Escherichia microorganism with improved l-isoleucine productivity and method for producing l-isoleucine using same

Abstract

The present invention relates to an Escherichia microorganism with improved L-isoleucine productivity and a method for producing L-isoleucine using same, the Escherichia microorganism having reduced or deactivated threonine operon leader peptide and threonine dehydrogenase activity to thus strengthen L-isoleucine biosynthesis pathways and reduce production of by-products, thereby allowing the L-isoleucine production level to be greater than that with the parent strain.

Description

Escherichia genus microorganism with enhanced L-isoleucine production ability and method for producing L-isoleucine using the same

[0001] The present invention relates to a microorganism of the genus Escherichia having improved L-isoleucine production ability and a method for producing L-isoleucine using the same.

[0002] L-isoleucine is an essential amino acid that is not synthesized in the human or animal body and must be supplied externally. It is generally produced through fermentation using microorganisms such as bacteria or yeast.

[0003] L-isoleucine shares a major biosynthetic pathway with the branched-chain amino acids L-valine and L-leucine. In particular, L-isoleucine and L-valine have very similar chemical properties, such as chemical structure, isoelectric point, and solubility. Therefore, producing a single amino acid as L-isoleucine with high purity requires many process steps and costs, making it difficult to recover it in high yield. To lower the production cost of L-isoleucine, it is important to discover or develop strains that produce high amounts of L-isoleucine while producing low amounts of L-valine.

[0004] L-isoleucine can be produced using either wild-type strains obtained from nature or mutant strains modified to enhance their L-isoleucine production ability. Microbial biosynthesis of L-isoleucine involves the sequential synthesis of L-threonine using pyruvic acid and oxaloacetic acid as precursors, followed by the sequential synthesis of L-isoleucine.

[0005] Recently, in order to improve the production efficiency of L-isoleucine, various recombinant strains or mutants with excellent L-isoleucine production ability, and L-isoleucine production methods using the same, have been developed by applying genetic recombination technology to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances. In particular, there have been attempts to increase the production of L-isoleucine by directly causing mutations in genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of L-isoleucine, or by inducing mutations in the promoters that control their expression. However, since there are dozens to hundreds of types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-isoleucine production, much research is still needed to determine whether changes in the activity of these proteins increase L-isoleucine production.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Korean Patent No. 10-1747542

[0009] The purpose of the present invention is to provide a microorganism of the genus Escherichia with improved L-isoleucine production ability.

[0010] In addition, the present invention aims to provide a method for producing L-isoleucine using the above Escherichia genus microorganism.

[0011] One aspect of the present invention provides an Escherichia genus microorganism having enhanced L-isoleucine production ability by weakening or inactivating the activity of a threonine operon leader peptide and threonine dehydrogenase.

[0012] The "threonine operon leader peptide" used in the present invention constitutes a threonine operon involved in the regulation of threonine biosynthesis. The threonine operon leader peptide in the present invention may be a polypeptide encoded by the thrL gene and having threonine operon leader peptide activity, but is not limited thereto.

[0013] The “threonine dehydrogenase” used in the present invention catalyzes the NAD+-dependent oxidation of L-threonine to produce 2-amino-3-ketobutyrate. The threonine dehydrogenase in the present invention may be a polypeptide encoded by the tdh gene and having threonine dehydrogenase activity, but is not limited thereto.

[0014] Nucleic acid sequence and protein sequence information for the above threonine operon leader peptide and threonine dehydrogenase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0015] As used herein, “weakening of activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is reduced compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such weakening of activity includes cases where the activity of the protein itself is reduced compared to the activity of the protein originally possessed by the microorganism through modification of the nucleotides encoding the gene (e.g., substitution, insertion, deletion of some nucleotides in the target gene, or a combination thereof), cases where the overall protein activity level in the cell is lower than that of the wild-type strain or the strain before modification due to inhibition of expression or translation of the target gene due to modification of a non-coding region that does not encode a gene, such as a promoter (e.g., modification of all or part of the nucleotides in the promoter sequence, replacement with a weak promoter), and combinations thereof.

[0016] The above nucleotide modification means that all or part of the nucleotide sequence is different from the original nucleotide sequence due to substitution, insertion, deletion, or a combination thereof. The above promoter modification means that all or part of the nucleotides of the promoter sequence are different from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof, and this results in a decrease in the expression level for the target gene or a weakened activity. In addition, the above promoter modification includes replacing the promoter of the original gene with a promoter that has a weaker expression level or activity for the target gene. Here, a substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0017] According to one specific example of the present invention, the weakening of the activity of the threonine operon leader peptide may be achieved by nucleotide modification, promoter modification, or a combination thereof of a gene encoding the threonine operon leader peptide.

[0018] According to one specific example of the present invention, the weakening of the activity of the threonine dehydrogenase may be due to a nucleotide modification, a promoter modification, or a combination thereof of a gene encoding the threonine dehydrogenase.

[0019] “Inactivation” as used in the present invention means a case where the expression of a gene encoding a protein such as an enzyme, transcription factor, or transport protein is not expressed at all compared to the original microorganism, i.e., a wild type strain or a strain before modification, or where the expression is not active.

[0020] According to one specific example of the present invention, the threonine operon leader peptide may be encoded by a thrL gene derived from Escherichia coli.

[0021] The above threonine operon leader peptide may be encoded by the base sequence of SEQ ID NO: 1 or may be composed of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

[0022] According to one specific example of the present invention, the threonine dehydrogenase may be encoded by a tdh gene derived from Escherichia coli.

[0023] The above threonine dehydrogenase may be encoded by the base sequence of SEQ ID NO: 3 or may be composed of the amino acid sequence of SEQ ID NO: 4, but is not limited thereto.

[0024] According to the present invention, each base sequence or amino acid sequence of the threonine operon leader peptide and threonine dehydrogenase may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the base sequence or amino acid sequence of SEQ ID NOs: 1 to 4, and may have an original function. Here, “homology” or “identity” means the rate of identity (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0025] As used herein, “improved productivity” means increased productivity of L-isoleucine compared to the target of mutation (parent strain). The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Escherichia genus microorganism or strain that has no L-isoleucine production ability or has L-isoleucine production ability and is a wild type Escherichia genus microorganism or strain that has been mutated from the wild type.

[0026] According to one specific example of the present invention, the genus Escherichia may be, but is not limited to, Escherichia coli, Escherichia albertii, Escherichia blattae, Escherichia fergusonii, Escherichia hermannii, Escherichia vulneris, etc.

[0027] For example, the genus Escherichia may be Escherichia coli.

[0028] The Escherichia genus microorganism according to the present invention can have improved L-isoleucine production ability due to weakening or inactivation of the activity of the threonine operon leader peptide and threonine dehydrogenase.

[0029] Specifically, Escherichia microorganisms with enhanced L-isoleucine production exhibit increased L-isoleucine production compared to the parent strain or when the activity of the threonine operon leader peptide or threonine dehydrogenase is weakened, and in particular, L-isoleucine production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, It may be increased by 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto. For example, the Escherichia genus microorganism in which the activity of the threonine operon leader peptide and threonine dehydrogenase is weakened or inactivated may have an L-isoleucine production increased by 5% or more, specifically 5 to 50% (preferably 10 to 40%) compared to the parent strain.

[0030] A composition comprising a microorganism of the genus Escherichia according to the present invention can be used as a composition for producing L-isoleucine.

[0031]

[0032] According to one specific example of the present invention, an Escherichia genus microorganism can be implemented through a gene inactivation method or a recombinant vector to delete a gene encoding a threonine operon leader peptide and a threonine dehydrogenase from a parent strain.

[0033] The above gene inactivation method can be performed using a known method. For example, the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); and Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145(1988)) are not limited thereto.

[0034] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0035] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0036] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0037] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0038] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0039] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0040] When transforming prokaryotic cells to produce recombinant microorganisms, host cells may be used, including, but not limited to, Escherichia coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus.

[0041] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0042] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0043] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0044] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0045] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Escherichia through homologous recombination crossing over.

[0046] According to one specific example of the present invention, the host cell may be a microorganism of the genus Escherichia. For example, it may be Escherichia coli, but is not limited thereto.

[0047]

[0048] Another aspect of the present invention provides a method for producing L-isoleucine, comprising the steps of culturing the Escherichia genus microorganism in a medium; and recovering L-isoleucine from the Escherichia genus microorganism or the medium in which the Escherichia genus microorganism is cultured.

[0049] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0050] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for Escherichia spp. strains can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0051] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0052] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0053] According to one specific example of the present invention, the step of recovering L-isoleucine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-isoleucine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but the present invention is not limited thereto.

[0054] According to one specific example of the present invention, the step of recovering the L-isoleucine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0055] According to one specific example of the present invention, the step of recovering L-isoleucine may include a process of purifying L-isoleucine.

[0056] The Escherichia genus microorganism according to the present invention can improve the production yield of L-isoleucine compared to the parent strain by strengthening the L-isoleucine biosynthesis pathway and weakening or inactivating the activity of the threonine operon leader peptide and threonine dehydrogenase, thereby weakening the production of by-products.

[0057] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0058]

[0059] Example 1. Production of a mutant strain with weakened activity of the threonine operon leader peptide.

[0060] To produce a strain with weakened activity of the threonine operon leader peptide, the thrL gene (SEQ ID NO: 1) encoding the threonine operon leader peptide was deleted using the one step inactivation method (Warner et al., PNAS, 6:6640-6645 (2000)) using Escherichia coli DS44 (accession number KCTC11602BP), which produces L-isoleucine.

[0061] First, a PCR reaction was performed using the primer pair thrL_F and thrL_R with the pKD13 plasmid (GenBank AY048744) as a template to obtain a fragment. After introducing the red recombinase plasmid pKD46 (GenBank AY048746) into E. coliDS44, the prepared PCR fragment was injected by electroporation, and colonies with kanamycin resistance were selected. The selected transformants were confirmed to have deletion of the thrL gene by performing a PCR reaction using the primer pair thrL_CF and thrL_CR. As expected, DS44ΔthrL, into which DNA for fragmentation was inserted, produced a product of about 2.1 kb, and DS44 produced a product of about 0.8 kb.

[0062] A process to remove the antibiotic resistance marker gene was performed using a strain with a confirmed thrL gene deletion. The pCP20 plasmid (Cherepanov and Wackerneagel, 1995; Datsenko and Wanner, 2000) was introduced into the thrL gene deletion strain to induce FLP recombination. The thrL gene deletion strain was then cultured on LB plates with or without antibiotics, confirming the removal of the antibiotic resistance marker gene.

[0063] Here, the PCR reaction was performed in a total reaction volume of 50 μl, with 1 cycle at 94°C for 1 minute, followed by 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes, for a total of 30 cycles, and then 72°C for 2 minutes.

[0064] The primer sequences used in Example 1 are shown in Table 1 below.

[0065] Sequence number Primer name Primer sequence (5'-3') 5thrL_CFACATAAAACTGGTCGACTGG 6thrL_CRACTAATGCCATGCAGGACAT 7thrL_FATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCgtgtaggctggagctgcttc 8thrL_RAAAAGCCCGCACTGTCAGGTGCGGGCTTTTTTCTGTGTTTCCTGTACGCGctgtcaaacatgagaattaa

[0066]

[0067] Example 2. Production of a mutant strain with weakened threonine dehydrogenase activity.

[0068] To produce a strain with weakened threonine dehydrogenase activity, Escherichia coli DS44 (accession number KCTC11602BP), which produces L-isoleucine, was used to delete the tdh gene (SEQ ID NO: 3) encoding threonine dehydrogenase using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645 (2000).

[0069] First, a fragment was obtained by PCR using the primer pair tdh_F and tdh_R with the pKD13 plasmid (GenBank AY048744) as a template. After introducing the red recombinase plasmid pKD46 (GenBank AY048746) into E. coliDS44, the prepared PCR fragment was injected by electroporation, and colonies with kanamycin resistance were selected. The selected transformants were confirmed to have deleted the tdh gene by PCR using the primer pair tdh_CF and tdh_CR. As expected, DS44Δtdh, into which DNA for fragmentation was inserted, produced a product of about 2.6 kb, and DS44 produced a product of about 3.3 kb.

[0070] A process to remove the antibiotic resistance marker gene was performed using a strain with a confirmed tdh gene deletion. The pCP20 plasmid was introduced into the tdh gene deletion strain to induce FLP recombination. The tdh gene deletion strain was then cultured on LB plates with or without antibiotics, confirming the removal of the antibiotic resistance marker gene.

[0071] Here, the PCR reaction was performed in a total reaction volume of 50 μl, with 1 cycle at 94°C for 1 minute, followed by 30 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes, for a total of 30 cycles, and then 72°C for 2 minutes.

[0072] The primer sequences used in Example 2 are shown in Table 2 below.

[0073] Sequence number Primer name Primer sequence (5'-3') 9tdh_CFCGTCCATCAAAGTACTGGAG 10tdh_CRGCGGATAGTTTTCTGCGTAA 11tdh_FCATTTACGCGTATTGGTAAACAACTGGGCGTTATCGCCTGAGGATGTGAGgtgtaggctggagctgcttc 12tdh_RTAACAGATTATCCTCAGATAAAAGGGCTGGAATACCAGCCCTTGTTCGTGctgtcaaacatgagaattaa

[0074]

[0075] Example 3. Production of mutant strains with weakened threonine operon leader peptide and threonine dehydrogenase activity.

[0076] To produce a strain with weakened activities of the threonine operon leader peptide and threonine dehydrogenase, the same procedure as in Example 2 was followed, except that DS44ΔthrL of Example 1 was used instead of E. coliDS44. Finally, DS44ΔthrLΔtdh, in which the thrL and tdh genes were deleted, was produced.

[0077]

[0078] Experimental Example 1. Evaluation of L-isoleucine production capacity

[0079] The L-isoleucine production ability of the Escherichia coli mutants produced in Examples 1 to 3 was evaluated compared to the parent strain.

[0080] Each strain was cultured under the conditions of temperature 30°C, stirring speed 500 rpm, and aeration volume 1 vvm using the medium for isoleucine production in Table 3 below with 2 L of the initial solution and 342 mL of the additional solution. After the culture was completed, the concentrations of L-valine and AABA (L-α-aminobutyric acid), which were produced as byproducts along with L-isoleucine in the medium, were measured using HPLC (Agilent), and the results are shown in Table 4 below.

[0081] Ingredients Initial medium concentration Additional medium concentration Glucose 80 g / ℓ 550 g / ℓ Corn steep liquor 20 g / ℓ - Ammonium sulfate 20 g / ℓ 1 g / ℓ Phosphoric acid 15 g / ℓ 1 g / ℓ Fumaric acid 1 g / ℓ - Monosodium glutamate 7 g / ℓ - Sodium citrate 1 g / ℓ - Choline-HCl 1 g / ℓ - Thiamine-HCl 5 mg / ℓ - Pyridoxine-HCl 10 mg / ℓ - Nicotinic acid 5 mg / ℓ - Biotin 5 mg / ℓ - Calcium chloride 5 mg / ℓ - Cobalt chloride 5 mg / ℓ - Iron sulfate 20 mg / ℓ - Manganese sulfate 5 mg / ℓ - Zinc sulfate 5 mg / ℓ - Copper sulfate 5 mg / ℓ - Sodium hydroxide 10 g / ℓ -

[0082] Strain Culture time (hr) L-isoleucine (%) L-valine (%) V / I ratio (%) AABA (%) AABA / I ratio (%) DS44 (parent strain) 742.010.2813.90.1276.3 DS44ΔthrL 742.100.2913.80.1386.6 DS44Δtdh 732.080.2913.90.1406.7 DS44ΔthrLΔtdh 712.580.187.00.1054.1

[0083] As shown in Table 4 above, only L-isoleucine production was found to increase when the activity of the threonine operon leader peptide or threonine dehydrogenase was weakened compared to the parent strain (DS44ΔthrL and DS44Δtdh). Specifically, the L-isoleucine production of DS44ΔthrL and DS44Δtdh increased by approximately 4.4% and 3.4%, respectively, compared to DS44, while the L-valine / L-isoleucine (V / I) ratio and the AABA / L-isoleucine (AABA / I) ratio were at similar levels.

[0084] In addition, when the activities of the threonine operon leader peptide and threonine dehydrogenase were weakened compared to the parent strain (DS44ΔthrLΔtdh), L-isoleucine production was improved while L-valine and AABA production was decreased. Specifically, the L-isoleucine production of DS44ΔthrLΔtdh increased by approximately 28.3% compared to DS44, and approximately 22.8% and 24.0% compared to DS44ΔthrL and DS44Δtdh, respectively, while the L-valine / L-isoleucine (V / I) ratio decreased by approximately 49.7% compared to DS44, and the AABA / L-isoleucine (AABA / I) ratio decreased by approximately 35% compared to DS44.

[0085] These results suggest that when both the threonine operon leader peptide and threonine dehydrogenase activities are weakened, significantly superior L-isoleucine yield production and reduced by-product production are achieved.

[0086]

[0087] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0088] [Accession number]

[0089] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0090] Accession number: KCTC11602BP

[0091] Date of acceptance: 20091120

[0092]

Claims

1. A microorganism of the genus Escherichia with enhanced L-isoleucine production by weakening or inactivating the activity of the threonine operon leader peptide and threonine dehydrogenase.

2. In claim 1, A microorganism of the genus Escherichia, wherein the activity of the above threonine operon leader peptide is weakened by nucleotide modification, promoter modification, or a combination thereof of the gene encoding the threonine operon leader peptide.

3. In claim 1, A microorganism of the genus Escherichia, wherein the activity of the above threonine dehydrogenase is weakened by a nucleotide modification, a promoter modification, or a combination thereof of a gene encoding threonine dehydrogenase.

4. In claim 1, The above Escherichia genus is a microorganism of the genus Escherichia, which is Escherichia coli.

5. A step of culturing the Escherichia genus microorganism of claim 1 in a medium; and A method for producing L-isoleucine, comprising a step of recovering L-isoleucine from a microorganism of the genus Escherichia or a medium in which the microorganism of the genus Escherichia is cultured.

Images