Transgenic mouse expressing human ace2 and tmprss2 genes and use thereof

Abstract

The present invention relates to a transgenic mouse expressing human ACE2 and TMPRSS2 genes and a use thereof.

Description

Transgenic mice expressing human ACE2 and TMPRSS2 genes and their uses

[0001] The present invention relates to a transgenic mouse expressing human ACE2 and TMPRSS2 genes and its use.

[0002] Since the outbreak of COVID-19, which has become a pandemic and endemic, the development of treatments and vaccines remains essential. Primates, ferrets, and Syrian hamsters have been used to study the pathogenesis and transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). However, these models do not accurately reflect the severity or mortality of COVID-19. SARS-CoV-2 does not bind effectively to the mouse-expressing angiotensin I converting enzyme 2 (mACE2), preventing infection in normal mice. Therefore, K18-hACE2 transgenic mice, which express hACE2, are the most commonly used for SARS-CoV-2 infection. These transgenic mice provide a clinical disease and lethal infection model, allowing for the effective evaluation of treatments and vaccines.

[0003] The SARS-CoV-2 spike protein is composed of S1 and S2 proteins, which perform receptor recognition functions and mediate membrane fusion. Protease-mediated cleavage of S1 / S2 promotes the binding of the spike protein to ACE2 and induces cleavage of the S2' region. Human transmembrane serine protease 2 (human TMPRSS2, hTMPRSS2) promotes viral entry through proteolytic activation of the SARS-CoV-2 spike protein. Therefore, the Vero E6 cell line, which overexpresses TMPRSS2, has been reported to be highly susceptible to SARS-CoV-2. Furthermore, TMPRSS2 is known to be involved in viral replication, pathogenesis, and host immune responses.

[0004] In the present invention, we established a SARS-CoV-2-infected mouse model expressing both hACE2 and hTMPRSS2, which are expected to be highly susceptible to viral infection. Double-transgenic mice were generated by simultaneous microinjection of hACE2 and hTMPRSS2.

[0005] The present invention has been devised to solve the above problems, and to provide a transgenic mouse expressing human ACE2 and TMPRSS2 genes and its use in order to lay the foundation for the development of new treatment methods in the future by creating a better animal model in the study of COVID-19.

[0006] In order to achieve the above object, the present invention comprises the steps of: 1) securing a human angiotensin I converting enzyme 2 (hACE2) gene; 2) securing a human transmembrane serine proteinase 2 (hTMPRSS2) gene; 3) preparing CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA recombinant vectors in which the hACE2 and hTMPRSS2 genes are expressed by a CMV promoter, respectively; 4) confirming that the sequence of the recombinant vector has no genetic mutation through sequencing; 5) preparing linearized CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA DNA fragments by treating the recombinant vectors with restriction enzymes; 6) inserting the linearized CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA DNA fragments into a mouse fertilized egg through microinjection; 7) a step of obtaining DNA by a tail-cut method and confirming the produced mouse; 8) a step of isolating lung tissue, isolating total RNA, and confirming hACE2 and hTMPRSS2 gene expression by a real-time quantitative PCR method; and 9) a step of infecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) through the nasal route and confirming body weight, mortality rate, and symptom severity; a method for producing a double transgenic mouse expressing hACE2 and hTMPRSS2 is provided.

[0007] As used herein, the term "promoter" refers to a DNA sequence that, when linked to a specific sequence, can control the transcription of a specific nucleotide sequence into mRNA. Generally, a promoter, although not applicable in all cases, exists 5' (i.e., a sequence located 5' from the upstream, reference nucleotide sequence) of the desired nucleotide sequence to be transcribed into mRNA and provides a site for specific binding of RNA polymerase and other transcription factors for transcription initiation. It also refers to a nucleic acid or nucleic acid sequence that has the function of controlling the transcription of one or more genes, as described above.

[0008] As used herein, the term "operably linked" refers to a functional linkage between a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or RNA, such that the nucleic acid sequence is functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA are operably linked to affect the expression of the encoding nucleic acid sequence. The operably linked sequence with a recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes generally known in the art.

[0009] The term "recombinant vector" as used herein refers to a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct including essential regulatory elements operably linked to enable expression of a gene insert. The recombinant vector represented by the cleavage map of Fig. 1 of the present invention preferably includes a base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The base sequence of SEQ ID NO: 1 refers to the hACE2 gene sequence, and the base sequence of SEQ ID NO: 2 refers to the hTMPRSS2 gene sequence.

[0010] In the present invention, the term "tag" or "tag sequence" refers to a chemical moiety or other chemical substance of a nucleotide, oligonucleotide, polynucleotide, or amino acid, peptide, or protein that, when added to another sequence, imparts an additional use or property useful for the detection or separation of that sequence.

[0011] In the present invention, the term "transformation" means changing the genetic properties of an organism by externally provided DNA. It also means that exogenous DNA is introduced into a host organism such as a cell, tissue, or adult (in the present invention, a mouse), is stably inherited, and exhibits a change in phenotype. Various methods known in the art may be appropriately selected and applied for transformation, such as microinjection, electroporation, particle bombardment, sperm-mediated gene transfer, viral infection, direct muscle injection, and techniques using insulators and transposons. Preferably, transformation can be achieved through microinjection in the present invention.

[0012] In one example of the present invention, the present invention provides a double transgenic mouse expressing hACE2 and hTMPRSS2 produced by a production method.

[0013] The above mice may exhibit weight loss, increased mortality, and worsening of symptoms upon infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Furthermore, the above mice may be susceptible to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0014] In another example of the present invention, the present invention provides a method for screening a severe acute respiratory syndrome coronavirus 2 vaccine, comprising the steps of: i) producing a double transgenic mouse expressing hACE2 and hTMPRSS2 according to the above-described production method; ii) pre-administering a severe acute respiratory syndrome coronavirus 2 vaccine candidate; and iii) confirming the effectiveness of the severe acute respiratory syndrome coronavirus 2 vaccine candidate.

[0015] In another example of the present invention, the present invention provides a method for screening a severe acute respiratory syndrome coronavirus 2 therapeutic agent, comprising the steps of: i) producing a double transgenic mouse expressing hACE2 and hTMPRSS2 according to the production method of claim 1; ii) administering a severe acute respiratory syndrome coronavirus 2 therapeutic agent candidate; and iii) confirming the effect of the severe acute respiratory syndrome coronavirus 2 therapeutic agent candidate.

[0016] Transgenic mice expressing human ACE2 and TMPRSS2 genes according to the present invention are highly susceptible to COVID-19, and thus can be useful for research on the disease mechanism of COVID-19 and development of new therapeutic agents.

[0017] Figure 1 shows a recombinant vector map or a cleavage map in which human ACE2 and TMPRSS2 gene expression is induced by the CMV promoter of the present invention.

[0018] Figure 2 shows the progress of a PCR experiment to identify transgenic mice expressing the human ACE2 gene.

[0019] Figure 3 shows the PCR results for the initial selection of hACE2 transgenic mice into which the human ACE2 gene was transduced, and the genotyping results of the F0 generation of CMV-hACE2-C-Flag transgenic mice.

[0020] Figure 4 shows the progress of a PCR experiment to identify transgenic mice expressing the human TMPRSS2 gene.

[0021] Figure 5 shows the PCR results for the initial selection of hTMPRSS2 transgenic mice into which the human TMPRSS2 gene was transduced, and the genotyping results of the F0 generation of CMV-hTMPRSS2-C-HA transgenic mice.

[0022] Figure 6 shows the results of confirming ACE2 and TMPRSS2 gene expression in organ tissues of F1 generation human ACE2 and TMPRSS2 gene-expressing transgenic mice using real-time PCR techniques.

[0023] Figure 7 shows information on infection of human ACE2 and TMPRSS2 gene-expressing transgenic mice of the present invention with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) via the intranasal route, and the change in body weight, survival rate, and symptom severity of the test group according to virus titer.

[0024] Figure 8 shows the results of confirming severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection in lung and nasal tissues using real-time PCR in the test groups (wild-type C57BL / 6 mice, human ACE2 and TMPRSS2 gene-expressing transgenic mice) infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) of Figure 7.

[0025] Hereinafter, preferred embodiments of the present invention will be described in detail. Furthermore, the following description includes numerous specific details, such as specific components, but these are provided to facilitate a more comprehensive understanding of the present invention. It will be apparent to those skilled in the art that the present invention can be practiced without these specific details. Furthermore, in describing the present invention, detailed descriptions of known functions or configurations will be omitted if they are deemed to unnecessarily obscure the gist of the present invention.

[0026]

[0027] Example 1. Biological safety

[0028] All procedures were performed by personnel equipped with powered air-purifying respirators in a BSL-3 (biosafety level 3) or animal BSL-3 facility for SARS-CoV-2-related experiments. This invention was approved by the Institutional Animal Care and Use Committee of the Korea Research Institute of Chemical Technology (protocol ID: 8A-M6, IACUC ID 2021-8A-02-01, 2021-8A-03-03).

[0029]

[0030] Example 2. Mice

[0031] C57BL / 6 mice were purchased from Orient Bio Co., Ltd. (Gyeonggi-do, South Korea). Groups of 8- to 12-week-old male and female double Tg mice were administered SARS-CoV-2 inoculum (2 × 10) under anesthesia using isoflurane in a BSL-3 animal facility. 3Plaque forming units (PFU) were administered intranasally. The control group received the same volume of phosphate buffered saline (PBS) in all experiments. Mice were monitored and weighed daily. Clinical disease signs were scored from 0 to 4 as follows: 0, no symptoms; 1, matted fur; 2, decreased mobility; 3, crouching posture; and 4, moribund or dead. In the present invention, the first mouse lethal dose 50 (MLD 50 ) was considered a criterion for humane euthanasia via CO2 asphyxiation, excluding the assessment of morbidity and mortality. Animals were anesthetized with isoflurane and transcardially perfused with cold phosphate-buffered saline (PBS). Organ tissues were collected on the indicated days postinjection (dpi). Tissues were weighed and homogenized in preloaded steel bead tubes containing cold PBS using a Tacoprep bead beater (GeneReach Biotechnology Corp., Taichung City, Taiwan).

[0032]

[0033] Example 3. Virus

[0034] SARS-CoV-2 (GISAID: EPI_ISL_407193) was obtained from the Korea Centers for Disease Control and Prevention and propagated in Vero cells (CCL-81; ATCC). Culture supernatants containing the virus were stored at -80°C. Virus titers were measured using a plaque assay as previously described (Nat Commun 2022; 13:4910).

[0035]

[0036] Example 4. In vivo transfection

[0037] Six-week-old male and female C57BL / 6 mice were intranasally infected with 40 μg pCMV3 vector or pCMV3-hACE2-FLAG or co-transfected with 30 μg pCMV3-hTMPRSS2-HA and 10 μg pCMV3-hTMPRSS2-HA using in vivo jet PEI reagent (Polyplus, Illkirch, France) administered twice at 1-h intervals according to the manufacturer's instructions (N / P ratio = 8). Mice were divided into 5 × 10 5 Infected with PFU SARS-CoV-2.

[0038] Figure 1 shows the results of confirming the plasmid vector for producing transgenic mice. The CMV_hACE2_C-Flag vector and the CMV_hTMPRSS2_HA vector were treated with restriction enzymes to confirm the presence or absence of hACE2 and hTMPRSS2 genes inserted.

[0039] Figure 2 shows the PCR primer information for genotyping to confirm whether the hACE2 gene is inserted in the produced F0 transgenic mouse.

[0040] Figure 3 shows the results of isolating DNA from the tail tissue of an F0 transgenic mouse using information from Figure 2 and confirming whether the hACE2 gene was inserted through PCR.

[0041] Figure 4 shows PCR primer information for genotyping to confirm whether the hTMPRSS2 gene is inserted in the produced F0 transgenic mouse.

[0042] Figure 5 shows DNA isolated from the tail tissue of an F0 transgenic mouse produced using the information in Figure 4, and the presence or absence of hTMPRSS2 gene insertion was confirmed through PCR.

[0043]

[0044] # Sequence number 1: hACE2

[0045] TAATTTCTTTGTCACTGCACCTAAAAATGTGTCTGATATCATTCCTAGAACTGAAGTTGAAAAGGCCATCAGGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTCTGAATGACAACAGCCTAGAGTTTCTGGGGATACAGCCAACACTTGGACCTCCTAACCAGCCCCCTGTTTCCATATGGCTGATTGTTTTTGGAGTTGTGATGGGAGTGATAGTGGTTGGCATTGTCATCCTGATCTTCACTGGGATCAGAGATCGGAAGAAGAAAAATAAAGCAAGAAGTGGAGAAAATCCTTATGCCTCCATCGATATTAGCAAAGGAGAAAATAATCCAGGATTCCAAAACACTGATGATGTTCAGACCTCCTTT

[0046]

[0047] # 서열번호 2: hTMPRSS2

[0048] CCAAGAACAATGACATTGCGCTGATGAAGCTGCAGAAGCCTCTGACTTTCAACGACCTAGTGAAACCAGTGTGTCTGCCCAACCCAGGCATGATGCTGCAGCCAGAACAGCTCTGCTGGATTTCCGGGTGGGGGGCCACCGAGGAGAAAGGGAAGACCTCAGAAGTGCTGAACGCTGCCAAGGTGCTTCTCATTGAGACACAGAGATGCAACAGCAGATATGTCTATGACAACCTGATCACACCAGCCATGATCTGTGCCGGCTTCCTGCAGGGGAACGTCGATTCTTGCCAGGGTGACAGTGGAGGGCCTCTGGTCACTTCGAAGAACAATATCTGGTGGCTGATAGGGGATACAAGCTGGGGTTCTGGCTGTGCCAAAGCTTACAGACCAGGAGTGTACGGGAATGTGATGGTATTCACGGACTGGATTTATCGACAAATGAGGGCAGACGGC

[0049]

[0050] 실시예 5. RNA 추출 및 RT-qPCR

[0051] Total cellular RNA was extracted using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). RNA was extracted from tissue homogenates using the Maxwell RSC simplyRNA tissue kit (Promega, Madison, WI, USA) according to the manufacturer's protocol. Quantitative RT-PCR (QuantStudio 3; Applied Biosystems, Foster City, CA, USA) was performed using the OneStep PrimeScript III RT-qPCR Mix (Takara, Kyoto, Japan). Viral RNA of the nucleocapsid protein (NP) was detected using the 2019-nCoV RUO Kit (10006713; Integrated DNA Technologies, Coralville, IA, USA).

[0052] - hACE2 primers and probes

[0053] Forward primer: 5'-GCCACTGCTTTG-3'

[0054] Reverse primer: 5'-GCTATCTCTCTTTG-3'

[0055] Probe: 5'-ACTCCAGTCGGCTCCA-3'

[0056] - hTMPRSS2

[0057] Forward primer: 5'-TGTACTCAGAGTC-3'

[0058] Reverse primer: 5'-CTGGGGGTCC-3'

[0059] Probe: 5'-ACCTGGGGGTGTC-3'

[0060] Absolute quantification of hACE2 and hTMPRSS2 mRNA transcripts was performed by constructing each standard curve using serial dilutions of pCMV3-hACE2-FLAG and pCMV3-hTMPRSS2-HA.

[0061]

[0062] Example 6. Statistical Analysis

[0063] All experiments were performed at least three times. All data were analyzed using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). Statistical significance was set at P < 0.05.

[0064]

[0065] Experimental Example 1. SARS-CoV-2 infection in hACE2 and hTMPRSS2 double-transgenic mice

[0066] To generate double-Tg mice containing both hACE2 and hTMPRSS2 under the control of the CMV promoter, these transgenes were simultaneously microinjected into the male pronuclei of fertilized C57BL / 6 mice, followed by transfer of transgenic zygotes. Expression levels of hACE2 and hTMPRSS2 were detected with similar expression patterns in multiple tissues, including the lung, brain, heart, liver, kidney, and colon (Fig. 6). Wild-type C57BL / 6 (non-Tg) mice served as negative controls.

[0067] Next, double Tg mice were intranasally infected with various viral doses of SARS-CoV-2 to determine the MLD 50 was determined. Body weight, survival rate, and clinical symptoms were monitored and found to increase in a dose-dependent manner (Fig. 7A-C). 1 × 10 3 All mice infected with an inoculum greater than 1 × 10 PFU began to lose weight, became lethargic after 5 days of infection, and eventually died on days 9–12, whereas all mice infected with 1 × 10 PFU survived. 2 Mice infected with PFU showed variable mortality (3 out of 4 females and 1 out of 3 males survived). Among these, the MLD for SARS-CoV-2 in Tg mice 502 × 10 using the Reed and Muench method (American journal of epidemiology1938;27:493-497, World journal of virology2016;5:85) 2 was calculated as PFU. In particular, this MLD 50 The measurements were similar to those of other transgenic mice, suggesting that double Tg mice are highly susceptible to SARS-CoV-2. Therefore, all mice were administered 10 MLD in subsequent experiments. 50 (2 × 10 3 were infected with PFU).

[0068] Lung and nasal tissues from wild-type C57BL / 6 mice and double Tg mice were isolated and used for RT-qPCR to confirm that infection occurred only in double Tg mice at 3 and 6 dpi (Fig. 8).

Claims

1. 1) Step of obtaining human angiotensin I converting enzyme 2 (hACE2) gene; 2) Step of obtaining human transmembrane serine proteinase 2 (hTMPRSS2) gene; 3) A step of preparing CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA recombinant vectors in which the hACE2 and hTMPRSS2 genes are expressed by the CMV promoter, respectively; 4) A step of confirming that there is no genetic mutation in the sequence of the above recombinant vector through sequencing; 5) A step of preparing linearized CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA DNA fragments by treating the above recombinant vector with a restriction enzyme; 6) A step of inserting linearized CMV-hACE2-C-Flag and CMV-hTMPRSS2-HA DNA fragments into mouse fertilized eggs through microinjection; 7) Step of confirming the produced mouse by obtaining DNA using the tail-cut method; 8) A step of isolating lung tissue and isolating total RNA to confirm hACE2 and hTMPRSS2 gene expression using real-time quantitative PCR method; and 9) A method for producing double transgenic mice expressing hACE2 and hTMPRSS2, comprising the step of infecting them with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) via the nasal route and checking the body weight, mortality rate, and symptom severity; 2. A method for producing a double transgenic mouse expressing hACE2 and hTMPRSS2, characterized in that the hACE2 in the first paragraph has the sequence number 1.

3. A method for producing a double transgenic mouse expressing hACE2 and hTMPRSS2, characterized in that the hTMPRSS2 in the first paragraph has the sequence number 2.

4. Double transgenic mouse expressing hACE2 and hTMPRSS2 manufactured by any one of the manufacturing methods of clauses 1 to 3.

5. In the fourth paragraph, the mouse is a double transgenic mouse expressing hACE2 and hTMPRSS2, characterized by weight loss, increased mortality, and worsening of symptoms when infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

6. In the fourth paragraph, the mouse is a double transgenic mouse expressing hACE2 and hTMPRSS2, characterized in that it exhibits susceptibility to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). 7.i) A step of producing a double transgenic mouse expressing hACE2 and hTMPRSS2 according to the production method of paragraph 1; ii) a step of pre-administering a severe acute respiratory syndrome coronavirus 2 vaccine candidate; and iii) A method for screening a severe acute respiratory syndrome coronavirus 2 vaccine, comprising: a step of confirming the effectiveness of a severe acute respiratory syndrome coronavirus 2 vaccine candidate; 8.i) A step of producing a double transgenic mouse expressing hACE2 and hTMPRSS2 according to the production method of paragraph 1; ii) a step of administering a candidate therapeutic agent for severe acute respiratory syndrome coronavirus 2; and iii) A method for screening a severe acute respiratory syndrome coronavirus 2 therapeutic agent, comprising: a step of confirming the effectiveness of a candidate substance for the treatment of severe acute respiratory syndrome coronavirus 2;

Images