2 hours prior and the mice were anesthetized using 1.5% isoflurane in tandem with supplemental oxygenated air (95% Carboxin) and positioned on a heated warm plate. A Vevo 2100 ultrasound system (FUJIFILM Visual Sonics Inc., ON, Canada) was optimized before knocking down the mice. A linear-array probe (MS400) transmitting 24 MHz frequency was activated to transmit ultrasound and receive echo signals from vessels and surrounding heterogeneous tissue at the wound edge. The probe was mounted on the probe stand and a 100% water-based ultrasound gel (Parker Laboratories, NY) was applied at the interface between the probe and the skin. This gel helped to avoid the air gap between the probe and the tissue. The probe was positioned on the target tissue to minimize the jitter motion to enable detecting the blood vessels. The echoes from the pulsating blood were detected as color-coded Doppler blood flow videos from color Doppler mode and pulse wave profiles from power wave(PW) Doppler mode. The scanning plane was selected parallel to the vascular bed and medial to wound edge artery and / or capillaries. By selecting sample volume digitally on the color- coded vessel regions in the scanning plane, PW Doppler wave forms were obtained at a depth of 1.5-3 mm for all blood flow quantifications. All raw data were converted to DICOM format and processed offline using VevoLab v2.0 software to measure the velocity time integral (VTI) and blood flow velocities at systole and diastole. These wave forms enabled calculating pulse pressure and, hence, allowed for the estimation of the pulsation of blood flow and the elasticity of the arteries.RNA extraction and real-time quantitative PCR:
[0138] RNA from cells, mice normal skin tissue or wound edge tissue sample was extracted by using miRVana miRNA isolation kit (Ambion, Thermo Fisher Scientific, cat. no. AM1560) according to the manufacturer’s instructions. The RNA quantity was measured using a NanoDrop ND- 1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA was reverse transcribed using SuperScript III First-Strand Synthesis System (Invitrogen, ThermoFisher Scientific, cat. no. 18080051). Quantitation of mRNA expression was studied using SYBR green-based real-time PCR (Applied Biosystems) by using gene-specific primers. Melting curve analysis was performed after the final extension to ensure the specificity of the products. 18S rRNA or P-Actin were used as housekeeping control. Relative expression of each gene represented as fold change over the control.Flow Cytometry Analyses:
[0139] Cells were stained according to the manufacturer’s protocol. Briefly, single cell suspensions from skin tissue were prepared by using macs single suspension kit protocol. Then scramble-gRNA or demethylation cocktail cells were incubated in IX fixative (True-Nuclear 4X Fix Concentrate) for 30 min and pelleted. They were then permeabilized by resuspending with vigorous vortexing 1 mF of lx permeabilization buffer (True-Nuclear 10X Perm Buffer) and incubated at 4 °C for at least 1 h. Cells were washed twice in the staining media (PBS containing 1% BSA) and then resuspended in staining media at 0.5-1 x 106 cells / 100 pF. Monoclonal antibodies against PECy2 #3872S, Cell Signaling Technology, Danvers, MA and vWF ; PECy2 #3872S, Cell Signaling Technology, Danvers, MA and COE1A2-PE; PECy2 #3872S, Cell Signaling Technology, Danvers, MA) were added and incubated for 1 h at room temperature then use respective species-specific Alexa Fluor fluorescent antibodies were added for Ih at room temperature. The cells were washed with staining media and pelleted. Finally, samples were resuspended in 100 mF staining media and analyzed by flow cytometer (BD FACS Aria Fusion and BD Aria III flow cytometer, BD Biosciences, 2350 Qume Drive, SanJose, CA 95131-1807). The fluorescence and light- scattering properties (forward scatter and side scatter) of the cells were determined. Signals from cells labeled with conjugated fluorophores were detected. BD FACS Diva software v.9 was used for cell sorting. All data were analyzed with FlowJo software (version 10.7.1). Gates were set manually. The gating strategy for the fluorophores has been shown in the respective figures.Histology, Immunohistochemistry, and Immunocytochemistry:
[0140] Biopsy samples of wounded skin, approximately 6mm in diameter, were harvested from mice at day 10. For histological analysis, transverse sections of the wounded skin, with a thickness of 10 micrometers, were prepared on slides. In immunostaining studies, six matched sections were utilized for comprehensive analysis. Utilizing trilogy, a steam bath at 6.6 psi and 110°C temperature was applied for 15 minutes. Sections were blocked in 5% normal goat serum in PBS for 1 h at room temperature (RT). The sections were incubated in the following primary antibodies in 2.5% normal goat serum in PBST overnight at 4°C: CD31 (1: 100), vWF (1:500), PLCy2 (1: 100), p-PLCy2(l:100), VEGF (1: 100), p-44 / 42 MAPK (1: 100), and HIFlalpha (1: 100). Sections were washed and visualized using the respective species- specific Alexa Fluor fluorescent antibodies (diluted 1:200 in 2.5% normal goat serum in PBST for 1 h at RT). Sections were washed 3 times in PBST for 10 min, then mount with prolong DAPI mounting media slides. Images were acquired on a fluorescence microscope with similar exposure and gains across stains and animals Confocal Laser Scanning Microscope-LSM 880 and AxioScan Zl; analyze with Zen blue 3.1., microvessel density was calculated using Vessel Analysis plugin and the Mexican Hat filter plugin and JaCoP plugin within the Fiji platform (Fiji Is Just ImageJ), Pearson's correlation coefficient were employed alongside overlap analysis to assess image colocalization. Cosets' randomization was implemented and an automatic thresholding approach was utilized, as a courtesy, to enhance the reliability and objectivity of the analyses. Pearson's correlation coefficient was employed to assess the linear relationship between the two datasets. This coefficient is calculated as the covariance of the two variables divided by the product of their standard deviations, yielding values between -1 and 1. A value of 1 indicates a perfect positive correlation, 0 indicates no correlation, and -1 represents a perfect negative correlation.Histological analysis of wound healing
[0141] For the quantitative characterization of the wound healing response, wound-edge sections were stained with hematoxylin & eosin (HE) and Masson's trichrome (MT), and were histologically scored. Wound length was measured using ImageJ, with samples representing varying quality and stages of healing. Un-biased visual inspection of the samples for theparameters such as re-epithelization, epidermal thickness index and collagen remodeling as described earlier by van de Vyver et al ((2021). Histology Scoring System for Murine Cutaneous Wounds. Stem Cells Dev 30, 1141-1152.).Cell culture and transfection:
[0142] HMEC (ATCC number CRL-3243) and mouse pulmonary endothelial Cells (MPEC) (Cat# 10MU-04) cells were cultured in MCDB 131 media enriched with 10% serum respectively. To initiate transfections, HMEC cells were plated at a density of 1.5x106 cells per well in 2 ml of complete media on the day of transfection using specially treated 6-well plates. For each Lipofectamine LTX transfection, 2.5 pg of DNA of Empty or PLCy2ORF plasmid (procured from NovoPro Biosciences Inc.) was combined with 2.5 pl of Plus reagent (Invitrogen, catalog number 11514-015) in 500 pl of serum-free media and incubated for 5 minutes. Subsequently, 5 pl of Lipofectamine LTX (Invitrogen, catalog number 15338-100) was added, thoroughly mixed, and incubated for an additional 25 minutes before being added dropwise to the cells. The cells were then incubated at 37°C with 5% CO2 for a period of up to 24 hours. Notably, assays involving titer collection were conducted at 48 hours.PLCy2 and VEGFA ELISA:
[0143] Cell lysates obtained from HMEC-1 transfected with PLCy2 ORF, both with and without transfection, were subjected to Phospho-PLCy2 (Tyr753) and Total PLCy2 ELISA (PEL-PLCy2-Y753-T-l; RayBiotech) and mouse VEGF ELISA Kit (ELM-VEGF-1; RayBiotech) according to the manufacturer's instructions.Protein isolation and Western blot:
[0144] Cells were harvested using cell lysis buffer (cat. no. 9803; Cell Signaling Technology), sonicated on ice (three pulses for 3s), and centrifuged (14,000g for 20 min at 4°C). The protein estimation in the clear lysates was done using bicinchoninic acid assay. Proteins (30-40 pg) were separated on 4-12% Bis-Tris Gel / MOPS running buffer (NuPAGE, cat. nos. NP0321BOX and NP0001) (45 min at 200 V) using the NuPAGE electrophoresis system (Invitrogen). Proteins were transferred to polyvinylidene difluoride membranes (2.15 h at 30 V). Membranes were blocked with 5% skim milk in Tris-buffered saline with 0.1% Tween 20 for 1 h at room temperature and incubated with the respective primary antibodies overnight at 4°C. The following day the membranes were washed and incubated with the corresponding horseradish peroxidase-conjugated secondary antibody for Ih at room temperature. The membranes were washed, and the images were acquired WestemBright™ ECL Spray (cat. no. K-12049-D50; Advansta) and Azure c600 Gel Imaging System by Azure Biosystems. P-Actin were used as loading control. Image J (National Institutes of Health) software was used forquantification of bands by densitometry analysis. For Western blot, polyvinylidene difluoride membranes were incubated with specific primary antibodies against p44 / 42 MAPK (cat. no. 4695, 1: 1000; Cell Signaling Technology), HIF-la (cat. no. H6536, 1: 1000; Sigma- Aldrich), P-Actin-PeroxidDbe Qitibody (c3. no. A3854, 1 :5,000; Sigm DAldrich)Statistical Analysis
[0145] GraphPad vlO.O (Prism) software was used for statistical analyses. Data were assumed to be normally distributed for all analyses conducted. Data for independent experiments are presented as means ± SEM unless otherwise stated. The student t test (two-tailed) or one-way or two-way ANOVA was used to test the significant differences among groups. In case of ANOVA, the Tukey honestly significant difference (HSD) post hoc test was applied. P value of <0.05 was considered significant.Data and code availability
[0146] Generated scRNA-seq data have been deposited at GEO under accession numbers GSE176417 and GSE268834. This paper does not report any original code. Any additional information required to analyze the data reported in this paper is available from the lead contact upon request. This study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Kanhaiya Singh (singhk@pitt.edu).ResultsAnnotation of cellular clusters in human nondiabetic and T2DM wound-edge tissue
[0147] Influenced by the differential physiological and energetic demands in an injured tissue, the heterogeneous vascular endothelium dynamically engages in specialized functions. As a result, endothelial subtype-dependent differential effects on angiogenic potential are observed during treatment with vascular growth factors. Transcriptomic specifications of an arterial, capillary, and venous endothelial phenotype are critical for differential responses to the VEGF therapy also. However, in diabetic tissue, due to sustained hyperglycemia and ischemia, such specifications are skewed. To determine the transcriptomic differences between the endothelial subpopulations in diabetic and non-diabetic subjects, the scRNA-seq of 66,709 individual cells obtained from tissue located at the periphery or edge of chronic human wounds obtained from lower extremity amputations was investigated. Out of these, 44,979 wound-edge cells were from individuals with clinically diagnosed T2DM (n=5) and 21,730 cells from nondiabetic subjects (n=5) (FIG. 1, panel A). Unbiased clustering analysis of these 66,709 cells resulted in a Uniform Manifold Approximation and Projection (UMAP) plot containing 12 different cellular clusters based on transcriptional heterogeneity (FIG. 1, panel A). Cluster 0 wasidentified as endothelial cells based on high expression levels of classical endothelial markers such as CDH5 and VWF (FIG. 1, Panel A). This CDH5hlVWFhlendothelial cluster 0 was LYVEllow, a classical lymphatic endothelial cell (LEC) marker, and hence was transcriptionally different from LYVElhlLEC cluster 10. Similarly, the remaining 10 clusters (clusters 2-9 and 11) were annotated to various cell types based on high expression of signature genes as compared to other clusters (FIG. 1, Panel A and FIG. 7, Panel A). To gain more insight of the wound-edge endothelial cells at single cell level, sub-clustering of CDH5hlVWFhlLYVEllowendothelial cluster was performed (FIG. 1, panel B). This subclustering analysis revealed that wound-edge endothelial cells were composed of five distinct subclusters (FIG. 1, panel B). As expected, all these five clusters expressed constitutive endothelial genes such as CDH5, VWF and PECAM1 at similar levels (FIG. 1, panel B). However, the expression levels of endothelial sub-compartment specific markers were different. For example, endothelial subcluster 0 cells were predominantly derived from capillaries as defined by RGCChlSPARChlexpression pattern (FIG. 1, panel B). NR2F2hlACKRlhlSELEhlendothelial subclusters 1 and 2 were identified as venous subtype, while subcluster 3 (SEMA3GhlGJA4hlEFNB2hl) was predominantly arterial subtype (FIG. 1, panel B). Endothelial subcluster 4 was a mixture of the above three subtypes. Compositional analysis of these endothelial subtypes identified low abundance of capillary endothelial subtype (subcluster 0) and more prevalence of venous subtype (subcluster 2) in the wound-edge of T2DM as compared to nondiabetic subjects (FIG. 1, panel B).The low expression of PLCy2 in endothelial subtypes is attributed to its hypermethylated promoter in response to hyperglycemia and ischemia
[0148] The single cell expression level of PLCy2 was compared in the identified wound-edge endothelial subtypes between T2DM and non-diabetic wound-edge. Among the endothelial cells from non-diabetic wound-edge, the PLCy2 transcripts were most abundant in the capillary endothelial subtype (subcluster 0) and least abundant in the venous subtype (subcluster 2) (FIG. 1, panel C). Interestingly, the PLCy2 expression was diminished in all the five woundedge endothelial subclusters encompassing arterial, venous, and capillary cells in T2DM subjects(FIG. 1, panel C). To further validate the findings in other diabetic wound cohort, additional single cell RNA sequencing data from diabetic foot ulcer patients (n= 7 samples) were retrieved from the GEO database (accession number GSE165816). Violin plot, with inclusion of new samples, also showed that PLCy2 expression was significantly down in all five subclusters of diabetic wound endothelial cells despite differences in origin (arterial, venous, or capillary).Next, to address the effect of sex on PLCy2 expression, the observed findings were reported in isolated male and female samples. PLCy2 expression was observed to be significantly lowered in all five subclusters of diabetic endothelial cells from male (ND, 2401 cells, n=3; DM, 9126 cells, n=7) and in females (ND, 1101 cells, n=l; 1,275 cells, n = 5). Aditionally, the expression of PLCy2 was significantly low in human T2DM wound-edge endothelial cells at protein (FIG. 1, panels C and C) and mRNA levels (FIG. 1, panel D). Such reduction of expression can be attributed to hyperglycemia / ischemia-mediated promoter hypermethylation of the wound-edge endothelial cells. Indeed, this hypothesis was tested by bisulfite sequencing, where the methylation level in nondiabetic wound-edge endothelial cells was 11%, contrasting with a marked increase to 45% in individuals with T2DM (FIG. 1, panel D).
[0149] The potential of PLCy2 to be regulated by DNA methylation remains conserved throughout different species. In mice, bioinformatic analysis utilizing the UCSC genome browser revealed the potential regulation of the murine PLCy2 promoter through DNA methylation based on the presence of large CpG islands containing 62 CpGs (Position: chr8: 117498197-117498881, Band: 8qEl) (FIG. 2, panel A). Hence, to test the causal effect of hyperglycemia and ischemia individually on PLCy2 methylation, specific established murine models were studied. In C57BL / 6 mice, acute diabetes induction was achieved via a low dose of streptozotocin (STZ) at 50 mg / kg administered over 5 days (FIG. 2, panel B). The rationale was to study the effect of isolated hyperglycemia in absence of other secondary complications commonly associated with T2DM mice. In addition, due to sustained hyperglycemia more persistent inflammation and tissue damage is observed in STZ-treated diabetic mice. Mice were considered diabetic if their glucose levels exceeded 250 mg / dl, and glucose was measured on 15 days post-STZ injection (FIG. 2, panel B). To investigate the effect of hyperglycemia, DNA methylation status within the CpG island of the PLCy2 promoter were assessed in the skin of STZ-induced diabetic mice as compared to nondiabetic mice. The results demonstrated that where in murine non-diabetic skin the PLCy2 promoter was methylated at 21.2%, hyperglycemia increased this methylation level to 60.6% in STZ-induced diabetic mice (FIG. 2, panel C). Similar results were obtained using a murine model of T2DM, db / db mice, in which PLCy2 promoter was 48.5% methylated as compared to non-diabetic db / + mice in which basal methylation was 33.3%. Such hyperglycemia-dependent increase in the promoter methylation resulted in the significant lowering of PLCy2 abundance at mRNA (FIG. 2, panel D) and protein expression levels (FIG. 2, panel D).
[0150] Next, the isolated impact of ischemia was investigated on PLCy2 promoter methylation in mice. The murine ischemic flap approach offers the opportunity to investigate DNAmethylation as a function of graded ischemia. In murine monopedicle ischemic skin flap approach in C57BL / 6 mice, the blood supply to the flapped tissue derived from vessels located in the cephalad attachment (FIG. 3, panel A). Thus, an ischemic gradient is established between proximal (mild ischemic, 135.9+1.9 perfusion unit, P.U.), intermediate (moderate ischemic, 95.7+10.5 P.U.), and distal (severe ischemic, 78.9+7.0 P.U.) regions (FIG. 3, panel A) as reported. Such graded ischemia is known to give rise to high DNA methyltransferase (DNMT) expression and global DNA hypermethylation (marked by increased levels of 5mC) in distal region of the flap as compared to intermediate and proximal region. In addition, the monopedicle graded ischemic cutaneous injury also causes concomitant gradients in hypoxia with the most ischemic region having the greatest hypoxia with the most distal tip of tissue at greatest risk for necrosis. In the present study, using the monopedicle ischemic / hypoxic skin flap model, the effect of graded ischemia / hypoxia on the methylation levels of PLCy2 promoter was investigated. In comparison to the uninjured skin (21.2% methylated), the mild ischemic proximal region of the flap displayed comparable PLCy2 promoter methylation (25.8% methylated) (FIG. 2, panel C; FIG. 3, panels B and C). However, the promoter methylation extent increased in the moderate ischemic intermediate region (35.5% methylated) and was heavily methylated (58.1% methylated) in the severely ischemic / hypoxic (marked by elevated expression of HIFla) distal region of the flap demonstrating ischemia / hypoxia as a causal factor for PLCy2 hypermethylation (FIG. 3, panels B and C). Such change in promoter methylation extent resulted in significantly lower protein expression of PLCy2 in the severely ischemic distal region as compared to the proximal and intermediate regions (FIG. 3, panels D and E). Hence the two extreme conditions (hyperglycemia and ischemia / hypoxia) that are characteristic of the diabetic wound environment can cause DNA hypermethylation driven PLCy2 silencing.Endothelial-targeted, demethylation ofPLCy2 improves VEGF therapy on diabetic wound-edge vascularization
[0151] Given that DNA methylation is reversible, strategies that promote DNA demethylation can rescue diabetic vasculopathy. Hypomethylating agents, such as 5-azacytidne (5-aza) and its deoxy derivative decitabine, have been approved by the FDA to revert the effects of methylation induced gene silencing. The topical administration of 5-aza, a global demethylating agent, improves wound healing in animal models. However, 5-aza mediated demethylation events are not gene- specific and are therefore limited in their ability to provide mechanistic insights. This critical issue can be resolved by using a CRISPR-Cas9 approach in which the Cas9 is catalytically inactive (dCas9) in addition with catalytic domain of TET1- aDNA-demethylating enzyme. Directed by a gRNA, dCas9 aims for specific areas for DNA demethylation, initiating the transformation of 5mC to 5hmC by active TET1 enzyme. This targeted demethylation process can alleviate the transcriptional suppression of a gene induced by hypermethylation, thereby reactivating the gene expression. To increase the efficiency of targeted demethylation, dCas9- SuperNova Tagging (SunTag) with modified linker length to 22 amino acids (multi GCN4) was used. Without wishing to be bound by the theory, it is believed that the length of the linker may be important to increase efficiency of the treatment. dCas9-fused GCN4 peptides can recruit multiple copies of single-chain variable fragment (scFv)-fused target. To specifically address the demethylation of the PLCy2 promoter as a therapeutic strategy for rescuing ischemic wound perfusion, the present study adopted CRISPR / dCas9-based targeted DNA demethylation approach using endothelial cell-specific guide RNAs. To achieve targeted demethylation, a demethylation cocktail was utilized which was composed of (a) dCas9 fused with peptide repeat (multi GCN4) (b) antibody (scFv)-fused TET1CD (c) CDH5-promoter driven PLCy2 specific guide RNAs (FIG. 4, panel A). dCas9 fused to a peptide repeat can recruit multiple copies of antibody (scFv)-fused TET1CD thereby increasing demethylation efficiency. In the study of mouse pulmonary endothelial cells (MPEC) three independent PLCy2 specific guide RNAs were tested. Combining gRNAs (1+2+3) resulted in a more pronounced demethylation effect and augmented PLCy2 activity.
[0152] The demethylation cocktail was administered via nano-electroporation based tissue nanotransfection (TNT2.0) on day 1 post-ischemic wound creation in STZ-induced diabetic mice. Validation studies using flow cytometry demonstrated that CDH5 promoter driven gRNA expression induced the PLCy2 demethylation only in endothelial compartment and not in other skin cells such as fibroblasts and keratinocytes. This specificity was further tested by capturing endothelial, fibroblast and keratinocyte elements using laser capture microdissection (LCM). Bisulfite sequencing analysis of PLCy2 promoter in LCM-captured endothelial elements demonstrated lowered methylation level (6.7%) in demethylation cocktail treated skin as compared to sham treated skin (40%). On the contrary, the methylation levels were comparable in fibroblast and keratinocyte compartments irrespective of the treatment with the endothelial- specific demethylation cocktail. Gene specific demethylation was also tested in LCM-captured endothelial element by examining the promoter methylation status of a house keeping gene (P-actin). Bisulfite sequencing demonstrated that P-actin promoter methylation was not affected in response to PLCy2-specific demethylation cocktail treatment.
[0153] Once the specificity and efficacy of the demethylation cocktail on endothelial PLCy2 demethylation was positively validated, its efficacy to augment VEGF therapy of diabeticischemic wound vascularization was investigated (FIG. 4, panel A). Fifteen days post-STZ injection, ischemic bipedicle wounds were created on the dorsum of C57BL / 6 mice (FIG. 4, panel A). The electrophoretic TNT was performed to deliver VEGF open reading frames (ORFs) alone or a cocktail of VEGF and endothelial PLCy2 demethylation cocktail to the ischemic wound-edge on day 1 post-ischemic wound creation. Such successful demethylation of the PLCy2 promoter augmented the effect of VEGF therapy (compared to VEGF alone or control) on diabetic ischemic wound perfusion on days 7 and 10 post-surgery as measured through laser speckle imaging (LSI) (FIG. 4, panel B). Additionally, the efficacy of VEGF ORF + endothelial PLCy2 demethylation cocktail was compared against VEGF ORF + nontargeting (scramble) guide RNA as an additional arm in in vivo studies. Of interest, demethylation of the PLCy2 promoter alone significantly enhanced wound perfusion to such an extent that overexpression of VEGF did not induce a significant additional improvement. Similar results were obtained in db / db diabetic mice where endothelial PLCy2 demethylation increased the efficacy of VEGF therapy on ischemic wound-edge perfusion compared to VEGF alone or control. Moreover, the addition of VEGF overexpression did not further enhance perfusion to that achieved with demethylation of the PLCy2 promoter alone. Vascular functionality at the ischemic wound-edge was further tested by the quantitative assessment of pulsatile blood flow using high-resolution pulsed wave Doppler analysis. Higher perfusion at the ischemic tissue site of diabetic mice subjected to VEGF plus endothelial PLCy2 demethylation was supported by increased velocity time integral (VTI) compared to VEGF monotherapy, but the combined VEGF plus endothelial PLCy2 demethylation significantly increased arterial pulse pressure in comparison to VEGF monotherapy or endothelial PLCy2 demethylation alone (FIG. 4, panels C and D). Compromised wound vascularization is recognized as a key limiting factor in diabetic wound closure. Endothelial PLCy2 demethylation was determined to have improved diabetic ischemic wound closure. The study of physiological wound healing under conditions of PLCy2 demethylation (with or without VEGF overexpression) revealed significant increase in wound re-epithelialization and collagen deposition at the wound site.Demethylation of the PLCy2 promoter augments VEGF therapy and promotes ischemic tissue angiogenesis via activation of MAP kinase signaling
[0154] Higher perfusion at the ischemic wound-edge of diabetic mice subjected to VEGF therapy in addition to endothelial PLCy2 demethylation was supported by histological studies demonstrating increased abundance of total (vWF+ / PLCy2+) and activated (vWF+ / phospho- PLCy2+) PLCy2 expression along with increase in endothelial VEGF (vWF+ / VEGFA+)abundance (FIG. 6, panel A). Interestingly, the abundance of VEGF also increased in the group where PLCy2 demethylation was achieved without VEGF therapy io such an extent that further overexpression of VEGF' failed to significantly increase endothelial VEGF colocalization (FIG. 6, panel A). This observation pointed towards the presence of a feedback loop of VEGF expression by PLCy2 activation. Previous literature also indicates such a possibility via phosphorylation of mitogen-activated protein kinase (MAPK) 44 / 42, which in turn facilitates the translocation of hypoxia-inducible factor (HIF1 alpha) into the nucleus, thereby initiating the transcription of VEGFA52. Indeed, IHC analysis of diabetic ischemic wound-edge demonstrated that the demethylation-induced induction of PLCy2 in endothelial cells results in the phosphorylation of MAPK 44 / 42 (FIG. 6, panel B). This mechanism of PLCy2 induced VEGF signaling was further explored in cultured endothelial cells. Induced PLCy2 expression resulted in an increased abundance of phosphorylated PLCy2 in endothelial cells (FIG. 7, panel A). Interestingly, induced expression of PLCy2 alone was able to induce VEGF expression in the media of cultured endothelial cells (FIG. 7, panel A). This finding indicated the presence of a feedback loop mechanism between PLCy2 and VEGF. To address this, the effects of activation of PLCy2 were examined both on the basal level and on the stimulated transactivation activity of MAPK 44 / 42. Increased presence and activation of PLCy2 enhances not only basal abundance of MAPK 44 / 42 but its activity as well as quantified by phosphorylated MAPK 44 / 42 levels (FIG. 7, panel A). Additionally, PLCy2 and subsequent MAPK 44 / 42 activation resulted in the nuclear localization of HIF-alpha explaining the observation of activation of VEGF signaling in endothelial cells (FIG. 7, panel B). Under such conditions, PLCy2 demethylation alone can enhance the ischemic tissue perfusion without the administration of exogenous VEGF (FIG. 6, panel A). These findings recognize PLCy2 demethylation as a critical factor that can increase the efficiency of VEGF therapy in diabetic ischemic tissue.Discussion
[0155] Endothelial cells demonstrate significant diversity across vascular beds and organs, showcasing distinct molecular profiles and functions. In diabetic skin, this heterogeneity is further shaped by pathophysiological stressors such as chronic hyperglycemia and ischemia, potentially guiding disease- specific changes in endothelial functionality. Moreover, endothelial dysfunction in diabetes is linked to arterial stiffness and various biochemical alterations such as lipid level changes. Through scRNA-seq, the present study has identified differential abundance of distinct subtypes of dermal endothelial cells, including capillary, arterial, and venous endothelial cells, each with unique characteristics of transcript abundance. Thesevariations suggest specialized roles for these endothelial subtypes in the pathophysiology of diabetic skin conditions. In depth understanding of the distinct features of these endothelial subtypes shed light on their contributions to diabetic skin pathophysiology and opens avenues for targeted therapeutic interventions. The capillary endothelial subset (subcluster 0) displayed a preference for cell proliferation as marked by enrichment of pathways related to mitotic spindle, DNA repair, G2M checkpoint, and protein secretion as compared to other subclusters. At the same time, this endothelial subset exhibits diminished inflammatory response as marked by negative enrichment of pathways related to interferon and TNFa related inflammatory response. Venous subcluster 2 on the other hand, are equipped with positively enriched levels of genes related to interferon related inflammatory response. Hence, the selective reduction of proliferative and anti-inflammatory endothelial subset (subcluster 0) and increased abundance of inflammatory endothelial subset (subcluster 2) at the diabetic wound-edge may explain the higher prevalence of wound chronicity in diabetics. Future studies addressing the epigenetic and metabolic forces underlying such endothelial heterogeneity in diabetic skin will be crucial for developing targeted therapies.
[0156] In endothelial cells, epigenetic mechanisms are directly implicated in diabetic vasculopathy. DNA methylation and histone modifications are key players in regulating gene expression in endothelial cells affected by diabetes causing endothelial dysfunction. Promoter DNA methylation induced gene silencing is the most extensive epigenetic modification reported in diabetic vasculopathy which is often associated with impaired diabetic wound healing. For example, DNMT induced DNA hypermethylation of KLF2 promoter results in inflammation induced vascular disorders. Other reported genes whose methylation changes results in endothelial inflammation are KLF4, SMAD7, and CTGF27. Interestingly, some of these genes can also be hypermethylated in response to disturbed blood flow often associated with diabetic vasculopathy. VEGF, its receptors, and downstream molecules such as eNOS, are controlled by their promoter methylation status. VEGF and eNOS expression can be diminished via Methyl-CpG-Binding Domain Protein 2 (MBD2) binding, the protein readers of methylation that regulate endothelial function in both physiological and disease states. This study demonstrates that expression of PLCy2, a significant VEGF pathway downstream gene, is controlled by hyperglycemia dependent hypermethylation and gene silencing. Overcoming PLCy2 promoter methylation in endothelial cells using TNT delivery of targeted demethylation reagents increases VEGF in targeted cells. This explains the regulatory mechanism of the previous finding that under conditions of diabetes, limited PLCy2 abundance is responsible for the neutralization of the angiogenic effects of VEGF therapy.
[0157] Epigenetic therapies warrant serious consideration. Understanding these epigenetic mechanisms opens avenues for potential therapeutic targets to mitigate diabetic vascular complications and improve clinical management in diabetic patients. Currently, two DNMT inhibitors, 5- azacytidine, and 5-aza-2'-deoxycytidine, have been approved by FDA for clinical use against certain cancers. The administration of these drugs improved angiogenesis and wound healing outcomes. Traditional gene editing used for therapeutic purposes has off-target effects that lead to cytotoxicity at the target site of the host genome. However, it is recognized that either knock-in or knock-out of specific genes can induce unknown and undesired regulatory effects due to the altered genome or position-specific effects. The use of CRISPR / dCas9-based demethylation approach is safe compared to traditional genetic engineering. Regarding these off-target effects, an advantage of using dCas9 technology is that the expected frequency of off-target binding to essential (functional) exons remains very low. Results present in this study directly address this risk, showing that under the given conditions, off-target effects is not a significant concern. Among other measures to offset off-target effects, adherence to sgRNA design rules to maximize on-target activity and minimize off-target effects is valuable. To monitor any unforeseen complication, a long-term cohort study was conducted where the mice subjected to CRISPR / dCas9 (TNT sham and TNTdemethyiation cocktail) were followed for 120 days. Both groups were healthy and the weight and blood vessel density difference at day 120 post-TNT between the groups was non- significant. Necropsy studies were performed to examine any adverse effects on major organs: (i) brain, (ii) heart, (iii) kidney, (iv) liver, (v) lung and (vi) spleen. There was no major treatment-related pathology observed (Figure S13 A-B). As previously reported, TNT-induced vasculogenicity require tissue ischemia / hypoxia microenvironment. Post-TNT (120 days) expression of PLCy2 as well as VEGF signaling cascade (VEGF and p-MAPK44 / 42) were comparable in both groups. The demethylation cocktail employed in the current study was stable as evident by outcomes observed on d2 and d6 post-delivery. Reported in vivo studies, have shown that the targeted DNA demethylation approach adopted achieves functionality sufficient to produce the desired outcomes.
[0158] Although the global mode of action can have positive effects, these drugs are unsuitable for the precise targeting of a particular methylated CpG. The present work reports on in vivo targeted demethylation of dermal endothelial cells as a therapeutic intervention for enabling VEGF therapy to rescue cutaneous diabetic wound vascularization. PLCy2 is a critical signaling molecule involved in various cellular processes, including proliferation and calcium flux, essential for wound healing. In diabetic conditions, PLCy2 activity and abundance isdownregulated thus hindering the effectiveness of VEGF action to improve blood flow and healing of ischemic tissues. Rescue of PLCy2 expression through targeted gene delivery may significantly improve blood flow in diabetic ischemic limbs. Demethylation of the promoter of PLCy2 enhances gene expression of PLCy2, augments VEGF signaling and improves angiogenic outcomes. Demethylation of PLCy2 resulted in increased abundance of its phosphorylated active form (p-PLCy2) which then increased phosphorylation of MAPK / ERK resulting in the HIF-la nuclear translocation in endothelial cells. Phospho-ERKl / 2 (MAPK 44 / 42) modifies HIF-la within the ERK Targeted Domain (ETD), inhibiting its nuclear export signal (NES) interaction with CRM1, leading to HIF-la translocation to the nucleus from the cytoplasm. HIF-la, as a main controller of the cellular response to hypoxia, directly triggers the transcript of VEGF in ischemic diseases. Translocation of HIF-la to nucleus induces endogenous VEGF production through its attachment to the hypoxia response elements (HREs) situated within the VEGF gene promoter in presence of co-activators such as p300 / CBP. The expression levels of VEGF are closely connected to HIF-la levels, with suppression of HIF- la leading to decreased VEGF expression. These findings collectively highlight the intricate regulatory mechanisms of positive regulation of demethylation induced PLCy2 expression to augment endogenous VEGF production and action in the rescue of diabetic ischemic tissue perfusion. These results suggest that targeted therapies to overcome epigenetic barriers for specific key angiogenic gene regulatory networks may be a novel pathway to enhance wound perfusion in diabetic wound tissue. Such strategy to enhance wound healing and should be considered in future translational trials since current VEGF therapy approaches alone have not proven to impact patient therapy as much as anticipated.
[0159] The present invention has been described with reference to certain exemplary embodiments, dispersible compositions and uses thereof. However, it will be recognized by those of ordinary skill in the art that various substitutions, modifications or combinations of any of the exemplary embodiments may be made without departing from the spirit and scope of the invention. Thus, the invention is not limited by the description of the exemplary embodiments.
Claims
THE INVENTION CLAIMED IS1. A composition for treating ischemic tissue, comprising: at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQ ID NO: 15, or a nucleic acid comprising a gene for expressing at least one independent guide RNA targeting a PLCy2 promoter sequence having at least 90%, at least 95%, or 100% sequence identity with SEQ ID NO: 14 and / or SEQ ID NO: 15; a dCas9 linked to an antigen binding partner or a nucleic acid comprising a gene for expressing a dCas9 linked to an antigen binding partner; and a catalytic domain of a DNA demethylase linked to an antigen-binding regent or a nucleic acid comprising a gene for expressing a catalytic domain of a DNA demethylase linked to an antigen-binding reagent.
2. The composition of claim 1, comprising at least two independent guide RNAs targeting different sequences of the PLCy2 promoter sequence or at least two nucleic acids each comprising genes for expressing independent guide RNAs targeting different sequences of the PLCy2 promoter sequence.
3. The composition of claim 1, comprising at least three independent guide RNAs targeting different sequences of the PLCy2 promoter sequence or at least three nucleic acids each comprising genes for expressing independent guide RNAs targeting different sequences of the PLCy2 promoter sequence.
4. The composition of claim 1, wherein the guide RNA comprises at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or a nucleic acid comprising genes for expressing the guide RNA comprises at least 10 contiguous bases, at least 11 contiguous bases, at least 12 contiguous bases, at least 13 contiguous bases, at least 14 contiguous bases, at least 15 contiguous bases, at least 16 contiguous bases, at least 17 contiguous bases, at least 18 contiguous bases, at least 19 contiguous bases, or at least 20 contiguous bases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3.
5. The composition of claim 1, wherein the guide RNA is provided as a nucleic acid comprising a gene for expressing the guide RNA.
6. The composition of claim 5, wherein expression of the guide RNA is driven by a tissue-specific promoter.
7. The composition of claim 5, wherein expression of the guide RNA is driven by a tissue-specific promoter for selective expression in endothelial cells.
8. The composition of claim 5, wherein expression of the guide RNA is driven by a CDH5 promoter.
9. The composition of claim 1, comprising a fusion protein of a dCas9 and a peptide or a nucleic acid comprising a gene for expressing a fusion protein of a dCas9 and a peptide.
10. The composition of claim 1, wherein the peptide linked to a dCas9 is a repeating peptide, optionally having a length of about 22 amino acids.
11. The composition of claim 1, wherein the peptide linked to a dCas9 is a peptide repeat of GCN4.
12. The composition of claim 1, wherein the catalytic domain of a DNA demethylase is from the TET family of enzymes.
13. The composition of claim 1, wherein the catalytic domain of a DNA demethylase is from a TET1 enzyme.
14. The composition of claim 1, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is an antibody or derived from an antibody.
15. The composition of claim 1, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is an antibody fragment.
16. The composition of claim 1, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is a scFv.
17. The composition of claim 1, wherein the antigen-binding reagent linked to a catalytic domain of a DNA demethylase is a scFv is directed towards GCN4.
18. The composition of claim 1, further comprising a VEGF or a nucleic acid comprising a gene for expressing a VEGF.
19. The composition of claim 18, comprising a nucleic acid comprising a gene for expressing a VEGF.
20. The composition of claim 19, wherein the nucleic acid comprising a gene for expressing a VEGF comprises the open reading frame of a VEGF.
21. The composition of claim 19, wherein the nucleic acid comprising a gene for expressing a VEGF comprises the open reading frame of VEGFA.
22. The composition of claim 1, further comprising a buffered solution.
23. The composition of claim 22, wherein the buffered solution is a saline solution.
24. The composition of claim 22, wherein the buffered solution is a phosphate buffered saline solution.
25. The composition of claim 1, further comprising a hydrophilic bioerodible polymer.
26. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the guide RNA targeting a PLCy2 promoter sequence of claim 1.
27. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the dCas9 linked to a peptide of claim 1.
28. A composition comprising a nucleic acid comprising a plasmid comprising genes for expressing the catalytic domain of a DNA demethylase linked to an antigen-binding regent of claim 1.
29. A kit comprising the composition of claim 1.
30. The kit of claim 29, further comprising one or more electrodes, an electroporation chip, and / or a power source, such as a battery.
31. A method of treating ischemic tissue, comprising delivering the composition of claim 1 in an amount effective to improve blood flow and / or vascularization into the ischemic tissue.
32. The method of claim 31, wherein the composition is delivered up to three days following an injury.
33. The method of claim 31, wherein the composition is delivered up to three days following an ischemic event.
34. The method of claim 31, further comprising delivering VEGF or a nucleic acid comprising a gene for expressing VEGF.
35. The method of claim 31, further comprising delivering VEGF or a nucleic acid comprising a gene for expressing VEGF after up to 10 days after the delivery of the composition.
36. The method of claim 35, wherein the VEGF or a nucleic acid comprising a gene for expressing VEGF is delivered up to 10 days after the delivery of the composition.
37. The method of claim 35, wherein the VEGF or a nucleic acid comprising a gene for expressing VEGF is delivered after the delivery of the composition and prior to the resolution of ischemia.
38. The method of claim 31, wherein the composition is delivered by non- viral transfection.
39. The method of claim 31, wherein the composition is delivered by electroporation.
40. The method of claim 31, wherein the composition is delivered by nanoelectroporation.
41. The method of claim 31, wherein the composition is delivered by tissue nanoelectroporation technique 2.0.
42. The method of claim 31, wherein the composition is delivered to ischemic tissue.
43. The method of claim 31, wherein the composition is delivered to a diabetic wound.
44. The method of claim 31, wherein the composition is delivered to a patient with an ischemic disease.
45. The method of claim 44, wherein the ischemic disease is peripheral artery disease.
46. The method of claim 44, wherein the ischemic disease is coronary artery disease.
47. The method of claim 44, wherein the ischemic disease is cerebrovascular disease.
48. The method of claim 31, wherein the composition is delivered to a patient with a metabolic disease.
49. The method of claim 48, wherein the metabolic disease is diabetes mellitus.
50. The method of claim 48, wherein the metabolic disease is type 2 diabetes.
51. The method of claim 31, wherein the composition is delivered in more than once to the patient.
52. The method of claim 34, wherein the VEGF is delivered more than once to the patient.
Citation Information
Patent Citations
Method and use of nano-scale devices for reduction of tissue injury in ischemic and reperfusion injury
US20070259032A1
Polycomb-associated Non-Coding RNAs
US20140142160A1